#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2M	2	genome.wustl.edu	37	12	9246090	9246090	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:9246090C>T	ENST00000318602.7	-	18	2518	c.2211G>A	c.(2209-2211)gaG>gaA	p.E737E		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	737					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AGATCCATGTCTCAGGGAAGT	0.463																																						dbGAP											0													118.0	110.0	112.0					12																	9246090		1916	4129	6045	-	-	-	SO:0001819	synonymous_variant	0			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2211G>A	12.37:g.9246090C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_Beta-lactam/transpept-like,superfamily_Cupredoxin	p.E737	ENST00000318602.7	37	c.2211	CCDS44827.1	12																																																																																			A2M	-	NULL	ENSG00000175899		0.463	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	HGNC	protein_coding	OTTHUMT00000317233.2	97	0.00	0	C	NM_000014		9246090	9246090	-1	no_errors	ENST00000318602	ensembl	human	known	69_37n	silent	56	32.14	27	SNP	1.000	T
ABCF3	55324	genome.wustl.edu	37	3	183911228	183911228	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:183911228C>T	ENST00000429586.2	+	20	2144	c.1959C>T	c.(1957-1959)ctC>ctT	p.L653L	ABCF3_ENST00000292808.5_Silent_p.L647L|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	653	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCCGTGCCCTCAACAATTTCA	0.587																																						dbGAP											0													152.0	141.0	145.0					3																	183911228		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1959C>T	3.37:g.183911228C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L653	ENST00000429586.2	37	c.1959	CCDS3254.1	3																																																																																			ABCF3	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000161204		0.587	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	HGNC	protein_coding	OTTHUMT00000346047.1	79	0.00	0	C	NM_018358		183911228	183911228	+1	no_errors	ENST00000429586	ensembl	human	known	69_37n	silent	63	38.83	40	SNP	1.000	T
ACP5	54	genome.wustl.edu	37	19	11687274	11687274	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:11687274C>A	ENST00000592828.1	-	6	921	c.519G>T	c.(517-519)gaG>gaT	p.E173D	ACP5_ENST00000218758.5_Missense_Mutation_p.E173D|ACP5_ENST00000433365.2_Missense_Mutation_p.E173D|ACP5_ENST00000590420.1_Intron|ACP5_ENST00000412435.2_Missense_Mutation_p.E173D	NM_001111034.1	NP_001104504.1	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant	173					bone morphogenesis (GO:0060349)|bone resorption (GO:0045453)|defense response to Gram-positive bacterium (GO:0050830)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of superoxide anion generation (GO:0032929)|negative regulation of tumor necrosis factor production (GO:0032720)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	acid phosphatase activity (GO:0003993)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	9						CTCGGGGCCTCTCAGGCTGCT	0.582																																						dbGAP											0													52.0	52.0	52.0					19																	11687274		2203	4300	6503	-	-	-	SO:0001583	missense	0			X14618	CCDS12265.1	19p13.2	2012-10-02			ENSG00000102575	ENSG00000102575	3.1.3.2		124	protein-coding gene	gene with protein product	"""tartrate-resistant acid phosphatase"""	171640				8449511, 2338077	Standard	NM_001611		Approved	TRAP	uc002msj.4	P13686	OTTHUMG00000182036	ENST00000592828.1:c.519G>T	19.37:g.11687274C>A	ENSP00000468767:p.Glu173Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3V2|Q2TAB1|Q6IAS6|Q9UCJ5|Q9UCJ6|Q9UCJ7	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom	p.E173D	ENST00000592828.1	37	c.519	CCDS12265.1	19	.	.	.	.	.	.	.	.	.	.	c	3.361	-0.130487	0.06753	.	.	ENSG00000102575	ENST00000218758;ENST00000412435;ENST00000433365	D;D;D	0.85411	-1.98;-1.98;-1.98	5.32	3.17	0.36434	Metallophosphoesterase domain (1);	0.378704	0.30302	N	0.009935	T	0.69142	0.3078	N	0.16478	0.41	0.21553	N	0.999647	B	0.02656	0.0	B	0.04013	0.001	T	0.50642	-0.8804	10	0.11794	T	0.64	-14.6524	8.5537	0.33467	0.0:0.7525:0.0:0.2475	.	173	P13686	PPA5_HUMAN	D	173	ENSP00000218758:E173D;ENSP00000392374:E173D;ENSP00000413456:E173D	ENSP00000218758:E173D	E	-	3	2	ACP5	11548274	0.000000	0.05858	0.333000	0.25482	0.161000	0.22273	0.141000	0.16076	1.229000	0.43630	0.655000	0.94253	GAG	ACP5	-	pfam_Metallo_PEstase_dom	ENSG00000102575		0.582	ACP5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACP5	HGNC	protein_coding	OTTHUMT00000458881.1	77	0.00	0	C			11687274	11687274	-1	no_errors	ENST00000218758	ensembl	human	known	69_37n	missense	33	27.66	13	SNP	0.097	A
ACSS3	79611	genome.wustl.edu	37	12	81610679	81610679	+	Splice_Site	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:81610679G>C	ENST00000548058.1	+	10	2264		c.e10-1		ACSS3_ENST00000261206.3_Splice_Site|ACSS3_ENST00000548324.1_Splice_Site			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3							mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						TCTTTTTCCAGAGACTGGATC	0.398																																						dbGAP											0													98.0	92.0	94.0					12																	81610679		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1355-1G>C	12.37:g.81610679G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC66	Splice_Site	SNP	-	e10-1	ENST00000548058.1	37	c.1355-1	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844892	0.71603	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4482	0.90693	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSS3	80134810	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.593000	0.82686	2.634000	0.89283	0.655000	0.94253	.	ACSS3	-	-	ENSG00000111058		0.398	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	40	0.00	0	G	NM_024560	Intron	81610679	81610679	+1	no_errors	ENST00000548058	ensembl	human	known	69_37n	splice_site	56	18.84	13	SNP	1.000	C
ACSS3	79611	genome.wustl.edu	37	12	81647325	81647325	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:81647325G>A	ENST00000548058.1	+	15	2781	c.1871G>A	c.(1870-1872)aGa>aAa	p.R624K	ACSS3_ENST00000261206.3_Missense_Mutation_p.R623K|ACSS3_ENST00000548324.1_Missense_Mutation_p.R306K			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	624						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						AAACACGTTAGACAGAACATT	0.413																																						dbGAP											0													102.0	103.0	103.0					12																	81647325		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1871G>A	12.37:g.81647325G>A	ENSP00000449535:p.Arg624Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC66	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448	p.R624K	ENST00000548058.1	37	c.1871	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632014	0.87660	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.60424	0.19;0.19;0.19	6.03	6.03	0.97812	.	0.046439	0.85682	D	0.000000	T	0.73885	0.3644	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.87578	0.998;0.97	T	0.73344	-0.4012	10	0.72032	D	0.01	-15.5385	20.5752	0.99366	0.0:0.0:1.0:0.0	.	306;624	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	K	624;623;306	ENSP00000449535:R624K;ENSP00000261206:R623K;ENSP00000448965:R306K	ENSP00000261206:R623K	R	+	2	0	ACSS3	80171456	1.000000	0.71417	0.963000	0.40424	0.358000	0.29455	9.434000	0.97515	2.868000	0.98415	0.557000	0.71058	AGA	ACSS3	-	NULL	ENSG00000111058		0.413	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	79	0.00	0	G	NM_024560		81647325	81647325	+1	no_errors	ENST00000548058	ensembl	human	known	69_37n	missense	75	14.61	13	SNP	1.000	A
ACTB	60	genome.wustl.edu	37	7	5567953	5567953	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:5567953C>T	ENST00000331789.5	-	4	952	c.761G>A	c.(760-762)cGg>cAg	p.R254Q	AC006483.1_ENST00000579427.1_RNA|ACTB_ENST00000464611.1_5'Flank	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	254			R -> W (in BRWS2; dbSNP:rs281875328). {ECO:0000269|PubMed:22366783}.		adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		GCAGCGGAACCGCTCATTGCC	0.622																																						dbGAP											0													73.0	75.0	74.0					7																	5567953		2203	4300	6503	-	-	-	SO:0001583	missense	0			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.761G>A	7.37:g.5567953C>T	ENSP00000349960:p.Arg254Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R254Q	ENST00000331789.5	37	c.761	CCDS5341.1	7	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799669	0.31869	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.97186	-4.28	5.55	3.75	0.43078	.	0.101790	0.37483	N	0.002070	D	0.97303	0.9118	M	0.93283	3.4	0.36575	D	0.873227	B	0.15473	0.013	B	0.27796	0.083	D	0.96835	0.9614	10	0.87932	D	0	.	11.0849	0.48080	0.0:0.8481:0.0:0.1519	.	254	P60709	ACTB_HUMAN	Q	254;230;226;173	ENSP00000349960:R254Q	ENSP00000440549:R173Q	R	-	2	0	ACTB	5534479	1.000000	0.71417	0.956000	0.39512	0.598000	0.36846	7.533000	0.81994	0.719000	0.32188	0.650000	0.86243	CGG	ACTB	-	pfam_Actin-like,smart_Actin-like	ENSG00000075624		0.622	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	HGNC	protein_coding	OTTHUMT00000059589.4	46	0.00	0	C	NM_001101		5567953	5567953	-1	no_errors	ENST00000331789	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.999	T
ACTN3	89	genome.wustl.edu	37	11	66325184	66325184	+	lincRNA	DEL	C	C	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:66325184delC	ENST00000504911.1	-	0	1160				ACTN3_ENST00000513398.1_RNA|ACTN3_ENST00000502692.1_RNA																							TGGAGTGGATCCGCCGCACTG	0.647																																						dbGAP											0													21.0	25.0	24.0					11																	66325184		2196	4294	6490	-	-	-			0																															11.37:g.66325184delC		Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	NULL	p.R348fs	ENST00000504911.1	37	c.1041		11																																																																																			ACTN3	-	NULL	ENSG00000248746		0.647	CTD-3074O7.2-001	KNOWN	basic|exp_conf	lincRNA	ACTN3	HGNC	lincRNA	OTTHUMT00000362463.1	49	0.00	0	C			66325184	66325184	+1	pseudogene	ENST00000502692	ensembl	human	known	69_37n	frame_shift_del	22	50.00	23	DEL	1.000	-
ACTR6	64431	genome.wustl.edu	37	12	100604127	100604127	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:100604127C>G	ENST00000188312.2	+	6	1335	c.570C>G	c.(568-570)taC>taG	p.Y190*	ACTR6_ENST00000551617.1_Nonsense_Mutation_p.Y108*|ACTR6_ENST00000546902.1_Nonsense_Mutation_p.Y108*|ACTR6_ENST00000552376.1_Nonsense_Mutation_p.Y190*	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	190						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						TCATATCTTACAGGTGATGCT	0.383																																						dbGAP											0													84.0	87.0	86.0					12																	100604127		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.570C>G	12.37:g.100604127C>G	ENSP00000188312:p.Tyr190*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Nonsense_Mutation	SNP	pfam_Actin-like,smart_Actin-like	p.Y190*	ENST00000188312.2	37	c.570	CCDS9074.1	12	.	.	.	.	.	.	.	.	.	.	C	37	5.990796	0.97179	.	.	ENSG00000075089	ENST00000188312;ENST00000546902;ENST00000552376;ENST00000551617	.	.	.	4.77	4.77	0.60923	.	0.120124	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3353	0.90286	0.0:1.0:0.0:0.0	.	.	.	.	X	190;108;190;108	.	.	Y	+	3	2	ACTR6	99128258	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	2.927000	0.48900	2.634000	0.89283	0.655000	0.94253	TAC	ACTR6	-	pfam_Actin-like,smart_Actin-like	ENSG00000075089		0.383	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR6	HGNC	protein_coding	OTTHUMT00000408159.1	86	0.00	0	C	NM_022496		100604127	100604127	+1	no_errors	ENST00000188312	ensembl	human	known	69_37n	nonsense	101	13.68	16	SNP	1.000	G
AFF2	2334	genome.wustl.edu	37	X	147891430	147891430	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:147891430G>A	ENST00000370460.2	+	4	1551	c.1072G>A	c.(1072-1074)Gaa>Aaa	p.E358K	AFF2_ENST00000286437.5_Missense_Mutation_p.E28K|AFF2_ENST00000342251.3_Missense_Mutation_p.E354K|AFF2_ENST00000370457.5_Missense_Mutation_p.E354K|AFF2_ENST00000370458.1_Missense_Mutation_p.E354K	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	358					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCTGTGTTGAAGAAATCTT	0.333																																						dbGAP											0													216.0	185.0	195.0					X																	147891430		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1072G>A	X.37:g.147891430G>A	ENSP00000359489:p.Glu358Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E358K	ENST00000370460.2	37	c.1072	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732682	0.89482	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458;ENST00000286437	T;T;T;T;T	0.75589	-0.5;-0.5;-0.5;-0.5;-0.95	5.87	5.87	0.94306	.	0.057340	0.64402	D	0.000003	D	0.84032	0.5383	L	0.51422	1.61	0.50039	D	0.999844	D;D;D;D;D;D;P	0.76494	0.997;0.998;0.998;0.998;0.998;0.999;0.953	D;D;D;D;D;D;P	0.83275	0.985;0.994;0.994;0.994;0.994;0.996;0.857	D	0.84384	0.0551	10	0.59425	D	0.04	.	19.184	0.93635	0.0:0.0:1.0:0.0	.	28;358;354;354;354;358;354	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;.;AFF2_HUMAN;.	K	358;354;354;354;28	ENSP00000359489:E358K;ENSP00000359486:E354K;ENSP00000345459:E354K;ENSP00000359487:E354K;ENSP00000286437:E28K	ENSP00000286437:E28K	E	+	1	0	AFF2	147699122	1.000000	0.71417	0.990000	0.47175	0.819000	0.46315	6.877000	0.75562	2.481000	0.83766	0.600000	0.82982	GAA	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.333	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	803	0.00	0	G	NM_002025		147891430	147891430	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	missense	853	36.99	509	SNP	1.000	A
AKAP12	9590	genome.wustl.edu	37	6	151670325	151670325	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:151670325G>C	ENST00000253332.1	+	3	988	c.799G>C	c.(799-801)Gag>Cag	p.E267Q	AKAP12_ENST00000402676.2_Missense_Mutation_p.E267Q|AKAP12_ENST00000354675.6_Missense_Mutation_p.E169Q|AKAP12_ENST00000359755.5_Missense_Mutation_p.E162Q|snoU13_ENST00000458767.1_RNA			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	267	Involved in PKC-binding. {ECO:0000305}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GGAATGCAAAGAGGAAGGAGA	0.473																																					Melanoma(141;1616 1805 10049 24534 51979)	dbGAP											0													47.0	53.0	51.0					6																	151670325		2203	4300	6503	-	-	-	SO:0001583	missense	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.799G>C	6.37:g.151670325G>C	ENSP00000253332:p.Glu267Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.E267Q	ENST00000253332.1	37	c.799	CCDS5229.1	6	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015759	0.54468	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	T;T;T;T	0.06933	3.24;3.24;3.25;3.25	5.39	5.39	0.77823	.	1.147620	0.06720	N	0.774769	T	0.08403	0.0209	L	0.51422	1.61	0.35320	D	0.784698	D;D;D	0.57571	0.98;0.98;0.966	P;P;P	0.53649	0.731;0.731;0.543	T	0.13361	-1.0512	10	0.11794	T	0.64	.	12.8149	0.57658	0.075:0.0:0.925:0.0	.	162;169;267	Q02952-3;Q02952-2;Q02952	.;.;AKA12_HUMAN	Q	267;267;169;162	ENSP00000384537:E267Q;ENSP00000253332:E267Q;ENSP00000346702:E169Q;ENSP00000352794:E162Q	ENSP00000253332:E267Q	E	+	1	0	AKAP12	151712018	0.281000	0.24258	0.227000	0.23927	0.021000	0.10359	1.189000	0.32114	2.688000	0.91661	0.650000	0.86243	GAG	AKAP12	-	NULL	ENSG00000131016		0.473	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	HGNC	protein_coding	OTTHUMT00000042712.1	46	0.00	0	G			151670325	151670325	+1	no_errors	ENST00000253332	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	0.962	C
ANKRD12	23253	genome.wustl.edu	37	18	9256837	9256837	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr18:9256837G>A	ENST00000262126.4	+	9	3812	c.3572G>A	c.(3571-3573)aGa>aAa	p.R1191K	ANKRD12_ENST00000400020.3_Missense_Mutation_p.R1168K|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.R1168K	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1191						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AGGTCTCCTAGATCAGAAAAT	0.403																																						dbGAP											0													41.0	43.0	42.0					18																	9256837		2202	4298	6500	-	-	-	SO:0001583	missense	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3572G>A	18.37:g.9256837G>A	ENSP00000262126:p.Arg1191Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R1191K	ENST00000262126.4	37	c.3572	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449282	0.43531	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.74632	-0.86;-0.86	5.79	4.9	0.64082	.	0.099693	0.64402	D	0.000002	T	0.67116	0.2859	L	0.50333	1.59	0.43426	D	0.995589	B;B	0.26081	0.141;0.087	B;B	0.26202	0.067;0.03	T	0.63642	-0.6591	10	0.37606	T	0.19	-13.916	9.8288	0.40928	0.0769:0.0:0.782:0.141	.	1168;1191	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	K	1168;1191	ENSP00000372932:R1168K;ENSP00000262126:R1191K	ENSP00000262126:R1191K	R	+	2	0	ANKRD12	9246837	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.313000	0.59160	1.407000	0.46875	0.655000	0.94253	AGA	ANKRD12	-	NULL	ENSG00000101745		0.403	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	31	0.00	0	G	NM_015208		9256837	9256837	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	missense	24	31.43	11	SNP	1.000	A
ASB5	140458	genome.wustl.edu	37	4	177146416	177146416	+	Silent	SNP	T	T	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr4:177146416T>A	ENST00000296525.3	-	2	386	c.273A>T	c.(271-273)tcA>tcT	p.S91S	ASB5_ENST00000511879.1_5'UTR|ASB5_ENST00000512254.1_Silent_p.S38S	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	91					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		ATATTACCTGTGATAATAATG	0.363																																						dbGAP											0													76.0	83.0	80.0					4																	177146416		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.273A>T	4.37:g.177146416T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7B5	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.S91	ENST00000296525.3	37	c.273	CCDS3827.1	4																																																																																			ASB5	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000164122		0.363	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB5	HGNC	protein_coding	OTTHUMT00000362344.1	78	0.00	0	T			177146416	177146416	-1	no_errors	ENST00000296525	ensembl	human	known	69_37n	silent	42	22.22	12	SNP	1.000	A
ASH2L	9070	genome.wustl.edu	37	8	37996551	37996551	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:37996551G>A	ENST00000343823.6	+	16	2158	c.1849G>A	c.(1849-1851)Gaa>Aaa	p.E617K	ASH2L_ENST00000428278.2_Missense_Mutation_p.E523K|ASH2L_ENST00000250635.7_Missense_Mutation_p.E490K|ASH2L_ENST00000545394.1_Missense_Mutation_p.E478K|ASH2L_ENST00000521652.1_Missense_Mutation_p.E490K	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	617					cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				CGTGGAGACAGAAGTGGATGG	0.537																																						dbGAP											0													51.0	43.0	46.0					8																	37996551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.1849G>A	8.37:g.37996551G>A	ENSP00000340896:p.Glu617Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	p.E617K	ENST00000343823.6	37	c.1849	CCDS6101.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.245144	0.95272	.	.	ENSG00000129691	ENST00000343823;ENST00000250635;ENST00000545394;ENST00000428278;ENST00000521652	T;T;T;T;T	0.79749	-0.31;-1.3;-1.25;-1.27;-1.3	6.17	6.17	0.99709	.	0.041485	0.85682	D	0.000000	T	0.77935	0.4205	L	0.60455	1.87	0.80722	D	1	B;P	0.43094	0.227;0.799	B;B	0.32762	0.059;0.152	T	0.80730	-0.1252	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	490;617	Q9UBL3-2;Q9UBL3	.;ASH2L_HUMAN	K	617;490;478;523;490	ENSP00000340896:E617K;ENSP00000250635:E490K;ENSP00000443606:E478K;ENSP00000395310:E523K;ENSP00000430259:E490K	ENSP00000250635:E490K	E	+	1	0	ASH2L	38115708	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	9.625000	0.98406	2.941000	0.99782	0.655000	0.94253	GAA	ASH2L	-	NULL	ENSG00000129691		0.537	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASH2L	HGNC	protein_coding	OTTHUMT00000376749.4	234	0.00	0	G	NM_004674		37996551	37996551	+1	no_errors	ENST00000343823	ensembl	human	known	69_37n	missense	152	16.39	30	SNP	1.000	A
ATP1A3	478	genome.wustl.edu	37	19	42472978	42472978	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:42472978G>A	ENST00000302102.5	-	20	2928	c.2778C>T	c.(2776-2778)atC>atT	p.I926I	ATP1A3_ENST00000543770.1_Silent_p.I937I|ATP1A3_ENST00000545399.1_Silent_p.I939I|ATP1A3_ENST00000602133.1_Silent_p.I896I	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	926					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GGGTCTTGCAGATGATCAGAT	0.592																																						dbGAP											0													114.0	88.0	97.0					19																	42472978		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2778C>T	19.37:g.42472978G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.I939	ENST00000302102.5	37	c.2817	CCDS12594.1	19																																																																																			ATP1A3	-	pfam_ATPase_P-typ_cation-transptr_C,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000105409		0.592	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	HGNC	protein_coding	OTTHUMT00000268107.1	149	0.00	0	G	NM_152296		42472978	42472978	-1	no_errors	ENST00000545399	ensembl	human	known	69_37n	silent	122	13.29	19	SNP	1.000	A
BAIAP2L2	80115	genome.wustl.edu	37	22	38494435	38494435	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr22:38494435C>T	ENST00000381669.3	-	5	475	c.331G>A	c.(331-333)Gac>Aac	p.D111N	BAIAP2L2_ENST00000332536.5_Missense_Mutation_p.D111N	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	111	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					AACTGCATGTCCAGCTTGGTG	0.597											OREG0026556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													95.0	101.0	99.0					22																	38494435		2089	4218	6307	-	-	-	SO:0001583	missense	0			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.331G>A	22.37:g.38494435C>T	ENSP00000371085:p.Asp111Asn	Somatic	878	WXS	Illumina GAIIx	Phase_IV	B0QYE2|Q96BG7	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.D111N	ENST00000381669.3	37	c.331	CCDS43018.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.477335	0.96291	.	.	ENSG00000128298	ENST00000381669;ENST00000402500;ENST00000332536	.	.	.	5.63	5.63	0.86233	IRSp53/MIM homology domain (IMD) (3);	0.000000	0.85682	D	0.000000	D	0.83727	0.5317	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85280	0.1061	9	0.87932	D	0	-22.9713	19.6911	0.96000	0.0:1.0:0.0:0.0	.	111	Q6UXY1	BI2L2_HUMAN	N	111	.	ENSP00000328876:D111N	D	-	1	0	BAIAP2L2	36824381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.107000	0.71517	2.658000	0.90341	0.563000	0.77884	GAC	BAIAP2L2	-	pfam_IRSp53/MIM_homology_IMD	ENSG00000128298		0.597	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L2	HGNC	protein_coding	OTTHUMT00000321727.1	104	0.00	0	C	NM_025045		38494435	38494435	-1	no_errors	ENST00000381669	ensembl	human	known	69_37n	missense	100	18.03	22	SNP	1.000	T
BBS5	129880	genome.wustl.edu	37	2	170359665	170359665	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:170359665G>A	ENST00000295240.3	+	10	1253	c.877G>A	c.(877-879)Gat>Aat	p.D293N	RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.D293N|BBS5_ENST00000554017.1_Missense_Mutation_p.D293N|BBS5_ENST00000392663.2_Missense_Mutation_p.D272N	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	293					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						AATAGACTCTGATGGTCACAC	0.383									Bardet-Biedl syndrome																													dbGAP											0													94.0	89.0	91.0					2																	170359665		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.877G>A	2.37:g.170359665G>A	ENSP00000295240:p.Asp293Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPC3|Q6PKN0	Missense_Mutation	SNP	pfam_BBL5,pfam_Kelch_1,smart_DM16_repeat,smart_Kelch_1	p.D293N	ENST00000295240.3	37	c.877	CCDS2233.1	2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307205	0.81247	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	T;T;T;T	0.78707	-0.82;-0.82;-1.2;-0.82	5.28	5.28	0.74379	.	0.134434	0.64402	D	0.000003	T	0.67988	0.2952	N	0.21097	0.63	0.80722	D	1	B;B;B	0.32753	0.383;0.001;0.213	B;B;B	0.33521	0.165;0.002;0.113	T	0.64786	-0.6325	10	0.22706	T	0.39	-7.124	18.9158	0.92505	0.0:0.0:1.0:0.0	.	293;272;293	E9PBE3;Q8N3I7-2;Q8N3I7	.;.;BBS5_HUMAN	N	293;293;272;293	ENSP00000295240:D293N;ENSP00000452313:D293N;ENSP00000376431:D272N;ENSP00000424363:D293N	ENSP00000295240:D293N	D	+	1	0	BBS5;RP11-724O16.1	170067911	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.162000	0.71874	2.474000	0.83562	0.585000	0.79938	GAT	BBS5	-	pfam_BBL5	ENSG00000163093		0.383	BBS5-001	KNOWN	basic|CCDS	protein_coding	BBS5	HGNC	protein_coding	OTTHUMT00000255265.2	71	0.00	0	G	NM_152384		170359665	170359665	+1	no_errors	ENST00000554017	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	1.000	A
C5	727	genome.wustl.edu	37	9	123737059	123737059	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:123737059C>G	ENST00000223642.1	-	30	4044	c.4015G>C	c.(4015-4017)Gag>Cag	p.E1339Q		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1339					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TCATTTACCTCTACTGGCCTC	0.348																																						dbGAP											0													110.0	114.0	113.0					9																	123737059		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.4015G>C	9.37:g.123737059C>G	ENSP00000223642:p.Glu1339Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CJ0|Q27I61	Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.E1339Q	ENST00000223642.1	37	c.4015	CCDS6826.1	9	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508568	0.44660	.	.	ENSG00000106804	ENST00000223642	T	0.35789	1.29	5.71	5.71	0.89125	.	0.220504	0.44285	D	0.000469	T	0.55529	0.1926	M	0.69248	2.105	0.33381	D	0.574928	D	0.89917	1.0	D	0.66716	0.946	T	0.63972	-0.6516	10	0.35671	T	0.21	.	14.139	0.65308	0.0:0.9264:0.0:0.0736	.	1339	P01031	CO5_HUMAN	Q	1339	ENSP00000223642:E1339Q	ENSP00000223642:E1339Q	E	-	1	0	C5	122776880	0.973000	0.33851	0.993000	0.49108	0.702000	0.40608	1.073000	0.30691	2.686000	0.91538	0.650000	0.86243	GAG	C5	-	NULL	ENSG00000106804		0.348	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	HGNC	protein_coding	OTTHUMT00000053844.1	170	0.00	0	C	NM_001735		123737059	123737059	-1	no_errors	ENST00000223642	ensembl	human	known	69_37n	missense	51	50.96	53	SNP	0.997	G
C9orf131	138724	genome.wustl.edu	37	9	35043674	35043674	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:35043674C>A	ENST00000312292.5	+	2	1095	c.1048C>A	c.(1048-1050)Ctg>Atg	p.L350M	C9orf131_ENST00000421362.2_Missense_Mutation_p.L302M|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000354479.5_Missense_Mutation_p.L277M	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	350										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CCCAGCTTCTCTGTCAGAACC	0.517																																						dbGAP											0													189.0	215.0	206.0					9																	35043674		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1048C>A	9.37:g.35043674C>A	ENSP00000308279:p.Leu350Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	NULL	p.L350M	ENST00000312292.5	37	c.1048	CCDS6572.2	9	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815931	0.50527	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292	T;T;T	0.35973	1.3;1.28;1.33	5.05	2.2	0.27929	.	0.418928	0.17713	N	0.164509	T	0.46405	0.1391	L	0.43923	1.385	0.18873	N	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75484	0.986;0.986;0.986	T	0.21793	-1.0235	10	0.62326	D	0.03	0.0084	7.212	0.25939	0.0:0.5822:0.3285:0.0893	.	350;277;302	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	M	302;277;350	ENSP00000393683:L302M;ENSP00000346472:L277M;ENSP00000308279:L350M	ENSP00000308279:L350M	L	+	1	2	C9orf131	35033674	0.014000	0.17966	0.576000	0.28549	0.087000	0.18053	0.660000	0.25009	0.303000	0.22785	-0.127000	0.14921	CTG	C9orf131	-	NULL	ENSG00000174038		0.517	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	HGNC	protein_coding	OTTHUMT00000052283.5	190	0.00	0	C	NM_203299		35043674	35043674	+1	no_errors	ENST00000312292	ensembl	human	known	69_37n	missense	172	17.62	37	SNP	0.349	A
C9orf117	286207	genome.wustl.edu	37	9	130474484	130474484	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:130474484G>C	ENST00000373295.2	+	6	1033	c.993G>C	c.(991-993)caG>caC	p.Q331H	C9orf117_ENST00000373293.5_5'UTR	NM_001012502.2	NP_001012520.2	Q5JU67	CI117_HUMAN	chromosome 9 open reading frame 117	331										breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CCAGGAGCCAGAGAGACCAGC	0.637																																						dbGAP											0													26.0	31.0	29.0					9																	130474484		1970	4149	6119	-	-	-	SO:0001583	missense	0			AK094948	CCDS43878.1	9q34.11	2012-04-02			ENSG00000160401	ENSG00000160401			27843	protein-coding gene	gene with protein product							Standard	NM_001012502		Approved		uc004brn.1	Q5JU67	OTTHUMG00000020709	ENST00000373295.2:c.993G>C	9.37:g.130474484G>C	ENSP00000362392:p.Gln331His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8T9	Missense_Mutation	SNP	NULL	p.Q331H	ENST00000373295.2	37	c.993	CCDS43878.1	9	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041379	0.35989	.	.	ENSG00000160401	ENST00000373295	T	0.42131	0.98	4.96	1.92	0.25849	.	0.763705	0.12247	N	0.486001	T	0.39489	0.1080	L	0.47716	1.5	0.19945	N	0.999949	P	0.48503	0.911	P	0.47941	0.562	T	0.23261	-1.0193	10	0.72032	D	0.01	-13.9648	5.1011	0.14760	0.1887:0.0:0.646:0.1653	.	331	Q5JU67	CI117_HUMAN	H	331	ENSP00000362392:Q331H	ENSP00000362392:Q331H	Q	+	3	2	C9orf117	129514305	0.004000	0.15560	0.095000	0.20976	0.647000	0.38526	0.338000	0.19858	0.611000	0.30052	-0.379000	0.06801	CAG	C9orf117	-	NULL	ENSG00000160401		0.637	C9orf117-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C9orf117	HGNC	protein_coding	OTTHUMT00000054215.2	48	0.00	0	G	NM_001012502		130474484	130474484	+1	no_errors	ENST00000373295	ensembl	human	known	69_37n	missense	11	45.00	9	SNP	0.005	C
CACNA1G	8913	genome.wustl.edu	37	17	48693656	48693656	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:48693656G>T	ENST00000359106.5	+	28	4932	c.4932G>T	c.(4930-4932)aaG>aaT	p.K1644N	CACNA1G_ENST00000505165.1_Missense_Mutation_p.K1644N|CACNA1G_ENST00000442258.2_Missense_Mutation_p.K1603N|CACNA1G_ENST00000515165.1_Missense_Mutation_p.K1644N|CACNA1G_ENST00000507609.1_Missense_Mutation_p.K1644N|CACNA1G_ENST00000429973.2_Missense_Mutation_p.K1626N|CACNA1G_ENST00000510115.1_Missense_Mutation_p.K1610N|CACNA1G_ENST00000513689.2_Missense_Mutation_p.K1599N|CACNA1G_ENST00000514717.1_Missense_Mutation_p.K1587N|CACNA1G_ENST00000515765.1_Missense_Mutation_p.K1633N|CACNA1G_ENST00000514079.1_Missense_Mutation_p.K1651N|CACNA1G_ENST00000507896.1_Missense_Mutation_p.K1633N|CACNA1G_ENST00000352832.5_Missense_Mutation_p.K1610N|CACNA1G_ENST00000513964.1_Missense_Mutation_p.K1599N|CACNA1G_ENST00000503485.1_Missense_Mutation_p.K1610N|CACNA1G_ENST00000502264.1_Missense_Mutation_p.K1621N|CACNA1G_ENST00000507336.1_Missense_Mutation_p.K1633N|CACNA1G_ENST00000360761.4_Missense_Mutation_p.K1621N|CACNA1G_ENST00000358244.5_Missense_Mutation_p.K1610N|CACNA1G_ENST00000507510.2_Missense_Mutation_p.K1644N|CACNA1G_ENST00000512389.1_Missense_Mutation_p.K1633N|CACNA1G_ENST00000354983.4_Missense_Mutation_p.K1610N|CACNA1G_ENST00000510366.1_Missense_Mutation_p.K1592N|CACNA1G_ENST00000514181.1_Missense_Mutation_p.K1626N|CACNA1G_ENST00000515411.1_Missense_Mutation_p.K1626N	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1644					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	AGGCTCTGAAGATCTGCAACT	0.547																																						dbGAP											0													103.0	103.0	103.0					17																	48693656		1921	4119	6040	-	-	-	SO:0001583	missense	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4932G>T	17.37:g.48693656G>T	ENSP00000352011:p.Lys1644Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.K1644N	ENST00000359106.5	37	c.4932	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	g	20.2	3.947416	0.73672	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39	4.96	4.0	0.46444	.	0.052460	0.85682	D	0.000000	D	0.97486	0.9177	M	0.62723	1.935	0.80722	D	1	P;D;D;D;D;D;D;D;D;D;D;P;P;D;D;D;P;P;D;D;D;P;D;D;D	0.89917	0.913;0.997;0.999;0.991;0.998;1.0;0.995;0.992;0.995;0.997;0.991;0.919;0.762;0.998;0.997;0.999;0.614;0.544;0.998;0.998;0.993;0.882;0.991;0.999;0.998	P;D;D;D;D;D;D;P;D;D;P;P;P;D;D;D;P;B;D;D;D;P;P;D;D	0.83275	0.812;0.964;0.996;0.992;0.937;0.996;0.989;0.889;0.989;0.951;0.859;0.73;0.542;0.94;0.989;0.973;0.572;0.434;0.937;0.964;0.977;0.54;0.859;0.98;0.991	D	0.96523	0.9387	10	0.42905	T	0.14	.	9.6037	0.39622	0.1596:0.0:0.8404:0.0	.	1587;1599;1592;1626;1599;1626;1651;1610;1644;1633;1644;1621;1633;1633;1626;1633;1644;1621;1644;1610;1603;1610;1621;1644;1610	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.	N	1621;1610;1610;1603;1621;1633;1599;1587;1592;1610;1644;1633;1599;1644;1610;1644;1626;1633;1651;1610;1644;1626;1626;1644;1633	ENSP00000353990:K1621N;ENSP00000339302:K1610N;ENSP00000347078:K1610N;ENSP00000409759:K1603N;ENSP00000425522:K1621N;ENSP00000426261:K1633N;ENSP00000425451:K1599N;ENSP00000422407:K1587N;ENSP00000426814:K1592N;ENSP00000427238:K1610N;ENSP00000423112:K1644N;ENSP00000420918:K1633N;ENSP00000426172:K1599N;ENSP00000423045:K1644N;ENSP00000427173:K1610N;ENSP00000426098:K1644N;ENSP00000425698:K1626N;ENSP00000426232:K1633N;ENSP00000423317:K1651N;ENSP00000350979:K1610N;ENSP00000352011:K1644N;ENSP00000414388:K1626N;ENSP00000423155:K1626N;ENSP00000422268:K1644N;ENSP00000421518:K1633N	ENSP00000339302:K1610N	K	+	3	2	CACNA1G	46048655	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.480000	0.53172	1.083000	0.41159	-0.142000	0.14014	AAG	CACNA1G	-	NULL	ENSG00000006283		0.547	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	108	0.00	0	G	NM_018896		48693656	48693656	+1	no_errors	ENST00000359106	ensembl	human	known	69_37n	missense	54	64.52	100	SNP	1.000	T
CACNA1G	8913	genome.wustl.edu	37	17	48695486	48695486	+	Splice_Site	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:48695486G>C	ENST00000359106.5	+	31	5304	c.5304G>C	c.(5302-5304)ctG>ctC	p.L1768L	CACNA1G_ENST00000505165.1_Splice_Site_p.L1768L|CACNA1G_ENST00000442258.2_Splice_Site_p.L1727L|CACNA1G_ENST00000515165.1_Splice_Site_p.L1768L|CACNA1G_ENST00000507609.1_Splice_Site_p.L1761L|CACNA1G_ENST00000429973.2_Splice_Site_p.L1750L|CACNA1G_ENST00000510115.1_Splice_Site_p.L1734L|CACNA1G_ENST00000513689.2_Splice_Site_p.L1723L|CACNA1G_ENST00000514717.1_Splice_Site_p.L1711L|CACNA1G_ENST00000515765.1_Splice_Site_p.L1757L|CACNA1G_ENST00000514079.1_Splice_Site_p.L1775L|CACNA1G_ENST00000507896.1_Splice_Site_p.L1757L|CACNA1G_ENST00000352832.5_Splice_Site_p.L1734L|CACNA1G_ENST00000513964.1_Splice_Site_p.L1723L|CACNA1G_ENST00000503485.1_Splice_Site_p.L1734L|CACNA1G_ENST00000502264.1_Splice_Site_p.L1745L|CACNA1G_ENST00000507336.1_Splice_Site_p.L1757L|CACNA1G_ENST00000360761.4_Splice_Site_p.L1745L|CACNA1G_ENST00000358244.5_Splice_Site_p.L1734L|CACNA1G_ENST00000507510.2_Splice_Site_p.L1768L|CACNA1G_ENST00000512389.1_Splice_Site_p.L1757L|CACNA1G_ENST00000354983.4_Splice_Site_p.L1734L|CACNA1G_ENST00000510366.1_Splice_Site_p.L1716L|CACNA1G_ENST00000514181.1_Splice_Site_p.L1743L|CACNA1G_ENST00000515411.1_Splice_Site_p.L1750L	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1768					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TTGGAGACCTGGGTGAGTTGG	0.572																																						dbGAP											0													53.0	54.0	54.0					17																	48695486		1880	4116	5996	-	-	-	SO:0001630	splice_region_variant	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.5305+1G>C	17.37:g.48695486G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	pfam_Ion_trans_dom,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.W1752S	ENST00000359106.5	37	c.5255	CCDS45730.1	17																																																																																			CACNA1G	-	NULL	ENSG00000006283		0.572	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	71	0.00	0	G	NM_018896	Silent	48695486	48695486	+1	no_errors	ENST00000506406	ensembl	human	known	69_37n	missense	55	59.56	81	SNP	0.997	C
CALD1	800	genome.wustl.edu	37	7	134552540	134552540	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:134552540G>A	ENST00000361675.2	+	3	285	c.56G>A	c.(55-57)cGa>cAa	p.R19Q	CALD1_ENST00000417172.1_Missense_Mutation_p.R19Q|CALD1_ENST00000361388.2_Missense_Mutation_p.R19Q|CALD1_ENST00000361901.2_Missense_Mutation_p.R19Q|CALD1_ENST00000422748.1_Missense_Mutation_p.R19Q			Q05682	CALD1_HUMAN	caldesmon 1	19					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						GAGGAGATGCGACTCGAAGCA	0.458																																						dbGAP											0													122.0	109.0	114.0					7																	134552540		2203	4300	6503	-	-	-	SO:0001583	missense	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.56G>A	7.37:g.134552540G>A	ENSP00000354826:p.Arg19Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.R19Q	ENST00000361675.2	37	c.56	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962285	0.53400	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000454108;ENST00000361675;ENST00000361901;ENST00000445569;ENST00000435928	T;T;T;T;T;T	0.51071	1.67;0.72;1.6;1.6;1.17;1.67	5.31	5.31	0.75309	.	0.164616	0.27831	U	0.017664	T	0.53384	0.1793	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.988;0.986;0.995;0.988;0.988	T	0.56282	-0.8005	10	0.37606	T	0.19	-2.6891	18.5778	0.91161	0.0:0.0:1.0:0.0	.	19;19;19;19;19	A8K0X1;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;CALD1_HUMAN;.	Q	19	ENSP00000398826:R19Q;ENSP00000411476:R19Q;ENSP00000355000:R19Q;ENSP00000395710:R19Q;ENSP00000354826:R19Q;ENSP00000354513:R19Q	ENSP00000355000:R19Q	R	+	2	0	CALD1	134203080	1.000000	0.71417	0.972000	0.41901	0.964000	0.63967	7.084000	0.76866	2.456000	0.83038	0.655000	0.94253	CGA	CALD1	-	pfam_Caldesmon_LSP	ENSG00000122786		0.458	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	207	0.00	0	G	NM_033138		134552540	134552540	+1	no_errors	ENST00000361388	ensembl	human	known	69_37n	missense	176	22.47	51	SNP	0.999	A
CALD1	800	genome.wustl.edu	37	7	134620445	134620445	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:134620445G>C	ENST00000361675.2	+	6	1544	c.1315G>C	c.(1315-1317)Gag>Cag	p.E439Q	CALD1_ENST00000393118.2_Missense_Mutation_p.E204Q|CALD1_ENST00000417172.1_Intron|CALD1_ENST00000495522.1_Missense_Mutation_p.E204Q|CALD1_ENST00000361388.2_Missense_Mutation_p.E210Q|CALD1_ENST00000361901.2_Intron|CALD1_ENST00000424922.1_Intron|CALD1_ENST00000543443.1_Intron|CALD1_ENST00000422748.1_Missense_Mutation_p.E210Q			Q05682	CALD1_HUMAN	caldesmon 1	439					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						AAAGGGAGAAGAGAAGGGAAC	0.393																																						dbGAP											0													63.0	59.0	61.0					7																	134620445		2203	4300	6503	-	-	-	SO:0001583	missense	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1315G>C	7.37:g.134620445G>C	ENSP00000354826:p.Glu439Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.E210Q	ENST00000361675.2	37	c.628	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	G	16.10	3.028150	0.54790	.	.	ENSG00000122786	ENST00000361388;ENST00000422748;ENST00000361675;ENST00000393118;ENST00000495522	T;T;T;T;T	0.44083	1.78;1.77;0.93;1.76;1.77	5.87	5.87	0.94306	.	0.252294	0.27294	N	0.020029	T	0.59770	0.2218	L	0.57536	1.79	0.80722	D	1	P;D;P;P;D	0.62365	0.84;0.991;0.808;0.808;0.991	P;P;B;B;P	0.62089	0.459;0.898;0.329;0.329;0.898	T	0.54111	-0.8342	10	0.40728	T	0.16	-11.7598	18.3889	0.90475	0.0:0.0:1.0:0.0	.	210;204;204;210;439	A8K0X1;E7EX44;Q05682-3;Q05682-2;Q05682	.;.;.;.;CALD1_HUMAN	Q	210;210;439;204;204	ENSP00000355000:E210Q;ENSP00000395710:E210Q;ENSP00000354826:E439Q;ENSP00000376826:E204Q;ENSP00000419673:E204Q	ENSP00000355000:E210Q	E	+	1	0	CALD1	134270985	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	6.314000	0.72848	2.774000	0.95407	0.650000	0.86243	GAG	CALD1	-	pfam_Caldesmon_LSP	ENSG00000122786		0.393	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	328	0.00	0	G	NM_033138		134620445	134620445	+1	no_errors	ENST00000361388	ensembl	human	known	69_37n	missense	258	29.82	113	SNP	1.000	C
