#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA4	24	genome.wustl.edu	37	1	94543428	94543428	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:94543428G>T	ENST00000370225.3	-	11	1458	c.1372C>A	c.(1372-1374)Cca>Aca	p.P458T	ABCA4_ENST00000535735.1_Missense_Mutation_p.P458T	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	458					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.P458T(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TTTACTGTTGGGTTCCCCAGG	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	105.0	105.0					1																	94543428		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1372C>A	1.37:g.94543428G>T	ENSP00000359245:p.Pro458Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.P458T	ENST00000370225.3	37	c.1372	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	3.093	-0.186539	0.06340	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.85088	-1.94;-1.94	5.14	4.23	0.50019	.	1.254750	0.05391	N	0.539002	T	0.80204	0.4580	L	0.58810	1.83	0.51482	D	0.999924	P;B	0.45531	0.86;0.212	B;B	0.44044	0.439;0.094	T	0.74009	-0.3802	10	0.42905	T	0.14	.	12.1963	0.54298	0.1427:0.0:0.8573:0.0	.	458;458	F5H6E5;P78363	.;ABCA4_HUMAN	T	458	ENSP00000359245:P458T;ENSP00000437682:P458T	ENSP00000359245:P458T	P	-	1	0	ABCA4	94316016	1.000000	0.71417	0.996000	0.52242	0.198000	0.23893	5.952000	0.70282	1.538000	0.49270	-0.140000	0.14226	CCA	ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.438	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	34	0.00	0	G	NM_000350		94543428	94543428	-1	no_errors	ENST00000370225	ensembl	human	known	69_37n	missense	33	45.00	27	SNP	1.000	T
ABCA4	24	genome.wustl.edu	37	1	94543428	94543428	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:94543428G>T	ENST00000370225.3	-	11	1458	c.1372C>A	c.(1372-1374)Cca>Aca	p.P458T	ABCA4_ENST00000535735.1_Missense_Mutation_p.P458T	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	458					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.P458T(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TTTACTGTTGGGTTCCCCAGG	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	105.0	105.0					1																	94543428		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1372C>A	1.37:g.94543428G>T	ENSP00000359245:p.Pro458Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.P458T	ENST00000370225.3	37	c.1372	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	3.093	-0.186539	0.06340	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.85088	-1.94;-1.94	5.14	4.23	0.50019	.	1.254750	0.05391	N	0.539002	T	0.80204	0.4580	L	0.58810	1.83	0.51482	D	0.999924	P;B	0.45531	0.86;0.212	B;B	0.44044	0.439;0.094	T	0.74009	-0.3802	10	0.42905	T	0.14	.	12.1963	0.54298	0.1427:0.0:0.8573:0.0	.	458;458	F5H6E5;P78363	.;ABCA4_HUMAN	T	458	ENSP00000359245:P458T;ENSP00000437682:P458T	ENSP00000359245:P458T	P	-	1	0	ABCA4	94316016	1.000000	0.71417	0.996000	0.52242	0.198000	0.23893	5.952000	0.70282	1.538000	0.49270	-0.140000	0.14226	CCA	ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.438	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	50	0.00	0	G	NM_000350		94543428	94543428	-1	no_errors	ENST00000370225	ensembl	human	known	69_37n	missense	33	45.00	27	SNP	1.000	T
ABCA6	23460	genome.wustl.edu	37	17	67094096	67094096	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:67094096G>C	ENST00000284425.2	-	23	3259	c.3085C>G	c.(3085-3087)Cct>Gct	p.P1029A	ABCA6_ENST00000446604.2_5'UTR|MIR4524B_ENST00000581569.1_RNA	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1029					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P1029A(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					GTGATATAAGGAGAAATGCTA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	55.0	56.0					17																	67094096		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.3085C>G	17.37:g.67094096G>C	ENSP00000284425:p.Pro1029Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P1029A	ENST00000284425.2	37	c.3085	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	G	13.77	2.337733	0.41398	.	.	ENSG00000154262	ENST00000284425	D	0.88201	-2.35	4.92	4.92	0.64577	.	0.000000	0.52532	D	0.000078	D	0.94584	0.8255	M	0.88241	2.94	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	D	0.94736	0.7914	10	0.59425	D	0.04	.	13.8152	0.63287	0.0:0.0:1.0:0.0	.	1029	Q8N139	ABCA6_HUMAN	A	1029	ENSP00000284425:P1029A	ENSP00000284425:P1029A	P	-	1	0	ABCA6	64605691	1.000000	0.71417	0.766000	0.31476	0.213000	0.24496	4.539000	0.60657	2.717000	0.92951	0.557000	0.71058	CCT	ABCA6	-	NULL	ENSG00000154262		0.368	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	107	0.00	0	G	NM_080284		67094096	67094096	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	0.981	C
ABCA6	23460	genome.wustl.edu	37	17	67094096	67094096	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:67094096G>C	ENST00000284425.2	-	23	3259	c.3085C>G	c.(3085-3087)Cct>Gct	p.P1029A	ABCA6_ENST00000446604.2_5'UTR|MIR4524B_ENST00000581569.1_RNA	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1029					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P1029A(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					GTGATATAAGGAGAAATGCTA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	55.0	56.0					17																	67094096		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.3085C>G	17.37:g.67094096G>C	ENSP00000284425:p.Pro1029Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P1029A	ENST00000284425.2	37	c.3085	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	G	13.77	2.337733	0.41398	.	.	ENSG00000154262	ENST00000284425	D	0.88201	-2.35	4.92	4.92	0.64577	.	0.000000	0.52532	D	0.000078	D	0.94584	0.8255	M	0.88241	2.94	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	D	0.94736	0.7914	10	0.59425	D	0.04	.	13.8152	0.63287	0.0:0.0:1.0:0.0	.	1029	Q8N139	ABCA6_HUMAN	A	1029	ENSP00000284425:P1029A	ENSP00000284425:P1029A	P	-	1	0	ABCA6	64605691	1.000000	0.71417	0.766000	0.31476	0.213000	0.24496	4.539000	0.60657	2.717000	0.92951	0.557000	0.71058	CCT	ABCA6	-	NULL	ENSG00000154262		0.368	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	155	0.00	0	G	NM_080284		67094096	67094096	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	0.981	C
ABCC12	94160	genome.wustl.edu	37	16	48167699	48167699	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:48167699G>T	ENST00000311303.3	-	7	1372	c.1027C>A	c.(1027-1029)Caa>Aaa	p.Q343K	ABCC12_ENST00000448542.1_Missense_Mutation_p.Q343K|ABCC12_ENST00000416054.1_Missense_Mutation_p.Q343K	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	343	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.Q343K(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TTTCCACTTTGGACAAATCCA	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	117.0	116.0					16																	48167699		2201	4300	6501	-	-	-	SO:0001583	missense	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1027C>A	16.37:g.48167699G>T	ENSP00000311030:p.Gln343Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.Q343K	ENST00000311303.3	37	c.1027	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231249	0.79688	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	D;D;D	0.89343	-2.5;-2.5;-2.5	4.85	4.85	0.62838	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94198	0.8138	M	0.78049	2.395	0.58432	D	0.999999	D;P	0.76494	0.999;0.933	D;P	0.79784	0.993;0.775	D	0.94770	0.7944	10	0.62326	D	0.03	.	16.7547	0.85496	0.0:0.0:1.0:0.0	.	343;343	Q96J65-2;Q96J65	.;MRP9_HUMAN	K	343;343;285;343	ENSP00000311030:Q343K;ENSP00000401855:Q343K;ENSP00000413046:Q343K	ENSP00000311030:Q343K	Q	-	1	0	ABCC12	46725200	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	7.400000	0.79949	2.211000	0.71520	0.467000	0.42956	CAA	ABCC12	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000140798		0.483	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	123	0.00	0	G	NM_033226		48167699	48167699	-1	no_errors	ENST00000311303	ensembl	human	known	69_37n	missense	160	22.71	47	SNP	1.000	T
ABCC12	94160	genome.wustl.edu	37	16	48167699	48167699	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:48167699G>T	ENST00000311303.3	-	7	1372	c.1027C>A	c.(1027-1029)Caa>Aaa	p.Q343K	ABCC12_ENST00000448542.1_Missense_Mutation_p.Q343K|ABCC12_ENST00000416054.1_Missense_Mutation_p.Q343K	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	343	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.Q343K(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TTTCCACTTTGGACAAATCCA	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	117.0	116.0					16																	48167699		2201	4300	6501	-	-	-	SO:0001583	missense	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1027C>A	16.37:g.48167699G>T	ENSP00000311030:p.Gln343Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.Q343K	ENST00000311303.3	37	c.1027	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231249	0.79688	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	D;D;D	0.89343	-2.5;-2.5;-2.5	4.85	4.85	0.62838	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94198	0.8138	M	0.78049	2.395	0.58432	D	0.999999	D;P	0.76494	0.999;0.933	D;P	0.79784	0.993;0.775	D	0.94770	0.7944	10	0.62326	D	0.03	.	16.7547	0.85496	0.0:0.0:1.0:0.0	.	343;343	Q96J65-2;Q96J65	.;MRP9_HUMAN	K	343;343;285;343	ENSP00000311030:Q343K;ENSP00000401855:Q343K;ENSP00000413046:Q343K	ENSP00000311030:Q343K	Q	-	1	0	ABCC12	46725200	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	7.400000	0.79949	2.211000	0.71520	0.467000	0.42956	CAA	ABCC12	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000140798		0.483	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	81	0.00	0	G	NM_033226		48167699	48167699	-1	no_errors	ENST00000311303	ensembl	human	known	69_37n	missense	160	22.71	47	SNP	1.000	T
ABHD11	83451	genome.wustl.edu	37	7	73151593	73151593	+	Silent	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:73151593A>T	ENST00000222800.3	-	4	660	c.591T>A	c.(589-591)cgT>cgA	p.R197R	ABHD11_ENST00000437775.2_Silent_p.R190R|LINC00035_ENST00000427153.1_RNA|ABHD11_ENST00000395147.4_Intron|ABHD11_ENST00000468998.1_5'Flank|ABHD11_ENST00000458339.1_Intron	NM_148912.2	NP_683710.1	Q8NFV4	ABHDB_HUMAN	abhydrolase domain containing 11	197						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)	p.R197R(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Lung NSC(55;0.0908)|all_lung(88;0.198)				GTTTTCGGGCACGGGAGCGGG	0.557																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											79.0	71.0	74.0					7																	73151593		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF217971	CCDS5558.1, CCDS47607.1, CCDS47608.1, CCDS75615.1	7q11.23	2010-08-05	2005-01-24	2005-01-27	ENSG00000106077	ENSG00000106077		"""Abhydrolase domain containing"""	16407	protein-coding gene	gene with protein product			"""Williams Beuren syndrome chromosome region 21"""	WBSCR21		12073013	Standard	NR_026910		Approved	PP1226	uc003tzb.3	Q8NFV4	OTTHUMG00000130029	ENST00000222800.3:c.591T>A	7.37:g.73151593A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	H7BYM8|Q6PJU0|Q8N722|Q8N723|Q8NFV2|Q8NFV3|Q9HBS8	Silent	SNP	pfam_AB_hydrolase_1,pfam_PGAP1-like,pfam_Thioesterase,pfam_Esterase_put,prints_AB_hydrolase_1	p.R197	ENST00000222800.3	37	c.591	CCDS5558.1	7																																																																																			ABHD11	-	pfam_AB_hydrolase_1,pfam_Thioesterase	ENSG00000106077		0.557	ABHD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD11	HGNC	protein_coding	OTTHUMT00000252306.1	8	0.00	0	A			73151593	73151593	-1	no_errors	ENST00000222800	ensembl	human	known	69_37n	silent	45	33.82	23	SNP	0.000	T
ACSM5	54988	genome.wustl.edu	37	16	20442397	20442397	+	Splice_Site	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:20442397T>C	ENST00000331849.4	+	9	1353		c.e9+2			NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.?(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GATGTGCAGGTAGCAGCCTCC	0.597																																						dbGAP											1	Unknown(1)	breast(1)											137.0	128.0	131.0					16																	20442397		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1206+2T>C	16.37:g.20442397T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV1|Q96CX8|Q9NWV3	Splice_Site	SNP	-	e8+2	ENST00000331849.4	37	c.1206+2	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	T	9.571	1.121044	0.20877	.	.	ENSG00000183549	ENST00000331849	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8693	0.57957	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSM5	20349898	1.000000	0.71417	0.994000	0.49952	0.143000	0.21401	6.439000	0.73430	1.722000	0.51474	0.528000	0.53228	.	ACSM5	-	-	ENSG00000183549		0.597	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	15	0.00	0	T	NM_017888	Intron	20442397	20442397	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	splice_site	76	22.45	22	SNP	1.000	C