CAPN3	825	genome.wustl.edu	37	15	42703522	42703522	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr15:42703522C>T	ENST00000397163.3	+	23	2637	c.2418C>T	c.(2416-2418)atC>atT	p.I806I	CAPN3_ENST00000357568.3_Silent_p.I800I|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000349748.3_Silent_p.I714I|CAPN3_ENST00000356316.3_Silent_p.I713I|CAPN3_ENST00000397200.4_Silent_p.I294I|CAPN3_ENST00000318023.7_Silent_p.I800I|CAPN3_ENST00000569136.1_Silent_p.I141I|CAPN3_ENST00000561817.1_Silent_p.I141I|CAPN3_ENST00000397204.4_Silent_p.I141I|CAPN3_ENST00000337571.4_Silent_p.I141I	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	806	Domain IV.|EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		GAGATGGTATCATCAAGCTCA	0.517																																						dbGAP											0													171.0	150.0	157.0					15																	42703522		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.2418C>T	15.37:g.42703522C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.S52L	ENST00000397163.3	37	c.155	CCDS45245.1	15																																																																																			CAPN3	-	pfscan_EF_HAND_2	ENSG00000092529		0.517	CAPN3-009	KNOWN	basic|CCDS	protein_coding	CAPN3	HGNC	protein_coding	OTTHUMT00000421075.1	176	0.00	0	C			42703522	42703522	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000568153	ensembl	human	known	69_37n	missense	85	25.86	30	SNP	1.000	T
CCDC14	64770	genome.wustl.edu	37	3	123675589	123675589	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:123675589delT	ENST00000488653.2	-	2	318	c.228delA	c.(226-228)aaafs	p.K76fs	CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000489746.1_5'UTR|CCDC14_ENST00000433542.2_Frame_Shift_Del_p.K76fs|CCDC14_ENST00000485727.1_5'UTR			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	76					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		GTACTTACGCTTTCTTTCCAT	0.358																																						dbGAP											0													179.0	157.0	164.0					3																	123675589		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.228delA	3.37:g.123675589delT	ENSP00000420180:p.Lys76fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Frame_Shift_Del	DEL	NULL	p.A77fs	ENST00000488653.2	37	c.228		3																																																																																			CCDC14	-	NULL	ENSG00000175455		0.358	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC14	HGNC	protein_coding		98	0.00	0	T	NM_022757		123675589	123675589	-1	no_errors	ENST00000488653	ensembl	human	known	69_37n	frame_shift_del	106	24.82	35	DEL	1.000	-
CD72	971	genome.wustl.edu	37	9	35618081	35618081	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:35618081C>T	ENST00000396757.1	-	3	284	c.120G>A	c.(118-120)gaG>gaA	p.E40E	CD72_ENST00000378430.3_Silent_p.E40E|CD72_ENST00000490239.1_5'UTR|CD72_ENST00000378431.1_Silent_p.E40E|CD72_ENST00000259633.4_Silent_p.E40E			P21854	CD72_HUMAN	CD72 molecule	40					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTTGAACATTCTCGTAGGTGA	0.547																																						dbGAP											0													186.0	190.0	189.0					9																	35618081		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.120G>A	9.37:g.35618081C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.E40	ENST00000396757.1	37	c.120	CCDS6581.1	9																																																																																			CD72	-	NULL	ENSG00000137101		0.547	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD72	HGNC	protein_coding	OTTHUMT00000052336.1	109	0.00	0	C	NM_001782		35618081	35618081	-1	no_errors	ENST00000259633	ensembl	human	known	69_37n	silent	82	31.15	38	SNP	1.000	T
CD72	971	genome.wustl.edu	37	9	35618271	35618271	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:35618271C>T	ENST00000396757.1	-	2	194	c.30G>A	c.(28-30)ctG>ctA	p.L10L	CD72_ENST00000378430.3_Silent_p.L10L|CD72_ENST00000490239.1_5'UTR|CD72_ENST00000378431.1_Silent_p.L10L|CD72_ENST00000259633.4_Silent_p.L10L			P21854	CD72_HUMAN	CD72 molecule	10					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCACAAACCTCAGATCTGCAT	0.602																																						dbGAP											0													116.0	95.0	102.0					9																	35618271		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.30G>A	9.37:g.35618271C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L10	ENST00000396757.1	37	c.30	CCDS6581.1	9																																																																																			CD72	-	NULL	ENSG00000137101		0.602	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD72	HGNC	protein_coding	OTTHUMT00000052336.1	83	0.00	0	C	NM_001782		35618271	35618271	-1	no_errors	ENST00000259633	ensembl	human	known	69_37n	silent	60	24.05	19	SNP	1.000	T
CDC42BPA	8476	genome.wustl.edu	37	1	227216475	227216475	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:227216475C>A	ENST00000366769.3	-	29	5501	c.4210G>T	c.(4210-4212)Gag>Tag	p.E1404*	CDC42BPA_ENST00000366765.3_Nonsense_Mutation_p.E1417*|CDC42BPA_ENST00000366766.2_Nonsense_Mutation_p.E1439*|CDC42BPA_ENST00000334218.5_Nonsense_Mutation_p.E1404*|CDC42BPA_ENST00000366767.3_Nonsense_Mutation_p.E1323*|CDC42BPA_ENST00000366764.2_Nonsense_Mutation_p.E1376*|CDC42BPA_ENST00000535525.1_Nonsense_Mutation_p.E1384*	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CTGGAGATCTCAACTGCGCAG	0.433																																						dbGAP											0													153.0	137.0	142.0					1																	227216475		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.4210G>T	1.37:g.227216475C>A	ENSP00000355731:p.Glu1404*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.E1404*	ENST00000366769.3	37	c.4210	CCDS1558.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.677743|6.677743	0.97755|0.97755	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765|ENST00000448940;ENST00000442054;ENST00000429440;ENST00000441725	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.87932|.	D|.	0|.	.|.	19.5792|19.5792	0.95459|0.95459	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	1404;1323;1404;1439;1376;719;1384;1417|606;732;301;628	.|.	ENSP00000335341:E1404X|.	E|X	-|-	1|2	0|2	CDC42BPA|CDC42BPA	225283098|225283098	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.017000|6.017000	0.70805|0.70805	2.704000|2.704000	0.92352|0.92352	0.585000|0.585000	0.79938|0.79938	GAG|TGA	CDC42BPA	-	pfam_Citron,superfamily_WD40_repeat_dom,smart_Citron	ENSG00000143776		0.433	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	112	0.00	0	C	NM_014826		227216475	227216475	-1	no_errors	ENST00000334218	ensembl	human	known	69_37n	nonsense	123	11.43	16	SNP	1.000	A
CDC42BPB	9578	genome.wustl.edu	37	14	103465921	103465921	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr14:103465921G>A	ENST00000361246.2	-	5	865	c.577C>T	c.(577-579)Cag>Tag	p.Q193*		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TAATGAAGCTGATGGATGGAG	0.448																																						dbGAP											0													133.0	120.0	124.0					14																	103465921		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.577C>T	14.37:g.103465921G>A	ENSP00000355237:p.Gln193*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.Q193*	ENST00000361246.2	37	c.577	CCDS9978.1	14	.	.	.	.	.	.	.	.	.	.	G	39	7.764655	0.98477	.	.	ENSG00000198752	ENST00000361246	.	.	.	4.97	4.97	0.65823	.	0.114726	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	15.2461	0.73507	0.0:0.1509:0.8491:0.0	.	.	.	.	X	193	.	ENSP00000355237:Q193X	Q	-	1	0	CDC42BPB	102535674	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.183000	0.72002	2.465000	0.83290	0.655000	0.94253	CAG	CDC42BPB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198752		0.448	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	182	0.00	0	G	NM_006035		103465921	103465921	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	nonsense	87	17.59	19	SNP	1.000	A
CDH11	1009	genome.wustl.edu	37	16	65016037	65016037	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr16:65016037G>A	ENST00000268603.4	-	8	1782	c.1167C>T	c.(1165-1167)atC>atT	p.I389I	CDH11_ENST00000566827.1_Silent_p.I263I|CDH11_ENST00000394156.3_Silent_p.I389I	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	389	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GGACTTCGTGGATGTAACTTG	0.512			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																												dbGAP		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													153.0	131.0	138.0					16																	65016037		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1167C>T	16.37:g.65016037G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I389	ENST00000268603.4	37	c.1167	CCDS10803.1	16																																																																																			CDH11	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000140937		0.512	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	257	0.00	0	G	NM_033664		65016037	65016037	-1	no_errors	ENST00000268603	ensembl	human	known	69_37n	silent	166	19.32	40	SNP	1.000	A
CHD5	26038	genome.wustl.edu	37	1	6202326	6202326	+	Silent	SNP	G	G	A	rs566097871		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:6202326G>A	ENST00000262450.3	-	15	2397	c.2298C>T	c.(2296-2298)cgC>cgT	p.R766R	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TCTCAAACTCGCGTTCCCAGT	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		17397	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													88.0	87.0	87.0					1																	6202326		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2298C>T	1.37:g.6202326G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_DUF1086,pfam_DUF1087,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R149*	ENST00000262450.3	37	c.445	CCDS57.1	1																																																																																			CHD5	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000116254		0.607	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	58	0.00	0	G	NM_015557		6202326	6202326	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000462991	ensembl	human	known	69_37n	nonsense	26	23.53	8	SNP	0.368	A
CEP170	9859	genome.wustl.edu	37	1	243349584	243349584	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:243349584C>T	ENST00000366542.1	-	9	1300	c.1249G>A	c.(1249-1251)Gaa>Aaa	p.E417K	CEP170_ENST00000366543.1_Missense_Mutation_p.E417K|CEP170_ENST00000366544.1_Missense_Mutation_p.E417K	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	417						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TGATGCTTTTCAGTAGCCTGG	0.438																																						dbGAP											0													167.0	164.0	165.0					1																	243349584		1896	4119	6015	-	-	-	SO:0001583	missense	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1249G>A	1.37:g.243349584C>T	ENSP00000355500:p.Glu417Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_Fibronectin_type3,smart_FHA_dom,pfscan_FHA_dom	p.E417K	ENST00000366542.1	37	c.1249	CCDS44339.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273372	0.80580	.	.	ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543;ENST00000424081	T;T;T	0.46063	0.88;0.93;0.93	5.3	5.3	0.74995	.	86.564400	0.05959	U	0.640346	T	0.57388	0.2050	L	0.58810	1.83	0.80722	D	1	P;B;B	0.52316	0.952;0.257;0.102	P;B;B	0.52909	0.713;0.188;0.034	T	0.50259	-0.8849	10	0.15499	T	0.54	-12.9267	18.9535	0.92649	0.0:1.0:0.0:0.0	.	417;417;417	Q5SW79-3;Q5SW79-2;Q5SW79	.;.;CE170_HUMAN	K	417;417;417;315	ENSP00000355500:E417K;ENSP00000355502:E417K;ENSP00000355501:E417K	ENSP00000355500:E417K	E	-	1	0	CEP170	241416207	0.997000	0.39634	0.961000	0.40146	0.989000	0.77384	3.008000	0.49544	2.468000	0.83385	0.585000	0.79938	GAA	CEP170	-	NULL	ENSG00000143702		0.438	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2	128	0.00	0	C	NM_014812		243349584	243349584	-1	no_errors	ENST00000366542	ensembl	human	known	69_37n	missense	132	44.30	105	SNP	0.994	T
CHN1	1123	genome.wustl.edu	37	2	175742723	175742723	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:175742723C>G	ENST00000409900.3	-	6	707	c.394G>C	c.(394-396)Gaa>Caa	p.E132Q	CHN1_ENST00000409156.3_Missense_Mutation_p.E132Q|CHN1_ENST00000488080.1_Intron	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	132	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			GCAATGTATTCTGCTGCCTTG	0.433			T	TAF15	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	0													201.0	192.0	195.0					2																	175742723		1936	4154	6090	-	-	-	SO:0001583	missense	0				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.394G>C	2.37:g.175742723C>G	ENSP00000386741:p.Glu132Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pirsf_N-chimaerin,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.E132Q	ENST00000409900.3	37	c.394	CCDS46455.1	2	.	.	.	.	.	.	.	.	.	.	C	19.20	3.782525	0.70222	.	.	ENSG00000128656	ENST00000409900;ENST00000409156	T;T	0.64085	-0.08;-0.08	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	L	0.34521	1.04	0.80722	D	1	B;P	0.38617	0.431;0.64	B;B	0.41088	0.081;0.347	T	0.56547	-0.7961	10	0.38643	T	0.18	.	18.7375	0.91761	0.0:1.0:0.0:0.0	.	132;132	B4DV19;P15882	.;CHIN_HUMAN	Q	132	ENSP00000386741:E132Q;ENSP00000386470:E132Q	ENSP00000386470:E132Q	E	-	1	0	CHN1	175450969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.550000	0.82173	2.663000	0.90544	0.655000	0.94253	GAA	CHN1	-	pirsf_N-chimaerin	ENSG00000128656		0.433	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHN1	HGNC	protein_coding	OTTHUMT00000334453.1	150	0.00	0	C	NM_001822		175742723	175742723	-1	no_errors	ENST00000409900	ensembl	human	known	69_37n	missense	83	23.15	25	SNP	1.000	G
CHRNB2	1141	genome.wustl.edu	37	1	154543986	154543986	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:154543986C>T	ENST00000368476.3	+	5	951	c.687C>T	c.(685-687)atC>atT	p.I229I		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	229					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	ATGACTTCATCATTCGCCGCA	0.572																																						dbGAP											0													307.0	236.0	260.0					1																	154543986		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.687C>T	1.37:g.154543986C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UEH9	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.I229	ENST00000368476.3	37	c.687	CCDS1070.1	1																																																																																			CHRNB2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000160716		0.572	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB2	HGNC	protein_coding	OTTHUMT00000090697.1	108	0.00	0	C	NM_000748		154543986	154543986	+1	no_errors	ENST00000368476	ensembl	human	known	69_37n	silent	111	27.39	43	SNP	1.000	T
CLEC14A	161198	genome.wustl.edu	37	14	38724848	38724848	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr14:38724848G>A	ENST00000342213.2	-	1	726	c.380C>T	c.(379-381)aCg>aTg	p.T127M		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	127	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		CCACTGCAGCGTGTCGCTTTC	0.687																																						dbGAP											0													20.0	24.0	23.0					14																	38724848		2199	4297	6496	-	-	-	SO:0001583	missense	0				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.380C>T	14.37:g.38724848G>A	ENSP00000353013:p.Thr127Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.T127M	ENST00000342213.2	37	c.380	CCDS9667.1	14	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454230	0.43634	.	.	ENSG00000176435	ENST00000342213	T	0.57595	0.39	3.91	3.91	0.45181	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.404889	0.20016	N	0.101004	T	0.49795	0.1578	N	0.08118	0	0.23969	N	0.996311	D	0.89917	1.0	D	0.64687	0.928	T	0.46498	-0.9187	10	0.49607	T	0.09	-5.943	13.7192	0.62717	0.0:0.0:1.0:0.0	.	127	Q86T13	CLC14_HUMAN	M	127	ENSP00000353013:T127M	ENSP00000353013:T127M	T	-	2	0	CLEC14A	37794599	0.973000	0.33851	0.651000	0.29564	0.547000	0.35210	2.309000	0.43699	2.480000	0.83734	0.591000	0.81541	ACG	CLEC14A	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000176435		0.687	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC14A	HGNC	protein_coding	OTTHUMT00000276729.1	27	0.00	0	G	NM_175060		38724848	38724848	-1	no_errors	ENST00000342213	ensembl	human	known	69_37n	missense	9	37.50	6	SNP	0.607	A
CLIP3	25999	genome.wustl.edu	37	19	36517498	36517498	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:36517498C>T	ENST00000360535.4	-	5	779	c.552G>A	c.(550-552)gcG>gcA	p.A184A	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Silent_p.A184A	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	184					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CTCGCGGCCTCGCACCCTTCA	0.667																																						dbGAP											0													49.0	45.0	47.0					19																	36517498		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.552G>A	19.37:g.36517498C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Silent	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.A184	ENST00000360535.4	37	c.552	CCDS12486.1	19																																																																																			CLIP3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000105270		0.667	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP3	HGNC	protein_coding	OTTHUMT00000457426.1	108	0.00	0	C	NM_015526		36517498	36517498	-1	no_errors	ENST00000360535	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	0.053	T
COL4A5	1287	genome.wustl.edu	37	X	107834341	107834341	+	Nonsense_Mutation	SNP	C	C	T	rs281874661		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:107834341C>T	ENST00000361603.2	+	20	1463	c.1219C>T	c.(1219-1221)Cag>Tag	p.Q407*	COL4A5_ENST00000328300.6_Nonsense_Mutation_p.Q407*	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	407	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AGAAAGGGGTCAGAAAGGTGA	0.527									Alport syndrome with Diffuse Leiomyomatosis																													dbGAP											0			GRCh37	CM983305	COL4A5	M							68.0	66.0	67.0					X																	107834341		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1219C>T	X.37:g.107834341C>T	ENSP00000354505:p.Gln407*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.Q407*	ENST00000361603.2	37	c.1219	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	c	40	8.436710	0.98810	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	.	.	.	5.26	4.36	0.52297	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	15.0992	0.72258	0.0:0.8622:0.1378:0.0	.	.	.	.	X	407	.	ENSP00000331902:Q407X	Q	+	1	0	COL4A5	107720997	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	3.320000	0.51991	2.196000	0.70406	0.540000	0.68198	CAG	COL4A5	-	pfam_Collagen	ENSG00000188153		0.527	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	209	0.00	0	C			107834341	107834341	+1	no_errors	ENST00000328300	ensembl	human	known	69_37n	nonsense	183	17.41	39	SNP	0.998	T
CROT	54677	genome.wustl.edu	37	7	87020973	87020973	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:87020973C>T	ENST00000331536.3	+	14	1555	c.1370C>T	c.(1369-1371)tCa>tTa	p.S457L	CROT_ENST00000419147.2_Missense_Mutation_p.S485L|CROT_ENST00000442291.1_Missense_Mutation_p.S457L	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	457					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	ACTATGCGATCATGCACAGTT	0.388																																						dbGAP											0													120.0	109.0	113.0					7																	87020973		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1370C>T	7.37:g.87020973C>T	ENSP00000331981:p.Ser457Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.S457L	ENST00000331536.3	37	c.1370	CCDS5604.1	7	.	.	.	.	.	.	.	.	.	.	C	22.8	4.331208	0.81690	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.91945	-2.94;-2.94;-2.94	5.62	5.62	0.85841	.	0.164376	0.53938	D	0.000049	D	0.97102	0.9053	M	0.93808	3.46	0.49299	D	0.999777	B;D	0.59357	0.112;0.985	B;D	0.63877	0.209;0.919	D	0.97418	1.0007	10	0.72032	D	0.01	-5.6	20.0281	0.97530	0.0:1.0:0.0:0.0	.	485;457	E7EQF2;Q9UKG9	.;OCTC_HUMAN	L	485;457;457	ENSP00000413575:S485L;ENSP00000331981:S457L;ENSP00000411983:S457L	ENSP00000331981:S457L	S	+	2	0	CROT	86858909	0.840000	0.29493	0.424000	0.26647	0.314000	0.28054	7.386000	0.79775	2.818000	0.97014	0.655000	0.94253	TCA	CROT	-	pfam_Carn_acyl_trans	ENSG00000005469		0.388	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROT	HGNC	protein_coding	OTTHUMT00000253485.1	109	0.00	0	C	NM_021151		87020973	87020973	+1	no_errors	ENST00000331536	ensembl	human	known	69_37n	missense	135	23.16	41	SNP	0.987	T
CWC25	54883	genome.wustl.edu	37	17	36958378	36958378	+	Silent	SNP	C	C	G	rs369359892		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:36958378C>G	ENST00000225428.5	-	10	1542	c.1245G>C	c.(1243-1245)tcG>tcC	p.S415S	CWC25_ENST00000536127.1_Silent_p.S352S|PIP4K2B_ENST00000269554.3_5'Flank|PIP4K2B_ENST00000311500.6_5'Flank	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	415										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						CCAGAGCTACCGAAGTTCTCT	0.468																																						dbGAP											0													73.0	70.0	71.0					17																	36958378		1865	4107	5972	-	-	-	SO:0001819	synonymous_variant	0			AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.1245G>C	17.37:g.36958378C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLM3|Q68DK5	Silent	SNP	pfam_CWC25,pfam_CIR_N_dom	p.S415	ENST00000225428.5	37	c.1245	CCDS45663.1	17																																																																																			CWC25	-	NULL	ENSG00000108296		0.468	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC25	HGNC	protein_coding	OTTHUMT00000442186.6	108	0.00	0	C	NM_017748		36958378	36958378	-1	no_errors	ENST00000225428	ensembl	human	known	69_37n	silent	27	41.67	20	SNP	0.031	G
CYP3A7	1551	genome.wustl.edu	37	7	99317955	99317955	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:99317955G>A	ENST00000336374.2	-	4	301	c.299C>T	c.(298-300)tCt>tTt	p.S100F		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	100					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	TGTGAAGACAGAATAACATTC	0.328																																						dbGAP											0													136.0	123.0	128.0					7																	99317955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.299C>T	7.37:g.99317955G>A	ENSP00000337450:p.Ser100Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D288|Q9H241	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.S100F	ENST00000336374.2	37	c.299	CCDS5673.1	7	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049525	0.55218	.	.	ENSG00000160870	ENST00000292414;ENST00000336374	T	0.63580	-0.05	4.72	3.76	0.43208	.	0.123241	0.56097	D	0.000024	D	0.83390	0.5244	H	0.96175	3.78	0.32355	N	0.557942	D	0.89917	1.0	D	0.80764	0.994	D	0.87838	0.2649	10	0.87932	D	0	.	10.6515	0.45651	0.0:0.3359:0.6641:0.0	.	100	P24462	CP3A7_HUMAN	F	100	ENSP00000337450:S100F	ENSP00000292414:S100F	S	-	2	0	CYP3A7	99155891	0.690000	0.27699	0.867000	0.34043	0.951000	0.60555	2.549000	0.45803	2.156000	0.67533	0.561000	0.74099	TCT	CYP3A7	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A	ENSG00000160870		0.328	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A7	HGNC	protein_coding	OTTHUMT00000345484.1	317	0.00	0	G			99317955	99317955	-1	no_errors	ENST00000336374	ensembl	human	known	69_37n	missense	259	34.51	137	SNP	0.470	A
DCAF8L1	139425	genome.wustl.edu	37	X	27998944	27998944	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:27998944C>A	ENST00000441525.1	-	1	622	c.508G>T	c.(508-510)Gcc>Tcc	p.A170S		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	170										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						ACAAAGCGGGCACTTGAACCC	0.562																																						dbGAP											0													34.0	31.0	32.0					X																	27998944		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.508G>T	X.37:g.27998944C>A	ENSP00000405222:p.Ala170Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXX1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A170S	ENST00000441525.1	37	c.508	CCDS35222.1	X	.	.	.	.	.	.	.	.	.	.	C	6.640	0.486613	0.12641	.	.	ENSG00000226372	ENST00000441525	T	0.63255	-0.03	0.842	-1.68	0.08212	.	0.441828	0.24298	N	0.039743	T	0.37265	0.0997	L	0.34521	1.04	0.20764	N	0.999858	B	0.14012	0.009	B	0.16722	0.016	T	0.30297	-0.9983	10	0.07990	T	0.79	-1.9525	2.7411	0.05254	0.0:0.2992:0.256:0.4448	.	170	A6NGE4	DC8L1_HUMAN	S	170	ENSP00000405222:A170S	ENSP00000405222:A170S	A	-	1	0	DCAF8L1	27908865	0.969000	0.33509	0.021000	0.16686	0.552000	0.35366	-0.173000	0.09854	-1.113000	0.02981	-0.739000	0.03532	GCC	DCAF8L1	-	NULL	ENSG00000226372		0.562	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	HGNC	protein_coding	OTTHUMT00000056150.2	92	0.00	0	C	XM_066690		27998944	27998944	-1	no_errors	ENST00000441525	ensembl	human	known	69_37n	missense	102	15.57	19	SNP	0.757	A
DCLRE1C	64421	genome.wustl.edu	37	10	14950493	14950493	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr10:14950493C>G	ENST00000378278.2	-	14	2030	c.1993G>C	c.(1993-1995)Gag>Cag	p.E665Q	DCLRE1C_ENST00000378242.1_Missense_Mutation_p.E318Q|DCLRE1C_ENST00000492201.1_5'Flank|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.E550Q|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.E550Q|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.E550Q|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.E545Q|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.E545Q|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.E545Q|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.E545Q|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.E545Q			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	665					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TGTAAATGCTCTCGTTTAGGT	0.378								Non-homologous end-joining																														dbGAP											0													126.0	128.0	127.0					10																	14950493		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1993G>C	10.37:g.14950493C>G	ENSP00000367527:p.Glu665Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	pfam_DRMBL	p.E665Q	ENST00000378278.2	37	c.1993	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523327	0.64747	.	.	ENSG00000152457	ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000378242	T;T;T;T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81	5.71	5.71	0.89125	.	0.162813	0.56097	D	0.000038	T	0.47488	0.1448	M	0.69823	2.125	0.28542	N	0.912064	D;D	0.63880	0.993;0.993	P;P	0.59424	0.857;0.796	T	0.46978	-0.9152	10	0.72032	D	0.01	.	16.14	0.81515	0.134:0.866:0.0:0.0	.	550;665	Q96SD1-3;Q96SD1	.;DCR1C_HUMAN	Q	545;550;550;550;545;545;545;665;545;318	ENSP00000400529:E545Q;ENSP00000367492:E550Q;ENSP00000350349:E550Q;ENSP00000367496:E550Q;ENSP00000380030:E545Q;ENSP00000367503:E545Q;ENSP00000367502:E545Q;ENSP00000367527:E665Q;ENSP00000367506:E545Q;ENSP00000367488:E318Q	ENSP00000350349:E550Q	E	-	1	0	DCLRE1C	14990499	0.997000	0.39634	0.636000	0.29352	0.731000	0.41821	2.991000	0.49409	2.694000	0.91930	0.557000	0.71058	GAG	DCLRE1C	-	NULL	ENSG00000152457		0.378	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	175	0.00	0	C	NM_022487		14950493	14950493	-1	no_errors	ENST00000378278	ensembl	human	known	69_37n	missense	67	54.05	80	SNP	0.542	G
DDX4	54514	genome.wustl.edu	37	5	55056082	55056082	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr5:55056082C>T	ENST00000505374.1	+	4	274	c.182C>T	c.(181-183)tCt>tTt	p.S61F	SLC38A9_ENST00000504880.1_Intron|DDX4_ENST00000354991.5_Missense_Mutation_p.S61F|DDX4_ENST00000353507.5_Missense_Mutation_p.S61F|DDX4_ENST00000508580.1_3'UTR|DDX4_ENST00000514278.2_Missense_Mutation_p.S61F	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	61	Gly-rich.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				GGATTTGCCTCTGGGCGGAAT	0.363																																						dbGAP											0													177.0	175.0	176.0					5																	55056082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.182C>T	5.37:g.55056082C>T	ENSP00000424838:p.Ser61Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S61F	ENST00000505374.1	37	c.182	CCDS3969.1	5	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281519	0.59758	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000506848;ENST00000514679;ENST00000354991;ENST00000511491	T;T;T;T;T;T;T	0.56776	1.9;1.86;1.94;3.39;0.52;1.9;0.44	5.04	5.04	0.67666	.	0.545591	0.20281	N	0.095446	T	0.48429	0.1499	L	0.29908	0.895	0.31633	N	0.648751	P;P;P	0.46220	0.874;0.755;0.8	P;B;P	0.48141	0.568;0.367;0.467	T	0.52866	-0.8518	10	0.33141	T	0.24	-13.3478	13.7675	0.63004	0.0:1.0:0.0:0.0	.	61;61;61	D6RDK4;Q9NQI0-2;Q9NQI0	.;.;DDX4_HUMAN	F	61	ENSP00000334167:S61F;ENSP00000425359:S61F;ENSP00000424838:S61F;ENSP00000427167:S61F;ENSP00000424112:S61F;ENSP00000347087:S61F;ENSP00000427522:S61F	ENSP00000334167:S61F	S	+	2	0	DDX4	55091839	0.996000	0.38824	0.995000	0.50966	0.711000	0.40976	3.125000	0.50469	2.615000	0.88500	0.563000	0.77884	TCT	DDX4	-	NULL	ENSG00000152670		0.363	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX4	HGNC	protein_coding	OTTHUMT00000214147.2	218	0.00	0	C	NM_024415		55056082	55056082	+1	no_errors	ENST00000505374	ensembl	human	known	69_37n	missense	137	41.53	98	SNP	1.000	T
DENND1A	57706	genome.wustl.edu	37	9	126520100	126520100	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:126520100G>A	ENST00000373624.2	-	5	385	c.184C>T	c.(184-186)Ctc>Ttc	p.L62F	DENND1A_ENST00000373620.3_Splice_Site_p.L62F|DENND1A_ENST00000373618.1_Splice_Site_p.L30F|DENND1A_ENST00000394219.3_Splice_Site_p.L30F|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394215.2_Splice_Site_p.L32F	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	62	UDENN.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CTAACTGTGAGGCTGCAGCAA	0.433																																						dbGAP											0													70.0	61.0	64.0					9																	126520100		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.183-1C>T	9.37:g.126520100G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L30F	ENST00000373624.2	37	c.88	CCDS35133.1	9	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214468	0.58452	.	.	ENSG00000119522	ENST00000373624;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;3.17	6.02	6.02	0.97574	uDENN (3);	0.208210	0.42172	D	0.000750	T	0.50069	0.1594	L	0.42245	1.32	0.43793	D	0.996331	D;P;P;B;P	0.54207	0.965;0.703;0.845;0.409;0.953	P;B;P;B;P	0.53401	0.725;0.299;0.568;0.246;0.722	T	0.16158	-1.0412	10	0.23891	T	0.37	-15.7634	19.5254	0.95203	0.0:0.0:1.0:0.0	.	30;30;32;62;62	Q8TEH3-6;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3	.;.;.;.;DEN1A_HUMAN	F	62;30;62;32;30	ENSP00000362727:L62F;ENSP00000377766:L30F;ENSP00000362722:L62F;ENSP00000377763:L32F;ENSP00000362720:L30F	ENSP00000362720:L30F	L	-	1	0	DENND1A	125559921	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.489000	0.53237	2.857000	0.98124	0.650000	0.86243	CTC	DENND1A	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000119522		0.433	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND1A	HGNC	protein_coding	OTTHUMT00000053997.1	51	0.00	0	G	NM_024820	Missense_Mutation	126520100	126520100	-1	no_errors	ENST00000394219	ensembl	human	known	69_37n	missense	29	40.00	20	SNP	1.000	A
DHPS	1725	genome.wustl.edu	37	19	12792473	12792473	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:12792473G>C	ENST00000210060.7	-	1	243	c.108C>G	c.(106-108)ttC>ttG	p.F36L	DHPS_ENST00000594424.1_5'Flank|DHPS_ENST00000351660.5_Missense_Mutation_p.F36L|CTD-2192J16.26_ENST00000593554.1_lincRNA|DHPS_ENST00000599481.1_5'Flank	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	36					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)			central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						CACCGCGGTTGAAGTCGTAGC	0.657																																						dbGAP											0													60.0	61.0	60.0					19																	12792473		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.108C>G	19.37:g.12792473G>C	ENSP00000210060:p.Phe36Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Missense_Mutation	SNP	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	p.F36L	ENST00000210060.7	37	c.108	CCDS12276.1	19	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569779	0.65765	.	.	ENSG00000095059	ENST00000210060;ENST00000351660	T;T	0.41065	1.01;1.01	5.43	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.66479	0.2793	M	0.91354	3.2	0.80722	D	1	D;P;P	0.76494	0.999;0.749;0.601	D;P;B	0.69307	0.963;0.447;0.156	T	0.70178	-0.4943	10	0.54805	T	0.06	-26.3104	8.1607	0.31196	0.181:0.0:0.819:0.0	.	36;36;36	Q5J8M5;P49366-2;P49366	.;.;DHYS_HUMAN	L	36	ENSP00000210060:F36L;ENSP00000221303:F36L	ENSP00000210060:F36L	F	-	3	2	DHPS	12653473	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	2.638000	0.46562	1.290000	0.44636	0.313000	0.20887	TTC	DHPS	-	tigrfam_Deoxyhypusine_synthase	ENSG00000095059		0.657	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHPS	HGNC	protein_coding	OTTHUMT00000462708.1	70	0.00	0	G	NM_001930		12792473	12792473	-1	no_errors	ENST00000210060	ensembl	human	known	69_37n	missense	28	40.43	19	SNP	1.000	C
DIP2A	23181	genome.wustl.edu	37	21	47957380	47957380	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr21:47957380G>A	ENST00000417564.2	+	15	1750	c.1729G>A	c.(1729-1731)Gtg>Atg	p.V577M	DIP2A_ENST00000427143.2_Missense_Mutation_p.V513M|DIP2A_ENST00000318711.7_Missense_Mutation_p.V578M|DIP2A_ENST00000400274.1_Missense_Mutation_p.V573M|DIP2A_ENST00000457905.3_Missense_Mutation_p.V577M|Metazoa_SRP_ENST00000607098.1_RNA|DIP2A_ENST00000466639.1_Missense_Mutation_p.V534M|DIP2A_ENST00000435722.3_Missense_Mutation_p.V577M			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	577					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CAGGATGCACGTGGTCAGCGT	0.547																																						dbGAP											0													106.0	110.0	108.0					21																	47957380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.1729G>A	21.37:g.47957380G>A	ENSP00000392066:p.Val577Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.V578M	ENST00000417564.2	37	c.1732	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454597	0.84209	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.44	5.44	0.79542	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.74007	0.3660	M	0.86502	2.82	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;0.996;1.0;0.99	D;D;D;D;D;P	0.91635	0.909;0.986;0.999;0.955;0.967;0.815	T	0.78216	-0.2290	10	0.62326	D	0.03	-27.7728	18.2394	0.89961	0.0:0.0:1.0:0.0	.	578;513;534;577;577;577	E9PER1;E7EMA5;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;.;DIP2A_HUMAN;.;.	M	573;513;578;534;577;534;577;577	ENSP00000383133:V573M;ENSP00000400528:V513M;ENSP00000323633:V578M;ENSP00000393434:V577M;ENSP00000430249:V534M;ENSP00000415089:V577M;ENSP00000392066:V577M	ENSP00000323633:V578M	V	+	1	0	DIP2A	46781808	1.000000	0.71417	0.270000	0.24601	0.620000	0.37586	4.832000	0.62759	2.554000	0.86153	0.591000	0.81541	GTG	DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.547	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	88	0.00	0	G	NM_015151		47957380	47957380	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.998	A
DIP2B	57609	genome.wustl.edu	37	12	51127933	51127933	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:51127933G>A	ENST00000301180.5	+	33	4031	c.3997G>A	c.(3997-3999)Gat>Aat	p.D1333N		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1333						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CTCAGGGCCTGATCCGACTAC	0.348																																						dbGAP											0													237.0	211.0	220.0					12																	51127933		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.3997G>A	12.37:g.51127933G>A	ENSP00000301180:p.Asp1333Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.D1333N	ENST00000301180.5	37	c.3997	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.463398	0.96257	.	.	ENSG00000066084	ENST00000301180	T	0.10668	2.85	5.18	5.18	0.71444	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.30510	0.0767	L	0.55743	1.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00180	-1.1948	10	0.44086	T	0.13	-17.2538	19.2659	0.93985	0.0:0.0:1.0:0.0	.	1333	Q9P265	DIP2B_HUMAN	N	1333	ENSP00000301180:D1333N	ENSP00000301180:D1333N	D	+	1	0	DIP2B	49414200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.616000	0.98359	2.854000	0.98071	0.655000	0.94253	GAT	DIP2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066084		0.348	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	149	0.00	0	G	NM_173602		51127933	51127933	+1	no_errors	ENST00000301180	ensembl	human	known	69_37n	missense	72	17.24	15	SNP	1.000	A
DNAJC3	5611	genome.wustl.edu	37	13	96438207	96438207	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:96438207G>A	ENST00000602402.1	+	10	1207	c.1090G>A	c.(1090-1092)Gaa>Aaa	p.E364K	DNAJC3_ENST00000376795.6_Missense_Mutation_p.E313K	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	364					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)	p.D362_Q367delDYETAQ(1)		NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			TCAGGATTATGAAACTGCTCA	0.313																																						dbGAP											1	Deletion - In frame(1)	kidney(1)											46.0	47.0	47.0					13																	96438207		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.1090G>A	13.37:g.96438207G>A	ENSP00000473631:p.Glu364Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WT9|Q8N4N2	Missense_Mutation	SNP	pfam_TPR-1,pfam_DnaJ_N,smart_TPR_repeat,smart_DnaJ_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.E364K	ENST00000602402.1	37	c.1090	CCDS9479.1	13	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676549	0.47886	.	.	ENSG00000102580	ENST00000376795	.	.	.	5.38	5.38	0.77491	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.092196	0.64402	D	0.000001	T	0.50752	0.1634	N	0.25031	0.7	0.80722	D	1	B;B	0.15473	0.013;0.013	B;B	0.15870	0.014;0.014	T	0.39961	-0.9588	9	0.22706	T	0.39	-6.1701	19.4906	0.95048	0.0:0.0:1.0:0.0	.	364;364	A8KA82;Q13217	.;DNJC3_HUMAN	K	364	.	ENSP00000365991:E364K	E	+	1	0	DNAJC3	95236208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.146000	0.77373	2.673000	0.90976	0.655000	0.94253	GAA	DNAJC3	-	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000102580		0.313	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC3	HGNC	protein_coding	OTTHUMT00000045504.3	49	0.00	0	G			96438207	96438207	+1	no_errors	ENST00000376795	ensembl	human	known	69_37n	missense	82	18.10	19	SNP	1.000	A
DOCK9	23348	genome.wustl.edu	37	13	99481583	99481583	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:99481583delA	ENST00000376460.1	-	43	4954	c.4874delT	c.(4873-4875)gtcfs	p.V1625fs	DOCK9_ENST00000448493.2_3'UTR|DOCK9-AS1_ENST00000439367.1_RNA|DOCK9_ENST00000339416.2_Frame_Shift_Del_p.V1626fs	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1626	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCCATTTTTGACATGGATCCT	0.532																																						dbGAP											0													49.0	47.0	47.0					13																	99481583		1984	4174	6158	-	-	-	SO:0001589	frameshift_variant	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4874delT	13.37:g.99481583delA	ENSP00000365643:p.Val1625fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Frame_Shift_Del	DEL	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V1626fs	ENST00000376460.1	37	c.4877	CCDS45062.1	13																																																																																			DOCK9	-	NULL	ENSG00000088387		0.532	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	36	0.00	0	A	NM_015296		99481583	99481583	-1	no_errors	ENST00000339416	ensembl	human	known	69_37n	frame_shift_del	49	44.68	42	DEL	1.000	-
DPY19L4	286148	genome.wustl.edu	37	8	95782692	95782692	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:95782692G>A	ENST00000414645.2	+	13	1446	c.1347G>A	c.(1345-1347)ctG>ctA	p.L449L		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	449						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					GTAAGTCCCTGAAGGAAACTG	0.294																																						dbGAP											0													85.0	88.0	87.0					8																	95782692		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.1347G>A	8.37:g.95782692G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	pfam_Dpy-19	p.E249K	ENST00000414645.2	37	c.745	CCDS34924.1	8	.	.	.	.	.	.	.	.	.	.	G	1.134	-0.651669	0.03506	.	.	ENSG00000156162	ENST00000523020	.	.	.	5.55	2.27	0.28462	.	.	.	.	.	T	0.57858	0.2082	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52525	-0.8564	4	.	.	.	7.3488	8.9554	0.35814	0.1453:0.2305:0.6242:0.0	.	.	.	.	K	249	.	.	E	+	1	0	DPY19L4	95851868	1.000000	0.71417	0.771000	0.31576	0.254000	0.26022	2.547000	0.45786	0.685000	0.31468	0.467000	0.42956	GAA	DPY19L4	-	pfam_Dpy-19	ENSG00000156162		0.294	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L4	HGNC	protein_coding	OTTHUMT00000379339.1	90	0.00	0	G	NM_181787		95782692	95782692	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000523020	ensembl	human	novel	69_37n	missense	82	34.65	44	SNP	0.981	A
EFHC2	80258	genome.wustl.edu	37	X	44109464	44109464	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:44109464G>T	ENST00000420999.1	-	5	917	c.834C>A	c.(832-834)ttC>ttA	p.F278L		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	278	DM10 2. {ECO:0000255|PROSITE- ProRule:PRU00665}.						calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						TCCTCCGGAGGAACATTTTTA	0.428																																						dbGAP											0													64.0	55.0	58.0					X																	44109464		1926	4128	6054	-	-	-	SO:0001583	missense	0			AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.834C>A	X.37:g.44109464G>T	ENSP00000404232:p.Phe278Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	pfam_DUF1126,smart_Uncharacterised_DM10,pfscan_EF_HAND_2	p.F278L	ENST00000420999.1	37	c.834	CCDS55405.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.02|13.02	2.112533|2.112533	0.37242|0.37242	.|.	.|.	ENSG00000183690|ENSG00000183690	ENST00000333807;ENST00000420999;ENST00000378056|ENST00000441230	T;T|.	0.57107|.	0.42;0.42|.	5.26|5.26	1.54|1.54	0.23209|0.23209	Uncharacterised domain DM10 (2);|.	0.108901|.	0.64402|.	N|.	0.000005|.	T|T	0.40694|0.40694	0.1127|0.1127	L|L	0.29908|0.29908	0.895|0.895	0.54753|0.54753	D|D	0.999988|0.999988	P|.	0.44877|.	0.845|.	P|.	0.48654|.	0.585|.	T|T	0.07712|0.07712	-1.0758|-1.0758	10|5	0.09843|.	T|.	0.71|.	-10.1834|-10.1834	6.477|6.477	0.22041|0.22041	0.3511:0.1171:0.5318:0.0|0.3511:0.1171:0.5318:0.0	.|.	278|.	Q5JST6|.	EFHC2_HUMAN|.	L|T	278;306;82|259	ENSP00000333823:F278L;ENSP00000404232:F306L|.	ENSP00000333823:F278L|.	F|P	-|-	3|1	2|0	EFHC2|EFHC2	43994408|43994408	1.000000|1.000000	0.71417|0.71417	0.763000|0.763000	0.31416|0.31416	0.275000|0.275000	0.26752|0.26752	0.664000|0.664000	0.25068|0.25068	-0.120000|-0.120000	0.11809|0.11809	-0.305000|-0.305000	0.09177|0.09177	TTC|CCT	EFHC2	-	pfam_DUF1126,smart_Uncharacterised_DM10	ENSG00000183690		0.428	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	EFHC2	HGNC	protein_coding	OTTHUMT00000056312.2	51	0.00	0	G	NM_025184		44109464	44109464	-1	no_errors	ENST00000333807	ensembl	human	known	69_37n	missense	62	15.07	11	SNP	0.998	T
ELP3	55140	genome.wustl.edu	37	8	27989918	27989918	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:27989918C>T	ENST00000256398.8	+	9	1280	c.903C>T	c.(901-903)ttC>ttT	p.F301F	ELP3_ENST00000521015.1_Silent_p.F287F|ELP3_ENST00000524103.1_Silent_p.F229F|ELP3_ENST00000542181.1_Silent_p.F172F|ELP3_ENST00000537665.1_Silent_p.F182F|ELP3_ENST00000380353.4_Silent_p.F209F	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3	301					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		TTGAACAGTTCACAGTAAGTG	0.463																																						dbGAP											0													98.0	80.0	86.0					8																	27989918		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.903C>T	8.37:g.27989918C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Silent	SNP	pfam_rSAM,pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,smart_Elp3/MiaB/NifB,pirsf_Hist_AcTrfase_ELP3,pfscan_GNAT_dom,tigrfam_Hist_AcTrfase_ELP3	p.F301	ENST00000256398.8	37	c.903	CCDS6065.1	8																																																																																			ELP3	-	smart_Elp3/MiaB/NifB,pirsf_Hist_AcTrfase_ELP3,tigrfam_Hist_AcTrfase_ELP3	ENSG00000134014		0.463	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP3	HGNC	protein_coding	OTTHUMT00000219963.2	116	0.00	0	C	NM_018091		27989918	27989918	+1	no_errors	ENST00000256398	ensembl	human	known	69_37n	silent	76	16.48	15	SNP	0.960	T
ERCC4	2072	genome.wustl.edu	37	16	14041640	14041640	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr16:14041640C>T	ENST00000311895.7	+	11	2196	c.2187C>T	c.(2185-2187)atC>atT	p.I729I		NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	729	ERCC4.|Nuclease.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						GCAAGAGTATCAGTGATTTAA	0.498			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	0													88.0	86.0	87.0					16																	14041640		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.2187C>T	16.37:g.14041640C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV6|A8K111|O00140|Q8TD83	Silent	SNP	pfam_ERCC4_domain,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_ERCC4_domain,tigrfam_Rad1	p.I729	ENST00000311895.7	37	c.2187	CCDS32390.1	16																																																																																			ERCC4	-	pfam_ERCC4_domain,superfamily_Restrct_endonuc-II-like,smart_ERCC4_domain,tigrfam_Rad1	ENSG00000175595		0.498	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC4	HGNC	protein_coding	OTTHUMT00000109634.2	87	0.00	0	C	NM_005236		14041640	14041640	+1	no_errors	ENST00000311895	ensembl	human	known	69_37n	silent	80	17.17	17	SNP	1.000	T
ERCC6L	54821	genome.wustl.edu	37	X	71425689	71425689	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:71425689C>G	ENST00000334463.3	-	2	3063	c.2928G>C	c.(2926-2928)gaG>gaC	p.E976D	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Missense_Mutation_p.E853D	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	976					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					TATTTTCTTTCTCAACATGCT	0.413																																						dbGAP											0													78.0	76.0	77.0					X																	71425689		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.2928G>C	X.37:g.71425689C>G	ENSP00000334675:p.Glu976Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_TPR-contain_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E976D	ENST00000334463.3	37	c.2928	CCDS35329.1	X	.	.	.	.	.	.	.	.	.	.	C	9.894	1.204896	0.22205	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.92858	-3.08;-3.12	5.58	-0.452	0.12205	.	.	.	.	.	D	0.89347	0.6689	M	0.64997	1.995	0.09310	N	1	P	0.46987	0.888	P	0.44561	0.453	T	0.80850	-0.1198	9	0.62326	D	0.03	-2.5996	5.5478	0.17073	0.0:0.3581:0.1434:0.4985	.	976	Q2NKX8	ERC6L_HUMAN	D	853;976	ENSP00000362761:E853D;ENSP00000334675:E976D	ENSP00000334675:E976D	E	-	3	2	ERCC6L	71342414	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.188000	0.09642	-0.061000	0.13110	-0.197000	0.12766	GAG	ERCC6L	-	NULL	ENSG00000186871		0.413	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6L	HGNC	protein_coding	OTTHUMT00000057174.2	171	0.00	0	C	NM_017669		71425689	71425689	-1	no_errors	ENST00000334463	ensembl	human	known	69_37n	missense	51	39.29	33	SNP	0.000	G
F9	2158	genome.wustl.edu	37	X	138630621	138630621	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:138630621C>T	ENST00000218099.2	+	5	498	c.491C>T	c.(490-492)gCa>gTa	p.A164V	F9_ENST00000394090.2_Missense_Mutation_p.A126V	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	164	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	TATCGACTTGCAGAAAACCAG	0.363																																						dbGAP											0			GRCh37	CM045773	F9	M							136.0	117.0	123.0					X																	138630621		2203	4300	6503	-	-	-	SO:0001583	missense	0			M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.491C>T	X.37:g.138630621C>T	ENSP00000218099:p.Ala164Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_GLA_domain,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Peptidase_S1_S6,pirsf_Pept_S1A_FX,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A,prints_GLA_domain	p.A164V	ENST00000218099.2	37	c.491	CCDS14666.1	X	.	.	.	.	.	.	.	.	.	.	C	13.14	2.147630	0.37923	.	.	ENSG00000101981	ENST00000218099;ENST00000394090	D;D	0.96856	-4.15;-4.15	5.08	4.15	0.48705	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.486098	0.20990	N	0.082044	D	0.95367	0.8496	M	0.76938	2.355	0.45318	D	0.998312	P;D	0.55605	0.745;0.972	B;B	0.43623	0.164;0.425	D	0.94730	0.7909	9	.	.	.	.	11.8696	0.52513	0.0:0.8265:0.1735:0.0	.	126;164	Q5FBE1;P00740	.;FA9_HUMAN	V	164;126	ENSP00000218099:A164V;ENSP00000377650:A126V	.	A	+	2	0	F9	138458287	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	2.165000	0.42396	2.242000	0.73789	0.544000	0.68410	GCA	F9	-	smart_EGF-like,pirsf_Pept_S1A_FX	ENSG00000101981		0.363	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F9	HGNC	protein_coding	OTTHUMT00000058557.1	206	0.00	0	C			138630621	138630621	+1	no_errors	ENST00000218099	ensembl	human	known	69_37n	missense	169	33.33	87	SNP	1.000	T
FAM13A	10144	genome.wustl.edu	37	4	89726164	89726164	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr4:89726164C>G	ENST00000264344.5	-	8	1254	c.1047G>C	c.(1045-1047)ttG>ttC	p.L349F	FAM13A_ENST00000508369.1_Missense_Mutation_p.L23F|FAM13A_ENST00000513837.1_Intron|FAM13A_ENST00000395002.2_Missense_Mutation_p.L23F|FAM13A_ENST00000511976.1_Intron|FAM13A_ENST00000502459.1_5'UTR|FAM13A_ENST00000503556.1_Intron	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	349					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						ATAAATACCTCAAATAGAAAG	0.299																																						dbGAP											0													43.0	41.0	42.0					4																	89726164		2200	4299	6499	-	-	-	SO:0001583	missense	0			AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.1047G>C	4.37:g.89726164C>G	ENSP00000264344:p.Leu349Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L349F	ENST00000264344.5	37	c.1047	CCDS34029.1	4	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348461	0.41599	.	.	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000508369	T;T;T	0.65916	-0.18;-0.18;-0.18	4.99	2.03	0.26663	.	0.282600	0.26859	N	0.022126	T	0.43634	0.1256	L	0.27053	0.805	0.80722	D	1	P;P;P	0.45902	0.868;0.773;0.773	B;B;B	0.42319	0.383;0.277;0.369	T	0.28235	-1.0050	10	0.48119	T	0.1	.	4.0535	0.09806	0.0:0.5854:0.1973:0.2173	.	349;23;23	O94988;O94988-3;O94988-1	FA13A_HUMAN;.;.	F	23;349;23	ENSP00000378450:L23F;ENSP00000264344:L349F;ENSP00000421562:L23F	ENSP00000264344:L349F	L	-	3	2	FAM13A	89945187	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.818000	0.27295	0.661000	0.30985	-0.157000	0.13467	TTG	FAM13A	-	NULL	ENSG00000138640		0.299	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13A	HGNC	protein_coding	OTTHUMT00000363371.1	123	0.00	0	C			89726164	89726164	-1	no_errors	ENST00000264344	ensembl	human	known	69_37n	missense	86	47.27	78	SNP	1.000	G
FAM157B	100132403	genome.wustl.edu	37	9	141109849	141109849	+	lincRNA	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:141109849C>T	ENST00000446912.2	+	0	163							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CCTACATGACCTTCATCTGCT	0.567																																						dbGAP											0													56.0	60.0	59.0					9																	141109849		692	1591	2283	-	-	-			0					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141109849C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			FAM157B	-	-	ENSG00000233013		0.567	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	90	0.00	0	C	NM_001145249		141109849	141109849	+1	no_errors	ENST00000540522	ensembl	human	known	69_37n	rna	62	26.74	23	SNP	0.029	T
MTFR2	113115	genome.wustl.edu	37	6	136560810	136560810	+	Silent	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:136560810G>C	ENST00000420702.1	-	6	1052	c.663C>G	c.(661-663)ctC>ctG	p.L221L	MTFR2_ENST00000451457.2_Silent_p.L221L	NM_001099286.1	NP_001092756.1	Q6P444	MTFR2_HUMAN	mitochondrial fission regulator 2	221	Pro-rich.				aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	mitochondrion (GO:0005739)											ACGGTGGCTGGAGAGATGAAA	0.502																																						dbGAP											0													74.0	68.0	70.0					6																	136560810		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011716	CCDS5176.1	6q23.2	2012-11-30	2012-11-29	2012-11-29	ENSG00000146410	ENSG00000146410			21115	protein-coding gene	gene with protein product			"""DUF729 domain containing 1"", ""family with sequence similarity 54, member A"""	DUFD1, FAM54A			Standard	NM_138419		Approved		uc003qgt.1	Q6P444	OTTHUMG00000015643	ENST00000420702.1:c.663C>G	6.37:g.136560810G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8D8|E1P585|Q5JWR7|Q6ZUE8|Q7L3U6|Q9BZ39	Silent	SNP	pfam_Mtfr1	p.L221	ENST00000420702.1	37	c.663	CCDS5176.1	6																																																																																			FAM54A	-	pfam_Mtfr1	ENSG00000146410		0.502	MTFR2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM54A	HGNC	protein_coding	OTTHUMT00000042378.2	159	0.00	0	G	NM_138419		136560810	136560810	-1	no_errors	ENST00000420702	ensembl	human	known	69_37n	silent	115	29.01	47	SNP	0.000	C
FBXW11	23291	genome.wustl.edu	37	5	171295750	171295750	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr5:171295750G>A	ENST00000265094.5	-	12	1655	c.1518C>T	c.(1516-1518)atC>atT	p.I506I	FBXW11_ENST00000296933.6_Silent_p.I493I|FBXW11_ENST00000393802.2_Silent_p.I472I|FBXW11_ENST00000425623.2_Silent_p.I474I	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	506					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGAGCTGCTGATGATCTGAA	0.423																																						dbGAP											0													95.0	88.0	91.0					5																	171295750		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.1518C>T	5.37:g.171295750G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Silent	SNP	pfam_WD40_repeat,pfam_Beta-TrCP_D,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I506	ENST00000265094.5	37	c.1518	CCDS34289.1	5																																																																																			FBXW11	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000072803		0.423	FBXW11-002	KNOWN	basic|CCDS	protein_coding	FBXW11	HGNC	protein_coding	OTTHUMT00000372382.1	172	0.00	0	G	NM_012300		171295750	171295750	-1	no_errors	ENST00000265094	ensembl	human	known	69_37n	silent	110	19.29	27	SNP	1.000	A
FBXW2	26190	genome.wustl.edu	37	9	123533674	123533674	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:123533674G>A	ENST00000608872.1	-	7	1215	c.1028C>T	c.(1027-1029)tCa>tTa	p.S343L	FBXW2_ENST00000493559.1_5'UTR|FBXW2_ENST00000340778.5_Missense_Mutation_p.S278L	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	343					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						ACCAAGTGCTGAACTACAGAC	0.428																																						dbGAP											0													99.0	91.0	93.0					9																	123533674		1907	4127	6034	-	-	-	SO:0001583	missense	0			AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.1028C>T	9.37:g.123533674G>A	ENSP00000476369:p.Ser343Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S343L	ENST00000608872.1	37	c.1028	CCDS43872.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.748629	0.96882	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.25912	1.77;1.77	5.77	5.77	0.91146	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.060373	0.64402	D	0.000001	T	0.52370	0.1730	M	0.75085	2.285	0.80722	D	1	D;D;D	0.57899	0.981;0.981;0.981	D;D;D	0.67231	0.943;0.95;0.95	T	0.51639	-0.8680	10	0.87932	D	0	-4.9971	17.8518	0.88748	0.0:0.0:1.0:0.0	.	278;343;343	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	L	343;278;343	ENSP00000363036:S343L;ENSP00000341161:S278L	ENSP00000341161:S278L	S	-	2	0	FBXW2	122573495	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	TCA	FBXW2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000119402		0.428	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW2	HGNC	protein_coding	OTTHUMT00000053834.2	152	0.00	0	G			123533674	123533674	-1	no_errors	ENST00000373926	ensembl	human	known	69_37n	missense	51	35.80	29	SNP	1.000	A
FEM1A	55527	genome.wustl.edu	37	19	4793216	4793216	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:4793216C>T	ENST00000269856.3	+	1	1489	c.1350C>T	c.(1348-1350)gcC>gcT	p.A450A	AC005523.2_ENST00000596170.1_RNA|AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000601192.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	450					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		AGGACCGGGCCGCCAAAGGCA	0.637																																						dbGAP											0													82.0	93.0	89.0					19																	4793216		2202	4293	6495	-	-	-	SO:0001819	synonymous_variant	0			BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.1350C>T	19.37:g.4793216C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A450	ENST00000269856.3	37	c.1350	CCDS12135.1	19																																																																																			FEM1A	-	NULL	ENSG00000141965		0.637	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEM1A	HGNC	protein_coding	OTTHUMT00000459000.1	20	0.00	0	C			4793216	4793216	+1	no_errors	ENST00000269856	ensembl	human	known	69_37n	silent	10	44.44	8	SNP	0.101	T
FERMT3	83706	genome.wustl.edu	37	11	63986822	63986822	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:63986822G>A	ENST00000279227.5	+	7	981	c.886G>A	c.(886-888)Gcc>Acc	p.A296T	FERMT3_ENST00000345728.5_Missense_Mutation_p.A296T	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	296	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						GGTGTTTGCCGCCCTGCAGGT	0.672																																						dbGAP											0													31.0	29.0	30.0					11																	63986822		2199	4295	6494	-	-	-	SO:0001583	missense	0			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.886G>A	11.37:g.63986822G>A	ENSP00000279227:p.Ala296Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	pfam_FERM_central,pfam_Pleckstrin_homology,superfamily_FERM_central,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A296T	ENST00000279227.5	37	c.886	CCDS8060.1	11	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655242	0.67472	.	.	ENSG00000149781	ENST00000345728;ENST00000279227	D;D	0.86432	-2.12;-2.12	5.18	4.26	0.50523	Band 4.1 domain (1);FERM central domain (2);	0.000000	0.85682	D	0.000000	D	0.91848	0.7420	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.91635	0.557;0.999	D	0.91123	0.4931	9	.	.	.	-20.0288	12.4383	0.55612	0.0836:0.0:0.9164:0.0	.	296;296	Q86UX7-2;Q86UX7	.;URP2_HUMAN	T	296	ENSP00000339950:A296T;ENSP00000279227:A296T	.	A	+	1	0	FERMT3	63743398	1.000000	0.71417	0.897000	0.35233	0.022000	0.10575	7.644000	0.83416	2.595000	0.87683	0.655000	0.94253	GCC	FERMT3	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain	ENSG00000149781		0.672	FERMT3-001	KNOWN	basic|CCDS	protein_coding	FERMT3	HGNC	protein_coding	OTTHUMT00000396297.1	30	0.00	0	G	NM_031471		63986822	63986822	+1	no_errors	ENST00000279227	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	0.998	A
FRMD4A	55691	genome.wustl.edu	37	10	13743360	13743360	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr10:13743360G>A	ENST00000357447.2	-	14	1323	c.955C>T	c.(955-957)Ctg>Ttg	p.L319L	FRMD4A_ENST00000378503.1_Silent_p.L319L|FRMD4A_ENST00000358621.4_Silent_p.L304L|FRMD4A_ENST00000492155.1_5'UTR|FRMD4A_ENST00000342409.2_Silent_p.L335L	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	319	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TTTCTGTCCAGATAGAACTGG	0.542																																						dbGAP											0													222.0	168.0	187.0					10																	13743360		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.955C>T	10.37:g.13743360G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	Silent	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.L319	ENST00000357447.2	37	c.955	CCDS7101.1	10																																																																																			FRMD4A	-	pfam_FERM_PH-like_C,pfscan_FERM_domain	ENSG00000151474		0.542	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	138	0.00	0	G	NM_018027		13743360	13743360	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	silent	74	15.91	14	SNP	1.000	A
GCM2	9247	genome.wustl.edu	37	6	10874552	10874552	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:10874552C>A	ENST00000379491.4	-	5	1344	c.1197G>T	c.(1195-1197)atG>atT	p.M399I	SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	399					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CACTGTATTTCATAGCAGGGG	0.552																																						dbGAP											0													124.0	120.0	121.0					6																	10874552		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.1197G>T	6.37:g.10874552C>A	ENSP00000368805:p.Met399Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3GDV6|Q5THN5	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.M399I	ENST00000379491.4	37	c.1197	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	C	8.141	0.785280	0.16189	.	.	ENSG00000124827	ENST00000379491	T	0.65916	-0.18	5.61	3.75	0.43078	.	0.849312	0.10435	N	0.674988	T	0.29556	0.0737	N	0.14661	0.345	0.39813	D	0.972733	B	0.02656	0.0	B	0.01281	0.0	T	0.11421	-1.0588	10	0.48119	T	0.1	-0.1649	11.9676	0.53044	0.0:0.8078:0.1239:0.0684	.	399	O75603	GCM2_HUMAN	I	399	ENSP00000368805:M399I	ENSP00000368805:M399I	M	-	3	0	GCM2	10982538	0.984000	0.35163	0.005000	0.12908	0.251000	0.25915	1.276000	0.33156	1.447000	0.47661	0.655000	0.94253	ATG	GCM2	-	NULL	ENSG00000124827		0.552	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	138	0.72	1	C			10874552	10874552	-1	no_errors	ENST00000379491	ensembl	human	known	69_37n	missense	233	17.99	52	SNP	0.500	A
GLI2	2736	genome.wustl.edu	37	2	121708875	121708875	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:121708875delC	ENST00000452319.1	+	4	371	c.311delC	c.(310-312)tccfs	p.S104fs	GLI2_ENST00000361492.4_Frame_Shift_Del_p.S104fs|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				ATCCGGCTTTCCCCGCACCCG	0.652																																						dbGAP											0													88.0	98.0	94.0					2																	121708875		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.311delC	2.37:g.121708875delC	ENSP00000390436:p.Ser104fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P105fs	ENST00000452319.1	37	c.311	CCDS33283.1	2																																																																																			GLI2	-	NULL	ENSG00000074047		0.652	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	HGNC	protein_coding	OTTHUMT00000332293.3	18	0.00	0	C	NM_005270		121708875	121708875	+1	no_errors	ENST00000361492	ensembl	human	known	69_37n	frame_shift_del	25	10.71	3	DEL	1.000	-
GOLGA1	2800	genome.wustl.edu	37	9	127674285	127674285	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:127674285C>T	ENST00000373555.4	-	11	1197	c.864G>A	c.(862-864)gaG>gaA	p.E288E		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	288					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						CGTCTTCTTTCTCTTGAGTTT	0.438																																						dbGAP											0													187.0	169.0	175.0					9																	127674285		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.864G>A	9.37:g.127674285C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T164|Q8IYZ9	Silent	SNP	pfam_GRIP,superfamily_Prefoldin,superfamily_GRIP,smart_GRIP,pfscan_GRIP	p.E288	ENST00000373555.4	37	c.864	CCDS6860.1	9																																																																																			GOLGA1	-	superfamily_Prefoldin	ENSG00000136935		0.438	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA1	HGNC	protein_coding	OTTHUMT00000054049.1	264	0.00	0	C	NM_002077		127674285	127674285	-1	no_errors	ENST00000373555	ensembl	human	known	69_37n	silent	128	36.00	72	SNP	0.976	T
GPR39	2863	genome.wustl.edu	37	2	133174867	133174867	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:133174867C>T	ENST00000329321.3	+	1	721	c.252C>T	c.(250-252)ctC>ctT	p.L84L		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	84					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGGTGTTCCTCATCGGCATGC	0.547																																						dbGAP											0													242.0	219.0	227.0					2																	133174867		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.252C>T	2.37:g.133174867C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.L84	ENST00000329321.3	37	c.252	CCDS2170.1	2																																																																																			GPR39	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000183840		0.547	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	142	0.00	0	C			133174867	133174867	+1	no_errors	ENST00000329321	ensembl	human	known	69_37n	silent	77	16.84	16	SNP	0.994	T
GRIA3	2892	genome.wustl.edu	37	X	122532572	122532572	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:122532572G>T	ENST00000371251.1	+	7	1050	c.998G>T	c.(997-999)cGg>cTg	p.R333L	GRIA3_ENST00000541091.1_Missense_Mutation_p.R317L|GRIA3_ENST00000542149.1_Missense_Mutation_p.R333L|GRIA3_ENST00000264357.5_Missense_Mutation_p.R333L|GRIA3_ENST00000371256.5_Missense_Mutation_p.R333L			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	333					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.R333Q(3)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GATGTGTCCCGGAGAGGAAGT	0.483																																						dbGAP											3	Substitution - Missense(3)	lung(3)											112.0	87.0	95.0					X																	122532572		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.998G>T	X.37:g.122532572G>T	ENSP00000360297:p.Arg333Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R333L	ENST00000371251.1	37	c.998	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517216	0.85495	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	5.93	5.93	0.95920	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89996	0.6877	M	0.62266	1.93	0.80722	D	1	P;D;D	0.67145	0.826;0.996;0.996	P;D;D	0.71656	0.463;0.974;0.956	D	0.90622	0.4560	10	0.87932	D	0	.	18.0905	0.89474	0.0:0.0:1.0:0.0	.	317;333;333	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	L	333;333;333;333;317	ENSP00000264357:R333L;ENSP00000446146:R333L;ENSP00000360302:R333L;ENSP00000360297:R333L;ENSP00000446440:R317L	ENSP00000264357:R333L	R	+	2	0	GRIA3	122360253	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.827000	0.99397	2.494000	0.84150	0.600000	0.82982	CGG	GRIA3	-	pfam_ANF_lig-bd_rcpt	ENSG00000125675		0.483	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	100	0.00	0	G	NM_000828		122532572	122532572	+1	no_errors	ENST00000264357	ensembl	human	known	69_37n	missense	84	21.10	23	SNP	1.000	T
GRID1	2894	genome.wustl.edu	37	10	87615921	87615922	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr10:87615921_87615922insTG	ENST00000327946.7	-	7	1062_1063	c.977_978insCA	c.(976-978)agtfs	p.S326fs		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	326					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GCATCAGAACACTGTCATACAG	0.505										Multiple Myeloma(13;0.14)																												dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.977_978insCA	10.37:g.87615921_87615922insTG	ENSP00000330148:p.Ser326fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXD5|B7Z7L0|Q8IXT3	Frame_Shift_Ins	INS	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V327fs	ENST00000327946.7	37	c.978_977	CCDS31236.1	10																																																																																			GRID1	-	pfam_ANF_lig-bd_rcpt	ENSG00000182771		0.505	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	62	0.00	0	-	XM_043613		87615921	87615922	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	frame_shift_ins	70	24.73	23	INS	0.999:1.000	TG
GRIN2B	2904	genome.wustl.edu	37	12	14018978	14018978	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:14018978C>T	ENST00000609686.1	-	2	374	c.165G>A	c.(163-165)gaG>gaA	p.E55E		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	55					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AATCATCTTTCTCGTGGGCAT	0.567																																						dbGAP											0													132.0	120.0	124.0					12																	14018978		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.165G>A	12.37:g.14018978C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E55	ENST00000609686.1	37	c.165	CCDS8662.1	12																																																																																			GRIN2B	-	NULL	ENSG00000150086		0.567	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	111	0.00	0	C			14018978	14018978	-1	no_errors	ENST00000279593	ensembl	human	known	69_37n	silent	97	37.89	61	SNP	1.000	T
GRIN2C	2905	genome.wustl.edu	37	17	72850861	72850861	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:72850861C>G	ENST00000293190.5	-	2	517	c.371G>C	c.(370-372)gGa>gCa	p.G124A	GRIN2C_ENST00000347612.4_Missense_Mutation_p.G124A|GRIN2C_ENST00000578159.1_Intron	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	124					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGCAGAGCCTCCGCTGATGCT	0.612																																						dbGAP											0													70.0	68.0	69.0					17																	72850861		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.371G>C	17.37:g.72850861C>G	ENSP00000293190:p.Gly124Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,pfam_NMDAR2_C,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G124A	ENST00000293190.5	37	c.371	CCDS32724.1	17	.	.	.	.	.	.	.	.	.	.	C	10.66	1.411709	0.25465	.	.	ENSG00000161509	ENST00000293190;ENST00000347612	T	0.17528	2.27	4.63	4.63	0.57726	Extracellular ligand-binding receptor (1);	0.129405	0.51477	D	0.000082	T	0.43500	0.1250	M	0.75615	2.305	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.36890	-0.9729	10	0.48119	T	0.1	.	17.6869	0.88258	0.0:1.0:0.0:0.0	.	124;158;124	Q6PCC5;Q8IW23;Q14957	.;.;NMDE3_HUMAN	A	124;158	ENSP00000293190:G124A	ENSP00000293190:G124A	G	-	2	0	GRIN2C	70362456	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	7.578000	0.82498	2.404000	0.81709	0.650000	0.86243	GGA	GRIN2C	-	pfam_ANF_lig-bd_rcpt	ENSG00000161509		0.612	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2C	HGNC	protein_coding	OTTHUMT00000103824.1	71	0.00	0	C			72850861	72850861	-1	no_errors	ENST00000293190	ensembl	human	known	69_37n	missense	47	20.63	13	SNP	1.000	G
GTF2E2	2961	genome.wustl.edu	37	8	30472233	30472233	+	Splice_Site	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:30472233C>T	ENST00000355904.4	-	4	541		c.e4-1		GTF2E2_ENST00000522833.1_5'Flank	NM_002095.4	NP_002086.1	P29084	T2EB_HUMAN	general transcription factor IIE, polypeptide 2, beta 34kDa						gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIE complex (GO:0005673)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.113)|Kidney(114;0.135)		GATGCCGTGTCTATCAAGTGA	0.343																																						dbGAP											0													126.0	109.0	115.0					8																	30472233		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC030572	CCDS6078.1	8p12	2010-03-23	2002-08-29		ENSG00000197265	ENSG00000197265		"""General transcription factors"""	4651	protein-coding gene	gene with protein product		189964	"""general transcription factor IIE, polypeptide 2 (beta subunit, 34kD)"""			1956404	Standard	NM_002095		Approved	TFIIE-B, FE, TF2E2	uc003xig.3	P29084	OTTHUMG00000163934	ENST00000355904.4:c.259-1G>A	8.37:g.30472233C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSV2|Q9H2B9	Splice_Site	SNP	-	e3-1	ENST00000355904.4	37	c.259-1	CCDS6078.1	8	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597415	0.66332	.	.	ENSG00000197265	ENST00000355904;ENST00000518599;ENST00000518445	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8061	0.85666	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTF2E2	30591775	1.000000	0.71417	0.977000	0.42913	0.558000	0.35554	7.522000	0.81844	2.562000	0.86427	0.460000	0.39030	.	GTF2E2	-	-	ENSG00000197265		0.343	GTF2E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2E2	HGNC	protein_coding	OTTHUMT00000376459.2	95	0.00	0	C	NM_002095	Intron	30472233	30472233	-1	no_errors	ENST00000355904	ensembl	human	known	69_37n	splice_site	82	27.59	32	SNP	1.000	T
GYG1	2992	genome.wustl.edu	37	3	148727120	148727120	+	Missense_Mutation	SNP	G	G	T	rs370532777		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:148727120G>T	ENST00000345003.4	+	5	839	c.539G>T	c.(538-540)aGa>aTa	p.R180I	GYG1_ENST00000479119.1_3'UTR|GYG1_ENST00000483267.1_Intron|GYG1_ENST00000296048.6_Missense_Mutation_p.R180I|GYG1_ENST00000484197.1_Missense_Mutation_p.R180I	NM_004130.3	NP_004121.2	P46976	GLYG_HUMAN	glycogenin 1	180					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogenin glucosyltransferase activity (GO:0008466)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ACAGATATCAGAAAACACCTG	0.373																																						dbGAP											0													102.0	109.0	107.0					3																	148727120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087942	CCDS3139.1, CCDS54654.1, CCDS54655.1	3q24-q25.1	2013-02-22	2005-11-04	2005-11-04	ENSG00000163754	ENSG00000163754	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4699	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	603942	"""glycogenin"""	GYG		8602861	Standard	NM_004130		Approved		uc003ewn.3	P46976	OTTHUMG00000159533	ENST00000345003.4:c.539G>T	3.37:g.148727120G>T	ENSP00000340736:p.Arg180Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNH0|D3DNH1|D3DNH2|Q6FHZ1|Q9UNV0	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.R180I	ENST00000345003.4	37	c.539	CCDS3139.1	3	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379595	0.42207	.	.	ENSG00000163754	ENST00000345003;ENST00000296048;ENST00000484197;ENST00000461191	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.52	2.71	0.32032	.	0.365346	0.31897	N	0.006881	T	0.19248	0.0462	N	0.12569	0.235	0.38387	D	0.945302	B;B;B	0.29341	0.145;0.02;0.242	B;B;B	0.32211	0.097;0.035;0.142	T	0.07578	-1.0765	10	0.46703	T	0.11	-24.3423	5.9292	0.19130	0.2788:0.1386:0.5825:0.0	.	180;180;180	D3DNH0;P46976-2;P46976	.;.;GLYG_HUMAN	I	180;180;180;176	ENSP00000340736:R180I;ENSP00000296048:R180I;ENSP00000420683:R180I;ENSP00000420247:R176I	ENSP00000296048:R180I	R	+	2	0	GYG1	150209810	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.087000	0.30865	0.667000	0.31107	-0.262000	0.10625	AGA	GYG1	-	pfam_Glyco_trans_8	ENSG00000163754		0.373	GYG1-001	KNOWN	basic|CCDS	protein_coding	GYG1	HGNC	protein_coding	OTTHUMT00000356046.1	147	0.00	0	G	NM_004130		148727120	148727120	+1	no_errors	ENST00000345003	ensembl	human	known	69_37n	missense	173	15.46	32	SNP	1.000	T
HDLBP	3069	genome.wustl.edu	37	2	242178170	242178170	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:242178170G>A	ENST00000391975.1	-	20	2870	c.2643C>T	c.(2641-2643)ccC>ccT	p.P881P	HDLBP_ENST00000427183.2_Silent_p.P848P|HDLBP_ENST00000391976.2_Silent_p.P881P|HDLBP_ENST00000310931.4_Silent_p.P881P	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	881	KH 11. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GGAATTTCTGGGGTATAGCAC	0.428																																						dbGAP											0													209.0	228.0	222.0					2																	242178170		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.2643C>T	2.37:g.242178170G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.P690S	ENST00000391975.1	37	c.2068	CCDS2547.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.43|10.43	1.347018|1.347018	0.24426|0.24426	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000427487|ENST00000373292	T|T	0.51071|0.49432	0.72|0.78	6.05|6.05	5.18|5.18	0.71444|0.71444	.|.	0.095616|0.095616	0.64402|0.64402	D|D	0.000001|0.000001	T|T	0.50837|0.50837	0.1639|0.1639	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.52815|0.52815	-0.8525|-0.8525	7|7	0.87932|0.46703	D|T	0|0.11	-25.186|-25.186	6.1485|6.1485	0.20298|0.20298	0.1511:0.0:0.6595:0.1894|0.1511:0.0:0.6595:0.1894	.|.	.|.	.|.	.|.	L|S	283|690	ENSP00000405180:P283L|ENSP00000362389:P690S	ENSP00000405180:P283L|ENSP00000362389:P690S	P|P	-|-	2|1	0|0	HDLBP|HDLBP	241826843|241826843	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	0.881000|0.881000	0.28173|0.28173	1.579000|1.579000	0.49836|0.49836	0.655000|0.655000	0.94253|0.94253	CCC|CCA	HDLBP	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.428	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	103	0.00	0	G	NM_203346		242178170	242178170	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000373292	ensembl	human	novel	69_37n	missense	68	26.88	25	SNP	1.000	A
HIST1H2BF	8343	genome.wustl.edu	37	6	26200015	26200015	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:26200015G>A	ENST00000359985.1	+	1	268	c.229G>A	c.(229-231)Gag>Aag	p.E77K	HIST1H3D_ENST00000377831.5_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H2AD_ENST00000341023.1_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	77					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E77K(3)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				CATCGCTGGCGAGGCTTCCCG	0.612																																						dbGAP											3	Substitution - Missense(3)	upper_aerodigestive_tract(2)|lung(1)											143.0	137.0	139.0					6																	26200015		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.229G>A	6.37:g.26200015G>A	ENSP00000353074:p.Glu77Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E77K	ENST00000359985.1	37	c.229	CCDS4592.1	6	.	.	.	.	.	.	.	.	.	.	.	20.5	3.992985	0.74703	.	.	ENSG00000197846	ENST00000359985	T	0.34472	1.36	3.89	3.89	0.44902	.	0.000000	0.41823	D	0.000808	T	0.42966	0.1226	.	.	.	0.37925	D	0.931804	.	.	.	.	.	.	T	0.46555	-0.9183	7	0.54805	T	0.06	.	15.7145	0.77658	0.0:0.0:1.0:0.0	.	.	.	.	K	77	ENSP00000353074:E77K	ENSP00000353074:E77K	E	+	1	0	HIST1H2BF	26307994	1.000000	0.71417	0.760000	0.31359	0.006000	0.05464	6.646000	0.74348	2.102000	0.63906	0.650000	0.86243	GAG	HIST1H2BF	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000197846		0.612	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BF	HGNC	protein_coding	OTTHUMT00000040108.1	152	0.00	0	G	NM_003522		26200015	26200015	+1	no_errors	ENST00000359985	ensembl	human	known	69_37n	missense	128	13.33	20	SNP	1.000	A
HIST1H1B	3009	genome.wustl.edu	37	6	27834879	27834879	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:27834879C>G	ENST00000331442.3	-	1	480	c.429G>C	c.(427-429)aaG>aaC	p.K143N		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	143					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						CTGCAGCCTTCTTGGCCTTCT	0.612																																						dbGAP											0													94.0	110.0	105.0					6																	27834879		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.429G>C	6.37:g.27834879C>G	ENSP00000330074:p.Lys143Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14529|Q3MJ42	Missense_Mutation	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.K143N	ENST00000331442.3	37	c.429	CCDS4635.1	6	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507453	0.27036	.	.	ENSG00000184357	ENST00000331442	T	0.23754	1.89	5.19	2.46	0.29980	.	0.532850	0.18618	N	0.135953	T	0.10981	0.0268	N	0.08118	0	0.44937	D	0.997953	D	0.64830	0.994	P	0.56343	0.796	T	0.08659	-1.0711	10	0.34782	T	0.22	-5.6028	10.1548	0.42816	0.0:0.7819:0.0:0.2181	.	143	P16401	H15_HUMAN	N	143	ENSP00000330074:K143N	ENSP00000330074:K143N	K	-	3	2	HIST1H1B	27942858	0.971000	0.33674	0.982000	0.44146	0.136000	0.21042	0.208000	0.17415	0.309000	0.22966	-0.140000	0.14226	AAG	HIST1H1B	-	NULL	ENSG00000184357		0.612	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	HGNC	protein_coding	OTTHUMT00000043371.1	48	0.00	0	C	NM_005322		27834879	27834879	-1	no_errors	ENST00000331442	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	1.000	G
HIST1H2BO	8348	genome.wustl.edu	37	6	27861510	27861510	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:27861510C>T	ENST00000303806.4	+	1	308	c.270C>T	c.(268-270)atC>atT	p.I90I	HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	90					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										GCTCGACCATCACCTCCAGGG	0.627																																						dbGAP											0													76.0	77.0	76.0					6																	27861510		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.270C>T	6.37:g.27861510C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KPI7|Q8TCV6	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.I90	ENST00000303806.4	37	c.270	CCDS4640.1	6																																																																																			HIST1H2BO	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000196331		0.627	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BO	HGNC	protein_coding	OTTHUMT00000040161.1	50	0.00	0	C	NM_003527		27861510	27861510	+1	no_errors	ENST00000303806	ensembl	human	known	69_37n	silent	94	16.81	19	SNP	1.000	T
HNRNPL	3191	genome.wustl.edu	37	19	39329054	39329054	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:39329054C>T	ENST00000221419.5	-	10	1906	c.1540G>A	c.(1540-1542)Gag>Aag	p.E514K	HNRNPL_ENST00000600873.1_Missense_Mutation_p.E381K|AC104534.3_ENST00000594769.1_Silent_p.P130P	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	514	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			AAGTTCTCCTCGGTCACCTCC	0.592																																						dbGAP											0													59.0	51.0	54.0					19																	39329054		2203	4300	6503	-	-	-	SO:0001583	missense	0			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1540G>A	19.37:g.39329054C>T	ENSP00000221419:p.Glu514Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.E514K	ENST00000221419.5	37	c.1540	CCDS33015.1	19	.	.	.	.	.	.	.	.	.	.	C	19.21	3.784252	0.70222	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	.	.	.	5.87	5.87	0.94306	Nucleotide-binding, alpha-beta plait (1);	0.210793	0.48767	D	0.000162	T	0.64238	0.2580	M	0.78049	2.395	0.50171	D	0.999855	P;D;D	0.69078	0.803;0.976;0.997	B;B;B	0.43274	0.043;0.091;0.414	T	0.70978	-0.4725	9	0.66056	D	0.02	.	19.3531	0.94398	0.0:1.0:0.0:0.0	.	514;483;497	P14866;B2R959;Q6NTA2	HNRPL_HUMAN;.;.	K	514;381;381	.	ENSP00000221419:E514K	E	-	1	0	HNRNPL	44020894	0.995000	0.38212	0.974000	0.42286	0.996000	0.88848	4.533000	0.60615	2.941000	0.99782	0.655000	0.94253	GAG	HNRNPL	-	tigrfam_HnRNP-L_PTB	ENSG00000104824		0.592	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPL	HGNC	protein_coding	OTTHUMT00000462670.1	137	0.00	0	C			39329054	39329054	-1	no_errors	ENST00000221419	ensembl	human	known	69_37n	missense	48	18.03	11	SNP	0.991	T