ACSM5	54988	genome.wustl.edu	37	16	20442397	20442397	+	Splice_Site	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:20442397T>C	ENST00000331849.4	+	9	1353		c.e9+2			NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.?(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GATGTGCAGGTAGCAGCCTCC	0.597																																						dbGAP											1	Unknown(1)	breast(1)											137.0	128.0	131.0					16																	20442397		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1206+2T>C	16.37:g.20442397T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV1|Q96CX8|Q9NWV3	Splice_Site	SNP	-	e8+2	ENST00000331849.4	37	c.1206+2	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	T	9.571	1.121044	0.20877	.	.	ENSG00000183549	ENST00000331849	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8693	0.57957	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSM5	20349898	1.000000	0.71417	0.994000	0.49952	0.143000	0.21401	6.439000	0.73430	1.722000	0.51474	0.528000	0.53228	.	ACSM5	-	-	ENSG00000183549		0.597	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	23	0.00	0	T	NM_017888	Intron	20442397	20442397	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	splice_site	76	22.45	22	SNP	1.000	C
ADAMTS19	171019	genome.wustl.edu	37	5	128863507	128863507	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:128863507C>G	ENST00000274487.4	+	5	1280	c.1135C>G	c.(1135-1137)Ctg>Gtg	p.L379V	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	379	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L379V(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAAGCTTATTCTGCTCCATGA	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	101.0	99.0					5																	128863507		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1135C>G	5.37:g.128863507C>G	ENSP00000274487:p.Leu379Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.L379V	ENST00000274487.4	37	c.1135	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701922	0.68501	.	.	ENSG00000145808	ENST00000274487	D	0.86230	-2.09	4.41	4.41	0.53225	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.106868	0.39146	N	0.001460	D	0.87281	0.6138	N	0.16743	0.435	0.48571	D	0.999673	D	0.65815	0.995	D	0.65573	0.936	D	0.85887	0.1426	9	.	.	.	.	18.326	0.90254	0.0:1.0:0.0:0.0	.	379	Q8TE59	ATS19_HUMAN	V	379	ENSP00000274487:L379V	.	L	+	1	2	ADAMTS19	128891406	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.300000	0.43620	2.737000	0.93849	0.563000	0.77884	CTG	ADAMTS19	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000145808		0.303	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	171	0.00	0	C	NM_133638		128863507	128863507	+1	no_errors	ENST00000274487	ensembl	human	known	69_37n	missense	46	39.47	30	SNP	1.000	G
ADAMTS19	171019	genome.wustl.edu	37	5	128863507	128863507	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:128863507C>G	ENST00000274487.4	+	5	1280	c.1135C>G	c.(1135-1137)Ctg>Gtg	p.L379V	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	379	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L379V(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAAGCTTATTCTGCTCCATGA	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	101.0	99.0					5																	128863507		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1135C>G	5.37:g.128863507C>G	ENSP00000274487:p.Leu379Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.L379V	ENST00000274487.4	37	c.1135	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701922	0.68501	.	.	ENSG00000145808	ENST00000274487	D	0.86230	-2.09	4.41	4.41	0.53225	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.106868	0.39146	N	0.001460	D	0.87281	0.6138	N	0.16743	0.435	0.48571	D	0.999673	D	0.65815	0.995	D	0.65573	0.936	D	0.85887	0.1426	9	.	.	.	.	18.326	0.90254	0.0:1.0:0.0:0.0	.	379	Q8TE59	ATS19_HUMAN	V	379	ENSP00000274487:L379V	.	L	+	1	2	ADAMTS19	128891406	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.300000	0.43620	2.737000	0.93849	0.563000	0.77884	CTG	ADAMTS19	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000145808		0.303	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	230	0.00	0	C	NM_133638		128863507	128863507	+1	no_errors	ENST00000274487	ensembl	human	known	69_37n	missense	46	39.47	30	SNP	1.000	G
ADAMTS6	11174	genome.wustl.edu	37	5	64748724	64748724	+	Missense_Mutation	SNP	G	G	T	rs368191265	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:64748724G>T	ENST00000536360.1	-	5	1466	c.653C>A	c.(652-654)cCt>cAt	p.P218H				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	218						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P218H(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CAGCCACCAAGGTTTGCCACT	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	120.0	125.0					5																	64748724		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.653C>A	5.37:g.64748724G>T	ENSP00000440995:p.Pro218His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.P218H	ENST00000536360.1	37	c.653		5	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068618	0.36470	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	T;T;T	0.60424	0.22;0.33;0.19	5.71	5.71	0.89125	.	0.106971	0.64402	D	0.000003	T	0.48370	0.1496	N	0.24115	0.695	0.58432	D	0.999999	B	0.06786	0.001	B	0.11329	0.006	T	0.32241	-0.9914	10	0.40728	T	0.16	.	19.8706	0.96849	0.0:0.0:1.0:0.0	.	218	Q9UKP5	ATS6_HUMAN	H	218	ENSP00000370443:P218H;ENSP00000423551:P218H;ENSP00000440995:P218H	ENSP00000261306:P218H	P	-	2	0	ADAMTS6	64784480	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	8.847000	0.92166	2.691000	0.91804	0.563000	0.77884	CCT	ADAMTS6	-	NULL	ENSG00000049192		0.358	ADAMTS6-201	KNOWN	basic	protein_coding	ADAMTS6	HGNC	protein_coding		108	0.00	0	G	NM_197941		64748724	64748724	-1	no_errors	ENST00000381055	ensembl	human	known	69_37n	missense	51	37.80	31	SNP	1.000	T
ADAMTS6	11174	genome.wustl.edu	37	5	64748724	64748724	+	Missense_Mutation	SNP	G	G	T	rs368191265	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:64748724G>T	ENST00000536360.1	-	5	1466	c.653C>A	c.(652-654)cCt>cAt	p.P218H				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	218						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P218H(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CAGCCACCAAGGTTTGCCACT	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	120.0	125.0					5																	64748724		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.653C>A	5.37:g.64748724G>T	ENSP00000440995:p.Pro218His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.P218H	ENST00000536360.1	37	c.653		5	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068618	0.36470	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	T;T;T	0.60424	0.22;0.33;0.19	5.71	5.71	0.89125	.	0.106971	0.64402	D	0.000003	T	0.48370	0.1496	N	0.24115	0.695	0.58432	D	0.999999	B	0.06786	0.001	B	0.11329	0.006	T	0.32241	-0.9914	10	0.40728	T	0.16	.	19.8706	0.96849	0.0:0.0:1.0:0.0	.	218	Q9UKP5	ATS6_HUMAN	H	218	ENSP00000370443:P218H;ENSP00000423551:P218H;ENSP00000440995:P218H	ENSP00000261306:P218H	P	-	2	0	ADAMTS6	64784480	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	8.847000	0.92166	2.691000	0.91804	0.563000	0.77884	CCT	ADAMTS6	-	NULL	ENSG00000049192		0.358	ADAMTS6-201	KNOWN	basic	protein_coding	ADAMTS6	HGNC	protein_coding		68	0.00	0	G	NM_197941		64748724	64748724	-1	no_errors	ENST00000381055	ensembl	human	known	69_37n	missense	51	37.80	31	SNP	1.000	T
ADAMTS2	9509	genome.wustl.edu	37	5	178585812	178585812	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:178585812G>A	ENST00000251582.7	-	6	1145	c.1044C>T	c.(1042-1044)ctC>ctT	p.L348L	ADAMTS2_ENST00000274609.5_Silent_p.L348L	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	348	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L348L(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GCTTCTGCTGGAGGTAGGCCC	0.592																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											121.0	106.0	111.0					5																	178585812		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1044C>T	5.37:g.178585812G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.L348	ENST00000251582.7	37	c.1044	CCDS4444.1	5																																																																																			ADAMTS2	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000087116		0.592	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	13	0.00	0	G	NM_014244		178585812	178585812	-1	no_errors	ENST00000251582	ensembl	human	known	69_37n	silent	97	28.15	38	SNP	1.000	A
ADAMTS2	9509	genome.wustl.edu	37	5	178585812	178585812	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:178585812G>A	ENST00000251582.7	-	6	1145	c.1044C>T	c.(1042-1044)ctC>ctT	p.L348L	ADAMTS2_ENST00000274609.5_Silent_p.L348L	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	348	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L348L(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GCTTCTGCTGGAGGTAGGCCC	0.592																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											121.0	106.0	111.0					5																	178585812		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1044C>T	5.37:g.178585812G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.L348	ENST00000251582.7	37	c.1044	CCDS4444.1	5																																																																																			ADAMTS2	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000087116		0.592	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	19	0.00	0	G	NM_014244		178585812	178585812	-1	no_errors	ENST00000251582	ensembl	human	known	69_37n	silent	97	28.15	38	SNP	1.000	A
ADSL	158	genome.wustl.edu	37	22	40746017	40746017	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr22:40746017C>A	ENST00000216194.7	+	2	391	c.335C>A	c.(334-336)tCt>tAt	p.S112Y	ADSL_ENST00000454266.2_Missense_Mutation_p.S112Y|ADSL_ENST00000342312.6_Missense_Mutation_p.S112Y	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	112	Substrate binding.				'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)	p.S112Y(2)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						GGTGCTACTTCTTGCTATGTT	0.418																																					Colon(4;65 130 1097 1516)	dbGAP											2	Substitution - Missense(2)	breast(2)											151.0	120.0	130.0					22																	40746017		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.335C>A	22.37:g.40746017C>A	ENSP00000216194:p.Ser112Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	pfam_Lyase1_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase,prints_D_crystallin,tigrfam_Pur_lyase	p.S112Y	ENST00000216194.7	37	c.335	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983874	0.93044	.	.	ENSG00000239900	ENST00000216194;ENST00000544206;ENST00000425605;ENST00000454266;ENST00000342312	D;D;D	0.99594	-4.37;-4.37;-6.25	5.59	5.59	0.84812	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.99837	0.9926	H	0.98487	4.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.96715	0.9528	10	0.87932	D	0	-22.6821	19.6899	0.95996	0.0:1.0:0.0:0.0	.	112;112;112;112	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	Y	112	ENSP00000216194:S112Y;ENSP00000390107:S112Y;ENSP00000341429:S112Y	ENSP00000216194:S112Y	S	+	2	0	ADSL	39075963	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.309000	0.78937	2.648000	0.89879	0.650000	0.86243	TCT	ADSL	-	superfamily_L-Aspartase-like,tigrfam_Pur_lyase	ENSG00000239900		0.418	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	109	0.00	0	C	NM_000026		40746017	40746017	+1	no_errors	ENST00000454266	ensembl	human	known	69_37n	missense	63	25.00	21	SNP	1.000	A