HTT	3064	genome.wustl.edu	37	4	3162104	3162104	+	Silent	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr4:3162104G>T	ENST00000355072.5	+	29	3994	c.3849G>T	c.(3847-3849)ctG>ctT	p.L1283L		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1283					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TGGCCACACTGCAGGACATTG	0.507																																						dbGAP											0													206.0	199.0	201.0					4																	3162104		1981	4119	6100	-	-	-	SO:0001819	synonymous_variant	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3849G>T	4.37:g.3162104G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQB7	Missense_Mutation	SNP	NULL	p.A6S	ENST00000355072.5	37	c.16	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	7.262	0.605409	0.14002	.	.	ENSG00000197386	ENST00000509618	.	.	.	4.27	3.39	0.38822	.	.	.	.	.	T	0.56470	0.1987	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51028	-0.8757	4	.	.	.	.	7.5819	0.27970	0.0:0.1434:0.4668:0.3897	.	.	.	.	S	6	.	.	A	+	1	0	HTT	3131902	0.993000	0.37304	0.997000	0.53966	0.857000	0.48899	0.229000	0.17833	0.855000	0.35359	0.563000	0.77884	GCA	HTT	-	NULL	ENSG00000197386		0.507	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	433	0.00	0	G	NM_002111		3162104	3162104	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000509618	ensembl	human	putative	69_37n	missense	365	15.86	69	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	70993581	70993581	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr16:70993581G>A	ENST00000393567.2	-	39	6261	c.6111C>T	c.(6109-6111)atC>atT	p.I2037I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2037					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGATAATGGCGATGCCTTTCC	0.532																																						dbGAP											0													15.0	49.0	40.0					16																	70993581		1430	3951	5381	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6111C>T	16.37:g.70993581G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.I2036	ENST00000393567.2	37	c.6108	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.532	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	162	0.00	0	G			70993581	70993581	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	silent	93	20.83	25	SNP	0.997	A
IARS	3376	genome.wustl.edu	37	9	95043061	95043061	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:95043061C>T	ENST00000375643.3	-	7	978	c.712G>A	c.(712-714)Gtt>Att	p.V238I	IARS_ENST00000375629.3_5'UTR|IARS_ENST00000447699.2_Missense_Mutation_p.V128I|IARS_ENST00000443024.2_Missense_Mutation_p.V238I	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	238					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	TCTGGATTAACACACACAGCA	0.338																																						dbGAP											0													112.0	106.0	108.0					9																	95043061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.712G>A	9.37:g.95043061C>T	ENSP00000364794:p.Val238Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,prints_Ile-tRNA-synt,tigrfam_Ile-tRNA-synt	p.V238I	ENST00000375643.3	37	c.712	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931074	0.92389	.	.	ENSG00000196305	ENST00000375643;ENST00000443024;ENST00000447699;ENST00000375660;ENST00000395554	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.55	5.55	0.83447	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	M	0.78637	2.42	0.80722	D	1	D;D	0.60575	0.975;0.988	D;P	0.63877	0.919;0.893	T	0.68689	-0.5342	10	0.87932	D	0	-21.9219	18.6371	0.91383	0.0:1.0:0.0:0.0	.	238;83	P41252;Q6P0M4	SYIC_HUMAN;.	I	238;238;128;238;238	ENSP00000364794:V238I;ENSP00000406448:V238I;ENSP00000415020:V128I;ENSP00000378922:V238I	ENSP00000364794:V238I	V	-	1	0	IARS	94082882	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.820000	0.69250	2.773000	0.95371	0.655000	0.94253	GTT	IARS	-	pfam_aa-tRNA-synth_Ia,superfamily_Val/Leu/Ile-tRNA-synth_edit,prints_Ile-tRNA-synt,tigrfam_Ile-tRNA-synt	ENSG00000196305		0.338	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2	116	0.00	0	C	NM_002161		95043061	95043061	-1	no_errors	ENST00000375643	ensembl	human	known	69_37n	missense	130	28.96	53	SNP	1.000	T
IGSF8	93185	genome.wustl.edu	37	1	160063723	160063723	+	Silent	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:160063723G>C	ENST00000368086.1	-	3	897	c.681C>G	c.(679-681)gcC>gcG	p.A227A	IGSF8_ENST00000314485.7_Silent_p.A227A|IGSF8_ENST00000460351.1_5'UTR			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	227	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CAGCCTCCACGGCCAAGTCTG	0.627																																						dbGAP											0													82.0	76.0	78.0					1																	160063723		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.681C>G	1.37:g.160063723G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NG09|Q96DP4|Q9BTG9	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.A227	ENST00000368086.1	37	c.681	CCDS1195.1	1																																																																																			IGSF8	-	smart_Ig_sub	ENSG00000162729		0.627	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF8	HGNC	protein_coding	OTTHUMT00000060636.1	166	0.60	1	G	NM_052868		160063723	160063723	-1	no_errors	ENST00000314485	ensembl	human	known	69_37n	silent	66	14.10	11	SNP	0.021	C
IL36B	27177	genome.wustl.edu	37	2	113785618	113785618	+	Intron	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:113785618G>T	ENST00000259213.4	-	4	369				IL36B_ENST00000327407.2_Silent_p.G112G	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta						immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			kidney(1)|ovary(1)|pancreas(1)	3						CAGAAGTGGAGCCTTCTTTAT	0.468																																						dbGAP											0													110.0	111.0	111.0					2																	113785618		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.261+897C>A	2.37:g.113785618G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Silent	SNP	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1,prints_Interleukin_1,prints_InterleukinIL1AB,prints_InterleukinIL1B	p.G112	ENST00000259213.4	37	c.336	CCDS2109.1	2																																																																																			IL36B	-	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1,prints_Interleukin_1,prints_InterleukinIL1AB	ENSG00000136696		0.468	IL36B-001	KNOWN	basic|CCDS	protein_coding	IL36B	HGNC	protein_coding	OTTHUMT00000254110.1	337	0.00	0	G	NM_014438		113785618	113785618	-1	no_errors	ENST00000327407	ensembl	human	known	69_37n	silent	302	16.71	61	SNP	0.000	T
IL6	3569	genome.wustl.edu	37	7	22769293	22769293	+	Intron	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:22769293C>A	ENST00000404625.1	+	5	930				IL6_ENST00000401651.1_Nonsense_Mutation_p.S86*|IL6_ENST00000401630.3_Intron|IL6_ENST00000406575.1_Nonsense_Mutation_p.S162*|IL6_ENST00000420258.2_Nonsense_Mutation_p.S216*|IL6_ENST00000258743.5_Intron|AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000407492.1_Intron			P05231	IL6_HUMAN	interleukin 6						acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	GGTGTGTCCTCATTCCCTCAA	0.493																																					Esophageal Squamous(47;342 1214 13936 33513)	dbGAP											0													113.0	113.0	113.0					7																	22769293		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.471+14C>A	7.37:g.22769293C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UCU2|Q9UCU3|Q9UCU4	Nonsense_Mutation	SNP	pfam_IL6_MGF_GCSF,superfamily_4_helix_cytokine-like_core,smart_IL6_MGF_GCSF,prints_Interleukin_6,prints_IL6_MGF_GCSF	p.S216*	ENST00000404625.1	37	c.647	CCDS5375.1	7	.	.	.	.	.	.	.	.	.	.	C	13.31	2.199951	0.38905	.	.	ENSG00000136244	ENST00000401651;ENST00000420258;ENST00000406575	.	.	.	4.68	-1.63	0.08345	.	.	.	.	.	.	.	.	.	.	.	0.39136	D	0.961951	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.2338	3.0621	0.06203	0.3372:0.2891:0.0:0.3737	.	.	.	.	X	86;216;162	.	.	S	+	2	0	IL6	22735818	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.124000	0.03260	-0.247000	0.09597	0.655000	0.94253	TCA	IL6	-	smart_IL6_MGF_GCSF	ENSG00000136244		0.493	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL6	HGNC	protein_coding	OTTHUMT00000250225.2	117	0.00	0	C	NM_000600		22769293	22769293	+1	no_errors	ENST00000420258	ensembl	human	known	69_37n	nonsense	79	19.39	19	SNP	0.000	A
IPO5	3843	genome.wustl.edu	37	13	98670799	98670799	+	Missense_Mutation	SNP	G	G	A	rs9584741	byFrequency	TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:98670799G>A	ENST00000490680.1	+	23	2742	c.2677G>A	c.(2677-2679)Gaa>Aaa	p.E893K	IPO5_ENST00000261574.5_Missense_Mutation_p.E911K|IPO5_ENST00000539640.1_Missense_Mutation_p.E768K			O00410	IPO5_HUMAN	importin 5	893					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						TGATGTCATAGAACACTGTAG	0.408																																						dbGAP											0													157.0	146.0	149.0					13																	98670799		2203	4300	6503	-	-	-	SO:0001583	missense	0			U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2677G>A	13.37:g.98670799G>A	ENSP00000418393:p.Glu893Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_Importin-beta_N	p.E911K	ENST00000490680.1	37	c.2731		13	.	.	.	.	.	.	.	.	.	.	G	36	5.624422	0.96660	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.85084	0.5616	M	0.86805	2.84	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.86878	0.2040	10	0.87932	D	0	-24.4157	19.8769	0.96880	0.0:0.0:1.0:0.0	rs9584741;rs9584741	911	O00410-3	.	K	911;893;893;768	ENSP00000261574:E911K;ENSP00000350219:E893K;ENSP00000418393:E893K;ENSP00000445126:E768K	ENSP00000261574:E911K	E	+	1	0	IPO5	97468800	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.581000	0.98210	2.712000	0.92718	0.650000	0.86243	GAA	IPO5	-	superfamily_ARM-type_fold	ENSG00000065150		0.408	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	IPO5	HGNC	protein_coding	OTTHUMT00000354655.1	87	0.00	0	G	NM_002271		98670799	98670799	+1	no_errors	ENST00000261574	ensembl	human	known	69_37n	missense	133	12.50	19	SNP	1.000	A
IQSEC2	23096	genome.wustl.edu	37	X	53276155	53276155	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:53276155C>T	ENST00000375368.5	-	7	2915	c.2715G>A	c.(2713-2715)ctG>ctA	p.L905L	IQSEC2_ENST00000375365.2_Silent_p.L710L|IQSEC2_ENST00000396435.3_Silent_p.L915L			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	905	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						AGTCACCTCTCAGGTTCTTGA	0.488																																						dbGAP											0													126.0	85.0	99.0					X																	53276155		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2715G>A	X.37:g.53276155C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.L915	ENST00000375368.5	37	c.2745		X																																																																																			IQSEC2	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000124313		0.488	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		154	0.00	0	C	XM_291345		53276155	53276155	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	silent	119	15.97	23	SNP	0.998	T
ITGB3BP	23421	genome.wustl.edu	37	1	63920061	63920061	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:63920061G>A	ENST00000271002.10	-	6	498	c.417C>T	c.(415-417)acC>acT	p.T139T	ITGB3BP_ENST00000371092.3_Silent_p.T178T|ITGB3BP_ENST00000461681.1_5'UTR|ITGB3BP_ENST00000283568.8_Silent_p.T139T	NM_014288.4	NP_055103.3	Q13352	CENPR_HUMAN	integrin beta 3 binding protein (beta3-endonexin)	139					apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9						TTAGTTCTTTGGTTTTCTGCA	0.303																																						dbGAP											0													81.0	80.0	80.0					1																	63920061		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U37139	CCDS30736.1, CCDS55603.1	1p31.3	2013-11-05			ENSG00000142856	ENSG00000142856			6157	protein-coding gene	gene with protein product	"""centromere protein R"""	605494				7593198, 10490654	Standard	NM_014288		Approved	NRIF3, HSU37139, TAP20, CENPR	uc001dbb.2	Q13352	OTTHUMG00000013364	ENST00000271002.10:c.417C>T	1.37:g.63920061G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7D8|Q13353|Q5RJ42|Q5RJ44|Q5RJ45|Q7KYX2|Q96CD5|Q9UKB6	Silent	SNP	pfam_NRIF3_coact_rcpt	p.T178	ENST00000271002.10	37	c.534	CCDS30736.1	1																																																																																			ITGB3BP	-	pfam_NRIF3_coact_rcpt	ENSG00000142856		0.303	ITGB3BP-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGB3BP	HGNC	protein_coding	OTTHUMT00000037242.2	122	0.00	0	G	NM_014288		63920061	63920061	-1	no_errors	ENST00000371092	ensembl	human	known	69_37n	silent	100	22.48	29	SNP	0.994	A
ITIH4	3700	genome.wustl.edu	37	3	52858546	52858546	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:52858546G>A	ENST00000266041.4	-	8	1008	c.912C>T	c.(910-912)ctC>ctT	p.L304L	ITIH4_ENST00000406595.1_Silent_p.L304L|ITIH4-AS1_ENST00000478366.1_RNA|ITIH4_ENST00000467462.1_5'Flank|ITIH4_ENST00000485816.1_Silent_p.L304L|ITIH4_ENST00000434759.3_Silent_p.L216L|ITIH4_ENST00000346281.5_Silent_p.L304L|RP5-966M1.6_ENST00000468472.1_3'UTR	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	304	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTCTGGGGCTGAGGTCATCCA	0.577																																						dbGAP											0													106.0	103.0	104.0					3																	52858546		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.912C>T	3.37:g.52858546G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Nonsense_Mutation	SNP	pfam_ITI_HC_C,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.Q162*	ENST00000266041.4	37	c.484	CCDS2865.1	3	.	.	.	.	.	.	.	.	.	.	G	7.512	0.654912	0.14580	.	.	ENSG00000055955	ENST00000441637	.	.	.	5.35	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-27.6943	9.7645	0.40552	0.0761:0.2413:0.6826:0.0	.	.	.	.	X	162	.	.	Q	-	1	0	ITIH4	52833586	0.079000	0.21365	0.879000	0.34478	0.850000	0.48378	0.348000	0.20031	1.271000	0.44313	0.561000	0.74099	CAG	ITIH4	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000055955		0.577	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITIH4	HGNC	protein_coding	OTTHUMT00000317715.1	52	0.00	0	G	NM_002218		52858546	52858546	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441637	ensembl	human	novel	69_37n	nonsense	31	20.51	8	SNP	0.373	A
KATNA1	11104	genome.wustl.edu	37	6	149959615	149959615	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:149959615G>C	ENST00000335647.5	-	1	113	c.69C>G	c.(67-69)gaC>gaG	p.D23E	KATNA1_ENST00000367411.2_Missense_Mutation_p.D23E|KATNA1_ENST00000335643.8_Missense_Mutation_p.D23E					katanin p60 (ATPase containing) subunit A 1											endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		CCATCGCAGAGTCATAGTTTC	0.383																																						dbGAP											0													204.0	206.0	205.0					6																	149959615		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.69C>G	6.37:g.149959615G>C	ENSP00000335106:p.Asp23Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.D23E	ENST00000335647.5	37	c.69	CCDS5217.1	6	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790979	0.50102	.	.	ENSG00000186625	ENST00000335647;ENST00000335643;ENST00000367411;ENST00000444282;ENST00000420200	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.67	3.89	0.44902	.	0.132561	0.64402	D	0.000002	T	0.04770	0.0129	N	0.11724	0.165	0.38827	D	0.95575	B;P;B	0.37500	0.022;0.597;0.01	B;B;B	0.33620	0.035;0.167;0.035	T	0.27606	-1.0069	9	.	.	.	.	8.0275	0.30446	0.2929:0.0:0.7071:0.0	.	23;23;23	A8K7S5;O75449-2;O75449	.;.;KTNA1_HUMAN	E	23	ENSP00000335106:D23E;ENSP00000335180:D23E;ENSP00000356381:D23E;ENSP00000390322:D23E;ENSP00000398993:D23E	.	D	-	3	2	KATNA1	150001308	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.177000	0.42509	1.415000	0.47037	0.650000	0.86243	GAC	KATNA1	-	NULL	ENSG00000186625		0.383	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KATNA1	HGNC	protein_coding	OTTHUMT00000042641.2	118	0.00	0	G	NM_007044		149959615	149959615	-1	no_errors	ENST00000335647	ensembl	human	known	69_37n	missense	122	13.48	19	SNP	1.000	C
KCNS2	3788	genome.wustl.edu	37	8	99440888	99440888	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:99440888C>T	ENST00000287042.4	+	2	1031	c.681C>T	c.(679-681)ttC>ttT	p.F227F	KCNS2_ENST00000521839.1_Silent_p.F227F	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	227					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			ACCCTAGGTTCGAAATCGTGG	0.547																																					Pancreas(138;844 2489 9202 24627)	dbGAP											0													126.0	127.0	127.0					8																	99440888		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.681C>T	8.37:g.99440888C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAN1	Silent	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv2	p.F227	ENST00000287042.4	37	c.681	CCDS6279.1	8																																																																																			KCNS2	-	NULL	ENSG00000156486		0.547	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS2	HGNC	protein_coding	OTTHUMT00000103134.1	122	0.00	0	C	NM_020697		99440888	99440888	+1	no_errors	ENST00000287042	ensembl	human	known	69_37n	silent	63	20.00	16	SNP	1.000	T
MAP10	54627	genome.wustl.edu	37	1	232940809	232940809	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:232940809delG	ENST00000418460.1	+	1	167	c.40delG	c.(40-42)gcafs	p.A14fs		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	0					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										GCTCTGTTTAGCATGGGAAAG	0.463																																						dbGAP											0													163.0	158.0	160.0					1																	232940809		1910	4131	6041	-	-	-	SO:0001589	frameshift_variant	0			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.40delG	1.37:g.232940809delG	ENSP00000403208:p.Ala14fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Frame_Shift_Del	DEL	NULL	p.A14fs	ENST00000418460.1	37	c.40	CCDS44334.1	1																																																																																			KIAA1383	-	NULL	ENSG00000212916		0.463	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1383	HGNC	protein_coding	OTTHUMT00000092317.3	83	0.00	0	G	NM_019090		232940809	232940809	+1	no_errors	ENST00000418460	ensembl	human	known	69_37n	frame_shift_del	80	40.82	60	DEL	0.006	-
RIC1	57589	genome.wustl.edu	37	9	5765456	5765456	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:5765456C>G	ENST00000414202.2	+	20	3075	c.2884C>G	c.(2884-2886)Cta>Gta	p.L962V	KIAA1432_ENST00000418622.3_Missense_Mutation_p.L883V|KIAA1432_ENST00000251879.6_Missense_Mutation_p.L962V|KIAA1432_ENST00000449720.2_Missense_Mutation_p.L846V|KIAA1432_ENST00000381532.2_Missense_Mutation_p.L883V	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TGCTACCCTTCTATTCAACAC	0.418																																						dbGAP											0													174.0	158.0	163.0					9																	5765456		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000414202.2:c.2884C>G	9.37:g.5765456C>G	ENSP00000416696:p.Leu962Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.L883V	ENST00000414202.2	37	c.2647	CCDS34982.2	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.157280|4.157280	0.78114|0.78114	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720|ENST00000545641	.|.	.|.	.|.	6.17|6.17	5.28|5.28	0.74379|0.74379	Ribosome control protein 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80518|0.80518	0.4638|0.4638	M|M	0.88775|0.88775	2.98|2.98	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.998;0.999;0.999;0.997|.	D|D	0.84062|0.84062	0.0375|0.0375	9|5	0.59425|.	D|.	0.04|.	-11.1587|-11.1587	15.4435|15.4435	0.75208|0.75208	0.0:0.9342:0.0:0.0658|0.0:0.9342:0.0:0.0658	.|.	846;883;962;962|.	B7ZM67;B2RN24;Q4ADV7;G5E932|.	.;.;RIC1_HUMAN;.|.	V|C	962;962;883;883;846|853	.|.	ENSP00000251879:L962V|.	L|S	+|+	1|2	2|0	KIAA1432|KIAA1432	5755456|5755456	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.840000|0.840000	0.47671|0.47671	5.783000|5.783000	0.68982|0.68982	1.633000|1.633000	0.50488|0.50488	0.655000|0.655000	0.94253|0.94253	CTA|TCT	KIAA1432	-	pfam_Ribosome_control_1	ENSG00000107036		0.418	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	216	0.00	0	C			5765456	5765456	+1	no_errors	ENST00000418622	ensembl	human	known	69_37n	missense	161	28.63	65	SNP	1.000	G
KIF4A	24137	genome.wustl.edu	37	X	69615655	69615655	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:69615655G>A	ENST00000374403.3	+	21	2449	c.2367G>A	c.(2365-2367)gaG>gaA	p.E789E	RNY4P23_ENST00000364507.1_RNA|KIF4A_ENST00000374388.3_Silent_p.E789E	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	789	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AATCTGGGGAGAATCCACCTC	0.433																																						dbGAP											0													61.0	58.0	59.0					X																	69615655		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2367G>A	X.37:g.69615655G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E789	ENST00000374403.3	37	c.2367	CCDS14401.1	X																																																																																			KIF4A	-	NULL	ENSG00000090889		0.433	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	100	0.00	0	G	NM_012310		69615655	69615655	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	silent	77	43.07	59	SNP	0.975	A
KIF6	221458	genome.wustl.edu	37	6	39325124	39325124	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:39325124G>A	ENST00000287152.7	-	19	2203	c.2109C>T	c.(2107-2109)ctC>ctT	p.L703L	KIF6_ENST00000394362.1_Silent_p.L154L|KIF6_ENST00000373213.4_Silent_p.L542L|KIF6_ENST00000229913.5_Silent_p.L154L|KIF6_ENST00000373215.3_Silent_p.L686L|KIF6_ENST00000373216.3_Silent_p.L703L|KIF6_ENST00000541946.1_Silent_p.L154L|KIF6_ENST00000538893.1_Silent_p.L647L	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	703					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TCGTGTGATCGAGTGAATTCA	0.443																																						dbGAP											0													158.0	141.0	147.0					6																	39325124		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.2109C>T	6.37:g.39325124G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S595L	ENST00000287152.7	37	c.1784	CCDS4844.1	6	.	.	.	.	.	.	.	.	.	.	G	4.222	0.040086	0.08148	.	.	ENSG00000164627	ENST00000458470	.	.	.	4.62	-3.7	0.04437	.	.	.	.	.	T	0.11793	0.0287	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34378	-0.9831	4	.	.	.	.	7.0919	0.25289	0.3456:0.2845:0.37:0.0	.	.	.	.	L	595	.	.	S	-	2	0	KIF6	39433102	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.404000	0.07205	-0.664000	0.05324	-0.910000	0.02820	TCG	KIF6	-	NULL	ENSG00000164627		0.443	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	156	0.00	0	G	NM_145027		39325124	39325124	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458470	ensembl	human	known	69_37n	missense	76	24.75	25	SNP	0.000	A
KRT76	51350	genome.wustl.edu	37	12	53164971	53164971	+	Silent	SNP	A	A	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:53164971A>G	ENST00000332411.2	-	7	1349	c.1296T>C	c.(1294-1296)gcT>gcC	p.A432A		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	432	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CACGCTGCTCAGCCTCTGCAA	0.522																																						dbGAP											0													127.0	113.0	117.0					12																	53164971		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1296T>C	12.37:g.53164971A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRR3|Q7Z795	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.A432	ENST00000332411.2	37	c.1296	CCDS8838.1	12																																																																																			KRT76	-	pfam_F	ENSG00000185069		0.522	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	HGNC	protein_coding	OTTHUMT00000405928.1	120	0.00	0	A	NM_015848		53164971	53164971	-1	no_errors	ENST00000332411	ensembl	human	known	69_37n	silent	50	25.37	17	SNP	0.972	G
KNTC1	9735	genome.wustl.edu	37	12	123089434	123089434	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:123089434G>A	ENST00000333479.7	+	50	5363	c.5186G>A	c.(5185-5187)cGt>cAt	p.R1729H	KNTC1_ENST00000450485.2_Intron|KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000537348.1_Missense_Mutation_p.R154H	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1729					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GACGAAAAACGTGAAAAAGCC	0.433																																						dbGAP											0													29.0	26.0	27.0					12																	123089434		1849	4110	5959	-	-	-	SO:0001583	missense	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.5186G>A	12.37:g.123089434G>A	ENSP00000328236:p.Arg1729His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.R1729H	ENST00000333479.7	37	c.5186	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	6.468	0.454526	0.12283	.	.	ENSG00000184445	ENST00000333479;ENST00000537348	T;T	0.33438	1.41;1.41	5.71	2.55	0.30701	RZZ complex, subunit KNTC1/ROD, C-terminal (1);	0.263069	0.43919	N	0.000503	T	0.09642	0.0237	N	0.01800	-0.715	0.30021	N	0.814345	B	0.17038	0.02	B	0.14578	0.011	T	0.24548	-1.0157	10	0.13470	T	0.59	-6.0304	6.9705	0.24646	0.4509:0.0:0.5491:0.0	.	1729	P50748	KNTC1_HUMAN	H	1729;154	ENSP00000328236:R1729H;ENSP00000443622:R154H	ENSP00000328236:R1729H	R	+	2	0	KNTC1	121655387	0.047000	0.20315	0.290000	0.24890	0.798000	0.45092	0.556000	0.23438	0.776000	0.33473	-0.216000	0.12614	CGT	KNTC1	-	pfam_RZZ-complex_KNTC1/ROD_C	ENSG00000184445		0.433	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	52	0.00	0	G			123089434	123089434	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	missense	22	32.35	11	SNP	0.966	A
KRTAP6-1	337966	genome.wustl.edu	37	21	31986193	31986193	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr21:31986193C>T	ENST00000329122.2	-	1	56	c.31G>A	c.(31-33)Ggc>Agc	p.G11S	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	11						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						CCAGGGGTGCCATAGTAGTTT	0.567																																						dbGAP											0													203.0	195.0	198.0					21																	31986193		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.31G>A	21.37:g.31986193C>T	ENSP00000332690:p.Gly11Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G11S	ENST00000329122.2	37	c.31	CCDS13602.1	21	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945203	0.34283	.	.	ENSG00000184724	ENST00000329122;ENST00000399871	T	0.31247	1.5	5.24	4.35	0.52113	.	0.000000	0.38837	U	0.001549	T	0.50497	0.1619	.	.	.	0.23611	N	0.997296	D	0.76494	0.999	D	0.72982	0.979	T	0.35943	-0.9768	9	0.87932	D	0	.	11.6755	0.51427	0.0:0.9129:0.0:0.0871	.	11	Q3LI64	KRA61_HUMAN	S	11;9	ENSP00000332690:G11S	ENSP00000332690:G11S	G	-	1	0	KRTAP6-1	30908064	0.995000	0.38212	0.995000	0.50966	0.620000	0.37586	1.963000	0.40452	2.897000	0.99335	0.643000	0.83706	GGC	KRTAP6-1	-	NULL	ENSG00000184724		0.567	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP6-1	HGNC	protein_coding	OTTHUMT00000128240.2	420	0.00	0	C	NM_181602		31986193	31986193	-1	no_errors	ENST00000329122	ensembl	human	known	69_37n	missense	620	11.11	78	SNP	0.980	T
LAMC3	10319	genome.wustl.edu	37	9	133907491	133907491	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:133907491C>T	ENST00000361069.4	+	3	871	c.738C>T	c.(736-738)gaC>gaT	p.D246D	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	246	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CGTTTGGGGACGACATCTTCA	0.607																																						dbGAP											0													160.0	152.0	154.0					9																	133907491		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.738C>T	9.37:g.133907491C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1APX9|B1APY0|Q59H72	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.D246	ENST00000361069.4	37	c.738	CCDS6938.1	9																																																																																			LAMC3	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000050555		0.607	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	122	0.00	0	C	NM_006059		133907491	133907491	+1	no_errors	ENST00000361069	ensembl	human	known	69_37n	silent	44	31.82	21	SNP	0.943	T
LGALS14	56891	genome.wustl.edu	37	19	40196643	40196643	+	Intron	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:40196643G>T	ENST00000392052.3	+	2	238				LGALS14_ENST00000360675.3_Missense_Mutation_p.M32I	NM_020129.2	NP_064514.1	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14						apoptotic process (GO:0006915)	nucleus (GO:0005634)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|stomach(2)	14	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			TGCCCTTGATGATTGTGGTGC	0.478																																						dbGAP											0													170.0	126.0	141.0					19																	40196643		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF267852	CCDS12542.1, CCDS46073.1	19q13.2	2014-03-19			ENSG00000006659	ENSG00000006659		"""Lectins, galactoside-binding"""	30054	protein-coding gene	gene with protein product		607260				11997112	Standard	NM_020129		Approved	PPL13, CLC2	uc002omg.3	Q8TCE9	OTTHUMG00000183143	ENST00000392052.3:c.16-594G>T	19.37:g.40196643G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPV8|B2R530|C5HZ19|Q7Z4X8|Q96KD4|Q96KD5|Q96KD6|Q9NR03	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.M32I	ENST00000392052.3	37	c.96	CCDS46073.1	19	.	.	.	.	.	.	.	.	.	.	.	2.880	-0.232104	0.05983	.	.	ENSG00000006659	ENST00000360675	T	0.06449	3.3	0.896	-1.72	0.08107	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.30211	0.273	B	0.29785	0.107	T	0.42275	-0.9461	9	0.49607	T	0.09	.	4.2502	0.10691	0.4614:0.0:0.5386:0.0	.	32	A8MPV8	.	I	32	ENSP00000353893:M32I	ENSP00000353893:M32I	M	+	3	0	LGALS14	44888483	0.000000	0.05858	0.005000	0.12908	0.023000	0.10783	-0.754000	0.04787	-0.676000	0.05238	0.305000	0.20034	ATG	LGALS14	-	superfamily_ConA-like_lec_gl	ENSG00000006659		0.478	LGALS14-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LGALS14	HGNC	protein_coding	OTTHUMT00000465222.1	182	0.00	0	G	NM_020129		40196643	40196643	+1	no_errors	ENST00000360675	ensembl	human	known	69_37n	missense	197	23.37	61	SNP	0.009	T
LINGO2	158038	genome.wustl.edu	37	9	27950415	27950415	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:27950415C>T	ENST00000379992.2	-	6	704	c.255G>A	c.(253-255)gaG>gaA	p.E85E	LINGO2_ENST00000308675.3_Silent_p.E85E	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	85						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TCAAGTCTATCTCTTCCAGCA	0.443																																						dbGAP											0													242.0	245.0	244.0					9																	27950415		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.255G>A	9.37:g.27950415C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K7|B2RPM5|Q6ZMD0	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E85	ENST00000379992.2	37	c.255	CCDS6524.1	9																																																																																			LINGO2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174482		0.443	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	98	0.00	0	C	NM_152570		27950415	27950415	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	silent	179	28.17	71	SNP	1.000	T
LMAN1L	79748	genome.wustl.edu	37	15	75111590	75111590	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr15:75111590C>G	ENST00000309664.5	+	6	834	c.695C>G	c.(694-696)tCa>tGa	p.S232*	RP11-414J4.2_ENST00000564823.1_RNA|LMAN1L_ENST00000379709.3_Nonsense_Mutation_p.S232*	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	232	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTTGGGGTCTCAGCAGCCACC	0.557																																						dbGAP											0													160.0	160.0	160.0					15																	75111590		2197	4296	6493	-	-	-	SO:0001587	stop_gained	0			AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.695C>G	15.37:g.75111590C>G	ENSP00000310431:p.Ser232*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWN2	Nonsense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	p.S232*	ENST00000309664.5	37	c.695	CCDS10270.1	15	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192418	0.58017	.	.	ENSG00000140506	ENST00000309664;ENST00000456603;ENST00000379709	.	.	.	5.67	2.82	0.32997	.	0.096714	0.45126	D	0.000395	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0604	0.19835	0.0:0.6784:0.155:0.1667	.	.	.	.	X	232;124;232	.	.	S	+	2	0	LMAN1L	72898643	0.992000	0.36948	0.937000	0.37676	0.251000	0.25915	2.496000	0.45346	0.363000	0.24346	-0.188000	0.12872	TCA	LMAN1L	-	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	ENSG00000140506		0.557	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	LMAN1L	HGNC	protein_coding	OTTHUMT00000286397.4	105	0.00	0	C			75111590	75111590	+1	no_errors	ENST00000309664	ensembl	human	known	69_37n	nonsense	19	48.65	18	SNP	0.985	G
LONRF3	79836	genome.wustl.edu	37	X	118123503	118123503	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:118123503G>C	ENST00000371628.3	+	4	1223	c.1192G>C	c.(1192-1194)Gag>Cag	p.E398Q	LONRF3_ENST00000304778.7_Missense_Mutation_p.E357Q|LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000422289.2_Missense_Mutation_p.E142Q	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	398							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GGAAGAAGAGGAGGAGAAGTG	0.512																																						dbGAP											0													99.0	74.0	82.0					X																	118123503		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1192G>C	X.37:g.118123503G>C	ENSP00000360690:p.Glu398Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.E398Q	ENST00000371628.3	37	c.1192	CCDS35374.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.31|10.31	1.313605|1.313605	0.23908|0.23908	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289|ENST00000439603	T;T;T;D|.	0.84298|.	-1.43;-1.43;-1.28;-1.83|.	4.51|4.51	4.51|4.51	0.55191|0.55191	.|.	0.842686|.	0.10780|.	N|.	0.634947|.	T|T	0.30166|0.30166	0.0756|0.0756	N|N	0.14661|0.14661	0.345|0.345	0.19775|0.19775	N|N	0.999958|0.999958	P;B;B|.	0.36909|.	0.573;0.032;0.157|.	B;B;B|.	0.35813|.	0.211;0.029;0.103|.	T|T	0.17289|0.17289	-1.0374|-1.0374	10|5	0.15952|.	T|.	0.53|.	-0.018|-0.018	12.1947|12.1947	0.54290|0.54290	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	142;357;398|.	B3KUN7;Q496Y0-2;Q496Y0|.	.;.;LONF3_HUMAN|.	Q|A	357;357;398;142|163	ENSP00000360691:E357Q;ENSP00000307732:E357Q;ENSP00000360690:E398Q;ENSP00000408894:E142Q|.	ENSP00000307732:E357Q|.	E|G	+|+	1|2	0|0	LONRF3|LONRF3	118007531|118007531	0.794000|0.794000	0.28838|0.28838	0.042000|0.042000	0.18584|0.18584	0.037000|0.037000	0.13140|0.13140	1.371000|1.371000	0.34250|0.34250	2.168000|2.168000	0.68352|0.68352	0.513000|0.513000	0.50165|0.50165	GAG|GGA	LONRF3	-	NULL	ENSG00000175556		0.512	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	HGNC	protein_coding	OTTHUMT00000355124.2	358	0.00	0	G	NM_024778		118123503	118123503	+1	no_errors	ENST00000371628	ensembl	human	known	69_37n	missense	254	29.32	107	SNP	0.244	C
LTBP1	4052	genome.wustl.edu	37	2	33477830	33477830	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:33477830C>T	ENST00000404816.2	+	11	2439	c.2086C>T	c.(2086-2088)Cac>Tac	p.H696Y	LTBP1_ENST00000404525.1_Missense_Mutation_p.H370Y|LTBP1_ENST00000354476.3_Missense_Mutation_p.H696Y|LTBP1_ENST00000407925.1_Missense_Mutation_p.H370Y|LTBP1_ENST00000402934.1_Missense_Mutation_p.H370Y|LTBP1_ENST00000418533.2_Missense_Mutation_p.H370Y|LTBP1_ENST00000390003.4_Missense_Mutation_p.H370Y			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	696	TB 2.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCTGTCTGTTCACCTCACCAA	0.552																																						dbGAP											0													157.0	150.0	153.0					2																	33477830		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2086C>T	2.37:g.33477830C>T	ENSP00000386043:p.His696Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.H696Y	ENST00000404816.2	37	c.2086	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	C	17.43	3.388746	0.61956	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000413303;ENST00000468091	D;D;D;D;D;D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07	5.48	5.48	0.80851	Matrix fibril-associated (3);TGF-beta binding (1);	.	.	.	.	D	0.86079	0.5847	N	0.11255	0.115	0.80722	D	1	P;P;B;B;P;P	0.47962	0.903;0.753;0.451;0.446;0.579;0.882	B;B;B;B;B;B	0.41764	0.366;0.362;0.212;0.118;0.247;0.251	D	0.88446	0.3045	9	0.56958	D	0.05	.	19.3625	0.94446	0.0:1.0:0.0:0.0	.	696;370;370;370;370;696	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	Y	696;696;370;370;370;370;370;52;13	ENSP00000386043:H696Y;ENSP00000346467:H696Y;ENSP00000374653:H370Y;ENSP00000393057:H370Y;ENSP00000384373:H370Y;ENSP00000385359:H370Y;ENSP00000384091:H370Y;ENSP00000415412:H52Y;ENSP00000417591:H13Y	ENSP00000346467:H696Y	H	+	1	0	LTBP1	33331334	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	5.440000	0.66563	2.567000	0.86603	0.655000	0.94253	CAC	LTBP1	-	pfam_TB_dom,superfamily_TB_dom	ENSG00000049323		0.552	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	187	0.00	0	C	NM_206943		33477830	33477830	+1	no_errors	ENST00000354476	ensembl	human	known	69_37n	missense	136	38.50	87	SNP	1.000	T
MAGIX	79917	genome.wustl.edu	37	X	49021148	49021148	+	Intron	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:49021148C>T	ENST00000412696.2	+	3	279				MAGIX_ENST00000376338.3_Missense_Mutation_p.S17L|MAGIX_ENST00000498742.1_Intron|MAGIX_ENST00000376339.1_Missense_Mutation_p.S17L|MAGIX_ENST00000425661.2_Intron	NM_024859.2	NP_079135.3	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked																		ATCCTTCTATCGGAGGCCTCC	0.542																																						dbGAP											0													107.0	107.0	107.0					X																	49021148		2074	4184	6258	-	-	-	SO:0001627	intron_variant	0			AK025340	CCDS48106.1, CCDS48107.1, CCDS75976.1	Xp11.23	2014-05-06			ENSG00000017621	ENSG00000269313			30006	protein-coding gene	gene with protein product							Standard	XM_005278065		Approved	PDZX, JM10, FLJ21687	uc010nin.1	Q9H6Y5	OTTHUMG00000188218	ENST00000412696.2:c.279+21C>T	X.37:g.49021148C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6XND4|A8MSX9|B7WP26|Q14C81	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S17L	ENST00000412696.2	37	c.50	CCDS48106.1	X	.	.	.	.	.	.	.	.	.	.	.	0.148	-1.095082	0.01858	.	.	ENSG00000017621	ENST00000376339;ENST00000376338	T;T	0.32753	1.65;1.44	3.3	-0.828	0.10799	.	.	.	.	.	T	0.17109	0.0411	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22521	-1.0214	8	0.44086	T	0.13	.	3.0046	0.06024	0.0:0.2728:0.2288:0.4984	.	17	Q9H6Y5-2	.	L	17	ENSP00000365517:S17L;ENSP00000365516:S17L	ENSP00000365516:S17L	S	+	2	0	MAGIX	48908092	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.107000	0.15375	-0.205000	0.10219	-0.527000	0.04329	TCG	MAGIX	-	NULL	ENSG00000017621		0.542	MAGIX-009	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGIX	HGNC	protein_coding	OTTHUMT00000378832.1	85	0.00	0	C	NM_024859		49021148	49021148	+1	no_errors	ENST00000376338	ensembl	human	known	69_37n	missense	67	10.67	8	SNP	0.000	T
MALT1	10892	genome.wustl.edu	37	18	56412910	56412910	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr18:56412910G>A	ENST00000348428.3	+	16	2182	c.1924G>A	c.(1924-1926)Gat>Aat	p.D642N	MALT1_ENST00000345724.3_Missense_Mutation_p.D631N|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	642					activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						TCTAGATATTGATCCAAAAGA	0.348			T	BIRC3	MALT																																	dbGAP		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	0													76.0	76.0	76.0					18																	56412910		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.1924G>A	18.37:g.56412910G>A	ENSP00000319279:p.Asp642Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	pfam_Pept_C14_cat,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_DEATH-like,smart_Ig_sub,smart_Ig_sub2,pfscan_Pept_C14_ICE_p20,pfscan_Ig-like	p.D642N	ENST00000348428.3	37	c.1924	CCDS11967.1	18	.	.	.	.	.	.	.	.	.	.	G	31	5.081222	0.94050	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.12879	2.64;2.64	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.34629	0.0904	M	0.64997	1.995	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.61658	0.892;0.783	T	0.01298	-1.1392	10	0.66056	D	0.02	.	19.507	0.95121	0.0:0.0:1.0:0.0	.	631;642	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	N	642;631	ENSP00000319279:D642N;ENSP00000304161:D631N	ENSP00000304161:D631N	D	+	1	0	MALT1	54563890	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.150000	0.94667	2.791000	0.96007	0.655000	0.94253	GAT	MALT1	-	NULL	ENSG00000172175		0.348	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MALT1	HGNC	protein_coding	OTTHUMT00000256132.2	100	0.00	0	G			56412910	56412910	+1	no_errors	ENST00000348428	ensembl	human	known	69_37n	missense	98	22.31	29	SNP	1.000	A