ADSL	158	genome.wustl.edu	37	22	40746017	40746017	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr22:40746017C>A	ENST00000216194.7	+	2	391	c.335C>A	c.(334-336)tCt>tAt	p.S112Y	ADSL_ENST00000454266.2_Missense_Mutation_p.S112Y|ADSL_ENST00000342312.6_Missense_Mutation_p.S112Y	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	112	Substrate binding.				'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)	p.S112Y(2)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						GGTGCTACTTCTTGCTATGTT	0.418																																					Colon(4;65 130 1097 1516)	dbGAP											2	Substitution - Missense(2)	breast(2)											151.0	120.0	130.0					22																	40746017		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.335C>A	22.37:g.40746017C>A	ENSP00000216194:p.Ser112Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	pfam_Lyase1_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase,prints_D_crystallin,tigrfam_Pur_lyase	p.S112Y	ENST00000216194.7	37	c.335	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983874	0.93044	.	.	ENSG00000239900	ENST00000216194;ENST00000544206;ENST00000425605;ENST00000454266;ENST00000342312	D;D;D	0.99594	-4.37;-4.37;-6.25	5.59	5.59	0.84812	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.99837	0.9926	H	0.98487	4.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.96715	0.9528	10	0.87932	D	0	-22.6821	19.6899	0.95996	0.0:1.0:0.0:0.0	.	112;112;112;112	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	Y	112	ENSP00000216194:S112Y;ENSP00000390107:S112Y;ENSP00000341429:S112Y	ENSP00000216194:S112Y	S	+	2	0	ADSL	39075963	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.309000	0.78937	2.648000	0.89879	0.650000	0.86243	TCT	ADSL	-	superfamily_L-Aspartase-like,tigrfam_Pur_lyase	ENSG00000239900		0.418	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	73	0.00	0	C	NM_000026		40746017	40746017	+1	no_errors	ENST00000454266	ensembl	human	known	69_37n	missense	63	25.00	21	SNP	1.000	A
AGL	178	genome.wustl.edu	37	1	100330007	100330007	+	Missense_Mutation	SNP	G	G	C	rs533806773		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:100330007G>C	ENST00000294724.4	+	5	1004	c.526G>C	c.(526-528)Gcc>Ccc	p.A176P	AGL_ENST00000361915.3_Missense_Mutation_p.A176P|AGL_ENST00000370161.2_Missense_Mutation_p.A160P|AGL_ENST00000370163.3_Missense_Mutation_p.A176P|AGL_ENST00000361302.3_Missense_Mutation_p.A160P|AGL_ENST00000361522.4_Missense_Mutation_p.A159P|AGL_ENST00000370165.3_Missense_Mutation_p.A176P	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	176					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.A176P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		CTACTCCCTTGCCAATCAGTT	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	154.0	154.0					1																	100330007		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.526G>C	1.37:g.100330007G>C	ENSP00000294724:p.Ala176Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	pfam_GDE_C,superfamily_6-hairpin_glycosidase-like,superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	p.A176P	ENST00000294724.4	37	c.526	CCDS759.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171940	0.78452	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88;-1.88;-1.88;-1.88	5.47	4.55	0.56014	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89560	0.6750	M	0.79475	2.455	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.995	D;D;D	0.69479	0.964;0.964;0.922	D	0.89490	0.3756	10	0.41790	T	0.15	.	15.7126	0.77644	0.0:0.0:0.8623:0.1377	.	159;160;176	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	P	176;176;176;176;160;160;159	ENSP00000355106:A176P;ENSP00000359184:A176P;ENSP00000359182:A176P;ENSP00000294724:A176P;ENSP00000354971:A160P;ENSP00000359180:A160P;ENSP00000354635:A159P	ENSP00000294724:A176P	A	+	1	0	AGL	100102595	1.000000	0.71417	0.968000	0.41197	0.952000	0.60782	5.351000	0.66022	1.298000	0.44778	0.563000	0.77884	GCC	AGL	-	superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	ENSG00000162688		0.368	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGL	HGNC	protein_coding	OTTHUMT00000029778.1	245	0.00	0	G	NM_000028		100330007	100330007	+1	no_errors	ENST00000294724	ensembl	human	known	69_37n	missense	51	40.70	35	SNP	1.000	C
AGL	178	genome.wustl.edu	37	1	100330007	100330007	+	Missense_Mutation	SNP	G	G	C	rs533806773		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:100330007G>C	ENST00000294724.4	+	5	1004	c.526G>C	c.(526-528)Gcc>Ccc	p.A176P	AGL_ENST00000361915.3_Missense_Mutation_p.A176P|AGL_ENST00000370161.2_Missense_Mutation_p.A160P|AGL_ENST00000370163.3_Missense_Mutation_p.A176P|AGL_ENST00000361302.3_Missense_Mutation_p.A160P|AGL_ENST00000361522.4_Missense_Mutation_p.A159P|AGL_ENST00000370165.3_Missense_Mutation_p.A176P	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	176					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.A176P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		CTACTCCCTTGCCAATCAGTT	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	154.0	154.0					1																	100330007		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.526G>C	1.37:g.100330007G>C	ENSP00000294724:p.Ala176Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	pfam_GDE_C,superfamily_6-hairpin_glycosidase-like,superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	p.A176P	ENST00000294724.4	37	c.526	CCDS759.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171940	0.78452	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88;-1.88;-1.88;-1.88	5.47	4.55	0.56014	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89560	0.6750	M	0.79475	2.455	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.995	D;D;D	0.69479	0.964;0.964;0.922	D	0.89490	0.3756	10	0.41790	T	0.15	.	15.7126	0.77644	0.0:0.0:0.8623:0.1377	.	159;160;176	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	P	176;176;176;176;160;160;159	ENSP00000355106:A176P;ENSP00000359184:A176P;ENSP00000359182:A176P;ENSP00000294724:A176P;ENSP00000354971:A160P;ENSP00000359180:A160P;ENSP00000354635:A159P	ENSP00000294724:A176P	A	+	1	0	AGL	100102595	1.000000	0.71417	0.968000	0.41197	0.952000	0.60782	5.351000	0.66022	1.298000	0.44778	0.563000	0.77884	GCC	AGL	-	superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	ENSG00000162688		0.368	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGL	HGNC	protein_coding	OTTHUMT00000029778.1	350	0.00	0	G	NM_000028		100330007	100330007	+1	no_errors	ENST00000294724	ensembl	human	known	69_37n	missense	51	40.70	35	SNP	1.000	C
AHCTF1	25909	genome.wustl.edu	37	1	247067282	247067282	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:247067282T>A	ENST00000391829.2	-	7	1058	c.935A>T	c.(934-936)aAg>aTg	p.K312M	AHCTF1_ENST00000366508.1_Missense_Mutation_p.K347M|AHCTF1_ENST00000326225.3_Missense_Mutation_p.K321M			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	312	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K312fs*13(1)|p.K312M(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGCCAAACACTTTCTATTACC	0.328																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											2	Substitution - Missense(1)|Deletion - Frameshift(1)	breast(2)											80.0	77.0	78.0					1																	247067282		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.935A>T	1.37:g.247067282T>A	ENSP00000375705:p.Lys312Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.K321M	ENST00000391829.2	37	c.962		1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.940419	0.73557	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.24151	1.87;1.87;1.87	5.37	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.35307	0.0927	L	0.32530	0.975	0.51482	D	0.999921	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	T	0.08680	-1.0710	10	0.59425	D	0.04	-14.1436	7.6745	0.28478	0.0:0.073:0.1418:0.7853	.	347;312	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	M	347;321;312	ENSP00000355464:K347M;ENSP00000355465:K321M;ENSP00000375705:K312M	ENSP00000355465:K321M	K	-	2	0	AHCTF1	245133905	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.784000	0.68990	0.848000	0.35191	0.455000	0.32223	AAG	AHCTF1	-	NULL	ENSG00000153207		0.328	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		119	0.00	0	T	NM_015446		247067282	247067282	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	missense	110	13.39	17	SNP	1.000	A
AHCTF1	25909	genome.wustl.edu	37	1	247067282	247067282	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:247067282T>A	ENST00000391829.2	-	7	1058	c.935A>T	c.(934-936)aAg>aTg	p.K312M	AHCTF1_ENST00000366508.1_Missense_Mutation_p.K347M|AHCTF1_ENST00000326225.3_Missense_Mutation_p.K321M			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	312	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K312fs*13(1)|p.K312M(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGCCAAACACTTTCTATTACC	0.328																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											2	Substitution - Missense(1)|Deletion - Frameshift(1)	breast(2)											80.0	77.0	78.0					1																	247067282		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.935A>T	1.37:g.247067282T>A	ENSP00000375705:p.Lys312Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.K321M	ENST00000391829.2	37	c.962		1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.940419	0.73557	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.24151	1.87;1.87;1.87	5.37	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.35307	0.0927	L	0.32530	0.975	0.51482	D	0.999921	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	T	0.08680	-1.0710	10	0.59425	D	0.04	-14.1436	7.6745	0.28478	0.0:0.073:0.1418:0.7853	.	347;312	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	M	347;321;312	ENSP00000355464:K347M;ENSP00000355465:K321M;ENSP00000375705:K312M	ENSP00000355465:K321M	K	-	2	0	AHCTF1	245133905	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.784000	0.68990	0.848000	0.35191	0.455000	0.32223	AAG	AHCTF1	-	NULL	ENSG00000153207		0.328	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		74	0.00	0	T	NM_015446		247067282	247067282	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	missense	110	13.39	17	SNP	1.000	A
AKAP6	9472	genome.wustl.edu	37	14	33293160	33293160	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:33293160T>A	ENST00000280979.4	+	13	6311	c.6141T>A	c.(6139-6141)caT>caA	p.H2047Q	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2047					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.H2047Q(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ATGTTTTCCATCAAAAAGATG	0.408																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	72.0	73.0					14																	33293160		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6141T>A	14.37:g.33293160T>A	ENSP00000280979:p.His2047Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.H2047Q	ENST00000280979.4	37	c.6141	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	T	15.23	2.770570	0.49680	.	.	ENSG00000151320	ENST00000280979	T	0.52057	0.68	6.03	4.87	0.63330	.	0.206197	0.42053	D	0.000770	T	0.42200	0.1192	L	0.60455	1.87	0.80722	D	1	P	0.38335	0.627	B	0.32022	0.139	T	0.40365	-0.9567	10	0.62326	D	0.03	-5.2321	12.2651	0.54674	0.0:0.0:0.1416:0.8584	.	2047	Q13023	AKAP6_HUMAN	Q	2047	ENSP00000280979:H2047Q	ENSP00000280979:H2047Q	H	+	3	2	AKAP6	32362911	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.142000	0.50601	1.075000	0.40932	0.533000	0.62120	CAT	AKAP6	-	NULL	ENSG00000151320		0.408	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	58	0.00	0	T	NM_004274		33293160	33293160	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	1.000	A
AKAP6	9472	genome.wustl.edu	37	14	33293160	33293160	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:33293160T>A	ENST00000280979.4	+	13	6311	c.6141T>A	c.(6139-6141)caT>caA	p.H2047Q	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2047					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.H2047Q(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ATGTTTTCCATCAAAAAGATG	0.408																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	72.0	73.0					14																	33293160		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6141T>A	14.37:g.33293160T>A	ENSP00000280979:p.His2047Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.H2047Q	ENST00000280979.4	37	c.6141	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	T	15.23	2.770570	0.49680	.	.	ENSG00000151320	ENST00000280979	T	0.52057	0.68	6.03	4.87	0.63330	.	0.206197	0.42053	D	0.000770	T	0.42200	0.1192	L	0.60455	1.87	0.80722	D	1	P	0.38335	0.627	B	0.32022	0.139	T	0.40365	-0.9567	10	0.62326	D	0.03	-5.2321	12.2651	0.54674	0.0:0.0:0.1416:0.8584	.	2047	Q13023	AKAP6_HUMAN	Q	2047	ENSP00000280979:H2047Q	ENSP00000280979:H2047Q	H	+	3	2	AKAP6	32362911	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.142000	0.50601	1.075000	0.40932	0.533000	0.62120	CAT	AKAP6	-	NULL	ENSG00000151320		0.408	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	87	0.00	0	T	NM_004274		33293160	33293160	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	1.000	A