MARK1	4139	genome.wustl.edu	37	1	220835278	220835278	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:220835278G>C	ENST00000366917.4	+	18	2424	c.2158G>C	c.(2158-2160)Gaa>Caa	p.E720Q	RP11-322F10.2_ENST00000446040.1_RNA|MARK1_ENST00000402574.1_Missense_Mutation_p.E570Q|MARK1_ENST00000366918.4_Missense_Mutation_p.E683Q					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		CATGATGAGAGAAATCCGAAA	0.418																																						dbGAP											0													98.0	98.0	98.0					1																	220835278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.2158G>C	1.37:g.220835278G>C	ENSP00000355884:p.Glu720Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E720Q	ENST00000366917.4	37	c.2158	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	35	5.480594	0.96307	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.58506	0.33;0.33;0.33	6.16	6.16	0.99307	Kinase-associated KA1 (2);	0.000000	0.85682	D	0.000000	T	0.80788	0.4690	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.997;0.99;0.997	T	0.81413	-0.0944	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	705;570;720;683	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	Q	570;683;720	ENSP00000386017:E570Q;ENSP00000355885:E683Q;ENSP00000355884:E720Q	ENSP00000355884:E720Q	E	+	1	0	MARK1	218901901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GAA	MARK1	-	superfamily_Kinase-assoc_KA1	ENSG00000116141		0.418	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	74	0.00	0	G			220835278	220835278	+1	no_errors	ENST00000366917	ensembl	human	known	69_37n	missense	91	24.39	30	SNP	1.000	C
MBTPS2	51360	genome.wustl.edu	37	X	21857900	21857900	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:21857900C>T	ENST00000379484.5	+	1	147	c.48C>T	c.(46-48)gtC>gtT	p.V16V	MBTPS2_ENST00000365779.2_Silent_p.V16V|MBTPS2_ENST00000465888.1_3'UTR	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	16					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						GCTGGACTGTCGTCTACCTGA	0.672																																						dbGAP											0													113.0	48.0	70.0					X																	21857900		2196	4291	6487	-	-	-	SO:0001819	synonymous_variant	0			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.48C>T	X.37:g.21857900C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UM70|Q9UMD3	Silent	SNP	pfam_Peptidase_M50,superfamily_PDZ,prints_Pept_M50_SREBP	p.V16	ENST00000379484.5	37	c.48	CCDS14201.1	X																																																																																			MBTPS2	-	NULL	ENSG00000012174		0.672	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	HGNC	protein_coding	OTTHUMT00000056026.1	82	0.00	0	C			21857900	21857900	+1	no_errors	ENST00000379484	ensembl	human	known	69_37n	silent	52	21.21	14	SNP	0.958	T
MFSD11	79157	genome.wustl.edu	37	17	74763467	74763467	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:74763467G>A	ENST00000588460.1	+	9	2724		c.e9-1		MFSD11_ENST00000593181.1_Splice_Site|MFSD11_ENST00000586622.1_Splice_Site|MFSD11_ENST00000336509.4_Splice_Site|MFSD11_ENST00000590514.1_Splice_Site|MFSD11_ENST00000355954.3_Splice_Site	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11							integral component of membrane (GO:0016021)		p.?(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						TGTGTTTACAGAAAAGTCTTT	0.308																																						dbGAP											1	Unknown(1)	ovary(1)											83.0	81.0	82.0					17																	74763467		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.683-1G>A	17.37:g.74763467G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43442|Q9NXI5	Splice_Site	SNP	-	e9-1	ENST00000588460.1	37	c.683-1	CCDS11750.1	17	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234485	0.79800	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1849	0.89790	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MFSD11	72275062	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	8.515000	0.90548	2.301000	0.77427	0.591000	0.81541	.	MFSD11	-	-	ENSG00000092931		0.308	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	HGNC	protein_coding	OTTHUMT00000451516.1	110	0.00	0	G	NM_024311	Intron	74763467	74763467	+1	no_errors	ENST00000336509	ensembl	human	known	69_37n	splice_site	66	45.90	56	SNP	1.000	A
LINC00599	157627	genome.wustl.edu	37	8	9760950	9760950	+	lincRNA	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:9760950C>G	ENST00000385275.1	-	0	32					NR_029668.1				long intergenic non-protein coding RNA 599																		ACATTTAAATCAAGGTCCGCT	0.552																																						dbGAP											0													35.0	34.0	34.0					8																	9760950		1568	3582	5150	-	-	-			0			AF052108		8p23.1	2012-10-19			ENSG00000253230	ENSG00000253230		"""Long non-coding RNAs"", ""-"""	27231	non-coding RNA	RNA, long non-coding	"""retinal non-coding RNA 3"""					8619474, 9110174	Standard	NR_024281		Approved	Rncr3			OTTHUMG00000163734		8.37:g.9760950C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000385275.1	37	NULL		8																																																																																			MIR124-1	-	-	ENSG00000208010		0.552	LINC00599-201	KNOWN	basic	miRNA	MIR124-1	HGNC	lincRNA		63	0.00	0	C	NR_024281		9760950	9760950	-1	no_errors	ENST00000385275	ensembl	human	known	69_37n	rna	24	20.00	6	SNP	1.000	G
KMT2A	4297	genome.wustl.edu	37	11	118375222	118375222	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:118375222C>T	ENST00000389506.5	+	27	8606	c.8606C>T	c.(8605-8607)tCa>tTa	p.S2869L	KMT2A_ENST00000534358.1_Missense_Mutation_p.S2872L|KMT2A_ENST00000354520.4_Missense_Mutation_p.S2831L			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2869					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGCCCAGAGTCATCTTCATCA	0.433																																						dbGAP											0													138.0	131.0	133.0					11																	118375222		2200	4295	6495	-	-	-	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8606C>T	11.37:g.118375222C>T	ENSP00000374157:p.Ser2869Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.S2869L	ENST00000389506.5	37	c.8606	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802658	0.50315	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.83914	-1.77;-1.78;-1.74	6.06	5.14	0.70334	.	0.120955	0.64402	N	0.000016	T	0.78355	0.4270	L	0.40543	1.245	0.52099	D	0.999941	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.74548	-0.3629	10	0.72032	D	0.01	.	15.6642	0.77213	0.0:0.9339:0.0:0.0661	.	2872;2869	E9PQG7;Q03164	.;MLL1_HUMAN	L	2872;2869;2831;1779	ENSP00000436786:S2872L;ENSP00000374157:S2869L;ENSP00000346516:S2831L	ENSP00000346516:S2831L	S	+	2	0	MLL	117880432	1.000000	0.71417	0.905000	0.35620	0.995000	0.86356	5.662000	0.68032	1.541000	0.49316	0.655000	0.94253	TCA	MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.433	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	61	0.00	0	C	NM_005933		118375222	118375222	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	missense	35	35.71	20	SNP	0.999	T
MOGS	7841	genome.wustl.edu	37	2	74690034	74690035	+	Frame_Shift_Ins	INS	-	-	G	rs184209905	byFrequency	TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:74690034_74690035insG	ENST00000233616.4	-	4	1043_1044	c.881_882insC	c.(880-882)cctfs	p.P294fs	MOGS_ENST00000535045.1_3'UTR|MOGS_ENST00000452063.2_Frame_Shift_Ins_p.P188fs|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000462443.1_5'UTR	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	294					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						GGTAGCGTTCAGGGGGGGCCCC	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.882dupC	2.37:g.74690041_74690041dupG	ENSP00000233616:p.Pro294fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K938|F5H6D0|Q17RN9|Q8TCT5	Frame_Shift_Ins	INS	pfam_Glycoside_hydrolase_63,superfamily_6-hairpin_glycosidase-like	p.E295fs	ENST00000233616.4	37	c.882_881	CCDS42700.1	2																																																																																			MOGS	-	pfam_Glycoside_hydrolase_63	ENSG00000115275		0.584	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGS	HGNC	protein_coding	OTTHUMT00000328382.1	29	0.00	0	-	NM_006302		74690034	74690035	-1	no_errors	ENST00000233616	ensembl	human	known	69_37n	frame_shift_ins	25	10.71	3	INS	0.988:0.983	G
MTHFD2	10797	genome.wustl.edu	37	2	74425784	74425784	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:74425784C>T	ENST00000394053.2	+	1	96	c.16C>T	c.(16-18)Cta>Tta	p.L6L	MTHFD2_ENST00000409601.1_Silent_p.L6L|MTHFD2_ENST00000477455.1_3'UTR|MTHFD2_ENST00000409804.1_Silent_p.L6L|MTHFD2_ENST00000394050.3_5'UTR|MTHFD2_ENST00000264090.4_5'UTR	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	6					folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	TGCGACTTCTCTAATGTCTGC	0.692																																						dbGAP											0													12.0	16.0	14.0					2																	74425784		1953	4131	6084	-	-	-	SO:0001819	synonymous_variant	0			X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.16C>T	2.37:g.74425784C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53G90|Q53GV5|Q53S36|Q7Z650	Silent	SNP	pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.L6	ENST00000394053.2	37	c.16	CCDS1935.2	2																																																																																			MTHFD2	-	NULL	ENSG00000065911		0.692	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2	HGNC	protein_coding	OTTHUMT00000252045.2	21	0.00	0	C			74425784	74425784	+1	no_errors	ENST00000394053	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	0.000	T
MUC17	140453	genome.wustl.edu	37	7	100684341	100684341	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:100684341C>G	ENST00000306151.4	+	3	9708	c.9644C>G	c.(9643-9645)tCa>tGa	p.S3215*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3215	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATTCCAACCTCAACTCCTAGT	0.498																																						dbGAP											0													282.0	285.0	284.0					7																	100684341		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9644C>G	7.37:g.100684341C>G	ENSP00000302716:p.Ser3215*	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S3215*	ENST00000306151.4	37	c.9644	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	c	48	14.892703	0.99814	.	.	ENSG00000169876	ENST00000306151	.	.	.	1.22	0.171	0.15026	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	6.9969	0.24786	0.0:0.7114:0.2886:0.0	.	.	.	.	X	3215	.	ENSP00000302716:S3215X	S	+	2	0	MUC17	100471061	0.005000	0.15991	0.001000	0.08648	0.085000	0.17905	2.855000	0.48333	0.062000	0.16340	0.089000	0.15464	TCA	MUC17	-	NULL	ENSG00000169876		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	94	0.00	0	C	NM_001040105		100684341	100684341	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	nonsense	158	12.57	23	SNP	0.001	G
MYLK	4638	genome.wustl.edu	37	3	123456342	123456342	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:123456342T>G	ENST00000475616.1	-	5	636	c.637A>C	c.(637-639)Aac>Cac	p.N213H	MYLK_ENST00000359169.1_Missense_Mutation_p.N213H|MYLK_ENST00000360304.3_Missense_Mutation_p.N213H|MYLK_ENST00000360772.3_Missense_Mutation_p.N213H|MYLK_ENST00000346322.5_Missense_Mutation_p.N213H			Q15746	MYLK_HUMAN	myosin light chain kinase	213	Ig-like C2-type 2.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TGCATGCCGTTCTTCTCAGAC	0.552																																						dbGAP											0													216.0	178.0	191.0					3																	123456342		2203	4300	6503	-	-	-	SO:0001583	missense	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.637A>C	3.37:g.123456342T>G	ENSP00000418335:p.Asn213His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.N213H	ENST00000475616.1	37	c.637	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	T	17.68	3.448274	0.63178	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27	5.2	5.2	0.72013	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75428	0.3848	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D;D	0.65815	0.991;0.995;0.995;0.995;0.987;0.993	P;D;P;P;P;D	0.64776	0.861;0.929;0.834;0.861;0.773;0.914	T	0.76769	-0.2837	9	0.48119	T	0.1	.	4.6101	0.12399	0.1696:0.0873:0.0:0.7431	.	213;213;213;213;213;213	Q15746-6;Q15746-5;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	H	213	ENSP00000354004:N213H;ENSP00000353452:N213H;ENSP00000352088:N213H;ENSP00000320622:N213H;ENSP00000418335:N213H	ENSP00000320622:N213H	N	-	1	0	MYLK	124939032	1.000000	0.71417	0.994000	0.49952	0.879000	0.50718	1.417000	0.34770	2.185000	0.69588	0.533000	0.62120	AAC	MYLK	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000065534		0.552	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	129	0.00	0	T	NM_053025		123456342	123456342	-1	no_errors	ENST00000360304	ensembl	human	known	69_37n	missense	192	11.47	25	SNP	0.979	G
MUC4	4585	genome.wustl.edu	37	3	195507915	195507915	+	Silent	SNP	T	T	C	rs71635073		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:195507915T>C	ENST00000463781.3	-	2	10995	c.10536A>G	c.(10534-10536)tcA>tcG	p.S3512S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S3512S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S3512S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGGATGCTGAGGAAGCGC	0.587																																						dbGAP											1	Substitution - coding silent(1)	kidney(1)											45.0	38.0	40.0					3																	195507915		649	1586	2235	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10536A>G	3.37:g.195507915T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S3512	ENST00000463781.3	37	c.10536	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	10	0.00	0	T	NM_018406		195507915	195507915	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	30	16.67	6	SNP	0.047	C
MYO9A	4649	genome.wustl.edu	37	15	72141301	72141301	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr15:72141301T>A	ENST00000356056.5	-	39	7194	c.6722A>T	c.(6721-6723)gAa>gTa	p.E2241V	MYO9A_ENST00000444904.1_Missense_Mutation_p.E2222V|MYO9A_ENST00000564571.1_Missense_Mutation_p.E2241V|MYO9A_ENST00000424560.1_Missense_Mutation_p.E2312V	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2241	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.|Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AACAATCAGTTCCACACAACT	0.373																																						dbGAP											0													78.0	69.0	72.0					15																	72141301		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.6722A>T	15.37:g.72141301T>A	ENSP00000348349:p.Glu2241Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.E2312V	ENST00000356056.5	37	c.6935	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	T	15.78	2.934454	0.52866	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	T;T;T	0.50001	0.76;0.76;0.76	5.66	5.66	0.87406	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	.	.	.	.	T	0.78438	0.4283	H	0.95437	3.67	0.80722	D	1	P;D	0.89917	0.949;1.0	B;D	0.87578	0.36;0.998	D	0.85296	0.1070	9	0.87932	D	0	.	16.187	0.81960	0.0:0.0:0.0:1.0	.	2241;2005	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	V	2241;2312;2222	ENSP00000348349:E2241V;ENSP00000399162:E2312V;ENSP00000398250:E2222V	ENSP00000348349:E2241V	E	-	2	0	MYO9A	69928355	1.000000	0.71417	0.997000	0.53966	0.084000	0.17831	7.671000	0.83941	2.285000	0.76669	0.533000	0.62120	GAA	MYO9A	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000066933		0.373	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	112	0.00	0	T	NM_006901		72141301	72141301	-1	no_errors	ENST00000424560	ensembl	human	known	69_37n	missense	78	23.53	24	SNP	1.000	A
N4BP2	55728	genome.wustl.edu	37	4	40127807	40127807	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr4:40127807C>G	ENST00000261435.6	+	12	4800	c.4384C>G	c.(4384-4386)Cag>Gag	p.Q1462E		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1462					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AAAATCATCTCAGAGAACAGG	0.333																																						dbGAP											0													111.0	118.0	116.0					4																	40127807		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4384C>G	4.37:g.40127807C>G	ENSP00000261435:p.Gln1462Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR3|Q9NVK2|Q9P2D4	Nonsense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,smart_Smr/MutS2_C,pfscan_Smr/MutS2_C	p.S1108*	ENST00000261435.6	37	c.3323	CCDS3457.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.04|18.04	3.533905|3.533905	0.64972|0.64972	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000261435;ENST00000381804|ENST00000513269	T|.	0.18960|.	2.18|.	5.86|5.86	5.01|5.01	0.66863|0.66863	.|.	0.656832|.	0.15562|.	N|.	0.255894|.	T|.	0.45013|.	0.1321|.	L|L	0.36672|0.36672	1.1|1.1	0.30085|0.30085	N|N	0.80885|0.80885	P;B|.	0.35628|.	0.513;0.379|.	B;B|.	0.26202|.	0.067;0.03|.	T|.	0.40515|.	-0.9559|.	10|.	0.21540|0.17832	T|T	0.41|0.49	-1.6526|-1.6526	15.3064|15.3064	0.73995|0.73995	0.0:0.8605:0.1395:0.0|0.0:0.8605:0.1395:0.0	.|.	1462;1462|.	Q86UW6-2;Q86UW6|.	.;N4BP2_HUMAN|.	E|X	1462;1382|1108	ENSP00000261435:Q1462E|.	ENSP00000261435:Q1462E|ENSP00000426430:S1108X	Q|S	+|+	1|2	0|0	N4BP2|N4BP2	39804202|39804202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	2.879000|2.879000	0.48522|0.48522	1.600000|1.600000	0.50102|0.50102	0.650000|0.650000	0.86243|0.86243	CAG|TCA	N4BP2	-	NULL	ENSG00000078177		0.333	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2	78	0.00	0	C	NM_018177		40127807	40127807	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000513269	ensembl	human	known	69_37n	nonsense	23	42.50	17	SNP	1.000	G
NDNF	79625	genome.wustl.edu	37	4	121958518	121958518	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr4:121958518G>C	ENST00000379692.4	-	4	1134	c.608C>G	c.(607-609)tCt>tGt	p.S203C	NDNF_ENST00000506900.1_5'UTR	NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	203					cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						TTTCAGCAAAGAGGCAGTGGG	0.498																																						dbGAP											0													197.0	203.0	201.0					4																	121958518		2170	4279	6449	-	-	-	SO:0001583	missense	0			BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.608C>G	4.37:g.121958518G>C	ENSP00000369014:p.Ser203Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Q0|Q6UWE5|Q9H5P7	Missense_Mutation	SNP	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.S203C	ENST00000379692.4	37	c.608	CCDS3717.2	4	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069333	0.55539	.	.	ENSG00000173376	ENST00000379692	T	0.55413	0.52	5.84	5.84	0.93424	.	0.049373	0.85682	D	0.000000	T	0.68988	0.3061	M	0.63428	1.95	0.80722	D	1	D	0.63046	0.992	P	0.60345	0.873	T	0.67003	-0.5780	10	0.48119	T	0.1	-25.8724	20.1346	0.98019	0.0:0.0:1.0:0.0	.	203	Q8TB73	NDNF_HUMAN	C	203	ENSP00000369014:S203C	ENSP00000369014:S203C	S	-	2	0	NDNF	122177968	1.000000	0.71417	0.503000	0.27626	0.997000	0.91878	5.344000	0.65981	2.765000	0.95021	0.655000	0.94253	TCT	NDNF	-	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000173376		0.498	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNF	HGNC	protein_coding	OTTHUMT00000256532.2	188	0.00	0	G	NM_024574		121958518	121958518	-1	no_errors	ENST00000379692	ensembl	human	known	69_37n	missense	153	19.37	37	SNP	0.998	C
NEB	4703	genome.wustl.edu	37	2	152467080	152467080	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:152467080C>G	ENST00000172853.10	-	76	11386	c.11239G>C	c.(11239-11241)Gat>Cat	p.D3747H	NEB_ENST00000603639.1_Missense_Mutation_p.D3990H|NEB_ENST00000604864.1_Missense_Mutation_p.D3990H|NEB_ENST00000427231.2_Missense_Mutation_p.D3990H|NEB_ENST00000397345.3_Missense_Mutation_p.D3990H|NEB_ENST00000409198.1_Missense_Mutation_p.D3747H			P20929	NEBU_HUMAN	nebulin	3747					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GAAATAGCATCTGCTCTCAGA	0.458																																						dbGAP											0													180.0	184.0	182.0					2																	152467080		2010	4160	6170	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11239G>C	2.37:g.152467080C>G	ENSP00000172853:p.Asp3747His	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.D3990H	ENST00000172853.10	37	c.11968		2	.	.	.	.	.	.	.	.	.	.	C	32	5.180579	0.94846	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.87144	0.6104	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88810	0.3291	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	3747	P20929	NEBU_HUMAN	H	3747;3990;3990;3747	ENSP00000386259:D3747H;ENSP00000380505:D3990H;ENSP00000416578:D3990H;ENSP00000172853:D3747H	ENSP00000172853:D3747H	D	-	1	0	NEB	152175326	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	7.729000	0.84864	2.941000	0.99782	0.655000	0.94253	GAT	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.458	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		150	0.00	0	C	NM_004543		152467080	152467080	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	149	13.71	24	SNP	1.000	G
NLRC5	84166	genome.wustl.edu	37	16	57075469	57075469	+	Silent	SNP	C	C	T	rs145670367	byFrequency	TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr16:57075469C>T	ENST00000262510.6	+	18	3237	c.3012C>T	c.(3010-3012)ctC>ctT	p.L1004L	NLRC5_ENST00000436936.1_Silent_p.L1004L|NLRC5_ENST00000539144.1_Silent_p.L1004L|NLRC5_ENST00000308149.7_Silent_p.L1004L	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1004					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GCTGCCACCTCGGTCACCTCC	0.537																																						dbGAP											0													78.0	73.0	75.0					16																	57075469		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3012C>T	16.37:g.57075469C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	NULL	p.S35L	ENST00000262510.6	37	c.104	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	C	2.550	-0.304361	0.05495	.	.	ENSG00000140853	ENST00000538805	.	.	.	2.43	-2.71	0.05986	.	.	.	.	.	T	0.28632	0.0709	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.32322	-0.9911	4	.	.	.	.	6.9862	0.24729	0.0:0.3332:0.0:0.6668	.	.	.	.	W	757	.	.	R	+	1	2	NLRC5	55632970	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	-1.918000	0.01574	-0.689000	0.05149	-0.812000	0.03155	CGG	NLRC5	-	NULL	ENSG00000140853		0.537	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	242	0.00	0	C	NM_032206		57075469	57075469	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000540182	ensembl	human	known	69_37n	missense	97	24.22	31	SNP	0.000	T
NLRP7	199713	genome.wustl.edu	37	19	55451001	55451001	+	Missense_Mutation	SNP	G	G	A	rs368470657		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:55451001G>A	ENST00000590030.1	-	3	1226	c.1186C>T	c.(1186-1188)Cgt>Tgt	p.R396C	NLRP7_ENST00000340844.2_Missense_Mutation_p.R396C|NLRP7_ENST00000592784.1_Missense_Mutation_p.R396C|NLRP7_ENST00000588756.1_Missense_Mutation_p.R396C|NLRP7_ENST00000448121.2_Missense_Mutation_p.R396C|NLRP7_ENST00000328092.5_Missense_Mutation_p.R396C|NLRP7_ENST00000446217.1_Missense_Mutation_p.R424C			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	396	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CAGAGGAAACGCAGGAACAGC	0.706																																						dbGAP											0													7.0	8.0	7.0					19																	55451001		2041	4053	6094	-	-	-	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1186C>T	19.37:g.55451001G>A	ENSP00000465520:p.Arg396Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R424C	ENST00000590030.1	37	c.1270	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556633	0.27827	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.74632	-0.8;-0.8;-0.86;-0.83	1.89	-0.479	0.12089	.	0.840893	0.09715	N	0.765148	T	0.72236	0.3435	L	0.37630	1.12	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	P;D;D;D	0.67103	0.847;0.911;0.911;0.949	T	0.58532	-0.7620	10	0.35671	T	0.21	.	0.9019	0.01276	0.1572:0.231:0.3775:0.2343	.	424;396;396;396	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	C	396;396;396;424;163	ENSP00000329568:R396C;ENSP00000409137:R396C;ENSP00000339491:R396C;ENSP00000414273:R424C	ENSP00000329568:R396C	R	-	1	0	NLRP7	60142813	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	0.228000	0.17814	-0.050000	0.13356	0.462000	0.41574	CGT	NLRP7	-	NULL	ENSG00000167634		0.706	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	18	0.00	0	G	NM_139176		55451001	55451001	-1	no_errors	ENST00000446217	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	0.039	A
NLRP13	126204	genome.wustl.edu	37	19	56424553	56424553	+	Silent	SNP	G	G	A	rs371490465		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:56424553G>A	ENST00000342929.3	-	5	629	c.630C>T	c.(628-630)gaC>gaT	p.D210D	NLRP13_ENST00000588751.1_Silent_p.D210D	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	210							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CCTCATGTTCGTCCTTTGATG	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		18036	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													166.0	173.0	170.0					19																	56424553		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.630C>T	19.37:g.56424553G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTR5	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D210	ENST00000342929.3	37	c.630	CCDS33119.1	19																																																																																			NLRP13	-	NULL	ENSG00000173572		0.498	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	102	0.00	0	G	NM_176810		56424553	56424553	-1	no_errors	ENST00000342929	ensembl	human	known	69_37n	silent	112	13.18	17	SNP	0.000	A
NOD2	64127	genome.wustl.edu	37	16	50744980	50744980	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr16:50744980C>T	ENST00000300589.2	+	4	1263	c.1158C>T	c.(1156-1158)ttC>ttT	p.F386F	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	386	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				AGTTCAAGTTCAGGTTCACGG	0.547																																						dbGAP											0													88.0	79.0	82.0					16																	50744980		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.1158C>T	16.37:g.50744980C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Silent	SNP	pfam_CARD,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.F386	ENST00000300589.2	37	c.1158	CCDS10746.1	16																																																																																			NOD2	-	pfscan_NACHT_NTPase	ENSG00000167207		0.547	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD2	HGNC	protein_coding	OTTHUMT00000256876.2	49	0.00	0	C	NM_022162		50744980	50744980	+1	no_errors	ENST00000300589	ensembl	human	known	69_37n	silent	22	21.43	6	SNP	1.000	T
NRCAM	4897	genome.wustl.edu	37	7	107823364	107823364	+	Splice_Site	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:107823364G>T	ENST00000425651.2	-	20	2304	c.2305C>A	c.(2305-2307)Ccc>Acc	p.P769T	NRCAM_ENST00000351718.4_Splice_Site_p.P753T|NRCAM_ENST00000413765.2_Splice_Site_p.P750T|NRCAM_ENST00000379022.4_Splice_Site_p.P769T|NRCAM_ENST00000379028.3_Splice_Site_p.P769T|NRCAM_ENST00000379024.4_Splice_Site_p.P750T	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	769	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CCATTCAAGGGCTACAAGGAA	0.428																																						dbGAP											0													50.0	48.0	48.0					7																	107823364		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2305-1C>A	7.37:g.107823364G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P769T	ENST00000425651.2	37	c.2305	CCDS47686.1	7	.	.	.	.	.	.	.	.	.	.	G	18.88	3.718274	0.68844	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979	T;T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11;0.11	5.58	5.58	0.84498	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.210324	0.51477	D	0.000096	T	0.74191	0.3684	M	0.77616	2.38	0.58432	D	0.999998	D;P;D;D;D	0.76494	0.98;0.747;0.984;0.98;0.999	D;P;D;P;D	0.77557	0.924;0.598;0.933;0.89;0.99	T	0.76443	-0.2957	10	0.62326	D	0.03	.	11.0526	0.47898	0.1436:0.0:0.8564:0.0	.	769;750;750;753;769	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	T	769;769;750;769;753;750;769;769;753	ENSP00000368314:P769T;ENSP00000407858:P750T;ENSP00000325269:P753T;ENSP00000368310:P750T;ENSP00000401244:P769T;ENSP00000368308:P769T	ENSP00000325269:P753T	P	-	1	0	NRCAM	107610600	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.807000	0.69157	2.602000	0.87976	0.650000	0.86243	CCC	NRCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000091129		0.428	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	37	0.00	0	G	NM_001037132	Missense_Mutation	107823364	107823364	-1	no_errors	ENST00000379028	ensembl	human	known	69_37n	missense	40	20.00	10	SNP	1.000	T
OBSL1	23363	genome.wustl.edu	37	2	220418356	220418356	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:220418356G>A	ENST00000404537.1	-	16	4985	c.4929C>T	c.(4927-4929)ggC>ggT	p.G1643G	OBSL1_ENST00000265318.4_3'UTR|OBSL1_ENST00000373876.1_Silent_p.G1551G	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1643	Ig-like 13.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		TAGCTGTGTCGCCCTCGGTCA	0.617																																						dbGAP											0													53.0	57.0	55.0					2																	220418356		2098	4206	6304	-	-	-	SO:0001819	synonymous_variant	0			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.4929C>T	2.37:g.220418356G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G1643	ENST00000404537.1	37	c.4929	CCDS46520.1	2																																																																																			OBSL1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000124006		0.617	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	43	0.00	0	G			220418356	220418356	-1	no_errors	ENST00000404537	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	0.974	A
OCRL	4952	genome.wustl.edu	37	X	128674765	128674765	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:128674765C>T	ENST00000371113.4	+	2	249	c.84C>T	c.(82-84)tgC>tgT	p.C28C	OCRL_ENST00000486673.1_Intron|OCRL_ENST00000357121.5_Silent_p.C28C	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	28	PH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						GGGAGCCCTGCGCCCTGACCC	0.617																																						dbGAP											0													69.0	72.0	71.0					X																	128674765		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.84C>T	X.37:g.128674765C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Silent	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.C28	ENST00000371113.4	37	c.84	CCDS35393.1	X																																																																																			OCRL	-	NULL	ENSG00000122126		0.617	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	OCRL	HGNC	protein_coding	OTTHUMT00000058917.1	76	0.00	0	C	NM_000276		128674765	128674765	+1	no_errors	ENST00000371113	ensembl	human	known	69_37n	silent	63	28.89	26	SNP	0.991	T
OR4D11	219986	genome.wustl.edu	37	11	59271218	59271218	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:59271218C>A	ENST00000313253.1	+	1	170	c.170C>A	c.(169-171)aCc>aAc	p.T57N		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						CGCCTTCACACCCCCATGTAC	0.478																																						dbGAP											0													212.0	207.0	209.0					11																	59271218		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.170C>A	11.37:g.59271218C>A	ENSP00000320077:p.Thr57Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T57N	ENST00000313253.1	37	c.170	CCDS31563.1	11	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459182	0.63401	.	.	ENSG00000176200	ENST00000313253	T	0.00478	7.13	5.45	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.133205	0.33834	N	0.004512	T	0.00906	0.0030	M	0.80183	2.485	0.31694	N	0.641522	P	0.48503	0.911	P	0.52710	0.707	T	0.08472	-1.0720	10	0.72032	D	0.01	-34.6487	8.8569	0.35234	0.0:0.7637:0.1533:0.083	.	57	Q8NGI4	OR4DB_HUMAN	N	57	ENSP00000320077:T57N	ENSP00000320077:T57N	T	+	2	0	OR4D11	59027794	0.000000	0.05858	1.000000	0.80357	0.962000	0.63368	0.671000	0.25172	2.559000	0.86315	0.563000	0.77884	ACC	OR4D11	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176200		0.478	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D11	HGNC	protein_coding	OTTHUMT00000394236.1	139	0.00	0	C	NM_001004706		59271218	59271218	+1	no_errors	ENST00000313253	ensembl	human	known	69_37n	missense	215	15.23	39	SNP	0.971	A
PABPC3	5042	genome.wustl.edu	37	13	25670378	25670378	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:25670378C>G	ENST00000281589.3	+	1	79	c.42C>G	c.(40-42)taC>taG	p.Y14*		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	14	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.Y14*(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CCTCGCTCTACGTGGGGGACC	0.637																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											58.0	56.0	57.0					13																	25670378		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.42C>G	13.37:g.25670378C>G	ENSP00000281589:p.Tyr14*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHV0|Q9H086	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.Y14*	ENST00000281589.3	37	c.42	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	C	34	5.412866	0.96072	.	.	ENSG00000151846	ENST00000281589	.	.	.	0.546	0.546	0.17196	.	0.000000	0.35407	U	0.003232	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.8935	0.05684	0.0:0.6302:0.0:0.3697	.	.	.	.	X	14	.	ENSP00000281589:Y14X	Y	+	3	2	PABPC3	24568378	0.829000	0.29322	0.739000	0.30968	0.181000	0.23173	-0.372000	0.07504	0.558000	0.29135	0.305000	0.20034	TAC	PABPC3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000151846		0.637	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	47	0.00	0	C	NM_030979		25670378	25670378	+1	no_errors	ENST00000281589	ensembl	human	known	69_37n	nonsense	90	15.74	17	SNP	1.000	G
PAG1	55824	genome.wustl.edu	37	8	81888988	81888988	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:81888988C>T	ENST00000220597.4	-	9	1800	c.1090G>A	c.(1090-1092)Gac>Aac	p.D364N	PAG1_ENST00000523463.1_5'Flank	NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	364					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			TTTTCGAAGTCTTTAACAGTA	0.527																																						dbGAP											0													94.0	93.0	93.0					8																	81888988		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.1090G>A	8.37:g.81888988C>T	ENSP00000220597:p.Asp364Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	NULL	p.D364N	ENST00000220597.4	37	c.1090	CCDS6227.1	8	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006600	0.74932	.	.	ENSG00000076641	ENST00000220597	.	.	.	5.05	5.05	0.67936	.	0.049678	0.85682	D	0.000000	T	0.75722	0.3888	M	0.69823	2.125	0.80722	D	1	D	0.53619	0.961	P	0.57620	0.824	T	0.78932	-0.2009	9	0.72032	D	0.01	-29.2297	18.3459	0.90322	0.0:1.0:0.0:0.0	.	364	Q9NWQ8	PAG1_HUMAN	N	364	.	ENSP00000220597:D364N	D	-	1	0	PAG1	82051543	1.000000	0.71417	0.982000	0.44146	0.380000	0.30137	5.524000	0.67105	2.501000	0.84356	0.655000	0.94253	GAC	PAG1	-	NULL	ENSG00000076641		0.527	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	98	0.00	0	C	NM_018440		81888988	81888988	-1	no_errors	ENST00000220597	ensembl	human	known	69_37n	missense	136	14.91	24	SNP	0.998	T
PARP4	143	genome.wustl.edu	37	13	25021216	25021216	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:25021216C>T	ENST00000381989.3	-	26	3328	c.3223G>A	c.(3223-3225)Gtg>Atg	p.V1075M		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1075					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AAGGACGGCACCTGGGCTGGG	0.522																																						dbGAP											0													64.0	53.0	56.0					13																	25021216		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3223G>A	13.37:g.25021216C>T	ENSP00000371419:p.Val1075Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.V1075M	ENST00000381989.3	37	c.3223	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	C	16.51	3.143370	0.57044	.	.	ENSG00000102699	ENST00000381989	T	0.01947	4.54	4.71	3.85	0.44370	.	0.142659	0.45361	D	0.000364	T	0.06005	0.0156	M	0.64997	1.995	0.31187	N	0.701412	D	0.58620	0.983	P	0.56474	0.799	T	0.01356	-1.1376	10	0.51188	T	0.08	-19.8983	6.4649	0.21975	0.0:0.8086:0.0:0.1914	.	1075	Q9UKK3	PARP4_HUMAN	M	1075	ENSP00000371419:V1075M	ENSP00000371419:V1075M	V	-	1	0	PARP4	23919216	1.000000	0.71417	0.996000	0.52242	0.778000	0.44026	3.535000	0.53575	2.615000	0.88500	0.644000	0.83932	GTG	PARP4	-	NULL	ENSG00000102699		0.522	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	37	0.00	0	C	NM_006437		25021216	25021216	-1	no_errors	ENST00000381989	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	0.974	T
PARPBP	55010	genome.wustl.edu	37	12	102569397	102569397	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:102569397C>G	ENST00000358383.5	+	7	1003	c.958C>G	c.(958-960)Caa>Gaa	p.Q320E	PARPBP_ENST00000535811.1_Intron|PARPBP_ENST00000543784.1_Intron|PARPBP_ENST00000392911.2_Missense_Mutation_p.Q239E|PARPBP_ENST00000327680.2_Missense_Mutation_p.Q239E|PARPBP_ENST00000378128.3_Intron|PARPBP_ENST00000541394.1_Missense_Mutation_p.Q397E			Q9NWS1	PARI_HUMAN	PARP1 binding protein	320					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						TATCAATTCTCAAGAAGGTGT	0.363																																						dbGAP											0													84.0	88.0	87.0					12																	102569397		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.958C>G	12.37:g.102569397C>G	ENSP00000351153:p.Gln320Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Missense_Mutation	SNP	NULL	p.Q320E	ENST00000358383.5	37	c.958	CCDS9090.2	12	.	.	.	.	.	.	.	.	.	.	C	12.30	1.895867	0.33442	.	.	ENSG00000185480	ENST00000327680;ENST00000541394;ENST00000358383;ENST00000392911	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.43	4.52	0.55395	.	0.162448	0.64402	N	0.000016	T	0.39733	0.1089	M	0.71581	2.175	0.44123	D	0.996906	B;B	0.28350	0.208;0.021	B;B	0.23574	0.047;0.016	T	0.25710	-1.0124	10	0.36615	T	0.2	-3.5113	9.5077	0.39058	0.0:0.7814:0.1443:0.0744	.	397;320	B4DZ31;Q9NWS1	.;PR1BP_HUMAN	E	239;397;320;239	ENSP00000332915:Q239E;ENSP00000440850:Q397E;ENSP00000351153:Q320E;ENSP00000376643:Q239E	ENSP00000332915:Q239E	Q	+	1	0	C12orf48	101093527	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.151000	0.58105	1.239000	0.43787	0.655000	0.94253	CAA	PARPBP	-	NULL	ENSG00000185480		0.363	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	121	0.00	0	C	NM_017915		102569397	102569397	+1	no_errors	ENST00000358383	ensembl	human	known	69_37n	missense	155	18.42	35	SNP	1.000	G
PATL2	197135	genome.wustl.edu	37	15	44965451	44965451	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr15:44965451G>A	ENST00000560775.1	-	4	487	c.428C>T	c.(427-429)tCg>tTg	p.S143L	PATL2_ENST00000434130.1_Missense_Mutation_p.S143L|PATL2_ENST00000560780.1_5'UTR|PATL2_ENST00000558573.1_5'Flank			C9JE40	PATL2_HUMAN	protein associated with topoisomerase II homolog 2 (yeast)	143					negative regulation of cytoplasmic mRNA processing body assembly (GO:0010607)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	RNA binding (GO:0003723)			kidney(2)|stomach(1)	3						AGGGGGCCACGAGGTCAGCAG	0.612																																						dbGAP											0													67.0	70.0	69.0					15																	44965451		687	1589	2276	-	-	-	SO:0001583	missense	0			BC036924	CCDS45253.1	15q21.1	2010-06-04			ENSG00000229474	ENSG00000229474			33630	protein-coding gene	gene with protein product		614661				17936923	Standard	NM_001145112		Approved		uc010uej.2	C9JE40		ENST00000560775.1:c.428C>T	15.37:g.44965451G>A	ENSP00000453915:p.Ser143Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Topo_II-assoc_PAT1	p.S143L	ENST00000560775.1	37	c.428	CCDS45253.1	15	.	.	.	.	.	.	.	.	.	.	G	13.46	2.243419	0.39697	.	.	ENSG00000229474	ENST00000434130	T	0.18016	2.24	5.25	5.25	0.73442	.	.	.	.	.	T	0.28532	0.0706	M	0.69823	2.125	0.29480	N	0.856412	D	0.57571	0.98	P	0.48704	0.587	T	0.13019	-1.0525	9	0.30854	T	0.27	-21.5241	14.3525	0.66713	0.0:0.0:1.0:0.0	.	143	C9JE40	PATL2_HUMAN	L	143	ENSP00000416673:S143L	ENSP00000416673:S143L	S	-	2	0	PATL2	42752743	0.996000	0.38824	0.689000	0.30133	0.134000	0.20937	2.832000	0.48152	2.463000	0.83235	0.462000	0.41574	TCG	PATL2	-	NULL	ENSG00000229474		0.612	PATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL2	HGNC	protein_coding	OTTHUMT00000415947.1	156	0.00	0	G	NM_001145112		44965451	44965451	-1	no_errors	ENST00000434130	ensembl	human	known	69_37n	missense	102	25.00	34	SNP	0.924	A
PCF11	51585	genome.wustl.edu	37	11	82876651	82876651	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:82876651C>T	ENST00000298281.4	+	5	1164	c.712C>T	c.(712-714)Ctt>Ttt	p.L238F		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	238					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GGCAGTTTCTCTTAGTGTTCA	0.378																																						dbGAP											0													49.0	47.0	48.0					11																	82876651		1875	4105	5980	-	-	-	SO:0001583	missense	0			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.712C>T	11.37:g.82876651C>T	ENSP00000298281:p.Leu238Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.L238F	ENST00000298281.4	37	c.712	CCDS44689.1	11	.	.	.	.	.	.	.	.	.	.	C	12.74	2.027661	0.35797	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.46451	1.91;0.93;0.87	5.69	4.76	0.60689	.	0.000000	0.48767	D	0.000167	T	0.59321	0.2185	M	0.62723	1.935	0.38584	D	0.950255	D;D	0.76494	0.999;0.999	D;D	0.80764	0.942;0.994	T	0.62586	-0.6823	9	.	.	.	-10.0855	12.1773	0.54192	0.0:0.918:0.0:0.082	.	238;238	E9PQ01;O94913	.;PCF11_HUMAN	F	238	ENSP00000298281:L238F;ENSP00000434540:L238F;ENSP00000431567:L238F	.	L	+	1	0	PCF11	82554299	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.952000	0.49097	1.334000	0.45468	0.655000	0.94253	CTT	PCF11	-	NULL	ENSG00000165494		0.378	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	HGNC	protein_coding	OTTHUMT00000392548.2	42	0.00	0	C	NM_015885		82876651	82876651	+1	no_errors	ENST00000298281	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	1.000	T