ALK	238	genome.wustl.edu	37	2	29432670	29432675	+	In_Frame_Del	DEL	ATCCCG	ATCCCG	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	ATCCCG	ATCCCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:29432670_29432675delATCCCG	ENST00000389048.3	-	25	4719_4724	c.3813_3818delCGGGAT	c.(3811-3819)ttcgggatg>ttg	p.1271_1273FGM>L	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1271	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.F1271_M1273>L(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GTCTCGGGCCATCCCGAAGTCTCCAA	0.544			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	1	Complex - deletion inframe(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3813_3818delCGGGAT	2.37:g.29432670_29432675delATCCCG	ENSP00000373700:p.Phe1271_Met1273delinsLeu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	In_Frame_Del	DEL	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.FGM1271in_frame_delL	ENST00000389048.3	37	c.3818_3813	CCDS33172.1	2																																																																																			ALK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000171094		0.544	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	17	0.00	0	ATCCCG	NM_004304		29432670	29432675	-1	no_errors	ENST00000389048	ensembl	human	known	69_37n	in_frame_del	84	18.27	19	DEL	1.000:1.000:0.873:1.000:1.000:0.947	-
ALK	238	genome.wustl.edu	37	2	29432670	29432675	+	In_Frame_Del	DEL	ATCCCG	ATCCCG	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	ATCCCG	ATCCCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:29432670_29432675delATCCCG	ENST00000389048.3	-	25	4719_4724	c.3813_3818delCGGGAT	c.(3811-3819)ttcgggatg>ttg	p.1271_1273FGM>L	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1271	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.F1271_M1273>L(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GTCTCGGGCCATCCCGAAGTCTCCAA	0.544			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	1	Complex - deletion inframe(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3813_3818delCGGGAT	2.37:g.29432670_29432675delATCCCG	ENSP00000373700:p.Phe1271_Met1273delinsLeu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	In_Frame_Del	DEL	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.FGM1271in_frame_delL	ENST00000389048.3	37	c.3818_3813	CCDS33172.1	2																																																																																			ALK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000171094		0.544	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	31	0.00	0	ATCCCG	NM_004304		29432670	29432675	-1	no_errors	ENST00000389048	ensembl	human	known	69_37n	in_frame_del	84	18.27	19	DEL	1.000:1.000:0.873:1.000:1.000:0.947	-
ANKRD30B	374860	genome.wustl.edu	37	18	14782552	14782552	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr18:14782552T>C	ENST00000358984.4	+	12	1689	c.1509T>C	c.(1507-1509)acT>acC	p.T503T	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Silent_p.T503T	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	503								p.T503T(2)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CTGCAAAGACTCAAGTGTGTA	0.274																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											70.0	61.0	64.0					18																	14782552		692	1584	2276	-	-	-	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1509T>C	18.37:g.14782552T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T503	ENST00000358984.4	37	c.1509	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.274	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	195	0.00	0	T	NM_001145029		14782552	14782552	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	silent	41	21.15	11	SNP	0.000	C
ANKRD30B	374860	genome.wustl.edu	37	18	14782552	14782552	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr18:14782552T>C	ENST00000358984.4	+	12	1689	c.1509T>C	c.(1507-1509)acT>acC	p.T503T	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Silent_p.T503T	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	503								p.T503T(2)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CTGCAAAGACTCAAGTGTGTA	0.274																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											70.0	61.0	64.0					18																	14782552		692	1584	2276	-	-	-	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1509T>C	18.37:g.14782552T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T503	ENST00000358984.4	37	c.1509	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.274	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	288	0.00	0	T	NM_001145029		14782552	14782552	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	silent	41	21.15	11	SNP	0.000	C
ANKRD36C	400986	genome.wustl.edu	37	2	96546211	96546211	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:96546211C>T	ENST00000456556.1	-	58	3517	c.3433G>A	c.(3433-3435)Gcc>Acc	p.A1145T	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.A172T|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.A396T|ANKRD36C_ENST00000295246.5_Missense_Mutation_p.A566T			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1145							ion channel inhibitor activity (GO:0008200)	p.A396T(2)|p.A566T(1)|p.A1145T(1)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						ATTTTGGTGGCTGTATTCAGA	0.318																																						dbGAP											4	Substitution - Missense(4)	breast(4)																																								-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.3433G>A	2.37:g.96546211C>T	ENSP00000403302:p.Ala1145Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1145T	ENST00000456556.1	37	c.3433		2	.	.	.	.	.	.	.	.	.	.	c	14.99	2.700854	0.48307	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039;ENST00000295246	T;T;T;T	0.43294	3.6;0.95;3.6;1.5	1.4	0.487	0.16842	.	.	.	.	.	T	0.52549	0.1741	L	0.59436	1.845	0.09310	N	1	D	0.62365	0.991	D	0.74348	0.983	T	0.37267	-0.9713	9	0.87932	D	0	.	3.6915	0.08347	0.0:0.7436:0.0:0.2564	.	1145	Q5JPF3	AN36C_HUMAN	T	396;1145;172;566	ENSP00000415231:A396T;ENSP00000403302:A1145T;ENSP00000407838:A172T;ENSP00000295246:A566T	ENSP00000295246:A566T	A	-	1	0	AC073995.2	95909938	0.004000	0.15560	0.002000	0.10522	0.449000	0.32228	0.130000	0.15850	0.159000	0.19401	0.194000	0.17425	GCC	ANKRD36C	-	NULL	ENSG00000174501		0.318	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	459	0.00	0	C	NM_001010914		96546211	96546211	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	97	19.83	24	SNP	0.002	T
ANKRD36C	400986	genome.wustl.edu	37	2	96546211	96546211	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:96546211C>T	ENST00000456556.1	-	58	3517	c.3433G>A	c.(3433-3435)Gcc>Acc	p.A1145T	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.A172T|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.A396T|ANKRD36C_ENST00000295246.5_Missense_Mutation_p.A566T			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1145							ion channel inhibitor activity (GO:0008200)	p.A396T(2)|p.A566T(1)|p.A1145T(1)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						ATTTTGGTGGCTGTATTCAGA	0.318																																						dbGAP											4	Substitution - Missense(4)	breast(4)																																								-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.3433G>A	2.37:g.96546211C>T	ENSP00000403302:p.Ala1145Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1145T	ENST00000456556.1	37	c.3433		2	.	.	.	.	.	.	.	.	.	.	c	14.99	2.700854	0.48307	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039;ENST00000295246	T;T;T;T	0.43294	3.6;0.95;3.6;1.5	1.4	0.487	0.16842	.	.	.	.	.	T	0.52549	0.1741	L	0.59436	1.845	0.09310	N	1	D	0.62365	0.991	D	0.74348	0.983	T	0.37267	-0.9713	9	0.87932	D	0	.	3.6915	0.08347	0.0:0.7436:0.0:0.2564	.	1145	Q5JPF3	AN36C_HUMAN	T	396;1145;172;566	ENSP00000415231:A396T;ENSP00000403302:A1145T;ENSP00000407838:A172T;ENSP00000295246:A566T	ENSP00000295246:A566T	A	-	1	0	AC073995.2	95909938	0.004000	0.15560	0.002000	0.10522	0.449000	0.32228	0.130000	0.15850	0.159000	0.19401	0.194000	0.17425	GCC	ANKRD36C	-	NULL	ENSG00000174501		0.318	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	614	0.00	0	C	NM_001010914		96546211	96546211	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	97	19.83	24	SNP	0.002	T
ARHGAP24	83478	genome.wustl.edu	37	4	86863218	86863218	+	Splice_Site	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:86863218G>T	ENST00000395184.1	+	5	857		c.e5-1		ARHGAP24_ENST00000264343.4_Splice_Site|ARHGAP24_ENST00000503995.1_Splice_Site|ARHGAP24_ENST00000395183.2_Splice_Site	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24						activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)	p.?(2)		breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		TTTTTTTTAAGGCATTTTTGG	0.383																																						dbGAP											2	Unknown(2)	breast(2)											74.0	71.0	72.0					4																	86863218		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.392-1G>T	4.37:g.86863218G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Splice_Site	SNP	-	e4-1	ENST00000395184.1	37	c.392-1	CCDS34025.1	4	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041854	0.75732	.	.	ENSG00000138639	ENST00000395184;ENST00000503995;ENST00000512201;ENST00000395183;ENST00000509300;ENST00000514229;ENST00000264343	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4561	0.99145	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP24	87082242	1.000000	0.71417	0.997000	0.53966	0.714000	0.41099	9.779000	0.99018	2.843000	0.97960	0.650000	0.86243	.	ARHGAP24	-	-	ENSG00000138639		0.383	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP24	HGNC	protein_coding	OTTHUMT00000252815.2	238	0.00	0	G	NM_031305	Intron	86863218	86863218	+1	no_errors	ENST00000395184	ensembl	human	known	69_37n	splice_site	72	25.77	25	SNP	1.000	T
ARHGAP24	83478	genome.wustl.edu	37	4	86863218	86863218	+	Splice_Site	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:86863218G>T	ENST00000395184.1	+	5	857		c.e5-1		ARHGAP24_ENST00000264343.4_Splice_Site|ARHGAP24_ENST00000503995.1_Splice_Site|ARHGAP24_ENST00000395183.2_Splice_Site	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24						activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)	p.?(2)		breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		TTTTTTTTAAGGCATTTTTGG	0.383																																						dbGAP											2	Unknown(2)	breast(2)											74.0	71.0	72.0					4																	86863218		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.392-1G>T	4.37:g.86863218G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Splice_Site	SNP	-	e4-1	ENST00000395184.1	37	c.392-1	CCDS34025.1	4	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041854	0.75732	.	.	ENSG00000138639	ENST00000395184;ENST00000503995;ENST00000512201;ENST00000395183;ENST00000509300;ENST00000514229;ENST00000264343	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4561	0.99145	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP24	87082242	1.000000	0.71417	0.997000	0.53966	0.714000	0.41099	9.779000	0.99018	2.843000	0.97960	0.650000	0.86243	.	ARHGAP24	-	-	ENSG00000138639		0.383	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP24	HGNC	protein_coding	OTTHUMT00000252815.2	333	0.00	0	G	NM_031305	Intron	86863218	86863218	+1	no_errors	ENST00000395184	ensembl	human	known	69_37n	splice_site	72	25.77	25	SNP	1.000	T