PCNXL2	80003	genome.wustl.edu	37	1	233121777	233121777	+	Intron	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:233121777C>T	ENST00000258229.9	-	33	6475				PCNXL2_ENST00000344698.2_Missense_Mutation_p.E753K	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GTGCCACGCTCAGGCCAGGAG	0.652																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.6240+60G>A	1.37:g.233121777C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.E753K	ENST00000258229.9	37	c.2257	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	9.930	1.214566	0.22289	.	.	ENSG00000135749	ENST00000344698	T	0.24151	1.87	2.27	-4.54	0.03452	.	.	.	.	.	T	0.14227	0.0344	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.25433	-1.0132	8	0.87932	D	0	.	1.3357	0.02144	0.1362:0.3371:0.2719:0.2548	.	753	A6NKB5-3	.	K	753	ENSP00000340759:E753K	ENSP00000340759:E753K	E	-	1	0	PCNXL2	231188400	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.093000	0.00608	-1.995000	0.00971	-0.305000	0.09177	GAG	PCNXL2	-	NULL	ENSG00000135749		0.652	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	12	0.00	0	C	NM_014801		233121777	233121777	-1	no_errors	ENST00000344698	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.000	T
PDCD11	22984	genome.wustl.edu	37	10	105160163	105160163	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr10:105160163G>A	ENST00000369797.3	+	3	206	c.112G>A	c.(112-114)Gaa>Aaa	p.E38K		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	38					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GATTTCTACTGAAGAGGGATC	0.443																																						dbGAP											0													44.0	52.0	49.0					10																	105160163		2203	4300	6503	-	-	-	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.112G>A	10.37:g.105160163G>A	ENSP00000358812:p.Glu38Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.E38K	ENST00000369797.3	37	c.112	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442547	0.83993	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.11063	2.81	5.84	4.94	0.65067	.	0.264196	0.43919	D	0.000505	T	0.07413	0.0187	N	0.25485	0.75	0.50813	D	0.999899	P	0.36874	0.572	B	0.27076	0.076	T	0.32640	-0.9899	10	0.38643	T	0.18	-14.4043	12.7778	0.57459	0.0764:0.0:0.9236:0.0	.	38	Q14690	RRP5_HUMAN	K	38	ENSP00000358812:E38K	ENSP00000358812:E38K	E	+	1	0	PDCD11	105150153	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.435000	0.66532	1.479000	0.48272	0.561000	0.74099	GAA	PDCD11	-	NULL	ENSG00000148843		0.443	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	171	0.00	0	G			105160163	105160163	+1	no_errors	ENST00000369797	ensembl	human	known	69_37n	missense	84	47.50	76	SNP	1.000	A
PDCD6	10016	genome.wustl.edu	37	5	272878	272878	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr5:272878C>G	ENST00000264933.4	+	2	254	c.154C>G	c.(154-156)Ctc>Gtc	p.L52V	PDCD6_ENST00000509581.1_Missense_Mutation_p.L52V|PDCD6_ENST00000507528.1_Missense_Mutation_p.L52V|PDCD6_ENST00000505221.1_Missense_Mutation_p.L52V|CTD-2083E4.6_ENST00000512642.1_RNA	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	52	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCAGCAAGCTCTCTCCAACGG	0.502																																						dbGAP											0													20.0	27.0	24.0					5																	272878		2187	4291	6478	-	-	-	SO:0001583	missense	0			AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.154C>G	5.37:g.272878C>G	ENSP00000264933:p.Leu52Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.L52V	ENST00000264933.4	37	c.154	CCDS3854.1	5	.	.	.	.	.	.	.	.	.	.	c	10.47	1.360279	0.24598	.	.	ENSG00000249915	ENST00000264933;ENST00000505221;ENST00000507528;ENST00000509581;ENST00000507473	D;T;D;T;D	0.82255	-1.59;2.46;-1.59;2.46;-1.59	4.34	0.11	0.14611	EF-hand-like domain (1);	.	.	.	.	D	0.91317	0.7262	H	0.95780	3.72	0.24385	N	0.994777	B;D;P	0.61080	0.011;0.989;0.507	B;D;P	0.74348	0.025;0.983;0.608	T	0.80144	-0.1505	9	0.87932	D	0	.	3.3397	0.07114	0.0:0.4183:0.2069:0.3748	.	84;52;52	B4DHG2;Q2YDC2;O75340	.;.;PDCD6_HUMAN	V	52;52;52;52;18	ENSP00000264933:L52V;ENSP00000422085:L52V;ENSP00000423815:L52V;ENSP00000422691:L52V;ENSP00000425370:L18V	ENSP00000264933:L52V	L	+	1	0	PDCD6	325878	0.069000	0.21087	0.009000	0.14445	0.115000	0.19883	0.296000	0.19083	0.119000	0.18210	-0.370000	0.07254	CTC	PDCD6	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000249915		0.502	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDCD6	HGNC	protein_coding	OTTHUMT00000206609.2	40	0.00	0	C	NM_013232		272878	272878	+1	no_errors	ENST00000264933	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	0.007	G
PDHA1	5160	genome.wustl.edu	37	X	19373834	19373834	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:19373834G>A	ENST00000422285.2	+	8	895	c.790G>A	c.(790-792)Gag>Aag	p.E264K	PDHA1_ENST00000379804.1_5'UTR|PDHA1_ENST00000545074.1_Missense_Mutation_p.E271K|PDHA1_ENST00000379806.5_Missense_Mutation_p.E302K|PDHA1_ENST00000540249.1_Missense_Mutation_p.E233K			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	264					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					GTGCGTCCGAGAGGCAACAAG	0.488																																						dbGAP											0													127.0	108.0	115.0					X																	19373834		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.790G>A	X.37:g.19373834G>A	ENSP00000394382:p.Glu264Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.E302K	ENST00000422285.2	37	c.904	CCDS14192.1	X	.	.	.	.	.	.	.	.	.	.	G	36	5.643626	0.96704	.	.	ENSG00000131828	ENST00000379806;ENST00000545074;ENST00000540249;ENST00000422285	D;D;D;D	0.95918	-3.85;-3.85;-3.85;-3.85	5.64	5.64	0.86602	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	M	0.78456	2.415	0.80722	D	1	P;D;D;D;D	0.71674	0.462;0.99;0.998;0.982;0.998	B;D;D;P;D	0.71656	0.363;0.941;0.974;0.891;0.974	D	0.97960	1.0337	10	0.62326	D	0.03	-15.8775	18.9649	0.92692	0.0:0.0:1.0:0.0	.	233;271;264;302;264	B7Z3X5;B7Z3T7;B2R5P7;A5YVE9;P08559	.;.;.;.;ODPA_HUMAN	K	302;271;233;264	ENSP00000369134:E302K;ENSP00000438550:E271K;ENSP00000440761:E233K;ENSP00000394382:E264K	ENSP00000369134:E302K	E	+	1	0	PDHA1	19283755	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.420000	0.97426	2.513000	0.84729	0.594000	0.82650	GAG	PDHA1	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000131828		0.488	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDHA1	HGNC	protein_coding	OTTHUMT00000055977.1	174	0.00	0	G			19373834	19373834	+1	no_errors	ENST00000379806	ensembl	human	known	69_37n	missense	161	23.22	49	SNP	1.000	A
PDZD11	51248	genome.wustl.edu	37	X	69509159	69509159	+	Silent	SNP	C	C	T	rs192256637		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:69509159C>T	ENST00000239666.4	-	2	165	c.33G>A	c.(31-33)ccG>ccA	p.P11P	KIF4A_ENST00000374388.3_5'Flank|PDZD11_ENST00000473667.1_5'UTR|PDZD11_ENST00000374454.1_Silent_p.P11P|KIF4A_ENST00000374403.3_5'Flank	NM_016484.4	NP_057568.1	Q5EBL8	PDZ11_HUMAN	PDZ domain containing 11	11						basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	protein C-terminus binding (GO:0008022)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)	9						AGAAAACCACCGGGTAGTCAT	0.507													c|||	1	0.000264901	0.0	0.0	3775	,	,		14667	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													80.0	61.0	68.0					X																	69509159		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151061	CCDS14400.1	Xq13.1	2008-02-05		2006-01-24	ENSG00000120509	ENSG00000120509			28034	protein-coding gene	gene with protein product		300632		PDZK11		11042152, 12975309	Standard	NM_016484		Approved		uc004dyd.1	Q5EBL8	OTTHUMG00000021771	ENST00000239666.4:c.33G>A	X.37:g.69509159C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVU3|Q6UWE1|Q9P0Q1	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P11	ENST00000239666.4	37	c.33	CCDS14400.1	X																																																																																			PDZD11	-	NULL	ENSG00000120509		0.507	PDZD11-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD11	HGNC	protein_coding	OTTHUMT00000057060.1	236	0.00	0	C	NM_016484		69509159	69509159	-1	no_errors	ENST00000239666	ensembl	human	known	69_37n	silent	139	19.65	34	SNP	0.170	T
PELI1	57162	genome.wustl.edu	37	2	64321937	64321937	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:64321937G>A	ENST00000358912.4	-	7	1598	c.1156C>T	c.(1156-1158)Cat>Tat	p.H386Y		NM_020651.3	NP_065702.2	Q96FA3	PELI1_HUMAN	pellino E3 ubiquitin protein ligase 1	386					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|protein K48-linked ubiquitination (GO:0070936)|response to dsRNA (GO:0043331)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	19						TGAGTACCATGAGGAAGTGGG	0.483																																						dbGAP											0													120.0	105.0	110.0					2																	64321937		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1876.1	2p13.3	2012-02-23	2012-02-23		ENSG00000197329	ENSG00000197329		"""Pellino homologs"""	8827	protein-coding gene	gene with protein product		614797	"""pellino (Drosophila) homolog 1"", ""pellino homolog 1 (Drosophila)"""			11306823, 16951688	Standard	NM_020651		Approved		uc002sct.4	Q96FA3	OTTHUMG00000129511	ENST00000358912.4:c.1156C>T	2.37:g.64321937G>A	ENSP00000351789:p.His386Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96SM0|Q9GZY5|Q9HCX0	Missense_Mutation	SNP	pfam_Pellino	p.H386Y	ENST00000358912.4	37	c.1156	CCDS1876.1	2	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878066	0.72294	.	.	ENSG00000197329	ENST00000358912	T	0.48201	0.82	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.72407	0.3456	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71009	-0.4716	10	0.44086	T	0.13	-16.5696	20.2187	0.98312	0.0:0.0:1.0:0.0	.	386	Q96FA3	PELI1_HUMAN	Y	386	ENSP00000351789:H386Y	ENSP00000351789:H386Y	H	-	1	0	PELI1	64175441	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.780000	0.95670	0.655000	0.94253	CAT	PELI1	-	pfam_Pellino	ENSG00000197329		0.483	PELI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELI1	HGNC	protein_coding	OTTHUMT00000251686.1	129	0.00	0	G	NM_020651		64321937	64321937	-1	no_errors	ENST00000358912	ensembl	human	known	69_37n	missense	95	34.93	51	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178917478	178917478	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:178917478G>A	ENST00000263967.3	+	3	510	c.353G>A	c.(352-354)gGt>gAt	p.G118D		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	118			G -> D (in CWS5). {ECO:0000269|PubMed:23246288}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.G118D(26)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTTATTAAAGGTTTTGCTATC	0.338		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	26	Substitution - Missense(26)	endometrium(11)|breast(4)|large_intestine(3)|central_nervous_system(3)|lung(3)|prostate(2)											93.0	87.0	89.0					3																	178917478		1809	4071	5880	-	-	-	SO:0001630	splice_region_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.353-1G>A	3.37:g.178917478G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G118D	ENST00000263967.3	37	c.353	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954561	0.53293	.	.	ENSG00000121879	ENST00000263967	T	0.46451	0.87	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.58722	0.2142	M	0.63843	1.955	0.80722	D	1	D	0.61080	0.989	P	0.56398	0.797	T	0.53823	-0.8384	9	.	.	.	.	20.1236	0.97970	0.0:0.0:1.0:0.0	.	118	P42336	PK3CA_HUMAN	D	118	ENSP00000263967:G118D	.	G	+	2	0	PIK3CA	180400172	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	9.471000	0.97696	2.746000	0.94184	0.563000	0.77884	GGT	PIK3CA	-	NULL	ENSG00000121879		0.338	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	83	0.00	0	G		Missense_Mutation	178917478	178917478	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	57	40.00	38	SNP	1.000	A
PLAGL2	5326	genome.wustl.edu	37	20	30784659	30784659	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr20:30784659G>C	ENST00000246229.4	-	3	1351	c.1087C>G	c.(1087-1089)Ctg>Gtg	p.L363V		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	363					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AGCTCCGCCAGAAAACTATCC	0.577																																					Colon(163;15 1893 11280 16306 47518)	dbGAP											0													27.0	31.0	30.0					20																	30784659		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.1087C>G	20.37:g.30784659G>C	ENSP00000246229:p.Leu363Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8T5|E1P5M3|Q92584	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L363V	ENST00000246229.4	37	c.1087	CCDS13197.1	20	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484376	0.44147	.	.	ENSG00000126003	ENST00000246229	T	0.10668	2.85	5.31	3.35	0.38373	.	0.074882	0.56097	D	0.000037	T	0.19604	0.0471	L	0.47190	1.495	0.48632	D	0.999686	D	0.63880	0.993	D	0.67548	0.952	T	0.01345	-1.1379	10	0.51188	T	0.08	.	5.4366	0.16484	0.1977:0.0:0.6423:0.16	.	363	Q9UPG8	PLAL2_HUMAN	V	363	ENSP00000246229:L363V	ENSP00000246229:L363V	L	-	1	2	PLAGL2	30248320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.279000	0.43435	0.790000	0.33803	0.650000	0.86243	CTG	PLAGL2	-	NULL	ENSG00000126003		0.577	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAGL2	HGNC	protein_coding	OTTHUMT00000078615.2	129	0.00	0	G	NM_002657		30784659	30784659	-1	no_errors	ENST00000246229	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	1.000	C
POLR3K	51728	genome.wustl.edu	37	16	103518	103518	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr16:103518G>A	ENST00000293860.5	-	1	110	c.69C>T	c.(67-69)ttC>ttT	p.F23F	SNRNP25_ENST00000383018.3_5'Flank	NM_016310.3	NP_057394.2	Q9Y2Y1	RPC10_HUMAN	polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa	23					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				TGTTGCAGGAGAAGCGGTGGC	0.687											OREG0003710	type=REGULATORY REGION|Gene=C16orf33|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													85.0	66.0	73.0					16																	103518		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF051316	CCDS10395.1	16p13.3	2013-01-21	2002-08-29		ENSG00000161980	ENSG00000161980		"""RNA polymerase subunits"""	14121	protein-coding gene	gene with protein product		606007	"""polymerase (RNA) III (DNA directed) polypeptide K (12.3 kDa)"""			9869639, 10079944	Standard	NM_016310		Approved	RPC11	uc002cfi.2	Q9Y2Y1	OTTHUMG00000060722	ENST00000293860.5:c.69C>T	16.37:g.103518G>A		Somatic	585	WXS	Illumina GAIIx	Phase_IV	Q1W6H4|Q96S35	Silent	SNP	pfam_Znf_TFIIS,pfam_DNA-dir_RNA_pol_M/15kDasu,smart_DNA-dir_RNA_pol_M/15kDasu,smart_Znf_TFIIS,pfscan_Znf_TFIIS	p.F23	ENST00000293860.5	37	c.69	CCDS10395.1	16																																																																																			POLR3K	-	pfam_DNA-dir_RNA_pol_M/15kDasu,smart_DNA-dir_RNA_pol_M/15kDasu	ENSG00000161980		0.687	POLR3K-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	POLR3K	HGNC	protein_coding	OTTHUMT00000134192.1	36	0.00	0	G	NM_016310		103518	103518	-1	no_errors	ENST00000293860	ensembl	human	known	69_37n	silent	33	19.51	8	SNP	1.000	A
PPP1R7	5510	genome.wustl.edu	37	2	242089920	242089920	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:242089920G>A	ENST00000234038.6	+	1	484	c.10G>A	c.(10-12)Gaa>Aaa	p.E4K	PPP1R7_ENST00000402734.1_Intron|PPP1R7_ENST00000404405.3_Missense_Mutation_p.E4K|PPP1R7_ENST00000272983.8_Missense_Mutation_p.E4K|PASK_ENST00000539818.1_5'Flank|PPP1R7_ENST00000401987.1_Missense_Mutation_p.E4K|PASK_ENST00000358649.4_5'Flank|PASK_ENST00000405260.1_5'Flank|PPP1R7_ENST00000407025.1_Missense_Mutation_p.E4K|PASK_ENST00000403638.3_5'Flank|PASK_ENST00000234040.4_5'Flank|PPP1R7_ENST00000406106.3_Missense_Mutation_p.E4K	NM_001282412.1|NM_001282413.1|NM_002712.1	NP_001269341.1|NP_001269342.1|NP_002703.1	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	4					positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	enzyme regulator activity (GO:0030234)|protein phosphatase type 1 regulator activity (GO:0008599)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)	23		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		CATGGCGGCGGAACGCGGCGC	0.716																																					NSCLC(62;446 1299 5417 11238 27640)	dbGAP											0													15.0	19.0	18.0					2																	242089920		2184	4285	6469	-	-	-	SO:0001583	missense	0			AF067136	CCDS2546.1, CCDS63190.1, CCDS63192.1, CCDS63193.1, CCDS63194.1	2q37.3	2012-04-17	2011-10-04		ENSG00000115685	ENSG00000115685		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9295	protein-coding gene	gene with protein product		602877	"""protein phosphatase 1, regulatory (inhibitor) subunit 7"""			7498485, 7670491, 10231361	Standard	NM_001282413		Approved	sds22	uc002wat.1	Q15435	OTTHUMG00000133390	ENST00000234038.6:c.10G>A	2.37:g.242089920G>A	ENSP00000234038:p.Glu4Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFD4|B5MCY6|Q9UQE5|Q9UQE6|Q9Y6K4	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_U2A'_phosphoprotein32A_C	p.E4K	ENST00000234038.6	37	c.10	CCDS2546.1	2	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420825	0.62622	.	.	ENSG00000115685	ENST00000407025;ENST00000272983;ENST00000234038;ENST00000404405;ENST00000439916;ENST00000406106;ENST00000401987	T;T;T;T;T;T;T	0.49432	0.78;0.87;0.78;0.93;1.18;1.1;0.93	4.51	4.51	0.55191	.	0.343157	0.27478	N	0.019200	T	0.29524	0.0736	N	0.08118	0	0.32009	N	0.602303	B;B;B;B	0.22146	0.027;0.039;0.065;0.039	B;B;B;B	0.19946	0.017;0.007;0.027;0.017	T	0.29243	-1.0018	10	0.35671	T	0.21	-6.0946	15.4098	0.74908	0.0:0.0:1.0:0.0	.	4;4;4;4	Q15435-2;Q15435;Q15435-3;B5MBZ8	.;PP1R7_HUMAN;.;.	K	4	ENSP00000385657:E4K;ENSP00000272983:E4K;ENSP00000234038:E4K;ENSP00000385498:E4K;ENSP00000409719:E4K;ENSP00000385022:E4K;ENSP00000385466:E4K	ENSP00000234038:E4K	E	+	1	0	PPP1R7	241738593	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.165000	0.64959	2.058000	0.61347	0.491000	0.48974	GAA	PPP1R7	-	NULL	ENSG00000115685		0.716	PPP1R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R7	HGNC	protein_coding	OTTHUMT00000257244.4	49	0.00	0	G	NM_002712		242089920	242089920	+1	no_errors	ENST00000234038	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.987	A
PRKDC	5591	genome.wustl.edu	37	8	48839893	48839893	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:48839893C>T	ENST00000314191.2	-	21	2336	c.2280G>A	c.(2278-2280)ctG>ctA	p.L760L	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Silent_p.L760L	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	760					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GGGTATAGCTCAGGCCCAGTT	0.373								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											0													69.0	62.0	65.0					8																	48839893		1859	4095	5954	-	-	-	SO:0001819	synonymous_variant	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.2280G>A	8.37:g.48839893C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L760	ENST00000314191.2	37	c.2280		8																																																																																			PRKDC	-	superfamily_ARM-type_fold	ENSG00000253729		0.373	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		86	0.00	0	C	NM_001081640		48839893	48839893	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	silent	82	31.45	39	SNP	1.000	T
PROM2	150696	genome.wustl.edu	37	2	95952919	95952919	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:95952919G>A	ENST00000317620.9	+	19	2266	c.2133G>A	c.(2131-2133)ctG>ctA	p.L711L	PROM2_ENST00000542147.1_Silent_p.L662L|PROM2_ENST00000317668.4_Silent_p.L711L|PROM2_ENST00000403131.2_Silent_p.L711L	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	711					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						TCACCTACCTGAAAGGAGAGC	0.572																																						dbGAP											0													58.0	55.0	56.0					2																	95952919		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.2133G>A	2.37:g.95952919G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Silent	SNP	pfam_Prominin	p.L711	ENST00000317620.9	37	c.2133	CCDS2012.1	2																																																																																			PROM2	-	pfam_Prominin	ENSG00000155066		0.572	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PROM2	HGNC	protein_coding	OTTHUMT00000252771.1	82	0.00	0	G	NM_144707		95952919	95952919	+1	no_errors	ENST00000317620	ensembl	human	known	69_37n	silent	54	28.21	22	SNP	0.013	A
PRR14L	253143	genome.wustl.edu	37	22	32108358	32108359	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr22:32108358_32108359delGT	ENST00000327423.6	-	4	5655_5656	c.5466_5467delAC	c.(5464-5469)acacttfs	p.L1824fs	PRR14L_ENST00000434485.1_Frame_Shift_Del_p.L1824fs|PRR14L_ENST00000397493.2_Frame_Shift_Del_p.L1824fs	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1824										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						AGTGCTAGAAGTGTGTGAAGGC	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.5466_5467delAC	22.37:g.32108362_32108363delGT	ENSP00000331845:p.Leu1824fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Frame_Shift_Del	DEL	NULL	p.L1823fs	ENST00000327423.6	37	c.5467_5466	CCDS13900.2	22																																																																																			PRR14L	-	NULL	ENSG00000183530		0.540	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	172	0.00	0	GT	NM_173566		32108358	32108359	-1	no_errors	ENST00000397493	ensembl	human	known	69_37n	frame_shift_del	123	17.45	26	DEL	0.875:0.026	-
PTGFRN	5738	genome.wustl.edu	37	1	117484574	117484574	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:117484574G>A	ENST00000393203.2	+	2	434	c.287G>A	c.(286-288)cGg>cAg	p.R96Q		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	96	Ig-like C2-type 1.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CTGTTAAGGCGGACTGCCAAC	0.597																																						dbGAP											0													79.0	74.0	76.0					1																	117484574		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.287G>A	1.37:g.117484574G>A	ENSP00000376899:p.Arg96Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R96Q	ENST00000393203.2	37	c.287	CCDS890.1	1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686983	0.88639	.	.	ENSG00000134247	ENST00000393203	T	0.64803	-0.12	5.2	5.2	0.72013	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73567	0.3603	M	0.77616	2.38	0.20489	N	0.999892	D	0.89917	1.0	D	0.87578	0.998	T	0.67814	-0.5573	10	0.52906	T	0.07	-20.3169	16.5857	0.84727	0.0:0.0:1.0:0.0	.	96	Q9P2B2	FPRP_HUMAN	Q	96	ENSP00000376899:R96Q	ENSP00000376899:R96Q	R	+	2	0	PTGFRN	117286097	1.000000	0.71417	0.011000	0.14972	0.887000	0.51463	8.381000	0.90152	2.604000	0.88044	0.467000	0.42956	CGG	PTGFRN	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000134247		0.597	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1	87	0.00	0	G	NM_020440		117484574	117484574	+1	no_errors	ENST00000393203	ensembl	human	known	69_37n	missense	45	16.36	9	SNP	0.119	A
PTK6	5753	genome.wustl.edu	37	20	62163969	62163969	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr20:62163969G>A	ENST00000217185.2	-	5	769	c.742C>T	c.(742-744)Ctg>Ttg	p.L248L	PTK6_ENST00000542869.1_Silent_p.L147L	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	248	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	TACAGCGCCAGGATGTGTTTG	0.647																																						dbGAP											0													123.0	99.0	107.0					20																	62163969		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.742C>T	20.37:g.62163969G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCR3|B4DW46|Q58F01	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.L248	ENST00000217185.2	37	c.742	CCDS13524.1	20																																																																																			PTK6	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000101213		0.647	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK6	HGNC	protein_coding	OTTHUMT00000080313.1	30	0.00	0	G			62163969	62163969	-1	no_errors	ENST00000217185	ensembl	human	known	69_37n	silent	26	18.18	6	SNP	0.974	A
QSER1	79832	genome.wustl.edu	37	11	32955397	32955397	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:32955397C>G	ENST00000399302.2	+	4	2541	c.2206C>G	c.(2206-2208)Ctt>Gtt	p.L736V	QSER1_ENST00000527788.1_Missense_Mutation_p.L497V	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	736	Gln-rich.							p.L736I(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TTTACAAATTCTTCAGCAGTC	0.418																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											93.0	88.0	89.0					11																	32955397		1899	4119	6018	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2206C>G	11.37:g.32955397C>G	ENSP00000382241:p.Leu736Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.L736V	ENST00000399302.2	37	c.2206	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790828	0.50102	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.27402	2.1;1.67	5.64	4.72	0.59763	.	0.196186	0.35555	N	0.003139	T	0.25680	0.0625	L	0.32530	0.975	0.41219	D	0.986493	P;P;B	0.41524	0.753;0.525;0.39	B;B;B	0.41174	0.349;0.182;0.089	T	0.03807	-1.1002	10	0.72032	D	0.01	.	11.0427	0.47840	0.0:0.8578:0.0:0.1422	.	497;497;736	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	V	736;497;497	ENSP00000382241:L736V;ENSP00000432766:L497V	ENSP00000078652:L497V	L	+	1	0	QSER1	32911973	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.308000	0.43690	2.673000	0.90976	0.591000	0.81541	CTT	QSER1	-	NULL	ENSG00000060749		0.418	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	38	0.00	0	C	NM_024774		32955397	32955397	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	39	30.36	17	SNP	1.000	G
QSER1	79832	genome.wustl.edu	37	11	32955563	32955563	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:32955563C>G	ENST00000399302.2	+	4	2707	c.2372C>G	c.(2371-2373)tCt>tGt	p.S791C	QSER1_ENST00000527788.1_Missense_Mutation_p.S552C	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	791										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					CCTCAAAATTCTGAAGTTATG	0.378																																						dbGAP											0													92.0	88.0	89.0					11																	32955563		1904	4124	6028	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2372C>G	11.37:g.32955563C>G	ENSP00000382241:p.Ser791Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.S791C	ENST00000399302.2	37	c.2372	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444654	0.63178	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.27402	2.05;1.67	5.69	5.69	0.88448	.	0.102279	0.46758	D	0.000280	T	0.48169	0.1485	L	0.36672	1.1	0.43508	D	0.995768	D;D;D	0.89917	1.0;0.998;0.988	D;P;P	0.69479	0.964;0.891;0.635	T	0.42050	-0.9474	10	0.66056	D	0.02	.	19.8937	0.96942	0.0:1.0:0.0:0.0	.	552;552;791	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	C	791;552;552	ENSP00000382241:S791C;ENSP00000432766:S552C	ENSP00000078652:S552C	S	+	2	0	QSER1	32912139	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	3.789000	0.55454	2.717000	0.92951	0.650000	0.86243	TCT	QSER1	-	NULL	ENSG00000060749		0.378	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	38	0.00	0	C	NM_024774		32955563	32955563	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	36	15.56	7	SNP	1.000	G
RBM25	58517	genome.wustl.edu	37	14	73576159	73576159	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr14:73576159C>G	ENST00000261973.7	+	14	1936	c.1651C>G	c.(1651-1653)Ctg>Gtg	p.L551V	RBM25_ENST00000527432.1_Missense_Mutation_p.L551V|RBM25_ENST00000532483.1_3'UTR	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	551	Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		GCAGCGCCTTCTGGCAGAAGG	0.517																																						dbGAP											0													89.0	88.0	89.0					14																	73576159		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1651C>G	14.37:g.73576159C>G	ENSP00000261973:p.Leu551Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	pfam_PWI,pfam_RRM_dom,superfamily_PWI,smart_RRM_dom,smart_PWI,pfscan_RRM_dom	p.L551V	ENST00000261973.7	37	c.1651	CCDS32113.1	14	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500796	0.44455	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.11712	2.75;2.75	5.97	1.0	0.19881	.	0.000000	0.85682	D	0.000000	T	0.07503	0.0189	L	0.38175	1.15	0.80722	D	1	B	0.25521	0.128	B	0.20955	0.032	T	0.36529	-0.9744	10	0.17832	T	0.49	.	9.6142	0.39681	0.0:0.5977:0.0:0.4023	.	551	P49756	RBM25_HUMAN	V	551	ENSP00000261973:L551V;ENSP00000431150:L551V	ENSP00000261973:L551V	L	+	1	2	RBM25	72645912	0.901000	0.30685	0.965000	0.40720	0.976000	0.68499	0.788000	0.26872	-0.079000	0.12707	-0.140000	0.14226	CTG	RBM25	-	NULL	ENSG00000119707		0.517	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	HGNC	protein_coding	OTTHUMT00000394966.1	118	0.00	0	C	XM_027330		73576159	73576159	+1	no_errors	ENST00000261973	ensembl	human	known	69_37n	missense	78	32.17	37	SNP	0.927	G
RCBTB2	1102	genome.wustl.edu	37	13	49089446	49089446	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:49089446C>T	ENST00000344532.3	-	6	667	c.244G>A	c.(244-246)Gac>Aac	p.D82N	RCBTB2_ENST00000544904.1_Missense_Mutation_p.D58N|RCBTB2_ENST00000481144.1_5'UTR|RCBTB2_ENST00000544492.1_5'UTR|RCBTB2_ENST00000430805.2_Missense_Mutation_p.D87N	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	82					positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		CTCTGGACGTCACCTAACCCC	0.428																																						dbGAP											0													130.0	137.0	135.0					13																	49089446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.244G>A	13.37:g.49089446C>T	ENSP00000345144:p.Asp82Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDW8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.D87N	ENST00000344532.3	37	c.259	CCDS9411.1	13	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632994	0.67015	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544904	T;T;T	0.81247	-1.47;-1.47;-1.47	5.87	5.03	0.67393	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.80639	0.4661	L	0.33792	1.035	0.80722	D	1	B;D;B;B	0.65815	0.017;0.995;0.007;0.117	B;P;B;B	0.58013	0.012;0.831;0.004;0.056	T	0.76669	-0.2874	10	0.15952	T	0.53	.	15.1903	0.73038	0.0:0.9326:0.0:0.0674	.	58;87;86;82	B4DPP7;B4DWG0;B3KVB1;O95199	.;.;.;RCBT2_HUMAN	N	82;86;87;87;58	ENSP00000345144:D82N;ENSP00000389910:D87N;ENSP00000443904:D58N	ENSP00000345144:D82N	D	-	1	0	RCBTB2	47987447	1.000000	0.71417	0.935000	0.37517	0.998000	0.95712	7.445000	0.80570	1.627000	0.50400	0.655000	0.94253	GAC	RCBTB2	-	superfamily_Reg_csome_cond/b-lactamase_inh	ENSG00000136161		0.428	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCBTB2	HGNC	protein_coding	OTTHUMT00000044888.2	70	0.00	0	C	NM_001268		49089446	49089446	-1	no_errors	ENST00000430805	ensembl	human	known	69_37n	missense	76	23.53	24	SNP	1.000	T
RFFL	117584	genome.wustl.edu	37	17	33344550	33344550	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:33344550C>T	ENST00000315249.7	-	4	889	c.667G>A	c.(667-669)Gag>Aag	p.E223K	RFFL_ENST00000415395.2_Missense_Mutation_p.E223K|RFFL_ENST00000413582.2_Missense_Mutation_p.E223K|RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000584655.1_Intron|RFFL_ENST00000378516.2_Missense_Mutation_p.E223K|RFFL_ENST00000394597.2_Missense_Mutation_p.E223K|RFFL_ENST00000447669.2_Missense_Mutation_p.E223K|RFFL_ENST00000268850.7_Intron					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ACCTGGGTCTCATCCTCAGCA	0.527																																						dbGAP											0													65.0	59.0	61.0					17																	33344550		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.667G>A	17.37:g.33344550C>T	ENSP00000326170:p.Glu223Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_RING,pfscan_Znf_RING	p.E223K	ENST00000315249.7	37	c.667	CCDS11286.1	17	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574206	0.65878	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000413582	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.15	5.15	0.70609	.	0.491819	0.22864	N	0.054705	T	0.57873	0.2083	L	0.48642	1.525	0.80722	D	1	D;P;D	0.67145	0.996;0.844;0.996	D;B;D	0.77557	0.99;0.164;0.987	T	0.56974	-0.7890	10	0.56958	D	0.05	-20.7327	15.4905	0.75602	0.0:1.0:0.0:0.0	.	223;223;223	C9JN73;Q8WZ73;Q8WZ73-2	.;RFFL_HUMAN;.	K	223	ENSP00000326170:E223K;ENSP00000378096:E223K;ENSP00000367777:E223K;ENSP00000408513:E223K	ENSP00000326170:E223K	E	-	1	0	RFFL	30368663	0.998000	0.40836	0.989000	0.46669	0.995000	0.86356	3.819000	0.55686	2.673000	0.90976	0.655000	0.94253	GAG	RFFL	-	NULL	ENSG00000092871		0.527	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFFL	HGNC	protein_coding	OTTHUMT00000256460.2	184	0.00	0	C	NM_057178		33344550	33344550	-1	no_errors	ENST00000315249	ensembl	human	known	69_37n	missense	88	42.14	67	SNP	0.996	T
RGAG1	57529	genome.wustl.edu	37	X	109694797	109694797	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:109694797G>A	ENST00000465301.2	+	3	1198	c.952G>A	c.(952-954)Gaa>Aaa	p.E318K	RGAG1_ENST00000540313.1_Missense_Mutation_p.E318K	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	318										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TCCAGGCTCTGAAGTAATGTC	0.488																																						dbGAP											0													255.0	231.0	239.0					X																	109694797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.952G>A	X.37:g.109694797G>A	ENSP00000419786:p.Glu318Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.E318K	ENST00000465301.2	37	c.952	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	G	10.97	1.502434	0.26949	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.44881	0.91;0.91	4.32	3.46	0.39613	.	1.153120	0.06676	N	0.767172	T	0.31918	0.0812	N	0.14661	0.345	0.09310	N	1	P	0.45827	0.867	P	0.44811	0.461	T	0.17715	-1.0360	9	.	.	.	0.1073	9.4189	0.38539	0.1085:0.0:0.8915:0.0	.	318	Q8NET4	RGAG1_HUMAN	K	318	ENSP00000419786:E318K;ENSP00000441452:E318K	.	E	+	1	0	RGAG1	109581453	0.390000	0.25213	0.002000	0.10522	0.012000	0.07955	3.193000	0.50997	1.161000	0.42604	0.600000	0.82982	GAA	RGAG1	-	NULL	ENSG00000243978		0.488	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	245	0.00	0	G	NM_020769		109694797	109694797	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	101	31.08	46	SNP	0.009	A
RIN2	54453	genome.wustl.edu	37	20	19955639	19955639	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr20:19955639C>G	ENST00000255006.6	+	8	1266	c.1117C>G	c.(1117-1119)Cgg>Ggg	p.R373G	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	324					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						CACAAGCCCTCGGCTGGCCAG	0.602																																						dbGAP											0													80.0	85.0	84.0					20																	19955639		1954	4156	6110	-	-	-	SO:0001583	missense	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1117C>G	20.37:g.19955639C>G	ENSP00000255006:p.Arg373Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.R373G	ENST00000255006.6	37	c.1117	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347998	0.24426	.	.	ENSG00000132669	ENST00000255006	T	0.08634	3.07	5.59	3.64	0.41730	.	0.996321	0.08142	N	0.991484	T	0.05960	0.0155	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35599	-0.9782	9	.	.	.	-2.4601	15.3116	0.74039	0.0:0.6515:0.3485:0.0	.	324	Q8WYP3	RIN2_HUMAN	G	373	ENSP00000255006:R373G	.	R	+	1	2	RIN2	19903639	0.872000	0.30054	0.999000	0.59377	0.974000	0.67602	1.551000	0.36233	0.706000	0.31912	-0.211000	0.12701	CGG	RIN2	-	NULL	ENSG00000132669		0.602	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	76	0.00	0	C			19955639	19955639	+1	no_errors	ENST00000255006	ensembl	human	known	69_37n	missense	42	12.24	6	SNP	1.000	G
ROPN1	54763	genome.wustl.edu	37	3	123694230	123694230	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:123694230C>T	ENST00000184183.4	-	5	732	c.392G>A	c.(391-393)gGa>gAa	p.G131E	ROPN1_ENST00000405845.3_Missense_Mutation_p.G131E	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	131						cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		ACTTACAACTCCCAGAGCGCT	0.502																																						dbGAP											0													10.0	11.0	11.0					3																	123694230		2158	4263	6421	-	-	-	SO:0001583	missense	0			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.392G>A	3.37:g.123694230C>T	ENSP00000184183:p.Gly131Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN99|Q9UF38	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.G131E	ENST00000184183.4	37	c.392	CCDS3026.1	3	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338111	0.41398	.	.	ENSG00000065371	ENST00000184183;ENST00000405845	T;T	0.19669	2.13;2.13	4.61	4.61	0.57282	.	0.070457	0.56097	D	0.000029	T	0.42720	0.1215	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.28681	-1.0036	10	0.72032	D	0.01	-38.6816	14.9935	0.71412	0.0:1.0:0.0:0.0	.	131	Q9HAT0	ROP1A_HUMAN	E	131	ENSP00000184183:G131E;ENSP00000385919:G131E	ENSP00000184183:G131E	G	-	2	0	ROPN1	125176920	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	4.462000	0.60121	2.614000	0.88457	0.644000	0.83932	GGA	ROPN1	-	NULL	ENSG00000065371		0.502	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROPN1	HGNC	protein_coding	OTTHUMT00000356188.2	42	0.00	0	C	NM_017578		123694230	123694230	-1	no_errors	ENST00000184183	ensembl	human	known	69_37n	missense	23	50.00	24	SNP	1.000	T
RPTOR	57521	genome.wustl.edu	37	17	78923268	78923268	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:78923268G>A	ENST00000306801.3	+	28	3653	c.3291G>A	c.(3289-3291)aaG>aaA	p.K1097K	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Silent_p.K939K	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1097					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GGGTCTGGAAGAATTTTGCTG	0.612																																						dbGAP											0													210.0	195.0	200.0					17																	78923268		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3291G>A	17.37:g.78923268G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.K1097	ENST00000306801.3	37	c.3291	CCDS11773.1	17																																																																																			RPTOR	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000141564		0.612	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	64	0.00	0	G	NM_020761		78923268	78923268	+1	no_errors	ENST00000306801	ensembl	human	known	69_37n	silent	16	20.00	4	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	34094087	34094087	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr15:34094087G>A	ENST00000389232.4	+	69	10006	c.9936G>A	c.(9934-9936)gaG>gaA	p.E3312E	RYR3_ENST00000415757.3_Silent_p.E3312E	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3312					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGAGAGAAGAGCAAAATTTTG	0.323																																						dbGAP											0													43.0	39.0	40.0					15																	34094087		1807	4066	5873	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9936G>A	15.37:g.34094087G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E3312	ENST00000389232.4	37	c.9936	CCDS45210.1	15																																																																																			RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.323	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	97	0.00	0	G			34094087	34094087	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	81	19.80	20	SNP	1.000	A
SALL4	57167	genome.wustl.edu	37	20	50405595	50405595	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr20:50405595C>T	ENST00000217086.4	-	3	2658	c.2547G>A	c.(2545-2547)tcG>tcA	p.S849S	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Silent_p.S72S|SALL4_ENST00000395997.3_Silent_p.S412S	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	849					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGGACAATGTCGAGGGTCCCA	0.577																																						dbGAP											0													59.0	56.0	57.0					20																	50405595		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2547G>A	20.37:g.50405595C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2D8|Q540H3|Q6Y8G6	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S849	ENST00000217086.4	37	c.2547	CCDS13438.1	20																																																																																			SALL4	-	NULL	ENSG00000101115		0.577	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	85	0.00	0	C			50405595	50405595	-1	no_errors	ENST00000217086	ensembl	human	known	69_37n	silent	48	35.14	26	SNP	0.000	T
SETX	23064	genome.wustl.edu	37	9	135173682	135173682	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:135173682C>T	ENST00000224140.5	-	13	5748	c.5566G>A	c.(5566-5568)Gag>Aag	p.E1856K	SETX_ENST00000372169.2_Missense_Mutation_p.E1856K|SETX_ENST00000393220.1_Missense_Mutation_p.E1856K	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1856					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AGGTAACACTCAGTTTTCCCA	0.373																																						dbGAP											0													78.0	74.0	76.0					9																	135173682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.5566G>A	9.37:g.135173682C>T	ENSP00000224140:p.Glu1856Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NULL	p.E1856K	ENST00000224140.5	37	c.5566	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495089	0.64186	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.90385	-2.11;-2.66;-2.19;-1.8	5.88	4.97	0.65823	.	0.424311	0.21916	N	0.067237	D	0.90854	0.7127	L	0.32530	0.975	0.32249	N	0.571729	P;D;D	0.89917	0.462;0.999;1.0	B;D;D	0.85130	0.382;0.994;0.997	D	0.89023	0.3436	10	0.38643	T	0.18	.	8.1486	0.31126	0.0:0.8489:0.0:0.1511	.	1856;1856;1856	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	K	1856;98;1856;1856	ENSP00000224140:E1856K;ENSP00000409143:E98K;ENSP00000361242:E1856K;ENSP00000376913:E1856K	ENSP00000224140:E1856K	E	-	1	0	SETX	134163503	0.990000	0.36364	0.959000	0.39883	0.334000	0.28698	2.784000	0.47774	2.773000	0.95371	0.591000	0.81541	GAG	SETX	-	NULL	ENSG00000107290		0.373	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	52	0.00	0	C	NM_015046		135173682	135173682	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	0.885	T
SETX	23064	genome.wustl.edu	37	9	135203024	135203024	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:135203024C>T	ENST00000224140.5	-	10	4143	c.3961G>A	c.(3961-3963)Gat>Aat	p.D1321N	SETX_ENST00000372169.2_Missense_Mutation_p.D1321N|SETX_ENST00000393220.1_Missense_Mutation_p.D1321N	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1321					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTTCGGGTATCAACTACTCCA	0.403																																						dbGAP											0													61.0	61.0	61.0					9																	135203024		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.3961G>A	9.37:g.135203024C>T	ENSP00000224140:p.Asp1321Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NULL	p.D1321N	ENST00000224140.5	37	c.3961	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088079	0.36855	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87103	-2.12;-2.21;-1.82	5.75	3.91	0.45181	.	1.123880	0.06773	N	0.783887	D	0.86628	0.5978	M	0.65975	2.015	0.09310	N	1	B;B;B	0.23806	0.091;0.024;0.091	B;B;B	0.26517	0.07;0.008;0.07	T	0.73238	-0.4046	10	0.33141	T	0.24	.	10.8934	0.47008	0.0:0.8506:0.0:0.1494	.	1321;1321;1321	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	N	1321	ENSP00000224140:D1321N;ENSP00000361242:D1321N;ENSP00000376913:D1321N	ENSP00000224140:D1321N	D	-	1	0	SETX	134192845	0.000000	0.05858	0.013000	0.15412	0.246000	0.25737	0.178000	0.16820	1.431000	0.47355	0.650000	0.86243	GAT	SETX	-	NULL	ENSG00000107290		0.403	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	150	0.00	0	C	NM_015046		135203024	135203024	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	missense	115	24.18	37	SNP	0.014	T
SFTPB	6439	genome.wustl.edu	37	2	85892750	85892750	+	Silent	SNP	C	C	T	rs543913426	byFrequency	TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:85892750C>T	ENST00000519937.2	-	5	580	c.561G>A	c.(559-561)gcG>gcA	p.A187A	SFTPB_ENST00000393822.3_Silent_p.A199A|SFTPB_ENST00000409383.1_Silent_p.A199A|SFTPB_ENST00000342375.3_Silent_p.A187A			P07988	PSPB_HUMAN	surfactant protein B	187					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						GCCCAGGCCTCGCCTGGAGGG	0.677													c|||	2	0.000399361	0.0008	0.0	5008	,	,		16274	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													32.0	35.0	34.0					2																	85892750		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.561G>A	2.37:g.85892750C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96R04	Missense_Mutation	SNP	pfam_SapB_2,pfam_SapA,pfam_SapB_1,superfamily_Saposin-like,smart_SapA,smart_SaposinB,prints_Saposin,pfscan_SapA,pfscan_SaposinB	p.E184K	ENST00000519937.2	37	c.550		2	.	.	.	.	.	.	.	.	.	.	c	10.23	1.292572	0.23564	.	.	ENSG00000168878	ENST00000428225	.	.	.	4.7	-1.97	0.07503	.	.	.	.	.	T	0.22666	0.0547	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26018	-1.0115	4	.	.	.	1.0166	4.6474	0.12579	0.0:0.3518:0.2851:0.3631	.	.	.	.	K	184	.	.	E	-	1	0	SFTPB	85746261	0.000000	0.05858	0.000000	0.03702	0.457000	0.32468	-0.228000	0.09114	-0.912000	0.03837	0.556000	0.70494	GAG	SFTPB	-	NULL	ENSG00000168878		0.677	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	SFTPB	HGNC	protein_coding	OTTHUMT00000252499.3	58	0.00	0	C	NM_198843		85892750	85892750	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000428225	ensembl	human	novel	69_37n	missense	72	14.29	12	SNP	0.000	T
SGSM1	129049	genome.wustl.edu	37	22	25301121	25301121	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr22:25301121C>G	ENST00000400359.4	+	22	2957	c.2950C>G	c.(2950-2952)Ctt>Gtt	p.L984V	SGSM1_ENST00000400358.4_Missense_Mutation_p.L929V	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	984	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)	p.L929I(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CATGTGTGATCTTCTGGCTCC	0.537																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											283.0	275.0	278.0					22																	25301121		2143	4253	6396	-	-	-	SO:0001583	missense	0			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2950C>G	22.37:g.25301121C>G	ENSP00000383212:p.Leu984Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.L984V	ENST00000400359.4	37	c.2950	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317728	0.81469	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.07800	3.16;3.16	5.62	5.62	0.85841	Rab-GAP/TBC domain (4);	0.055931	0.64402	D	0.000001	T	0.33847	0.0877	M	0.80028	2.48	0.58432	D	0.999999	P;P;P;D	0.89917	0.66;0.712;0.928;1.0	P;P;P;D	0.91635	0.711;0.809;0.839;0.999	T	0.02411	-1.1163	10	0.72032	D	0.01	-28.6862	19.0368	0.92982	0.0:1.0:0.0:0.0	.	929;984;1001;984	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	V	984;929;984	ENSP00000383211:L929V;ENSP00000383212:L984V	ENSP00000383211:L929V	L	+	1	0	SGSM1	23631121	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.660000	0.61511	2.823000	0.97156	0.643000	0.83706	CTT	SGSM1	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000167037		0.537	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	186	0.00	0	C	XM_059318		25301121	25301121	+1	no_errors	ENST00000400359	ensembl	human	known	69_37n	missense	169	18.36	38	SNP	1.000	G
SH3BP1	23616	genome.wustl.edu	37	22	38040966	38040967	+	Splice_Site	INS	-	-	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr22:38040966_38040967insG	ENST00000357436.4	+	9	1090_1091	c.777_778insG	c.(778-780)gac>Ggac	p.D260fs	SH3BP1_ENST00000336738.5_Splice_Site_p.D260fs|SH3BP1_ENST00000442465.2_Splice_Site_p.D260fs|Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000495174.1_3'UTR|SH3BP1_ENST00000599616.1_Splice_Site_p.D196fs	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	260	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					ACGGCCAAGCAGGTGGGGACAT	0.609																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.778+1->G	22.37:g.38040968_38040968dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Frame_Shift_Ins	INS	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.D259fs	ENST00000357436.4	37	c.777_778	CCDS13952.2	22																																																																																			SH3BP1	-	pfscan_BAR_dom	ENSG00000100092		0.609	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000075884.4	16	0.00	0	-	NM_018957	Frame_Shift_Ins	38040966	38040967	+1	no_errors	ENST00000357436	ensembl	human	known	69_37n	frame_shift_ins	21	32.26	10	INS	1.000:1.000	G
SHANK1	50944	genome.wustl.edu	37	19	51215349	51215349	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:51215349G>A	ENST00000293441.1	-	6	833	c.815C>T	c.(814-816)tCc>tTc	p.S272F	SHANK1_ENST00000359082.3_Missense_Mutation_p.S272F|SHANK1_ENST00000391814.1_Missense_Mutation_p.S272F	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	272					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GTAGTTGGGGGAACCCCCAAG	0.597																																						dbGAP											0													49.0	53.0	51.0					19																	51215349		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.815C>T	19.37:g.51215349G>A	ENSP00000293441:p.Ser272Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.S272F	ENST00000293441.1	37	c.815	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795721	0.70452	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.55052	0.54;0.54;0.54	4.68	4.68	0.58851	Ankyrin repeat-containing domain (4);	0.000000	0.56097	U	0.000025	T	0.71091	0.3299	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75184	-0.3407	10	0.87932	D	0	-12.5872	16.7598	0.85509	0.0:0.0:1.0:0.0	.	272	Q9Y566	SHAN1_HUMAN	F	272	ENSP00000293441:S272F;ENSP00000351984:S272F;ENSP00000375690:S272F	ENSP00000293441:S272F	S	-	2	0	SHANK1	55907161	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.819000	0.86621	2.328000	0.79073	0.555000	0.69702	TCC	SHANK1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000161681		0.597	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	37	0.00	0	G	NM_016148		51215349	51215349	-1	no_errors	ENST00000391814	ensembl	human	known	69_37n	missense	16	54.29	19	SNP	1.000	A
SI	6476	genome.wustl.edu	37	3	164712085	164712085	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:164712085G>T	ENST00000264382.3	-	41	4863	c.4801C>A	c.(4801-4803)Cat>Aat	p.H1601N		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1601	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.H1601Y(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CCATTAGCATGAATTTCATGC	0.353										HNSCC(35;0.089)																												dbGAP											1	Substitution - Missense(1)	skin(1)											119.0	116.0	117.0					3																	164712085		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4801C>A	3.37:g.164712085G>T	ENSP00000264382:p.His1601Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.H1601N	ENST00000264382.3	37	c.4801	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818620	0.90790	.	.	ENSG00000090402	ENST00000264382	D	0.93488	-3.23	5.2	5.2	0.72013	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.94833	0.8331	L	0.55834	1.745	0.80722	D	1	P	0.44734	0.842	P	0.54026	0.74	D	0.94886	0.8043	10	0.72032	D	0.01	.	18.9473	0.92626	0.0:0.0:1.0:0.0	.	1601	P14410	SUIS_HUMAN	N	1601	ENSP00000264382:H1601N	ENSP00000264382:H1601N	H	-	1	0	SI	166194779	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	9.314000	0.96306	2.876000	0.98609	0.644000	0.83932	CAT	SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.353	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	190	0.00	0	G	NM_001041		164712085	164712085	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	189	12.04	26	SNP	1.000	T
SIPA1	6494	genome.wustl.edu	37	11	65409803	65409804	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:65409803_65409804insG	ENST00000394224.3	+	3	1058_1059	c.762_763insG	c.(763-765)gggfs	p.G255fs	SIPA1_ENST00000527525.1_Frame_Shift_Ins_p.G255fs|SIPA1_ENST00000394227.3_Frame_Shift_Ins_p.G255fs|SIPA1_ENST00000534313.1_Frame_Shift_Ins_p.G255fs	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	255					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						AGGGCAGCGGAGGGGGCACCCT	0.678																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.767dupG	11.37:g.65409808_65409808dupG	ENSP00000377771:p.Gly255fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O14518|O60484|O60618|Q2YD83	Frame_Shift_Ins	INS	pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.T256fs	ENST00000394224.3	37	c.762_763	CCDS8108.1	11																																																																																			SIPA1	-	NULL	ENSG00000213445		0.678	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SIPA1	HGNC	protein_coding	OTTHUMT00000390356.1	13	0.00	0	-	NM_006747		65409803	65409804	+1	no_errors	ENST00000394224	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.968:0.985	G
SLC12A3	6559	genome.wustl.edu	37	16	56924230	56924230	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr16:56924230G>A	ENST00000563236.1	+	19	2355	c.2330G>A	c.(2329-2331)cGg>cAg	p.R777Q	SLC12A3_ENST00000438926.2_Missense_Mutation_p.R777Q|SLC12A3_ENST00000262502.5_Missense_Mutation_p.R776Q|SLC12A3_ENST00000566786.1_Missense_Mutation_p.R776Q			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	777					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	ATGAGGATGCGGGAGGGACTC	0.517																																						dbGAP											0													185.0	129.0	148.0					16																	56924230		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2330G>A	16.37:g.56924230G>A	ENSP00000456149:p.Arg777Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSJ2|C9JNN9	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.R777Q	ENST00000563236.1	37	c.2330	CCDS58464.1	16	.	.	.	.	.	.	.	.	.	.	G	8.054	0.766550	0.15983	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.63	5.63	0.86233	.	0.167944	0.50627	D	0.000113	T	0.21062	0.0507	N	0.20610	0.595	0.31688	N	0.642228	B;P;P	0.46142	0.108;0.8;0.873	B;B;B	0.39258	0.024;0.155;0.295	T	0.11131	-1.0600	9	0.19147	T	0.46	.	10.2177	0.43179	0.1507:0.0:0.8493:0.0	.	776;777;777	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	Q	776;777	.	ENSP00000262502:R777Q	R	+	2	0	SLC12A3	55481731	0.975000	0.34042	0.962000	0.40283	0.237000	0.25408	2.102000	0.41796	2.644000	0.89710	0.655000	0.94253	CGG	SLC12A3	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000070915		0.517	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	HGNC	protein_coding	OTTHUMT00000432337.1	56	0.00	0	G			56924230	56924230	+1	no_errors	ENST00000438926	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.606	A
SLC13A4	26266	genome.wustl.edu	37	7	135366339	135366339	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:135366339C>G	ENST00000354042.4	-	16	2542	c.1853G>C	c.(1852-1854)aGg>aCg	p.R618T	SLC13A4_ENST00000491630.1_5'UTR|C7orf73_ENST00000422968.1_Intron	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	618					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						GTTGCTGACCCTCGCCCATGC	0.537																																						dbGAP											0													191.0	146.0	161.0					7																	135366339		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1853G>C	7.37:g.135366339C>G	ENSP00000297282:p.Arg618Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q4|Q8N631	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.R618T	ENST00000354042.4	37	c.1853	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	C	4.865	0.160774	0.09287	.	.	ENSG00000164707	ENST00000354042	T	0.67345	-0.26	5.11	-0.603	0.11630	.	0.807812	0.11624	N	0.545495	T	0.33294	0.0858	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.15206	-1.0445	10	0.14656	T	0.56	.	1.6571	0.02784	0.1366:0.1603:0.1417:0.5614	.	487;618	Q59HF0;Q9UKG4	.;S13A4_HUMAN	T	618	ENSP00000297282:R618T	ENSP00000297282:R618T	R	-	2	0	SLC13A4	135016879	0.012000	0.17670	0.415000	0.26534	0.477000	0.33069	0.265000	0.18515	-0.178000	0.10672	-0.474000	0.04947	AGG	SLC13A4	-	NULL	ENSG00000164707		0.537	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	100	0.00	0	C	NM_012450		135366339	135366339	-1	no_errors	ENST00000354042	ensembl	human	known	69_37n	missense	73	23.71	23	SNP	0.045	G
SLC38A1	81539	genome.wustl.edu	37	12	46600987	46600987	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:46600987C>A	ENST00000398637.5	-	8	1208	c.514G>T	c.(514-516)Gaa>Taa	p.E172*	SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000552197.1_Nonsense_Mutation_p.E172*|SLC38A1_ENST00000546893.1_Nonsense_Mutation_p.E172*|SLC38A1_ENST00000439706.1_Nonsense_Mutation_p.E172*|SLC38A1_ENST00000549049.1_Nonsense_Mutation_p.E172*	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	172					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			GAGGGTAGTTCATTTTTTACG	0.308																																						dbGAP											0													74.0	66.0	68.0					12																	46600987		1820	4081	5901	-	-	-	SO:0001587	stop_gained	0			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.514G>T	12.37:g.46600987C>A	ENSP00000381634:p.Glu172*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Nonsense_Mutation	SNP	pfam_AA_transpt_TM	p.E172*	ENST00000398637.5	37	c.514	CCDS41774.1	12	.	.	.	.	.	.	.	.	.	.	C	43	9.868138	0.99284	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	.	.	.	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-21.1328	20.3748	0.98911	0.0:1.0:0.0:0.0	.	.	.	.	X	172	.	ENSP00000381634:E172X	E	-	1	0	SLC38A1	44887254	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.779000	0.85648	2.817000	0.96982	0.563000	0.77884	GAA	SLC38A1	-	pfam_AA_transpt_TM	ENSG00000111371		0.308	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	HGNC	protein_coding	OTTHUMT00000404218.2	91	0.00	0	C			46600987	46600987	-1	no_errors	ENST00000398637	ensembl	human	known	69_37n	nonsense	74	27.62	29	SNP	1.000	A
SMC2	10592	genome.wustl.edu	37	9	106862469	106862469	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr9:106862469G>A	ENST00000286398.7	+	6	864	c.576G>A	c.(574-576)ctG>ctA	p.L192L	SMC2_ENST00000374793.3_Silent_p.L192L|SMC2_ENST00000303219.8_Silent_p.L192L|SMC2_ENST00000374787.3_Silent_p.L192L	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	192					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						AGGCTAAGCTGAAAGAAATTA	0.303																																						dbGAP											0													30.0	34.0	33.0					9																	106862469		2195	4283	6478	-	-	-	SO:0001819	synonymous_variant	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.576G>A	9.37:g.106862469G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEE0|Q9P1P2	Silent	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	p.L192	ENST00000286398.7	37	c.576	CCDS35086.1	9																																																																																			SMC2	-	pfam_RecF/RecN/SMC	ENSG00000136824		0.303	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	56	0.00	0	G			106862469	106862469	+1	no_errors	ENST00000286398	ensembl	human	known	69_37n	silent	18	55.00	22	SNP	1.000	A
SMC6	79677	genome.wustl.edu	37	2	17897524	17897524	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:17897524C>A	ENST00000448223.2	-	15	1623	c.1354G>T	c.(1354-1356)Gaa>Taa	p.E452*	SMC6_ENST00000351948.4_Nonsense_Mutation_p.E452*|SMC6_ENST00000381272.4_Nonsense_Mutation_p.E478*|SMC6_ENST00000402989.1_Nonsense_Mutation_p.E452*	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	452	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ACATCTAATTCTTCTCTCCTA	0.363																																						dbGAP											0													101.0	103.0	102.0					2																	17897524		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1354G>T	2.37:g.17897524C>A	ENSP00000404092:p.Glu452*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Nonsense_Mutation	SNP	NULL	p.E478*	ENST00000448223.2	37	c.1432	CCDS1690.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.080822	0.97267	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	.	.	.	5.53	5.53	0.82687	.	0.429212	0.28114	N	0.016552	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	14.6424	0.68734	0.0:0.9283:0.0:0.0717	.	.	.	.	X	452;452;478;452;478	.	ENSP00000323439:E452X	E	-	1	0	SMC6	17761005	1.000000	0.71417	0.997000	0.53966	0.198000	0.23893	3.394000	0.52551	2.593000	0.87608	0.555000	0.69702	GAA	SMC6	-	NULL	ENSG00000163029		0.363	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC6	HGNC	protein_coding	OTTHUMT00000207359.1	134	0.00	0	C	NM_024624		17897524	17897524	-1	no_errors	ENST00000381272	ensembl	human	known	69_37n	nonsense	118	13.87	19	SNP	1.000	A
SNX24	28966	genome.wustl.edu	37	5	122337115	122337115	+	Silent	SNP	A	A	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr5:122337115A>G	ENST00000261369.4	+	5	545	c.360A>G	c.(358-360)acA>acG	p.T120T	SNX24_ENST00000395451.4_Silent_p.T153T|SNX24_ENST00000506996.1_Silent_p.T120T|SNX24_ENST00000513881.1_Silent_p.T120T	NM_014035.2	NP_054754.1	Q9Y343	SNX24_HUMAN	sorting nexin 24	120	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			lung(5)	5		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		TTGATGAAACAGAGTCTGAAG	0.323																																						dbGAP											0													87.0	89.0	88.0					5																	122337115		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF139461	CCDS4132.1	5q23.2	2008-03-11	2007-08-15		ENSG00000064652	ENSG00000064652		"""Sorting nexins"""	21533	protein-coding gene	gene with protein product						12461558	Standard	NM_014035		Approved	SBBI31	uc011cwo.2	Q9Y343	OTTHUMG00000128913	ENST00000261369.4:c.360A>G	5.37:g.122337115A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UY33	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.T120	ENST00000261369.4	37	c.360	CCDS4132.1	5																																																																																			SNX24	-	pfscan_Phox	ENSG00000064652		0.323	SNX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX24	HGNC	protein_coding	OTTHUMT00000250885.2	361	0.00	0	A	NM_014035		122337115	122337115	+1	no_errors	ENST00000261369	ensembl	human	known	69_37n	silent	116	28.31	47	SNP	1.000	G
SPEN	23013	genome.wustl.edu	37	1	16260104	16260104	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:16260104G>A	ENST00000375759.3	+	11	7573	c.7369G>A	c.(7369-7371)Gac>Aac	p.D2457N		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2457	Interaction with MSX2. {ECO:0000250}.|Pro-rich.|RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CATTGAAAGTGACCCGGTGAC	0.607																																						dbGAP											0													102.0	88.0	93.0					1																	16260104		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7369G>A	1.37:g.16260104G>A	ENSP00000364912:p.Asp2457Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.D2457N	ENST00000375759.3	37	c.7369	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	9.981	1.228096	0.22542	.	.	ENSG00000065526	ENST00000375759	T	0.08370	3.1	5.28	5.28	0.74379	.	.	.	.	.	T	0.18002	0.0432	L	0.44542	1.39	0.25143	N	0.990488	D	0.63880	0.993	D	0.70935	0.971	T	0.13522	-1.0506	9	0.22706	T	0.39	-22.0695	9.8832	0.41247	0.0754:0.1393:0.7852:0.0	.	2457	Q96T58	MINT_HUMAN	N	2457	ENSP00000364912:D2457N	ENSP00000364912:D2457N	D	+	1	0	SPEN	16132691	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	3.068000	0.50018	2.468000	0.83385	0.561000	0.74099	GAC	SPEN	-	NULL	ENSG00000065526		0.607	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	205	0.00	0	G	NM_015001		16260104	16260104	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	missense	50	52.34	56	SNP	0.999	A
SPEN	23013	genome.wustl.edu	37	1	16260233	16260233	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:16260233G>C	ENST00000375759.3	+	11	7702	c.7498G>C	c.(7498-7500)Gag>Cag	p.E2500Q		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2500	Pro-rich.|RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TAAGGTGACAGAGTGGATCAC	0.587																																						dbGAP											0													90.0	88.0	89.0					1																	16260233		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7498G>C	1.37:g.16260233G>C	ENSP00000364912:p.Glu2500Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.E2500Q	ENST00000375759.3	37	c.7498	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.549077	0.45383	.	.	ENSG00000065526	ENST00000375759	T	0.09538	2.97	5.4	4.49	0.54785	.	.	.	.	.	T	0.25717	0.0626	L	0.53249	1.67	0.38741	D	0.953882	D	0.57899	0.981	D	0.67900	0.954	T	0.02691	-1.1123	9	0.33940	T	0.23	-23.3608	13.8515	0.63499	0.0737:0.0:0.9263:0.0	.	2500	Q96T58	MINT_HUMAN	Q	2500	ENSP00000364912:E2500Q	ENSP00000364912:E2500Q	E	+	1	0	SPEN	16132820	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.770000	0.62309	1.283000	0.44513	0.561000	0.74099	GAG	SPEN	-	NULL	ENSG00000065526		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	78	0.00	0	G	NM_015001		16260233	16260233	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	missense	21	48.78	20	SNP	1.000	C
SPEN	23013	genome.wustl.edu	37	1	16260482	16260482	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:16260482G>A	ENST00000375759.3	+	11	7951	c.7747G>A	c.(7747-7749)Gaa>Aaa	p.E2583K		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2583	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAAGCCTTTAGAAGAAAAAAC	0.537																																						dbGAP											0													67.0	76.0	73.0					1																	16260482		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7747G>A	1.37:g.16260482G>A	ENSP00000364912:p.Glu2583Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.E2583K	ENST00000375759.3	37	c.7747	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	7.523	0.656988	0.14580	.	.	ENSG00000065526	ENST00000375759	T	0.10192	2.9	5.38	4.46	0.54185	.	.	.	.	.	T	0.11239	0.0274	L	0.53249	1.67	0.24669	N	0.993426	B	0.32918	0.39	B	0.24541	0.054	T	0.16630	-1.0396	9	0.15499	T	0.54	-23.1448	15.1613	0.72788	0.0:0.0:0.8479:0.1521	.	2583	Q96T58	MINT_HUMAN	K	2583	ENSP00000364912:E2583K	ENSP00000364912:E2583K	E	+	1	0	SPEN	16133069	1.000000	0.71417	0.135000	0.22099	0.018000	0.09664	6.888000	0.75622	1.231000	0.43661	-0.397000	0.06425	GAA	SPEN	-	NULL	ENSG00000065526		0.537	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	55	0.00	0	G	NM_015001		16260482	16260482	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	missense	14	50.00	15	SNP	0.915	A
SPEN	23013	genome.wustl.edu	37	1	16260814	16260814	+	Silent	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:16260814G>C	ENST00000375759.3	+	11	8283	c.8079G>C	c.(8077-8079)ctG>ctC	p.L2693L		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2693	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGAACGTCCTGAAAGGGCCTG	0.592																																						dbGAP											0													75.0	77.0	76.0					1																	16260814		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8079G>C	1.37:g.16260814G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.L2693	ENST00000375759.3	37	c.8079	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.592	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	130	0.00	0	G	NM_015001		16260814	16260814	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	silent	32	49.21	31	SNP	0.586	C
SPEN	23013	genome.wustl.edu	37	1	16262320	16262320	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr1:16262320G>A	ENST00000375759.3	+	11	9789	c.9585G>A	c.(9583-9585)gtG>gtA	p.V3195V		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3195					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CACGGGATGTGAGGATCATGG	0.617																																						dbGAP											0													75.0	68.0	70.0					1																	16262320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.9585G>A	1.37:g.16262320G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.V3195	ENST00000375759.3	37	c.9585	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.617	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	29	0.00	0	G	NM_015001		16262320	16262320	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	silent	7	53.33	8	SNP	0.789	A
STARD13	90627	genome.wustl.edu	37	13	33859651	33859651	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:33859651C>G	ENST00000336934.5	-	1	241	c.125G>C	c.(124-126)aGc>aCc	p.S42T	STARD13_ENST00000487412.1_5'UTR	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	42					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		TAGAATCCGGCTCATCCTGTA	0.493																																						dbGAP											0													181.0	164.0	170.0					13																	33859651		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.125G>C	13.37:g.33859651C>G	ENSP00000338785:p.Ser42Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.S42T	ENST00000336934.5	37	c.125	CCDS9348.1	13	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969709	0.53614	.	.	ENSG00000133121	ENST00000336934	T	0.06142	3.34	5.12	5.12	0.69794	.	0.115001	0.64402	D	0.000016	T	0.04003	0.0112	N	0.19112	0.55	0.80722	D	1	P	0.38922	0.651	B	0.27262	0.078	T	0.52193	-0.8608	10	0.09590	T	0.72	.	17.72	0.88348	0.0:1.0:0.0:0.0	.	42	Q9Y3M8	STA13_HUMAN	T	42	ENSP00000338785:S42T	ENSP00000338785:S42T	S	-	2	0	STARD13	32757651	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.334000	0.65923	2.654000	0.90174	0.555000	0.69702	AGC	STARD13	-	NULL	ENSG00000133121		0.493	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	HGNC	protein_coding	OTTHUMT00000276118.2	110	0.00	0	C	NM_001243466		33859651	33859651	-1	no_errors	ENST00000336934	ensembl	human	known	69_37n	missense	167	11.98	23	SNP	1.000	G
STRN	6801	genome.wustl.edu	37	2	37076895	37076895	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:37076895delA	ENST00000263918.4	-	17	2143	c.2135delT	c.(2134-2136)ttafs	p.L712fs	STRN_ENST00000379213.2_Frame_Shift_Del_p.L663fs	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	712					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				ATCAACTGCTAAACTTGTAAC	0.368																																						dbGAP											0													146.0	132.0	136.0					2																	37076895		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.2135delT	2.37:g.37076895delA	ENSP00000263918:p.Leu712fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KP65|Q53TQ8|Q9NP38	Frame_Shift_Del	DEL	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L712fs	ENST00000263918.4	37	c.2135	CCDS1784.1	2																																																																																			STRN	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000115808		0.368	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRN	HGNC	protein_coding	OTTHUMT00000218568.1	162	0.00	0	A			37076895	37076895	-1	no_errors	ENST00000263918	ensembl	human	known	69_37n	frame_shift_del	153	14.44	26	DEL	1.000	-
SUN1	23353	genome.wustl.edu	37	7	882998	882998	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:882998C>G	ENST00000405266.1	+	5	523	c.499C>G	c.(499-501)Cag>Gag	p.Q167E	SUN1_ENST00000452783.2_Intron|SUN1_ENST00000401592.1_Missense_Mutation_p.Q167E|SUN1_ENST00000425407.2_Missense_Mutation_p.Q117E|SUN1_ENST00000457378.2_Missense_Mutation_p.Q188E|SUN1_ENST00000403868.1_Missense_Mutation_p.Q167E|SUN1_ENST00000456758.2_Missense_Mutation_p.Q225E|SUN1_ENST00000389574.3_Missense_Mutation_p.Q117E			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	167					cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGCTGCCATTCAGGGAAACGG	0.498																																						dbGAP											0													67.0	79.0	75.0					7																	882998		1959	4130	6089	-	-	-	SO:0001583	missense	0			AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.499C>G	7.37:g.882998C>G	ENSP00000384116:p.Gln167Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	pfam_RNA-bd_mt,pfam_Sad1_UNC_C	p.Q225E	ENST00000405266.1	37	c.673		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.15|10.15	1.271972|1.271972	0.23221|0.23221	.|.	.|.	ENSG00000164828|ENSG00000164828	ENST00000419312|ENST00000456758;ENST00000389574;ENST00000457378;ENST00000435699;ENST00000405266;ENST00000401592;ENST00000403868;ENST00000297445;ENST00000425407	.|T;T;T;T;T;T;T;T	.|0.50001	.|0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	4.59|4.59	4.59|4.59	0.56863|0.56863	.|.	.|0.613870	.|0.16536	.|N	.|0.210176	T|T	0.67590|0.67590	0.2909|0.2909	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.67145	.|0.995;0.996;0.996;0.994	.|D;D;D;P	.|0.80764	.|0.994;0.99;0.99;0.851	T|T	0.64419|0.64419	-0.6412|-0.6412	5|10	.|0.29301	.|T	.|0.29	-10.8374|-10.8374	17.3676|17.3676	0.87367|0.87367	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|167;188;117;167	.|E9PF23;F8WD13;O94901-5;O94901-3	.|.;.;.;.	L|E	7|225;117;188;167;167;167;167;167;117	.|ENSP00000388743:Q225E;ENSP00000374225:Q117E;ENSP00000395952:Q188E;ENSP00000388430:Q167E;ENSP00000384116:Q167E;ENSP00000384015:Q167E;ENSP00000383947:Q167E;ENSP00000392309:Q117E	.|ENSP00000297445:Q167E	F|Q	+|+	3|1	2|0	SUN1|SUN1	849524|849524	0.993000|0.993000	0.37304|0.37304	0.989000|0.989000	0.46669|0.46669	0.284000|0.284000	0.27059|0.27059	2.983000|2.983000	0.49345|0.49345	2.266000|2.266000	0.75297|0.75297	0.591000|0.591000	0.81541|0.81541	TTC|CAG	SUN1	-	pfam_RNA-bd_mt	ENSG00000164828		0.498	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	SUN1	HGNC	protein_coding	OTTHUMT00000322566.1	54	0.00	0	C	NM_025154		882998	882998	+1	no_errors	ENST00000456758	ensembl	human	known	69_37n	missense	42	25.86	15	SNP	0.999	G
SYNE1	23345	genome.wustl.edu	37	6	152623079	152623079	+	Silent	SNP	C	C	T	rs368601212		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:152623079C>T	ENST00000367255.5	-	92	18067	c.17466G>A	c.(17464-17466)gaG>gaA	p.E5822E	SYNE1_ENST00000356820.4_Silent_p.E346E|SYNE1_ENST00000448038.1_Silent_p.E5751E|SYNE1_ENST00000265368.4_Silent_p.E5822E|SYNE1_ENST00000423061.1_Silent_p.E5751E|SYNE1_ENST00000341594.5_Silent_p.E5434E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5822					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCGCCAGCCCCTCGACCTCGG	0.622										HNSCC(10;0.0054)																												dbGAP											0													67.0	63.0	64.0					6																	152623079		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.17466G>A	6.37:g.152623079C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E5822	ENST00000367255.5	37	c.17466	CCDS5236.2	6																																																																																			SYNE1	-	pfam_Spectrin_repeat,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.622	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	27	0.00	0	C	NM_182961		152623079	152623079	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	24	41.86	18	SNP	1.000	T
TCF3	6929	genome.wustl.edu	37	19	1632396	1632396	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:1632396delC	ENST00000262965.5	-	4	498	c.154delG	c.(154-156)gacfs	p.D52fs	TCF3_ENST00000453954.2_5'Flank|TCF3_ENST00000395423.3_Intron|TCF3_ENST00000588136.1_Frame_Shift_Del_p.D52fs|TCF3_ENST00000344749.5_Frame_Shift_Del_p.D52fs	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0	CTNNB1-binding. {ECO:0000250}.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGGCCGGTCCTCAAGACCT	0.622			T	"""PBX1, HLF, TFPT"""	pre B-ALL																																	dbGAP		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	0													12.0	13.0	13.0					19																	1632396		2196	4298	6494	-	-	-	SO:0001589	frameshift_variant	0			M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.154delG	19.37:g.1632396delC	ENSP00000262965:p.Asp52fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R97|Q6PD70|Q9NP00	Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D52fs	ENST00000262965.5	37	c.154	CCDS12074.1	19																																																																																			TCF3	-	NULL	ENSG00000071564		0.622	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCF3	HGNC	protein_coding	OTTHUMT00000449367.1	30	0.00	0	C	NM_003200		1632396	1632396	-1	no_errors	ENST00000262965	ensembl	human	known	69_37n	frame_shift_del	7	36.36	4	DEL	1.000	-
TDRD3	81550	genome.wustl.edu	37	13	61057959	61057959	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr13:61057959G>A	ENST00000196169.3	+	6	1055	c.267G>A	c.(265-267)ccG>ccA	p.P89P	TDRD3_ENST00000535286.1_Silent_p.P182P|TDRD3_ENST00000377881.2_Silent_p.P89P|TDRD3_ENST00000377894.2_Silent_p.P89P	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	89					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.P89P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		GTGGACCACCGCCTTTTGTGC	0.343																																					Colon(36;164 906 35820 50723)	dbGAP											1	Substitution - coding silent(1)	lung(1)											164.0	166.0	165.0					13																	61057959		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.267G>A	13.37:g.61057959G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2MWP9|Q53XA6|Q6P992	Silent	SNP	pfam_DUF1767,pfam_Tudor,pfam_Survival_motor_neuron,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_Tudor,pfscan_Tudor,pfscan_UBA/transl_elong_EF1B_N_euk	p.P182	ENST00000196169.3	37	c.546	CCDS9441.1	13																																																																																			TDRD3	-	NULL	ENSG00000083544		0.343	TDRD3-201	KNOWN	basic|CCDS	protein_coding	TDRD3	HGNC	protein_coding	OTTHUMT00000045175.2	379	0.00	0	G	NM_030794		61057959	61057959	+1	no_errors	ENST00000535286	ensembl	human	known	69_37n	silent	489	10.22	56	SNP	1.000	A
TMEM169	92691	genome.wustl.edu	37	2	216964838	216964838	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:216964838G>A	ENST00000295658.4	+	3	674	c.467G>A	c.(466-468)cGt>cAt	p.R156H	TMEM169_ENST00000437356.2_Missense_Mutation_p.R156H|TMEM169_ENST00000406027.2_Missense_Mutation_p.R156H|TMEM169_ENST00000454545.1_Missense_Mutation_p.R156H	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	156						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAGCTGACCGTGGGCCCCAT	0.512																																						dbGAP											0													147.0	136.0	140.0					2																	216964838		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.467G>A	2.37:g.216964838G>A	ENSP00000295658:p.Arg156His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8W6	Missense_Mutation	SNP	NULL	p.R156H	ENST00000295658.4	37	c.467	CCDS2401.1	2	.	.	.	.	.	.	.	.	.	.	G	12.99	2.104097	0.37145	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.93	1.38	0.22167	.	0.451896	0.24866	N	0.034974	T	0.34687	0.0906	L	0.51422	1.61	0.27194	N	0.960331	B	0.13145	0.007	B	0.08055	0.003	T	0.18555	-1.0333	8	.	.	.	-0.6112	5.5306	0.16983	0.2238:0.1531:0.6231:0.0	.	156	Q96HH4	TM169_HUMAN	H	156	.	.	R	+	2	0	TMEM169	216673083	1.000000	0.71417	0.889000	0.34880	0.957000	0.61999	3.047000	0.49854	0.053000	0.16036	0.655000	0.94253	CGT	TMEM169	-	NULL	ENSG00000163449		0.512	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM169	HGNC	protein_coding	OTTHUMT00000256666.2	735	0.00	0	G	NM_138390		216964838	216964838	+1	no_errors	ENST00000295658	ensembl	human	known	69_37n	missense	835	16.42	165	SNP	0.841	A
TMEM47	83604	genome.wustl.edu	37	X	34657505	34657505	+	Splice_Site	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:34657505C>T	ENST00000275954.3	-	2	485		c.e2-1			NM_031442.3	NP_113630.1	Q9BQJ4	TMM47_HUMAN	transmembrane protein 47							cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ATCTGCCAATCTGGAAAGAAA	0.448																																						dbGAP											0													48.0	43.0	44.0					X																	34657505		2201	4300	6501	-	-	-	SO:0001630	splice_region_variant	0			AK090917	CCDS14235.1	Xp11.4	2008-02-05	2005-03-21	2005-03-21	ENSG00000147027	ENSG00000147027			18515	protein-coding gene	gene with protein product		300698	"""transmembrane 4 superfamily member 10"""	TM4SF10		11472633	Standard	NM_031442		Approved	BCMP1, DKFZP761J17121, DKFZp564E153	uc004ddh.3	Q9BQJ4	OTTHUMG00000021343	ENST00000275954.3:c.227-1G>A	X.37:g.34657505C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR44	Splice_Site	SNP	-	e2-1	ENST00000275954.3	37	c.227-1	CCDS14235.1	X	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502152	0.64298	.	.	ENSG00000147027	ENST00000275954	.	.	.	5.83	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7266	0.62761	0.154:0.846:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM47	34567426	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.487000	0.81328	2.449000	0.82847	0.538000	0.68166	.	TMEM47	-	-	ENSG00000147027		0.448	TMEM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM47	HGNC	protein_coding	OTTHUMT00000056209.1	150	0.00	0	C	NM_031442	Intron	34657505	34657505	-1	no_errors	ENST00000275954	ensembl	human	known	69_37n	splice_site	265	14.74	46	SNP	1.000	T