ANKRD50	57182	genome.wustl.edu	37	4	125631416	125631416	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:125631416G>C	ENST00000504087.1	-	2	1288	c.251C>G	c.(250-252)aCg>aGg	p.T84R	ANKRD50_ENST00000515641.1_Intron	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	84								p.T84R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						ACATAGGGCCGTCTTGCCACT	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	85.0	85.0					4																	125631416		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.251C>G	4.37:g.125631416G>C	ENSP00000425658:p.Thr84Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T84R	ENST00000504087.1	37	c.251	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719247	0.89205	.	.	ENSG00000151458	ENST00000504087	T	0.19250	2.16	5.4	5.4	0.78164	.	0.057922	0.64402	D	0.000003	T	0.48077	0.1480	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.48854	-0.8998	10	0.87932	D	0	.	19.1776	0.93609	0.0:0.0:1.0:0.0	.	84	Q9ULJ7	ANR50_HUMAN	R	84	ENSP00000425658:T84R	ENSP00000425658:T84R	T	-	2	0	ANKRD50	125850866	1.000000	0.71417	0.969000	0.41365	0.985000	0.73830	8.985000	0.93487	2.524000	0.85096	0.561000	0.74099	ACG	ANKRD50	-	NULL	ENSG00000151458		0.507	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	44	0.00	0	G	NM_020337		125631416	125631416	-1	no_errors	ENST00000504087	ensembl	human	known	69_37n	missense	71	20.22	18	SNP	1.000	C
ANKRD50	57182	genome.wustl.edu	37	4	125631416	125631416	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:125631416G>C	ENST00000504087.1	-	2	1288	c.251C>G	c.(250-252)aCg>aGg	p.T84R	ANKRD50_ENST00000515641.1_Intron	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	84								p.T84R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						ACATAGGGCCGTCTTGCCACT	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	85.0	85.0					4																	125631416		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.251C>G	4.37:g.125631416G>C	ENSP00000425658:p.Thr84Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T84R	ENST00000504087.1	37	c.251	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719247	0.89205	.	.	ENSG00000151458	ENST00000504087	T	0.19250	2.16	5.4	5.4	0.78164	.	0.057922	0.64402	D	0.000003	T	0.48077	0.1480	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.48854	-0.8998	10	0.87932	D	0	.	19.1776	0.93609	0.0:0.0:1.0:0.0	.	84	Q9ULJ7	ANR50_HUMAN	R	84	ENSP00000425658:T84R	ENSP00000425658:T84R	T	-	2	0	ANKRD50	125850866	1.000000	0.71417	0.969000	0.41365	0.985000	0.73830	8.985000	0.93487	2.524000	0.85096	0.561000	0.74099	ACG	ANKRD50	-	NULL	ENSG00000151458		0.507	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	56	0.00	0	G	NM_020337		125631416	125631416	-1	no_errors	ENST00000504087	ensembl	human	known	69_37n	missense	71	20.22	18	SNP	1.000	C
ARMC8	25852	genome.wustl.edu	37	3	137983034	137983034	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:137983034G>C	ENST00000469044.1	+	14	1550	c.1279G>C	c.(1279-1281)Gtt>Ctt	p.V427L	ARMC8_ENST00000538260.1_Missense_Mutation_p.V396L|ARMC8_ENST00000485396.1_Missense_Mutation_p.V354L|ARMC8_ENST00000461822.1_Missense_Mutation_p.V360L|NME9_ENST00000484930.1_Intron|NME9_ENST00000341790.5_Intron|ARMC8_ENST00000481646.1_Missense_Mutation_p.V413L|ARMC8_ENST00000393058.3_Missense_Mutation_p.V417L|NME9_ENST00000317876.4_Intron|NME9_ENST00000383180.2_Intron|NME9_ENST00000536478.1_Intron|ARMC8_ENST00000491704.1_Missense_Mutation_p.V385L	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	427								p.V413L(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GGATCATGCTGTTTGGAAACC	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	93.0	96.0					3																	137983034		1890	4124	6014	-	-	-	SO:0001583	missense	0				CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1279G>C	3.37:g.137983034G>C	ENSP00000419413:p.Val427Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.V427L	ENST00000469044.1	37	c.1279		3	.	.	.	.	.	.	.	.	.	.	G	17.15	3.314775	0.60524	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000461822;ENST00000485396;ENST00000538260;ENST00000393058;ENST00000463485;ENST00000539459	T;T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;1.57;1.57;1.57;0.2;1.75	5.61	5.61	0.85477	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72061	0.3414	M	0.75447	2.3	0.80722	D	1	P;D;P;B;D	0.62365	0.926;0.961;0.956;0.131;0.991	P;P;P;B;P	0.57101	0.526;0.527;0.65;0.024;0.813	T	0.73886	-0.3841	10	0.52906	T	0.07	-40.4247	17.1328	0.86730	0.0:0.0:1.0:0.0	.	354;360;396;427;413	B7Z637;B7Z441;F5GWK4;Q8IUR7;Q8IUR7-2	.;.;.;ARMC8_HUMAN;.	L	413;427;385;360;354;396;417;321;284	ENSP00000420333:V413L;ENSP00000419413:V427L;ENSP00000417304:V385L;ENSP00000420706:V360L;ENSP00000417049:V354L;ENSP00000441592:V396L;ENSP00000376778:V417L;ENSP00000417403:V321L	ENSP00000376778:V417L	V	+	1	0	ARMC8	139465724	1.000000	0.71417	0.935000	0.37517	0.726000	0.41606	9.230000	0.95299	2.644000	0.89710	0.561000	0.74099	GTT	ARMC8	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114098		0.423	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	ARMC8	HGNC	protein_coding	OTTHUMT00000357560.1	141	0.00	0	G	NM_015396		137983034	137983034	+1	no_errors	ENST00000469044	ensembl	human	known	69_37n	missense	54	36.47	31	SNP	0.999	C
ARMC8	25852	genome.wustl.edu	37	3	137983034	137983034	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:137983034G>C	ENST00000469044.1	+	14	1550	c.1279G>C	c.(1279-1281)Gtt>Ctt	p.V427L	ARMC8_ENST00000538260.1_Missense_Mutation_p.V396L|ARMC8_ENST00000485396.1_Missense_Mutation_p.V354L|ARMC8_ENST00000461822.1_Missense_Mutation_p.V360L|NME9_ENST00000484930.1_Intron|NME9_ENST00000341790.5_Intron|ARMC8_ENST00000481646.1_Missense_Mutation_p.V413L|ARMC8_ENST00000393058.3_Missense_Mutation_p.V417L|NME9_ENST00000317876.4_Intron|NME9_ENST00000383180.2_Intron|NME9_ENST00000536478.1_Intron|ARMC8_ENST00000491704.1_Missense_Mutation_p.V385L	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	427								p.V413L(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GGATCATGCTGTTTGGAAACC	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	93.0	96.0					3																	137983034		1890	4124	6014	-	-	-	SO:0001583	missense	0				CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1279G>C	3.37:g.137983034G>C	ENSP00000419413:p.Val427Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.V427L	ENST00000469044.1	37	c.1279		3	.	.	.	.	.	.	.	.	.	.	G	17.15	3.314775	0.60524	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000461822;ENST00000485396;ENST00000538260;ENST00000393058;ENST00000463485;ENST00000539459	T;T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;1.57;1.57;1.57;0.2;1.75	5.61	5.61	0.85477	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72061	0.3414	M	0.75447	2.3	0.80722	D	1	P;D;P;B;D	0.62365	0.926;0.961;0.956;0.131;0.991	P;P;P;B;P	0.57101	0.526;0.527;0.65;0.024;0.813	T	0.73886	-0.3841	10	0.52906	T	0.07	-40.4247	17.1328	0.86730	0.0:0.0:1.0:0.0	.	354;360;396;427;413	B7Z637;B7Z441;F5GWK4;Q8IUR7;Q8IUR7-2	.;.;.;ARMC8_HUMAN;.	L	413;427;385;360;354;396;417;321;284	ENSP00000420333:V413L;ENSP00000419413:V427L;ENSP00000417304:V385L;ENSP00000420706:V360L;ENSP00000417049:V354L;ENSP00000441592:V396L;ENSP00000376778:V417L;ENSP00000417403:V321L	ENSP00000376778:V417L	V	+	1	0	ARMC8	139465724	1.000000	0.71417	0.935000	0.37517	0.726000	0.41606	9.230000	0.95299	2.644000	0.89710	0.561000	0.74099	GTT	ARMC8	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114098		0.423	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	ARMC8	HGNC	protein_coding	OTTHUMT00000357560.1	91	0.00	0	G	NM_015396		137983034	137983034	+1	no_errors	ENST00000469044	ensembl	human	known	69_37n	missense	54	36.47	31	SNP	0.999	C
ARMCX1	51309	genome.wustl.edu	37	X	100807921	100807921	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:100807921G>A	ENST00000372829.3	+	4	379	c.8G>A	c.(7-9)cGc>cAc	p.R3H		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	3						integral component of membrane (GO:0016021)		p.R3H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						ACCATGGGCCGCACTCGGGAA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	53.0	55.0					X																	100807921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.8G>A	X.37:g.100807921G>A	ENSP00000361917:p.Arg3His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R3H	ENST00000372829.3	37	c.8	CCDS14487.1	X	.	.	.	.	.	.	.	.	.	.	g	22.8	4.342487	0.81911	.	.	ENSG00000126947	ENST00000372829	T	0.37411	1.2	3.6	3.6	0.41247	.	1.005610	0.08026	N	0.992663	T	0.49490	0.1560	L	0.54323	1.7	0.29794	N	0.832971	D	0.71674	0.998	P	0.57244	0.816	T	0.42632	-0.9440	10	0.72032	D	0.01	-7.0009	9.701	0.40187	0.0:0.0:1.0:0.0	.	3	Q9P291	ARMX1_HUMAN	H	3	ENSP00000361917:R3H	ENSP00000361917:R3H	R	+	2	0	ARMCX1	100694577	0.990000	0.36364	0.998000	0.56505	0.990000	0.78478	2.394000	0.44450	2.036000	0.60181	0.544000	0.68410	CGC	ARMCX1	-	NULL	ENSG00000126947		0.602	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX1	HGNC	protein_coding	OTTHUMT00000057561.1	22	0.00	0	G	NM_016608		100807921	100807921	+1	no_errors	ENST00000372829	ensembl	human	known	69_37n	missense	66	38.32	41	SNP	0.998	A
ARMCX1	51309	genome.wustl.edu	37	X	100807921	100807921	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:100807921G>A	ENST00000372829.3	+	4	379	c.8G>A	c.(7-9)cGc>cAc	p.R3H		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	3						integral component of membrane (GO:0016021)		p.R3H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						ACCATGGGCCGCACTCGGGAA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	53.0	55.0					X																	100807921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.8G>A	X.37:g.100807921G>A	ENSP00000361917:p.Arg3His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R3H	ENST00000372829.3	37	c.8	CCDS14487.1	X	.	.	.	.	.	.	.	.	.	.	g	22.8	4.342487	0.81911	.	.	ENSG00000126947	ENST00000372829	T	0.37411	1.2	3.6	3.6	0.41247	.	1.005610	0.08026	N	0.992663	T	0.49490	0.1560	L	0.54323	1.7	0.29794	N	0.832971	D	0.71674	0.998	P	0.57244	0.816	T	0.42632	-0.9440	10	0.72032	D	0.01	-7.0009	9.701	0.40187	0.0:0.0:1.0:0.0	.	3	Q9P291	ARMX1_HUMAN	H	3	ENSP00000361917:R3H	ENSP00000361917:R3H	R	+	2	0	ARMCX1	100694577	0.990000	0.36364	0.998000	0.56505	0.990000	0.78478	2.394000	0.44450	2.036000	0.60181	0.544000	0.68410	CGC	ARMCX1	-	NULL	ENSG00000126947		0.602	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX1	HGNC	protein_coding	OTTHUMT00000057561.1	34	0.00	0	G	NM_016608		100807921	100807921	+1	no_errors	ENST00000372829	ensembl	human	known	69_37n	missense	66	38.32	41	SNP	0.998	A
ASPH	444	genome.wustl.edu	37	8	62563641	62563641	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:62563641G>C	ENST00000379454.4	-	5	645	c.458C>G	c.(457-459)tCc>tGc	p.S153C	ASPH_ENST00000517847.2_Missense_Mutation_p.S139C|ASPH_ENST00000356457.5_Missense_Mutation_p.S153C|ASPH_ENST00000518068.1_Missense_Mutation_p.S153C|ASPH_ENST00000517903.1_Missense_Mutation_p.S139C|ASPH_ENST00000445642.3_Missense_Mutation_p.S139C|ASPH_ENST00000541428.1_Missense_Mutation_p.S124C|ASPH_ENST00000522835.1_Missense_Mutation_p.S139C	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	153	Glu-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)	p.S153C(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	ATGGAGAAGGGACTGAATTTG	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											188.0	175.0	179.0					8																	62563641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.458C>G	8.37:g.62563641G>C	ENSP00000368767:p.Ser153Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S153C	ENST00000379454.4	37	c.458	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	G	15.10	2.731986	0.48939	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000356457;ENST00000519234;ENST00000518068;ENST00000517903;ENST00000445642;ENST00000517847;ENST00000522835;ENST00000518306	T;T;T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.87	3.01	0.34805	Aspartyl beta-hydroxylase/Triadin domain (1);	0.527792	0.20814	N	0.085195	T	0.60573	0.2279	L	0.51422	1.61	0.20074	N	0.999934	D;D;D;D;D;D;D;D;D;D	0.89917	0.998;1.0;0.996;0.996;0.99;0.999;0.999;0.999;0.998;0.992	P;D;D;D;P;D;D;P;D;P	0.81914	0.903;0.995;0.95;0.95;0.849;0.965;0.968;0.891;0.976;0.907	T	0.47071	-0.9145	10	0.51188	T	0.08	-1.2643	5.7788	0.18294	0.1682:0.0:0.6726:0.1592	.	153;139;139;139;124;153;153;153;139;153	B8Y0L3;B4DIC9;B7ZM95;B7ZM96;F5H667;F8W7A9;Q8TB28;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;.;.;ASPH_HUMAN	C	153;124;153;153;168;153;139;139;139;139;124	ENSP00000437864:S124C;ENSP00000368767:S153C;ENSP00000348841:S153C;ENSP00000427823:S168C;ENSP00000429286:S153C;ENSP00000430245:S139C;ENSP00000394013:S139C;ENSP00000429954:S139C;ENSP00000429160:S139C;ENSP00000427877:S124C	ENSP00000348841:S153C	S	-	2	0	ASPH	62726195	0.578000	0.26717	0.329000	0.25429	0.817000	0.46193	1.533000	0.36040	0.892000	0.36259	0.655000	0.94253	TCC	ASPH	-	pfam_Asp-B-hydro/Triadin_dom	ENSG00000198363		0.348	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	250	0.00	0	G	NM_004318		62563641	62563641	-1	no_errors	ENST00000379454	ensembl	human	known	69_37n	missense	92	23.33	28	SNP	0.329	C
ASPH	444	genome.wustl.edu	37	8	62563641	62563641	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:62563641G>C	ENST00000379454.4	-	5	645	c.458C>G	c.(457-459)tCc>tGc	p.S153C	ASPH_ENST00000517847.2_Missense_Mutation_p.S139C|ASPH_ENST00000356457.5_Missense_Mutation_p.S153C|ASPH_ENST00000518068.1_Missense_Mutation_p.S153C|ASPH_ENST00000517903.1_Missense_Mutation_p.S139C|ASPH_ENST00000445642.3_Missense_Mutation_p.S139C|ASPH_ENST00000541428.1_Missense_Mutation_p.S124C|ASPH_ENST00000522835.1_Missense_Mutation_p.S139C	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	153	Glu-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)	p.S153C(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	ATGGAGAAGGGACTGAATTTG	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											188.0	175.0	179.0					8																	62563641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.458C>G	8.37:g.62563641G>C	ENSP00000368767:p.Ser153Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S153C	ENST00000379454.4	37	c.458	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	G	15.10	2.731986	0.48939	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000356457;ENST00000519234;ENST00000518068;ENST00000517903;ENST00000445642;ENST00000517847;ENST00000522835;ENST00000518306	T;T;T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.87	3.01	0.34805	Aspartyl beta-hydroxylase/Triadin domain (1);	0.527792	0.20814	N	0.085195	T	0.60573	0.2279	L	0.51422	1.61	0.20074	N	0.999934	D;D;D;D;D;D;D;D;D;D	0.89917	0.998;1.0;0.996;0.996;0.99;0.999;0.999;0.999;0.998;0.992	P;D;D;D;P;D;D;P;D;P	0.81914	0.903;0.995;0.95;0.95;0.849;0.965;0.968;0.891;0.976;0.907	T	0.47071	-0.9145	10	0.51188	T	0.08	-1.2643	5.7788	0.18294	0.1682:0.0:0.6726:0.1592	.	153;139;139;139;124;153;153;153;139;153	B8Y0L3;B4DIC9;B7ZM95;B7ZM96;F5H667;F8W7A9;Q8TB28;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;.;.;ASPH_HUMAN	C	153;124;153;153;168;153;139;139;139;139;124	ENSP00000437864:S124C;ENSP00000368767:S153C;ENSP00000348841:S153C;ENSP00000427823:S168C;ENSP00000429286:S153C;ENSP00000430245:S139C;ENSP00000394013:S139C;ENSP00000429954:S139C;ENSP00000429160:S139C;ENSP00000427877:S124C	ENSP00000348841:S153C	S	-	2	0	ASPH	62726195	0.578000	0.26717	0.329000	0.25429	0.817000	0.46193	1.533000	0.36040	0.892000	0.36259	0.655000	0.94253	TCC	ASPH	-	pfam_Asp-B-hydro/Triadin_dom	ENSG00000198363		0.348	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	350	0.00	0	G	NM_004318		62563641	62563641	-1	no_errors	ENST00000379454	ensembl	human	known	69_37n	missense	92	23.33	28	SNP	0.329	C
AQP10	89872	genome.wustl.edu	37	1	154300293	154300293	+	IGR	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:154300293T>G	ENST00000324978.3	+	0	1791				ATP8B2_ENST00000368489.3_Silent_p.A6A|ATP8B2_ENST00000368487.3_Intron|ATP8B2_ENST00000341822.2_5'Flank	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10						response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.A6A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCTTGAGAGCTGTTCCCCTTT	0.517																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											245.0	223.0	230.0					1																	154300293		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980		1.37:g.154300293T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYD3|Q5VYD4|Q8NG70	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.A6	ENST00000324978.3	37	c.18	CCDS1065.1	1																																																																																			ATP8B2	-	NULL	ENSG00000143515		0.517	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087661.1	136	0.00	0	T	NM_080429		154300293	154300293	+1	no_errors	ENST00000368489	ensembl	human	known	69_37n	silent	239	17.30	50	SNP	0.000	G
AQP10	89872	genome.wustl.edu	37	1	154300293	154300293	+	IGR	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:154300293T>G	ENST00000324978.3	+	0	1791				ATP8B2_ENST00000368489.3_Silent_p.A6A|ATP8B2_ENST00000368487.3_Intron|ATP8B2_ENST00000341822.2_5'Flank	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10						response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.A6A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCTTGAGAGCTGTTCCCCTTT	0.517																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											245.0	223.0	230.0					1																	154300293		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980		1.37:g.154300293T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYD3|Q5VYD4|Q8NG70	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.A6	ENST00000324978.3	37	c.18	CCDS1065.1	1																																																																																			ATP8B2	-	NULL	ENSG00000143515		0.517	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087661.1	210	0.00	0	T	NM_080429		154300293	154300293	+1	no_errors	ENST00000368489	ensembl	human	known	69_37n	silent	239	17.30	50	SNP	0.000	G
BRCA2	675	genome.wustl.edu	37	13	32953476	32953476	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr13:32953476T>G	ENST00000380152.3	+	22	9010	c.8777T>G	c.(8776-8778)tTa>tGa	p.L2926*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.L2926*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2926					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.L2926*(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GAAGAGCAGTTAAGAGCCTTG	0.353			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	2	Substitution - Nonsense(2)	breast(2)											82.0	78.0	79.0					13																	32953476		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8777T>G	13.37:g.32953476T>G	ENSP00000369497:p.Leu2926*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2,pfscan_BRCA2_repeat	p.L2926*	ENST00000380152.3	37	c.8777	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	T	51	17.719369	0.99892	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.6	4.38	0.52667	.	0.560120	0.17252	N	0.181107	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8784	0.58003	0.0:0.0:0.1361:0.8639	.	.	.	.	X	2926	.	ENSP00000369497:L2926X	L	+	2	0	BRCA2	31851476	0.560000	0.26570	0.476000	0.27291	0.994000	0.84299	3.570000	0.53834	1.022000	0.39626	0.460000	0.39030	TTA	BRCA2	-	superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2	ENSG00000139618		0.353	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	107	0.00	0	T	NM_000059		32953476	32953476	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	nonsense	59	35.16	32	SNP	0.941	G
BRCA2	675	genome.wustl.edu	37	13	32953476	32953476	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr13:32953476T>G	ENST00000380152.3	+	22	9010	c.8777T>G	c.(8776-8778)tTa>tGa	p.L2926*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.L2926*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2926					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.L2926*(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GAAGAGCAGTTAAGAGCCTTG	0.353			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	2	Substitution - Nonsense(2)	breast(2)											82.0	78.0	79.0					13																	32953476		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8777T>G	13.37:g.32953476T>G	ENSP00000369497:p.Leu2926*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2,pfscan_BRCA2_repeat	p.L2926*	ENST00000380152.3	37	c.8777	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	T	51	17.719369	0.99892	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.6	4.38	0.52667	.	0.560120	0.17252	N	0.181107	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8784	0.58003	0.0:0.0:0.1361:0.8639	.	.	.	.	X	2926	.	ENSP00000369497:L2926X	L	+	2	0	BRCA2	31851476	0.560000	0.26570	0.476000	0.27291	0.994000	0.84299	3.570000	0.53834	1.022000	0.39626	0.460000	0.39030	TTA	BRCA2	-	superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2	ENSG00000139618		0.353	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	150	0.00	0	T	NM_000059		32953476	32953476	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	nonsense	59	35.16	32	SNP	0.941	G
CCDC185	164127	genome.wustl.edu	37	1	223567939	223567939	+	Missense_Mutation	SNP	C	C	G	rs566778039	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:223567939C>G	ENST00000366875.3	+	1	1225	c.1122C>G	c.(1120-1122)tgC>tgG	p.C374W		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		374								p.C374W(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		GAAAACAGTGCCAGGTGCGGC	0.667																																						dbGAP											1	Substitution - Missense(1)	breast(1)											16.0	21.0	19.0					1																	223567939		2201	4295	6496	-	-	-	SO:0001583	missense	0																														ENST00000366875.3:c.1122C>G	1.37:g.223567939C>G	ENSP00000355840:p.Cys374Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N746|Q8NA93	Missense_Mutation	SNP	NULL	p.C374W	ENST00000366875.3	37	c.1122	CCDS1537.1	1	.	.	.	.	.	.	.	.	.	.	C	9.864	1.197148	0.22037	.	.	ENSG00000178395	ENST00000366875	T	0.23950	1.88	4.51	3.58	0.41010	.	.	.	.	.	T	0.24236	0.0587	L	0.59436	1.845	0.43522	D	0.995791	B	0.24426	0.103	B	0.24269	0.052	T	0.06570	-1.0819	9	0.66056	D	0.02	.	6.7274	0.23365	0.0:0.7216:0.1786:0.0998	.	374	Q8N715	CA065_HUMAN	W	374	ENSP00000355840:C374W	ENSP00000355840:C374W	C	+	3	2	C1orf65	221634562	0.051000	0.20477	0.123000	0.21794	0.172000	0.22775	0.604000	0.24164	0.838000	0.34948	0.650000	0.86243	TGC	C1orf65	-	NULL	ENSG00000178395		0.667	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf65	HGNC	protein_coding	OTTHUMT00000092718.1	9	0.00	0	C			223567939	223567939	+1	no_errors	ENST00000366875	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	0.424	G
CASR	846	genome.wustl.edu	37	3	121980913	121980913	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:121980913A>T	ENST00000490131.1	+	4	1403	c.1031A>T	c.(1030-1032)cAc>cTc	p.H344L	CASR_ENST00000498619.1_Missense_Mutation_p.H344L|CASR_ENST00000296154.5_Missense_Mutation_p.H344L	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	344					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.H344L(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AAGTCTGTCCACAATGGTTTT	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	59.0	60.0					3																	121980913		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1031A>T	3.37:g.121980913A>T	ENSP00000418685:p.His344Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.H344L	ENST00000490131.1	37	c.1031	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621487	0.46736	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.85955	-2.05;-2.05;-2.05	6.07	6.07	0.98685	Extracellular ligand-binding receptor (1);	0.227351	0.53938	D	0.000059	T	0.77191	0.4094	L	0.31578	0.945	0.53005	D	0.999965	B;B	0.32653	0.213;0.379	B;B	0.31946	0.138;0.126	T	0.76509	-0.2933	10	0.48119	T	0.1	.	10.9655	0.47410	0.8607:0.0:0.0:0.1393	.	344;344	E7ENE0;P41180	.;CASR_HUMAN	L	344	ENSP00000418685:H344L;ENSP00000420194:H344L;ENSP00000296154:H344L	ENSP00000296154:H344L	H	+	2	0	CASR	123463603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.978000	0.70501	2.326000	0.78906	0.533000	0.62120	CAC	CASR	-	pfam_ANF_lig-bd_rcpt	ENSG00000036828		0.517	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	24	0.00	0	A	NM_000388		121980913	121980913	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	73	27.72	28	SNP	1.000	T