TNK1	8711	genome.wustl.edu	37	17	7286594	7286594	+	Silent	SNP	G	G	A			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:7286594G>A	ENST00000576812.1	+	3	558	c.189G>A	c.(187-189)ctG>ctA	p.L63L	TNK1_ENST00000570896.1_Silent_p.L63L|TNK1_ENST00000311668.2_Silent_p.L63L	NM_001251902.1	NP_001238831.1			tyrosine kinase, non-receptor, 1											central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(2)|pancreas(1)	16		Prostate(122;0.157)				CCGAAGCTCTGAAAAGGCTAC	0.577																																						dbGAP											0													78.0	85.0	83.0					17																	7286594		2006	4170	6176	-	-	-	SO:0001819	synonymous_variant	0			U43408	CCDS45602.1, CCDS58510.1	17p13.1	2005-09-22				ENSG00000174292			11940	protein-coding gene	gene with protein product		608076				8632913	Standard	NM_003985		Approved		uc002ggi.4	Q13470		ENST00000576812.1:c.189G>A	17.37:g.7286594G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L63	ENST00000576812.1	37	c.189	CCDS58510.1	17																																																																																			TNK1	-	superfamily_SAM/pointed	ENSG00000174292		0.577	TNK1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TNK1	HGNC	protein_coding	OTTHUMT00000440832.2	139	0.00	0	G	NM_003985		7286594	7286594	+1	no_errors	ENST00000576812	ensembl	human	known	69_37n	silent	27	40.00	18	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	T	C	rs587780073		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:7577580T>C	ENST00000269305.4	-	7	890	c.701A>G	c.(700-702)tAc>tGc	p.Y234C	TP53_ENST00000455263.2_Missense_Mutation_p.Y234C|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.Y234C|TP53_ENST00000359597.4_Missense_Mutation_p.Y234C|TP53_ENST00000420246.2_Missense_Mutation_p.Y234C|TP53_ENST00000413465.2_Missense_Mutation_p.Y234C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	234	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y234C(94)|p.Y234S(9)|p.Y141C(8)|p.0?(8)|p.?(5)|p.Y234del(3)|p.Y141S(2)|p.I232_Y236delIHYNY(1)|p.Y234fs*2(1)|p.Y234F(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234R(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.I232fs*5(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGTAGTTGTAGTGGATGGT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	141	Substitution - Missense(115)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(5)	lung(32)|haematopoietic_and_lymphoid_tissue(17)|breast(17)|ovary(15)|central_nervous_system(10)|urinary_tract(9)|upper_aerodigestive_tract(8)|oesophagus(7)|biliary_tract(6)|large_intestine(5)|kidney(4)|bone(4)|cervix(2)|stomach(2)|adrenal_gland(1)|skin(1)|liver(1)	GRCh37	CM035576	TP53	M							119.0	95.0	103.0					17																	7577580		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.701A>G	17.37:g.7577580T>C	ENSP00000269305:p.Tyr234Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y234C	ENST00000269305.4	37	c.701	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	16.52	3.146603	0.57044	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99826	-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98	4.62	3.49	0.39957	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.211900	0.41823	D	0.000804	D	0.99778	0.9908	M	0.88105	2.93	0.51012	D	0.999909	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.982;0.998;0.997;0.985;0.994;0.999	D	0.98045	1.0384	10	0.87932	D	0	-10.1131	9.0203	0.36195	0.1783:0.0:0.0:0.8216	.	234;234;141;234;234;234	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	234;234;234;234;234;234;223;141;102;141	ENSP00000410739:Y234C;ENSP00000352610:Y234C;ENSP00000269305:Y234C;ENSP00000398846:Y234C;ENSP00000391127:Y234C;ENSP00000391478:Y234C;ENSP00000425104:Y102C;ENSP00000423862:Y141C	ENSP00000269305:Y234C	Y	-	2	0	TP53	7518305	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.037000	0.41174	0.835000	0.34877	0.379000	0.24179	TAC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	240	0.00	0	T	NM_000546		7577580	7577580	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	78	40.44	55	SNP	1.000	C
TRAPPC4	51399	genome.wustl.edu	37	11	118890872	118890872	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr11:118890872C>T	ENST00000533632.1	+	3	727	c.363C>T	c.(361-363)atC>atT	p.I121I	TRAPPC4_ENST00000533058.1_Silent_p.I121I|RPS25_ENST00000528547.1_5'Flank|RPS25_ENST00000527673.1_5'Flank|TRAPPC4_ENST00000434101.2_Intron|TRAPPC4_ENST00000359005.4_Silent_p.I121I|TRAPPC4_ENST00000525303.1_Intron|TRAPPC4_ENST00000528230.1_Silent_p.I78I|MIR3656_ENST00000577421.1_RNA	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4	121					dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		TCTTTGCCATCGGCTCCCAGC	0.488																																						dbGAP											0													77.0	63.0	68.0					11																	118890872		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296		ENST00000533632.1:c.363C>T	11.37:g.118890872C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3A5|B4DME1	Silent	SNP	pfam_Sybindin,pfam_Sedlin,superfamily_Longin-like_dom	p.I121	ENST00000533632.1	37	c.363	CCDS8407.1	11																																																																																			TRAPPC4	-	pfam_Sybindin,superfamily_Longin-like_dom	ENSG00000196655		0.488	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC4	HGNC	protein_coding	OTTHUMT00000389332.1	47	0.00	0	C	NM_016146		118890872	118890872	+1	no_errors	ENST00000533632	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.998	T
TRBV6-4	28603	genome.wustl.edu	37	7	142250751	142250751	+	RNA	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:142250751G>C	ENST00000390360.3	-	0	316									T cell receptor beta variable 6-4																		GGGTACAGCAGACGCCAACGT	0.502																																						dbGAP											0													117.0	119.0	118.0					7																	142250751		2013	4184	6197	-	-	-			0			X61653		7q34	2012-02-07			ENSG00000211713	ENSG00000211713		"""T cell receptors / TRB locus"""	12229	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV64, TCRBV13S5, TCRBV6S4			OTTHUMG00000158533		7.37:g.142250751G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S99C	ENST00000390360.3	37	c.296		7																																																																																			TRBV6-4	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211713		0.502	TRBV6-4-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV6-4	HGNC	TR_V_gene	OTTHUMT00000351239.2	67	0.00	0	G	NG_001333		142250751	142250751	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390360	ensembl	human	known	69_37n	missense	70	39.66	46	SNP	0.004	C
TRBV19	28568	genome.wustl.edu	37	7	142326775	142326775	+	RNA	SNP	C	C	G	rs372253307		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:142326775C>G	ENST00000390393.3	+	0	281									T cell receptor beta variable 19																		TGGAATCACTCAGTCCCCAAA	0.542																																						dbGAP											0													80.0	82.0	81.0					7																	142326775		1970	4160	6130	-	-	-			0			U48260		7q34	2012-02-07			ENSG00000211746	ENSG00000211746		"""T cell receptors / TRB locus"""	12194	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TCRBV17S1A1T, TCRBV19S1			OTTHUMG00000158877		7.37:g.142326775C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q25E	ENST00000390393.3	37	c.73		7																																																																																			TRBV19	-	pfam_Ig_V-set	ENSG00000211746		0.542	TRBV19-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV19	HGNC	TR_V_gene	OTTHUMT00000352485.2	149	0.00	0	C	NG_001333		142326775	142326775	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390393	ensembl	human	known	69_37n	missense	100	38.79	64	SNP	0.686	G
TRERF1	55809	genome.wustl.edu	37	6	42200628	42200628	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr6:42200628C>T	ENST00000372922.4	-	17	3631	c.3069G>A	c.(3067-3069)gtG>gtA	p.V1023V	TRERF1_ENST00000354325.2_Silent_p.V940V|TRERF1_ENST00000340840.2_Silent_p.V952V|TRERF1_ENST00000372917.4_Silent_p.V952V|TRERF1_ENST00000541110.1_Silent_p.V1043V	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1023	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGGAGCTGAACACCTGGGGAA	0.527																																						dbGAP											0													35.0	33.0	34.0					6																	42200628		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3069G>A	6.37:g.42200628C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.V1043	ENST00000372922.4	37	c.3129	CCDS4867.1	6																																																																																			TRERF1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124496		0.527	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	108	0.00	0	C	NM_033502		42200628	42200628	-1	no_errors	ENST00000541110	ensembl	human	known	69_37n	silent	46	44.71	38	SNP	1.000	T
TRMT2B	79979	genome.wustl.edu	37	X	100275496	100275496	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:100275496C>T	ENST00000372936.3	-	11	1920	c.1148G>A	c.(1147-1149)aGa>aAa	p.R383K	TRMT2B_ENST00000372931.5_Missense_Mutation_p.R383K|TRMT2B_ENST00000545398.1_Missense_Mutation_p.R383K|TRMT2B_ENST00000372935.1_Missense_Mutation_p.R383K|TRMT2B_ENST00000372939.1_Missense_Mutation_p.R338K|TRMT2B_ENST00000338687.7_Missense_Mutation_p.R338K	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	383						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)			breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						TGCAGTCCATCTTGCATCCTC	0.473																																						dbGAP											0													173.0	143.0	153.0					X																	100275496		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.1148G>A	X.37:g.100275496C>T	ENSP00000362027:p.Arg383Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Missense_Mutation	SNP	pfam_U5_MeTrfase,pfam_Small_mtfrase_dom	p.R383K	ENST00000372936.3	37	c.1148	CCDS14477.1	X	.	.	.	.	.	.	.	.	.	.	C	7.475	0.647537	0.14516	.	.	ENSG00000188917	ENST00000338687;ENST00000545398;ENST00000372939;ENST00000372935;ENST00000372936;ENST00000372931	T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1	4.66	3.78	0.43462	.	0.255305	0.35495	N	0.003179	T	0.11707	0.0285	N	0.17901	0.54	0.33342	D	0.569907	B;B;B	0.20368	0.01;0.03;0.044	B;B;B	0.28139	0.012;0.086;0.04	T	0.14337	-1.0476	10	0.02654	T	1	0.8882	10.4321	0.44413	0.0:0.8936:0.0:0.1064	.	338;383;383	Q96GJ1-3;F2Z384;Q96GJ1	.;.;TRM2_HUMAN	K	338;383;338;383;383;383	ENSP00000340970:R338K;ENSP00000438134:R383K;ENSP00000362030:R338K;ENSP00000362026:R383K;ENSP00000362027:R383K;ENSP00000362022:R383K	ENSP00000340970:R338K	R	-	2	0	TRMT2B	100162152	0.905000	0.30787	1.000000	0.80357	0.596000	0.36781	0.366000	0.20365	2.060000	0.61445	0.600000	0.82982	AGA	TRMT2B	-	pfam_U5_MeTrfase,pfam_Small_mtfrase_dom	ENSG00000188917		0.473	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TRMT2B	HGNC	protein_coding	OTTHUMT00000057512.1	148	0.00	0	C	NM_024917		100275496	100275496	-1	no_errors	ENST00000372935	ensembl	human	known	69_37n	missense	138	20.57	36	SNP	1.000	T
TRPC5	7224	genome.wustl.edu	37	X	111155925	111155925	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chrX:111155925C>T	ENST00000262839.2	-	3	1412	c.494G>A	c.(493-495)cGg>cAg	p.R165Q		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	165					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GATAGTGACCCGTTTTTGGAC	0.537																																						dbGAP											0													118.0	101.0	107.0					X																	111155925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.494G>A	X.37:g.111155925C>T	ENSP00000262839:p.Arg165Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R165Q	ENST00000262839.2	37	c.494	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	29.4	5.005107	0.93287	.	.	ENSG00000072315	ENST00000262839	T	0.69040	-0.37	5.43	5.43	0.79202	Ankyrin repeat-containing domain (1);	0.052985	0.64402	D	0.000001	T	0.49779	0.1577	N	0.03608	-0.345	0.53688	D	0.999979	P;P	0.51147	0.709;0.942	B;B	0.43445	0.23;0.42	T	0.64487	-0.6396	10	0.87932	D	0	-14.4789	18.2995	0.90158	0.0:1.0:0.0:0.0	.	166;165	Q59G51;Q9UL62	.;TRPC5_HUMAN	Q	165	ENSP00000262839:R165Q	ENSP00000262839:R165Q	R	-	2	0	TRPC5	111042581	0.985000	0.35326	0.934000	0.37439	0.961000	0.63080	4.000000	0.57039	2.260000	0.74910	0.529000	0.55759	CGG	TRPC5	-	smart_Ankyrin_rpt,tigrfam_TRP_channel	ENSG00000072315		0.537	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	65	0.00	0	C	NM_012471		111155925	111155925	-1	no_errors	ENST00000262839	ensembl	human	known	69_37n	missense	96	20.97	26	SNP	1.000	T
TRPS1	7227	genome.wustl.edu	37	8	116427084	116427084	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:116427084C>T	ENST00000220888.5	-	6	3172	c.3013G>A	c.(3013-3015)Gaa>Aaa	p.E1005K	TRPS1_ENST00000520276.1_Missense_Mutation_p.E1009K|TRPS1_ENST00000519076.1_Missense_Mutation_p.E759K|TRPS1_ENST00000395715.3_Missense_Mutation_p.E1018K			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1005	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CCCTGGGCTTCGTATTTACTT	0.468									Langer-Giedion syndrome																													dbGAP											0													139.0	132.0	134.0					8																	116427084		1890	4127	6017	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3013G>A	8.37:g.116427084C>T	ENSP00000220888:p.Glu1005Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.E1018K	ENST00000220888.5	37	c.3052		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.16|15.16	2.752166|2.752166	0.49362|0.49362	.|.	.|.	ENSG00000104447|ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276|ENST00000518018	D;D;D;D|.	0.98474|.	-4.95;-4.92;-4.89;-4.92|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	0.054169|.	0.85682|.	D|.	0.000000|.	T|T	0.52468|0.52468	0.1736|0.1736	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	P;P;P|.	0.51791|.	0.948;0.659;0.769|.	B;B;B|.	0.39590|.	0.304;0.083;0.172|.	T|T	0.45425|0.45425	-0.9262|-0.9262	10|5	0.59425|.	D|.	0.04|.	.|.	20.0897|20.0897	0.97814|0.97814	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1009;1005;1018|.	Q9UHF7-3;Q9UHF7;Q9UHF7-2|.	.;TRPS1_HUMAN;.|.	K|Q	1018;1005;759;1009|129	ENSP00000379065:E1018K;ENSP00000220888:E1005K;ENSP00000428910:E759K;ENSP00000428680:E1009K|.	ENSP00000220888:E1005K|.	E|R	-|-	1|2	0|0	TRPS1|TRPS1	116496260|116496260	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.987000|0.987000	0.75469|0.75469	4.405000|4.405000	0.59741|0.59741	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	GAA|CGA	TRPS1	-	NULL	ENSG00000104447		0.468	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	83	0.00	0	C	NM_014112		116427084	116427084	-1	no_errors	ENST00000395715	ensembl	human	known	69_37n	missense	106	31.41	49	SNP	0.998	T
TTN	7273	genome.wustl.edu	37	2	179422744	179422744	+	Missense_Mutation	SNP	C	C	T	rs373526664		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:179422744C>T	ENST00000591111.1	-	278	82638	c.82414G>A	c.(82414-82416)Ggg>Agg	p.G27472R	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G20240R|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G20173R|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G29113R|TTN_ENST00000460472.2_Missense_Mutation_p.G20048R|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G26545R			Q8WZ42	TITIN_HUMAN	titin	27472					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATATCTCCCAGCGTCAGCT	0.458																																						dbGAP											0													134.0	132.0	133.0					2																	179422744		1911	4130	6041	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.82414G>A	2.37:g.179422744C>T	ENSP00000465570:p.Gly27472Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.G26545R	ENST00000591111.1	37	c.79633		2	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683690	0.68157	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.63	5.63	0.86233	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.90858	0.7128	M	0.90483	3.12	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91882	0.5516	9	0.87932	D	0	.	20.0396	0.97574	0.0:1.0:0.0:0.0	.	20048;20173;20240;27472	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	26545;20048;20240;20173;20045	ENSP00000343764:G26545R;ENSP00000434586:G20048R;ENSP00000340554:G20240R;ENSP00000352154:G20173R	ENSP00000340554:G20240R	G	-	1	0	TTN	179130990	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.818000	0.86416	2.814000	0.96858	0.563000	0.77884	GGG	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2	ENSG00000155657		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	66	0.00	0	C	NM_133378		179422744	179422744	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	1.000	T
UMODL1	89766	genome.wustl.edu	37	21	43496237	43496237	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr21:43496237delG	ENST00000408910.2	+	2	200	c.200delG	c.(199-201)tggfs	p.W67fs	UMODL1_ENST00000400427.1_5'UTR|UMODL1_ENST00000408989.2_Frame_Shift_Del_p.W67fs|UMODL1_ENST00000400424.2_5'UTR	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	67	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.W67*(2)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TGGATCCCCTGGAGGCGGTGC	0.597																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											2	Substitution - Nonsense(2)	lung(2)											61.0	71.0	68.0					21																	43496237		1991	4160	6151	-	-	-	SO:0001589	frameshift_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.200delG	21.37:g.43496237delG	ENSP00000386147:p.Trp67fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Frame_Shift_Del	DEL	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.W67fs	ENST00000408910.2	37	c.200	CCDS42936.1	21																																																																																			UMODL1	-	pfam_EMI_domain,pfscan_EMI_domain	ENSG00000177398		0.597	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	60	0.00	0	G			43496237	43496237	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	frame_shift_del	42	21.82	12	DEL	0.214	-
UMODL1	89766	genome.wustl.edu	37	21	43496238	43496238	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr21:43496238G>C	ENST00000408910.2	+	2	201	c.201G>C	c.(199-201)tgG>tgC	p.W67C	UMODL1_ENST00000400427.1_5'UTR|UMODL1_ENST00000408989.2_Missense_Mutation_p.W67C|UMODL1_ENST00000400424.2_5'UTR	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	67	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.W67*(2)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GGATCCCCTGGAGGCGGTGCC	0.602																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											2	Substitution - Nonsense(2)	lung(2)											61.0	71.0	68.0					21																	43496238		1996	4164	6160	-	-	-	SO:0001583	missense	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.201G>C	21.37:g.43496238G>C	ENSP00000386147:p.Trp67Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.W67C	ENST00000408910.2	37	c.201	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	G	14.92	2.677971	0.47886	.	.	ENSG00000177398	ENST00000408989;ENST00000408910	T;T	0.42131	0.98;0.98	4.44	2.44	0.29823	EMI domain (2);	0.167045	0.28718	N	0.014379	T	0.47060	0.1425	L	0.34521	1.04	0.36208	D	0.851191	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.983	T	0.55579	-0.8119	10	0.87932	D	0	-11.6394	6.6268	0.22835	0.0983:0.0:0.7247:0.177	.	67;67	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	C	67	ENSP00000386126:W67C;ENSP00000386147:W67C	ENSP00000386147:W67C	W	+	3	0	UMODL1	42369307	1.000000	0.71417	0.131000	0.22000	0.798000	0.45092	2.993000	0.49425	1.166000	0.42689	0.655000	0.94253	TGG	UMODL1	-	pfam_EMI_domain,pfscan_EMI_domain	ENSG00000177398		0.602	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	60	0.00	0	G			43496238	43496238	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	0.188	C
WDR66	144406	genome.wustl.edu	37	12	122413473	122413473	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr12:122413473C>T	ENST00000288912.4	+	19	3742	c.2888C>T	c.(2887-2889)tCt>tTt	p.S963F		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	963							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TTCTACTATTCTCAGCTCCGC	0.438																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													106.0	96.0	99.0					12																	122413473		1932	4128	6060	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2888C>T	12.37:g.122413473C>T	ENSP00000288912:p.Ser963Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.S963F	ENST00000288912.4	37	c.2888	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701179	0.30142	.	.	ENSG00000158023	ENST00000288912	T	0.06068	3.35	5.26	4.36	0.52297	.	0.242522	0.39083	N	0.001471	T	0.06462	0.0166	L	0.39147	1.195	0.26795	N	0.969317	B	0.27700	0.186	B	0.28553	0.091	T	0.25745	-1.0123	10	0.33940	T	0.23	.	9.7966	0.40740	0.0:0.7753:0.1426:0.0821	.	963	Q8TBY9	WDR66_HUMAN	F	963	ENSP00000288912:S963F	ENSP00000288912:S963F	S	+	2	0	WDR66	120897856	0.800000	0.28916	0.458000	0.27068	0.869000	0.49853	1.831000	0.39141	1.187000	0.43000	0.561000	0.74099	TCT	WDR66	-	NULL	ENSG00000158023		0.438	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	86	0.00	0	C	NM_144668		122413473	122413473	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.297	T
WRN	7486	genome.wustl.edu	37	8	30954325	30954325	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr8:30954325C>T	ENST00000298139.5	+	17	2189	c.1940C>T	c.(1939-1941)tCa>tTa	p.S647L		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	647	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GAATACTGTTCAGGTAACATG	0.323			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	dbGAP	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													95.0	93.0	93.0					8																	30954325		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1940C>T	8.37:g.30954325C>T	ENSP00000298139:p.Ser647Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/RNaseD_C,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S647L	ENST00000298139.5	37	c.1940	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160955	0.38119	.	.	ENSG00000165392	ENST00000298139	T	0.13778	2.56	5.94	3.84	0.44239	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.424994	0.23573	N	0.046733	T	0.09862	0.0242	N	0.21545	0.675	0.35362	D	0.788303	B;B	0.16802	0.005;0.019	B;B	0.20384	0.029;0.022	T	0.17930	-1.0353	10	0.22706	T	0.39	0.2992	12.7856	0.57502	0.0:0.8419:0.0:0.158	.	57;647	Q59F09;Q14191	.;WRN_HUMAN	L	647	ENSP00000298139:S647L	ENSP00000298139:S647L	S	+	2	0	WRN	31073867	0.988000	0.35896	0.945000	0.38365	0.976000	0.68499	2.875000	0.48491	1.521000	0.48983	0.650000	0.86243	TCA	WRN	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000165392		0.323	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	72	0.00	0	C			30954325	30954325	+1	no_errors	ENST00000298139	ensembl	human	known	69_37n	missense	73	34.51	39	SNP	0.829	T
ZACN	353174	genome.wustl.edu	37	17	74077976	74077977	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr17:74077976_74077977delCA	ENST00000334586.5	+	8	977_978	c.894_895delCA	c.(892-897)accatcfs	p.I299fs	EXOC7_ENST00000332065.5_3'UTR|EXOC7_ENST00000591724.1_Intron|EXOC7_ENST00000607838.1_3'UTR|EXOC7_ENST00000589210.1_3'UTR	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	299	Leu-rich.				ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						ACTACTTCACCATCCTGCTGCT	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.894_895delCA	17.37:g.74077976_74077977delCA	ENSP00000334854:p.Ile299fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TB29|Q6ZWK3|Q86YW4	Frame_Shift_Del	DEL	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM	p.I299fs	ENST00000334586.5	37	c.894_895	CCDS11740.2	17																																																																																			ZACN	-	superfamily_Neurotrans-gated_channel_TM	ENSG00000186919		0.658	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZACN	HGNC	protein_coding	OTTHUMT00000347827.2	14	0.00	0	CA	NM_180990		74077976	74077977	+1	no_errors	ENST00000334586	ensembl	human	known	69_37n	frame_shift_del	13	38.10	8	DEL	0.001:0.001	-
ZAP70	7535	genome.wustl.edu	37	2	98354504	98354504	+	Missense_Mutation	SNP	G	G	A	rs201606579		TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:98354504G>A	ENST00000264972.5	+	13	1885	c.1670G>A	c.(1669-1671)cGg>cAg	p.R557Q	ZAP70_ENST00000442208.1_Missense_Mutation_p.R431Q|ZAP70_ENST00000451498.2_Missense_Mutation_p.R250Q|ZAP70_ENST00000463643.1_3'UTR	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	557	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CAGGGCAAGCGGATGGAGTGC	0.607																																						dbGAP											0													87.0	84.0	85.0					2																	98354504		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1670G>A	2.37:g.98354504G>A	ENSP00000264972:p.Arg557Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.R557Q	ENST00000264972.5	37	c.1670	CCDS33254.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.340901	0.95783	.	.	ENSG00000115085	ENST00000264972;ENST00000442208;ENST00000451498	D;D;D	0.84589	-1.87;-1.87;-1.87	4.66	4.66	0.58398	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41194	D	0.000928	D	0.92977	0.7765	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.911;0.999	D	0.94198	0.7447	10	0.87932	D	0	.	15.445	0.75223	0.0:0.0:1.0:0.0	.	431;557	P43403-3;P43403	.;ZAP70_HUMAN	Q	557;431;250	ENSP00000264972:R557Q;ENSP00000411141:R431Q;ENSP00000400475:R250Q	ENSP00000264972:R557Q	R	+	2	0	ZAP70	97720936	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.818000	0.99354	2.318000	0.78349	0.655000	0.94253	CGG	ZAP70	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_Prot_kinase_cat_dom	ENSG00000115085		0.607	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	HGNC	protein_coding	OTTHUMT00000329278.1	266	0.00	0	G			98354504	98354504	+1	no_errors	ENST00000264972	ensembl	human	known	69_37n	missense	105	20.15	27	SNP	1.000	A
ZDBF2	57683	genome.wustl.edu	37	2	207175781	207175781	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr2:207175781C>G	ENST00000374423.3	+	5	6915	c.6529C>G	c.(6529-6531)Cat>Gat	p.H2177D		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2177							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AAAGAAAATTCATGGAAAGAG	0.313																																						dbGAP											0													42.0	43.0	42.0					2																	207175781		1799	4070	5869	-	-	-	SO:0001583	missense	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6529C>G	2.37:g.207175781C>G	ENSP00000363545:p.His2177Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.H2177D	ENST00000374423.3	37	c.6529	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	C	1.985	-0.433128	0.04669	.	.	ENSG00000204186	ENST00000374423	T	0.41758	0.99	5.23	0.948	0.19561	.	.	.	.	.	T	0.25195	0.0612	N	0.22421	0.69	0.09310	N	1	B	0.16802	0.019	B	0.18871	0.023	T	0.23332	-1.0191	9	0.59425	D	0.04	.	3.3398	0.07114	0.2924:0.3391:0.0:0.3685	.	2177	Q9HCK1	ZDBF2_HUMAN	D	2177	ENSP00000363545:H2177D	ENSP00000363545:H2177D	H	+	1	0	ZDBF2	206884026	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	0.163000	0.16520	0.195000	0.20347	0.655000	0.94253	CAT	ZDBF2	-	NULL	ENSG00000204186		0.313	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	46	0.00	0	C	NM_020923		207175781	207175781	+1	no_errors	ENST00000374423	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.000	G
ZIC1	7545	genome.wustl.edu	37	3	147128456	147128456	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr3:147128456C>T	ENST00000282928.4	+	1	1286	c.557C>T	c.(556-558)tCg>tTg	p.S186L		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	186					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S186L(1)		central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						AGCCCGCGTTCGGAGCACTAT	0.672																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											38.0	42.0	40.0					3																	147128456		2203	4299	6502	-	-	-	SO:0001583	missense	0			D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.557C>T	3.37:g.147128456C>T	ENSP00000282928:p.Ser186Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3N1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S186L	ENST00000282928.4	37	c.557	CCDS3136.1	3	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849077	0.51270	.	.	ENSG00000152977	ENST00000282928	T	0.34859	1.34	3.31	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.25306	0.0615	N	0.22421	0.69	0.58432	D	0.999999	B	0.31655	0.334	B	0.26416	0.069	T	0.26360	-1.0105	10	0.72032	D	0.01	.	15.1323	0.72533	0.0:1.0:0.0:0.0	.	186	Q15915	ZIC1_HUMAN	L	186	ENSP00000282928:S186L	ENSP00000282928:S186L	S	+	2	0	ZIC1	148611146	0.995000	0.38212	0.993000	0.49108	0.965000	0.64279	7.329000	0.79170	1.847000	0.53656	0.549000	0.68633	TCG	ZIC1	-	NULL	ENSG00000152977		0.672	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC1	HGNC	protein_coding	OTTHUMT00000355497.1	25	0.00	0	C	NM_003412		147128456	147128456	+1	no_errors	ENST00000282928	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	1.000	T
ZNF211	10520	genome.wustl.edu	37	19	58152315	58152315	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:58152315A>T	ENST00000347302.3	+	3	640	c.461A>T	c.(460-462)cAg>cTg	p.Q154L	ZNF211_ENST00000240731.4_Missense_Mutation_p.Q167L|ZNF211_ENST00000391703.3_Missense_Mutation_p.Q93L|ZNF211_ENST00000254182.7_Missense_Mutation_p.Q145L|ZNF211_ENST00000420680.1_Missense_Mutation_p.Q158L|ZNF211_ENST00000299871.5_Missense_Mutation_p.Q219L|ZNF211_ENST00000541801.1_Missense_Mutation_p.Q145L|ZNF211_ENST00000544273.1_Missense_Mutation_p.Q166L	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAACAGCACCAGAGGCAGCAC	0.458																																						dbGAP											0													109.0	94.0	99.0					19																	58152315		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.461A>T	19.37:g.58152315A>T	ENSP00000339562:p.Gln154Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q167L	ENST00000347302.3	37	c.500	CCDS12957.1	19	.	.	.	.	.	.	.	.	.	.	A	14.43	2.532164	0.45073	.	.	ENSG00000121417	ENST00000420680;ENST00000347302;ENST00000254182;ENST00000391703;ENST00000541801;ENST00000299871;ENST00000544273;ENST00000240731	T;T;T;T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43	3.62	1.48	0.22813	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18718	0.0449	L	0.46819	1.47	0.09310	N	1	P;P;P;B;B;B	0.41848	0.557;0.557;0.763;0.2;0.421;0.421	B;B;P;B;B;B	0.44811	0.279;0.221;0.461;0.061;0.145;0.145	T	0.12167	-1.0558	9	0.87932	D	0	.	7.2269	0.26020	0.8002:0.0:0.1998:0.0	.	158;166;219;145;154;167	Q13398-4;Q13398-3;F8WDV2;Q13398-2;Q13398;B9ZVW1	.;.;.;.;ZN211_HUMAN;.	L	158;154;145;93;145;219;166;167	ENSP00000399193:Q158L;ENSP00000339562:Q154L;ENSP00000254182:Q145L;ENSP00000375584:Q93L;ENSP00000442601:Q145L;ENSP00000299871:Q219L;ENSP00000441386:Q166L;ENSP00000240731:Q167L	ENSP00000240731:Q167L	Q	+	2	0	ZNF211	62844127	0.002000	0.14202	0.000000	0.03702	0.070000	0.16714	1.387000	0.34430	0.133000	0.18654	0.482000	0.46254	CAG	ZNF211	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000121417		0.458	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF211	HGNC	protein_coding	OTTHUMT00000397502.1	136	0.00	0	A			58152315	58152315	+1	no_errors	ENST00000240731	ensembl	human	known	69_37n	missense	81	14.58	14	SNP	0.007	T
ZNF467	168544	genome.wustl.edu	37	7	149461892	149461892	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:149461892C>T	ENST00000302017.3	-	5	2112	c.1699G>A	c.(1699-1701)Gaa>Aaa	p.E567K	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGGGCGGCTTCGCCGTGAATG	0.716																																						dbGAP											0													17.0	20.0	19.0					7																	149461892		2090	4233	6323	-	-	-	SO:0001583	missense	0			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1699G>A	7.37:g.149461892C>T	ENSP00000304769:p.Glu567Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E567K	ENST00000302017.3	37	c.1699	CCDS5899.1	7	.	.	.	.	.	.	.	.	.	.	C	9.364	1.068820	0.20147	.	.	ENSG00000181444	ENST00000302017	T	0.07688	3.17	3.97	3.06	0.35304	.	0.648009	0.11830	U	0.525272	T	0.06325	0.0163	N	0.24115	0.695	0.09310	N	1	B	0.32731	0.382	B	0.23018	0.043	T	0.30031	-0.9992	10	0.66056	D	0.02	0.0406	12.1134	0.53852	0.0:0.8251:0.1749:0.0	.	567	Q7Z7K2	ZN467_HUMAN	K	567	ENSP00000304769:E567K	ENSP00000304769:E567K	E	-	1	0	ZNF467	149092825	0.000000	0.05858	0.015000	0.15790	0.064000	0.16182	0.952000	0.29149	0.860000	0.35481	0.462000	0.41574	GAA	ZNF467	-	NULL	ENSG00000181444		0.716	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	HGNC	protein_coding	OTTHUMT00000349833.1	16	0.00	0	C	NM_207336		149461892	149461892	-1	no_errors	ENST00000302017	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	0.021	T
ZNF527	84503	genome.wustl.edu	37	19	37880726	37880726	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:37880726G>T	ENST00000436120.2	+	5	1882	c.1775G>T	c.(1774-1776)aGc>aTc	p.S592I	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	592					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATAATTTTAGCTGTGTCTCA	0.388																																						dbGAP											0													51.0	54.0	53.0					19																	37880726		2087	4241	6328	-	-	-	SO:0001583	missense	0			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.1775G>T	19.37:g.37880726G>T	ENSP00000390179:p.Ser592Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVL5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S592I	ENST00000436120.2	37	c.1775	CCDS42559.1	19	.	.	.	.	.	.	.	.	.	.	G	8.086	0.773390	0.16051	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	3.59	2.54	0.30619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.189341	0.26065	N	0.026557	T	0.47838	0.1467	L	0.42529	1.33	0.20403	N	0.999905	D;D	0.67145	0.994;0.996	P;P	0.61477	0.889;0.823	T	0.29274	-1.0017	9	0.32370	T	0.25	.	10.2162	0.43170	0.103:0.0:0.897:0.0	.	592;560	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	I	592;560;540	.	ENSP00000325231:S560I	S	+	2	0	ZNF527	42572566	0.001000	0.12720	0.171000	0.22900	0.993000	0.82548	0.923000	0.28757	0.874000	0.35823	0.655000	0.94253	AGC	ZNF527	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189164		0.388	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	HGNC	protein_coding	OTTHUMT00000458434.1	40	0.00	0	G	NM_032453		37880726	37880726	+1	no_errors	ENST00000436120	ensembl	human	known	69_37n	missense	54	18.18	12	SNP	0.086	T
ZNF473	25888	genome.wustl.edu	37	19	50550264	50550264	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:50550264C>G	ENST00000595661.1	+	6	3059	c.2564C>G	c.(2563-2565)tCg>tGg	p.S855W	ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000445728.3_Missense_Mutation_p.S843W|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000270617.3_Missense_Mutation_p.S855W|ZNF473_ENST00000391821.2_Missense_Mutation_p.S855W|CTD-2126E3.3_ENST00000599410.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	855					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		CGGTGCCACTCGAGCCTCAGC	0.537											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													38.0	42.0	41.0					19																	50550264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2564C>G	19.37:g.50550264C>G	ENSP00000472808:p.Ser855Trp	Somatic	970	WXS	Illumina GAIIx	Phase_IV	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S855W	ENST00000595661.1	37	c.2564	CCDS33077.1	19	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704258	0.48412	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.33654	1.4;1.4;1.4	4.38	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.228609	0.22669	N	0.057087	T	0.53932	0.1827	M	0.90650	3.135	0.09310	N	1	D	0.69078	0.997	P	0.54664	0.758	T	0.50311	-0.8843	10	0.72032	D	0.01	-0.6034	8.5174	0.33255	0.0:0.7389:0.0:0.2611	.	855	Q8WTR7	ZN473_HUMAN	W	855;855;843	ENSP00000270617:S855W;ENSP00000375697:S855W;ENSP00000388961:S843W	ENSP00000270617:S855W	S	+	2	0	ZNF473	55242076	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.596000	0.05720	0.371000	0.24564	0.655000	0.94253	TCG	ZNF473	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000142528		0.537	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF473	HGNC	protein_coding	OTTHUMT00000464833.1	41	0.00	0	C	XM_046390		50550264	50550264	+1	no_errors	ENST00000270617	ensembl	human	known	69_37n	missense	45	22.95	14	SNP	0.000	G
ZNF625	90589	genome.wustl.edu	37	19	12256707	12256707	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:12256707C>T	ENST00000355738.1	-	4	675	c.326G>A	c.(325-327)cGt>cAt	p.R109H	CTC-359D24.3_ENST00000472362.1_RNA|ZNF625-ZNF20_ENST00000430024.1_Intron|ZNF625_ENST00000439556.2_Missense_Mutation_p.R175H|ZNF625_ENST00000542938.1_Missense_Mutation_p.R109H|ZNF625_ENST00000455799.1_3'UTR			Q96I27	ZN625_HUMAN	zinc finger protein 625	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						AATGCTTGAACGGGAAATAAA	0.433																																						dbGAP											0													143.0	132.0	136.0					19																	12256707		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.326G>A	19.37:g.12256707C>T	ENSP00000347977:p.Arg109His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU45|I3L0E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R175H	ENST00000355738.1	37	c.524		19	.	.	.	.	.	.	.	.	.	.	C	7.823	0.718280	0.15372	.	.	ENSG00000257591	ENST00000542938;ENST00000355738;ENST00000439556	T;T;T	0.36157	1.27;1.27;1.27	1.13	-2.26	0.06867	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20941	0.0504	L	0.38175	1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28332	-1.0047	9	0.17832	T	0.49	.	3.6788	0.08302	0.2293:0.459:0.3117:0.0	.	109;109	A8K8U0;Q96I27	.;ZN625_HUMAN	H	109;109;175	ENSP00000438436:R109H;ENSP00000347977:R109H;ENSP00000394380:R175H	ENSP00000347977:R109H	R	-	2	0	AC022415.5	12117707	0.000000	0.05858	0.000000	0.03702	0.974000	0.67602	-4.317000	0.00254	-1.168000	0.02776	0.313000	0.20887	CGT	ZNF625	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000257591		0.433	ZNF625-201	KNOWN	basic	protein_coding	ZNF625	Clone_based_vega_gene	protein_coding		84	0.00	0	C	NM_145233		12256707	12256707	-1	no_errors	ENST00000439556	ensembl	human	known	69_37n	missense	108	19.42	27	SNP	0.000	T
ZNF626	199777	genome.wustl.edu	37	19	20808023	20808023	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:20808023C>G	ENST00000601440.1	-	4	806	c.660G>C	c.(658-660)aaG>aaC	p.K220N	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						TATGAATTTTCTTATGTCTAG	0.388																																						dbGAP											0													48.0	51.0	50.0					19																	20808023		2148	4274	6422	-	-	-	SO:0001583	missense	0			BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.660G>C	19.37:g.20808023C>G	ENSP00000469958:p.Lys220Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8T4|Q96QM1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K220N	ENST00000601440.1	37	c.660	CCDS42535.1	19	.	.	.	.	.	.	.	.	.	.	N	8.666	0.901754	0.17760	.	.	ENSG00000188171	ENST00000392298;ENST00000453075;ENST00000305570	.	.	.	0.798	-0.603	0.11630	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.52565	0.1742	L	0.33093	0.98	0.45648	D	0.998576	D	0.62365	0.991	D	0.69654	0.965	T	0.53662	-0.8407	8	0.66056	D	0.02	.	4.4901	0.11810	0.0:0.6786:0.0:0.3214	.	220	Q68DY1	ZN626_HUMAN	N	220;144;220	.	ENSP00000445201:K220N	K	-	3	2	ZNF626	20599863	0.000000	0.05858	0.364000	0.25888	0.362000	0.29581	0.410000	0.21098	0.162000	0.19483	0.165000	0.16767	AAG	ZNF626	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188171		0.388	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF626	HGNC	protein_coding	OTTHUMT00000447845.2	36	0.00	0	C	NM_145297		20808023	20808023	-1	no_errors	ENST00000305570	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.777	G
ZNF587	84914	genome.wustl.edu	37	19	58370801	58370801	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr19:58370801C>T	ENST00000339656.5	+	3	1203	c.1021C>T	c.(1021-1023)Caa>Taa	p.Q341*	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597652.1_5'Flank|ZNF587_ENST00000423137.1_Nonsense_Mutation_p.Q340*|ZNF587_ENST00000419854.1_Nonsense_Mutation_p.Q298*|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		TAACCTCATTCAACATCAGCA	0.448																																					Pancreas(59;641 1233 1885 20055 50741)	dbGAP											0													103.0	133.0	123.0					19																	58370801		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.1021C>T	19.37:g.58370801C>T	ENSP00000345479:p.Gln341*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV72|G3V0H5|Q6ZMK8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q341*	ENST00000339656.5	37	c.1021	CCDS12964.1	19	.	.	.	.	.	.	.	.	.	.	.	16.02	3.004173	0.54254	.	.	ENSG00000198466	ENST00000376209;ENST00000423137;ENST00000339656;ENST00000540851;ENST00000419854	.	.	.	1.76	-3.53	0.04667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	4.5143	0.11926	0.5969:0.2348:0.1683:0.0	.	.	.	.	X	298;340;341;341;298	.	ENSP00000345479:Q341X	Q	+	1	0	ZNF587	63062613	0.000000	0.05858	0.001000	0.08648	0.082000	0.17680	-12.144000	0.00002	-0.195000	0.10382	0.195000	0.17529	CAA	ZNF587	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198466		0.448	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF587	HGNC	protein_coding	OTTHUMT00000337594.2	229	0.00	0	C	NM_032828		58370801	58370801	+1	no_errors	ENST00000339656	ensembl	human	known	69_37n	nonsense	187	17.39	40	SNP	0.000	T
ZNF92	168374	genome.wustl.edu	37	7	64853754	64853754	+	Silent	SNP	C	C	T			TCGA-A2-A0EY-01A-11W-A050-09	TCGA-A2-A0EY-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8cde596-e3f5-4b20-9e7f-45d079893176	b1d7c034-0cf5-40ce-8620-35248ca45e08	g.chr7:64853754C>T	ENST00000328747.7	+	3	365	c.166C>T	c.(166-168)Ctg>Ttg	p.L56L	ZNF92_ENST00000357512.2_Intron|ZNF92_ENST00000431504.1_Intron|ZNF92_ENST00000450302.2_5'UTR	NM_152626.2	NP_689839.1	Q03936	ZNF92_HUMAN	zinc finger protein 92	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|skin(1)|stomach(1)	13		Lung NSC(55;0.159)				GATCACCTGGCTGGAGCAAGG	0.388																																						dbGAP											0													100.0	106.0	104.0					7																	64853754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M61872	CCDS34646.1, CCDS47596.1, CCDS75608.1, CCDS75609.1	7q11.21	2013-01-08	2006-05-12		ENSG00000146757	ENSG00000146757		"""Zinc fingers, C2H2-type"", ""-"""	13168	protein-coding gene	gene with protein product		603974	"""zinc finger protein 92 (HTF12)"""			8467795	Standard	NM_001287533		Approved	HPF12, TF12	uc003ttz.3	Q03936	OTTHUMG00000156557	ENST00000328747.7:c.166C>T	7.37:g.64853754C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNF9|Q8N492|Q8NB35	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L56	ENST00000328747.7	37	c.166	CCDS34646.1	7																																																																																			ZNF92	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000146757		0.388	ZNF92-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF92	HGNC	protein_coding	OTTHUMT00000344589.2	194	0.00	0	C	NM_152626		64853754	64853754	+1	no_errors	ENST00000328747	ensembl	human	known	69_37n	silent	197	31.49	91	SNP	0.995	T