CASR	846	genome.wustl.edu	37	3	121980913	121980913	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:121980913A>T	ENST00000490131.1	+	4	1403	c.1031A>T	c.(1030-1032)cAc>cTc	p.H344L	CASR_ENST00000498619.1_Missense_Mutation_p.H344L|CASR_ENST00000296154.5_Missense_Mutation_p.H344L	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	344					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.H344L(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AAGTCTGTCCACAATGGTTTT	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	59.0	60.0					3																	121980913		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1031A>T	3.37:g.121980913A>T	ENSP00000418685:p.His344Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.H344L	ENST00000490131.1	37	c.1031	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621487	0.46736	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.85955	-2.05;-2.05;-2.05	6.07	6.07	0.98685	Extracellular ligand-binding receptor (1);	0.227351	0.53938	D	0.000059	T	0.77191	0.4094	L	0.31578	0.945	0.53005	D	0.999965	B;B	0.32653	0.213;0.379	B;B	0.31946	0.138;0.126	T	0.76509	-0.2933	10	0.48119	T	0.1	.	10.9655	0.47410	0.8607:0.0:0.0:0.1393	.	344;344	E7ENE0;P41180	.;CASR_HUMAN	L	344	ENSP00000418685:H344L;ENSP00000420194:H344L;ENSP00000296154:H344L	ENSP00000296154:H344L	H	+	2	0	CASR	123463603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.978000	0.70501	2.326000	0.78906	0.533000	0.62120	CAC	CASR	-	pfam_ANF_lig-bd_rcpt	ENSG00000036828		0.517	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	41	0.00	0	A	NM_000388		121980913	121980913	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	73	27.72	28	SNP	1.000	T
CDR1	1038	genome.wustl.edu	37	X	139866173	139866173	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:139866173T>G	ENST00000370532.2	-	1	550	c.359A>C	c.(358-360)gAc>gCc	p.D120A		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	120	23 X 6 AA approximate repeats.							p.D120A(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				AAAATCCTTGTCTTCCCTTAA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	99.0	97.0					X																	139866173		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.359A>C	X.37:g.139866173T>G	ENSP00000359563:p.Asp120Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXH6	Missense_Mutation	SNP	NULL	p.D120A	ENST00000370532.2	37	c.359	CCDS14670.1	X	.	.	.	.	.	.	.	.	.	.	T	10.19	1.281857	0.23392	.	.	ENSG00000184258	ENST00000370532	T	0.42513	0.97	4.07	-1.84	0.07809	.	.	.	.	.	T	0.24314	0.0589	L	0.32530	0.975	0.09310	N	1	P	0.40332	0.713	B	0.36418	0.224	T	0.13980	-1.0489	8	.	.	.	.	4.4987	0.11853	0.0:0.3374:0.356:0.3066	.	120	P51861	CDR1_HUMAN	A	120	ENSP00000359563:D120A	.	D	-	2	0	CDR1	139693839	0.095000	0.21747	0.003000	0.11579	0.002000	0.02628	2.395000	0.44459	-0.158000	0.11040	-0.459000	0.05422	GAC	CDR1	-	NULL	ENSG00000184258		0.443	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR1	HGNC	protein_coding	OTTHUMT00000058583.1	147	0.68	1	T	NM_004065		139866173	139866173	-1	no_errors	ENST00000370532	ensembl	human	known	69_37n	missense	79	32.48	38	SNP	0.017	G
CDR1	1038	genome.wustl.edu	37	X	139866173	139866173	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:139866173T>G	ENST00000370532.2	-	1	550	c.359A>C	c.(358-360)gAc>gCc	p.D120A		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	120	23 X 6 AA approximate repeats.							p.D120A(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				AAAATCCTTGTCTTCCCTTAA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	99.0	97.0					X																	139866173		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.359A>C	X.37:g.139866173T>G	ENSP00000359563:p.Asp120Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXH6	Missense_Mutation	SNP	NULL	p.D120A	ENST00000370532.2	37	c.359	CCDS14670.1	X	.	.	.	.	.	.	.	.	.	.	T	10.19	1.281857	0.23392	.	.	ENSG00000184258	ENST00000370532	T	0.42513	0.97	4.07	-1.84	0.07809	.	.	.	.	.	T	0.24314	0.0589	L	0.32530	0.975	0.09310	N	1	P	0.40332	0.713	B	0.36418	0.224	T	0.13980	-1.0489	8	.	.	.	.	4.4987	0.11853	0.0:0.3374:0.356:0.3066	.	120	P51861	CDR1_HUMAN	A	120	ENSP00000359563:D120A	.	D	-	2	0	CDR1	139693839	0.095000	0.21747	0.003000	0.11579	0.002000	0.02628	2.395000	0.44459	-0.158000	0.11040	-0.459000	0.05422	GAC	CDR1	-	NULL	ENSG00000184258		0.443	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR1	HGNC	protein_coding	OTTHUMT00000058583.1	214	0.47	1	T	NM_004065		139866173	139866173	-1	no_errors	ENST00000370532	ensembl	human	known	69_37n	missense	79	32.48	38	SNP	0.017	G
CELSR2	1952	genome.wustl.edu	37	1	109815559	109815559	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:109815559G>A	ENST00000271332.3	+	31	8309	c.8248G>A	c.(8248-8250)Gaa>Aaa	p.E2750K	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2750	Poly-Glu.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.E2750K(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		agaggaggaggaagaggaggC	0.612																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											1	Substitution - Missense(1)	breast(1)											44.0	48.0	47.0					1																	109815559		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.8248G>A	1.37:g.109815559G>A	ENSP00000271332:p.Glu2750Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E2750K	ENST00000271332.3	37	c.8248	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476111	0.44044	.	.	ENSG00000143126	ENST00000271332	T	0.69040	-0.37	4.7	4.7	0.59300	.	.	.	.	.	T	0.27349	0.0671	N	0.08118	0	0.28905	N	0.893049	B	0.06786	0.001	B	0.01281	0.0	T	0.10268	-1.0637	9	0.51188	T	0.08	.	8.6994	0.34316	0.1017:0.0:0.8983:0.0	.	2750	Q9HCU4	CELR2_HUMAN	K	2750	ENSP00000271332:E2750K	ENSP00000271332:E2750K	E	+	1	0	CELSR2	109617082	1.000000	0.71417	0.928000	0.36995	0.741000	0.42261	3.079000	0.50104	2.443000	0.82685	0.561000	0.74099	GAA	CELSR2	-	NULL	ENSG00000143126		0.612	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	13	0.00	0	G	NM_001408		109815559	109815559	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	78	27.78	30	SNP	0.993	A
CELSR2	1952	genome.wustl.edu	37	1	109815559	109815559	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:109815559G>A	ENST00000271332.3	+	31	8309	c.8248G>A	c.(8248-8250)Gaa>Aaa	p.E2750K	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2750	Poly-Glu.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.E2750K(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		agaggaggaggaagaggaggC	0.612																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											1	Substitution - Missense(1)	breast(1)											44.0	48.0	47.0					1																	109815559		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.8248G>A	1.37:g.109815559G>A	ENSP00000271332:p.Glu2750Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E2750K	ENST00000271332.3	37	c.8248	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476111	0.44044	.	.	ENSG00000143126	ENST00000271332	T	0.69040	-0.37	4.7	4.7	0.59300	.	.	.	.	.	T	0.27349	0.0671	N	0.08118	0	0.28905	N	0.893049	B	0.06786	0.001	B	0.01281	0.0	T	0.10268	-1.0637	9	0.51188	T	0.08	.	8.6994	0.34316	0.1017:0.0:0.8983:0.0	.	2750	Q9HCU4	CELR2_HUMAN	K	2750	ENSP00000271332:E2750K	ENSP00000271332:E2750K	E	+	1	0	CELSR2	109617082	1.000000	0.71417	0.928000	0.36995	0.741000	0.42261	3.079000	0.50104	2.443000	0.82685	0.561000	0.74099	GAA	CELSR2	-	NULL	ENSG00000143126		0.612	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	19	0.00	0	G	NM_001408		109815559	109815559	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	78	27.78	30	SNP	0.993	A
CEP70	80321	genome.wustl.edu	37	3	138216888	138216888	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:138216888G>C	ENST00000264982.3	-	17	1983	c.1717C>G	c.(1717-1719)Cta>Gta	p.L573V	CEP70_ENST00000489254.1_Missense_Mutation_p.L421V|CEP70_ENST00000484888.1_Missense_Mutation_p.L573V|CEP70_ENST00000542237.1_Missense_Mutation_p.L553V	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	573					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.L573V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						ATTTCAAGTAGATCATTAGTA	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	105.0	106.0					3																	138216888		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1717C>G	3.37:g.138216888G>C	ENSP00000264982:p.Leu573Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L573V	ENST00000264982.3	37	c.1717	CCDS3102.1	3	.	.	.	.	.	.	.	.	.	.	G	18.08	3.542928	0.65198	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000459695	T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64	5.27	5.27	0.74061	.	0.182213	0.39615	N	0.001304	T	0.54143	0.1840	M	0.71581	2.175	0.47153	D	0.999333	D;D;D	0.60575	0.988;0.985;0.985	P;D;D	0.65874	0.892;0.939;0.939	T	0.55927	-0.8063	10	0.72032	D	0.01	-8.0094	16.4305	0.83840	0.0:0.0:1.0:0.0	.	421;553;573	B7Z2D2;F5GZX8;Q8NHQ1	.;.;CEP70_HUMAN	V	573;553;421;573;555;46	ENSP00000264982:L573V;ENSP00000444128:L553V;ENSP00000417821:L421V;ENSP00000419231:L573V;ENSP00000419833:L555V;ENSP00000418552:L46V	ENSP00000264982:L573V	L	-	1	2	CEP70	139699578	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.153000	0.50685	2.722000	0.93159	0.655000	0.94253	CTA	CEP70	-	NULL	ENSG00000114107		0.343	CEP70-001	KNOWN	basic|CCDS	protein_coding	CEP70	HGNC	protein_coding	OTTHUMT00000358001.1	233	0.00	0	G	NM_024491		138216888	138216888	-1	no_errors	ENST00000264982	ensembl	human	known	69_37n	missense	93	41.61	67	SNP	1.000	C
CEP70	80321	genome.wustl.edu	37	3	138216888	138216888	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:138216888G>C	ENST00000264982.3	-	17	1983	c.1717C>G	c.(1717-1719)Cta>Gta	p.L573V	CEP70_ENST00000489254.1_Missense_Mutation_p.L421V|CEP70_ENST00000484888.1_Missense_Mutation_p.L573V|CEP70_ENST00000542237.1_Missense_Mutation_p.L553V	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	573					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.L573V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						ATTTCAAGTAGATCATTAGTA	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	105.0	106.0					3																	138216888		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1717C>G	3.37:g.138216888G>C	ENSP00000264982:p.Leu573Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L573V	ENST00000264982.3	37	c.1717	CCDS3102.1	3	.	.	.	.	.	.	.	.	.	.	G	18.08	3.542928	0.65198	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000459695	T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64	5.27	5.27	0.74061	.	0.182213	0.39615	N	0.001304	T	0.54143	0.1840	M	0.71581	2.175	0.47153	D	0.999333	D;D;D	0.60575	0.988;0.985;0.985	P;D;D	0.65874	0.892;0.939;0.939	T	0.55927	-0.8063	10	0.72032	D	0.01	-8.0094	16.4305	0.83840	0.0:0.0:1.0:0.0	.	421;553;573	B7Z2D2;F5GZX8;Q8NHQ1	.;.;CEP70_HUMAN	V	573;553;421;573;555;46	ENSP00000264982:L573V;ENSP00000444128:L553V;ENSP00000417821:L421V;ENSP00000419231:L573V;ENSP00000419833:L555V;ENSP00000418552:L46V	ENSP00000264982:L573V	L	-	1	2	CEP70	139699578	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.153000	0.50685	2.722000	0.93159	0.655000	0.94253	CTA	CEP70	-	NULL	ENSG00000114107		0.343	CEP70-001	KNOWN	basic|CCDS	protein_coding	CEP70	HGNC	protein_coding	OTTHUMT00000358001.1	310	0.00	0	G	NM_024491		138216888	138216888	-1	no_errors	ENST00000264982	ensembl	human	known	69_37n	missense	93	41.61	67	SNP	1.000	C
CLIP1	6249	genome.wustl.edu	37	12	122812589	122812589	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:122812589G>A	ENST00000540338.1	-	16	3195	c.3154C>T	c.(3154-3156)Ctg>Ttg	p.L1052L	CLIP1_ENST00000361654.4_Silent_p.L930L|CLIP1_ENST00000545889.1_Silent_p.L627L|CLIP1_ENST00000537178.1_Silent_p.L1006L|CLIP1_ENST00000302528.7_Silent_p.L1041L|CLIP1_ENST00000358808.2_Silent_p.L1041L			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1052					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.L1041L(1)		NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TCTGTGTCCAGCAGCGTCTTC	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											150.0	132.0	138.0					12																	122812589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3154C>T	12.37:g.122812589G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVD3|Q17RS4|Q29RG0	Silent	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Znf_CCHC,superfamily_Prefoldin,pfscan_CAP-Gly_domain	p.L1052	ENST00000540338.1	37	c.3154	CCDS58285.1	12																																																																																			CLIP1	-	NULL	ENSG00000130779		0.537	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	HGNC	protein_coding	OTTHUMT00000401625.1	120	0.83	1	G	NM_002956		122812589	122812589	-1	no_errors	ENST00000540338	ensembl	human	known	69_37n	silent	67	39.64	44	SNP	0.000	A
CLSTN2	64084	genome.wustl.edu	37	3	140123537	140123537	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:140123537C>A	ENST00000458420.3	+	4	756	c.566C>A	c.(565-567)tCc>tAc	p.S189Y	AC092988.1_ENST00000580582.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	189	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.S189Y(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GAGGACTGCTCCCCACAGTAC	0.537										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	122.0	130.0					3																	140123537		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.566C>A	3.37:g.140123537C>A	ENSP00000402460:p.Ser189Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S189Y	ENST00000458420.3	37	c.566	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218040	0.79352	.	.	ENSG00000158258	ENST00000458420	T	0.62639	0.01	5.66	5.66	0.87406	Cadherin (4);Cadherin-like (1);	0.126387	0.56097	D	0.000037	D	0.82779	0.5111	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85709	0.1318	10	0.87932	D	0	-3.9563	17.2492	0.87037	0.0:1.0:0.0:0.0	.	189	Q9H4D0	CSTN2_HUMAN	Y	189	ENSP00000402460:S189Y	ENSP00000402460:S189Y	S	+	2	0	CLSTN2	141606227	1.000000	0.71417	0.995000	0.50966	0.585000	0.36419	7.711000	0.84669	2.665000	0.90641	0.563000	0.77884	TCC	CLSTN2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000158258		0.537	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	22	0.00	0	C	NM_022131		140123537	140123537	+1	no_errors	ENST00000458420	ensembl	human	known	69_37n	missense	88	18.52	20	SNP	1.000	A
CLSTN2	64084	genome.wustl.edu	37	3	140123537	140123537	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:140123537C>A	ENST00000458420.3	+	4	756	c.566C>A	c.(565-567)tCc>tAc	p.S189Y	AC092988.1_ENST00000580582.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	189	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.S189Y(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GAGGACTGCTCCCCACAGTAC	0.537										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	122.0	130.0					3																	140123537		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.566C>A	3.37:g.140123537C>A	ENSP00000402460:p.Ser189Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S189Y	ENST00000458420.3	37	c.566	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218040	0.79352	.	.	ENSG00000158258	ENST00000458420	T	0.62639	0.01	5.66	5.66	0.87406	Cadherin (4);Cadherin-like (1);	0.126387	0.56097	D	0.000037	D	0.82779	0.5111	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85709	0.1318	10	0.87932	D	0	-3.9563	17.2492	0.87037	0.0:1.0:0.0:0.0	.	189	Q9H4D0	CSTN2_HUMAN	Y	189	ENSP00000402460:S189Y	ENSP00000402460:S189Y	S	+	2	0	CLSTN2	141606227	1.000000	0.71417	0.995000	0.50966	0.585000	0.36419	7.711000	0.84669	2.665000	0.90641	0.563000	0.77884	TCC	CLSTN2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000158258		0.537	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	32	0.00	0	C	NM_022131		140123537	140123537	+1	no_errors	ENST00000458420	ensembl	human	known	69_37n	missense	88	18.52	20	SNP	1.000	A
CNGA4	1262	genome.wustl.edu	37	11	6262921	6262922	+	Missense_Mutation	DNP	TG	TG	CT	rs544011023		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:6262921_6262922TG>CT	ENST00000379936.2	+	5	1293_1294	c.1178_1179TG>CT	c.(1177-1179)cTG>cCT	p.L393P	CNGA4_ENST00000533426.1_Missense_Mutation_p.L162P	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	393					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGGTCAACTGGCCGTGGTGG	0.53																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		Exception_encountered	11.37:g.6262921_6262922delinsCT	ENSP00000369268:p.Leu393Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation|Silent	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.L393P|p.L393	ENST00000379936.2	37	c.1178|c.1179	CCDS31408.1	11																																																																																			CNGA4	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000132259		0.530	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA4	HGNC	protein_coding	OTTHUMT00000383765.2	25|24	0.00	0	T|G	NM_001037329		6262921|6262922	6262921|6262922	+1	no_errors	ENST00000379936	ensembl	human	known	69_37n	missense|silent	106|104	30.07|31.37	46|48	SNP	1.000	C|T
CNGA4	1262	genome.wustl.edu	37	11	6262921	6262922	+	Missense_Mutation	DNP	TG	TG	CT	rs544011023		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:6262921_6262922TG>CT	ENST00000379936.2	+	5	1293_1294	c.1178_1179TG>CT	c.(1177-1179)cTG>cCT	p.L393P	CNGA4_ENST00000533426.1_Missense_Mutation_p.L162P	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	393					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGGTCAACTGGCCGTGGTGG	0.53																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		Exception_encountered	11.37:g.6262921_6262922delinsCT	ENSP00000369268:p.Leu393Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation|Silent	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.L393P|p.L393	ENST00000379936.2	37	c.1178|c.1179	CCDS31408.1	11																																																																																			CNGA4	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000132259		0.530	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA4	HGNC	protein_coding	OTTHUMT00000383765.2	25|30	0.00	0	T|G	NM_001037329		6262921|6262922	6262921|6262922	+1	no_errors	ENST00000379936	ensembl	human	known	69_37n	missense|silent	106|104	30.07|31.37	46|48	SNP	1.000	C|T
CNGA4	1262	genome.wustl.edu	37	11	6262921	6262922	+	Missense_Mutation	DNP	TG	TG	CT	rs544011023		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:6262921_6262922TG>CT	ENST00000379936.2	+	5	1293_1294	c.1178_1179TG>CT	c.(1177-1179)cTG>cCT	p.L393P	CNGA4_ENST00000533426.1_Missense_Mutation_p.L162P	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	393					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGGTCAACTGGCCGTGGTGG	0.53																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		Exception_encountered	11.37:g.6262921_6262922delinsCT	ENSP00000369268:p.Leu393Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation|Silent	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.L393P|p.L393	ENST00000379936.2	37	c.1178|c.1179	CCDS31408.1	11																																																																																			CNGA4	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000132259		0.530	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA4	HGNC	protein_coding	OTTHUMT00000383765.2	31|24	0.00	0	T|G	NM_001037329		6262921|6262922	6262921|6262922	+1	no_errors	ENST00000379936	ensembl	human	known	69_37n	missense|silent	106|104	30.07|31.37	46|48	SNP	1.000	C|T
CNGA4	1262	genome.wustl.edu	37	11	6262921	6262922	+	Missense_Mutation	DNP	TG	TG	CT	rs544011023		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:6262921_6262922TG>CT	ENST00000379936.2	+	5	1293_1294	c.1178_1179TG>CT	c.(1177-1179)cTG>cCT	p.L393P	CNGA4_ENST00000533426.1_Missense_Mutation_p.L162P	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	393					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGGTCAACTGGCCGTGGTGG	0.53																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		Exception_encountered	11.37:g.6262921_6262922delinsCT	ENSP00000369268:p.Leu393Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation|Silent	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.L393P|p.L393	ENST00000379936.2	37	c.1178|c.1179	CCDS31408.1	11																																																																																			CNGA4	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000132259		0.530	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA4	HGNC	protein_coding	OTTHUMT00000383765.2	31|30	0.00	0	T|G	NM_001037329		6262921|6262922	6262921|6262922	+1	no_errors	ENST00000379936	ensembl	human	known	69_37n	missense|silent	106|104	30.07|31.37	46|48	SNP	1.000	C|T
COL12A1	1303	genome.wustl.edu	37	6	75899454	75899454	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr6:75899454A>T	ENST00000322507.8	-	6	781	c.472T>A	c.(472-474)Tac>Aac	p.Y158N	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.Y158N|COL12A1_ENST00000416123.2_Missense_Mutation_p.Y158N	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	158	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.Y158N(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCTAAAATGTACTTGAAATTA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	94.0	95.0					6																	75899454		1894	4118	6012	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.472T>A	6.37:g.75899454A>T	ENSP00000325146:p.Tyr158Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.Y158N	ENST00000322507.8	37	c.472	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	A	14.65	2.599650	0.46318	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	D;D;D	0.82711	-1.64;-1.64;-1.64	5.75	5.75	0.90469	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000007	T	0.75459	0.3852	N	0.13272	0.32	0.40721	D	0.982668	D	0.56521	0.976	P	0.57057	0.812	T	0.79531	-0.1765	10	0.40728	T	0.16	.	16.0663	0.80878	1.0:0.0:0.0:0.0	.	158	Q99715	COCA1_HUMAN	N	158	ENSP00000325146:Y158N;ENSP00000412864:Y158N;ENSP00000421216:Y158N	ENSP00000325146:Y158N	Y	-	1	0	COL12A1	75956174	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.716000	0.54904	2.201000	0.70794	0.533000	0.62120	TAC	COL12A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000111799		0.408	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	70	0.00	0	A	NM_004370		75899454	75899454	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	T
COL12A1	1303	genome.wustl.edu	37	6	75899454	75899454	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr6:75899454A>T	ENST00000322507.8	-	6	781	c.472T>A	c.(472-474)Tac>Aac	p.Y158N	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.Y158N|COL12A1_ENST00000416123.2_Missense_Mutation_p.Y158N	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	158	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.Y158N(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCTAAAATGTACTTGAAATTA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	94.0	95.0					6																	75899454		1894	4118	6012	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.472T>A	6.37:g.75899454A>T	ENSP00000325146:p.Tyr158Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.Y158N	ENST00000322507.8	37	c.472	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	A	14.65	2.599650	0.46318	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	D;D;D	0.82711	-1.64;-1.64;-1.64	5.75	5.75	0.90469	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000007	T	0.75459	0.3852	N	0.13272	0.32	0.40721	D	0.982668	D	0.56521	0.976	P	0.57057	0.812	T	0.79531	-0.1765	10	0.40728	T	0.16	.	16.0663	0.80878	1.0:0.0:0.0:0.0	.	158	Q99715	COCA1_HUMAN	N	158	ENSP00000325146:Y158N;ENSP00000412864:Y158N;ENSP00000421216:Y158N	ENSP00000325146:Y158N	Y	-	1	0	COL12A1	75956174	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.716000	0.54904	2.201000	0.70794	0.533000	0.62120	TAC	COL12A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000111799		0.408	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	97	0.00	0	A	NM_004370		75899454	75899454	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	T
COL4A4	1286	genome.wustl.edu	37	2	227886853	227886853	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:227886853G>C	ENST00000396625.3	-	44	4334	c.4127C>G	c.(4126-4128)cCc>cGc	p.P1376R	COL4A4_ENST00000329662.7_Missense_Mutation_p.P1373R	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1376	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P1376R(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGGGATTCGGGGACAGTCATC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											139.0	147.0	145.0					2																	227886853		1917	4112	6029	-	-	-	SO:0001583	missense	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4127C>G	2.37:g.227886853G>C	ENSP00000379866:p.Pro1376Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P1376R	ENST00000396625.3	37	c.4127	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980826	0.34942	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.91068	-2.78;-2.74	5.63	4.74	0.60224	.	.	.	.	.	D	0.90290	0.6963	L	0.45137	1.4	0.49483	D	0.999799	D	0.58268	0.982	P	0.58013	0.831	D	0.87007	0.2120	9	0.16896	T	0.51	.	11.1937	0.48700	0.0863:0.0:0.9137:0.0	.	1376	P53420	CO4A4_HUMAN	R	1376;1373	ENSP00000379866:P1376R;ENSP00000328553:P1373R	ENSP00000328553:P1373R	P	-	2	0	COL4A4	227595097	0.999000	0.42202	0.996000	0.52242	0.782000	0.44232	3.398000	0.52579	1.479000	0.48272	0.561000	0.74099	CCC	COL4A4	-	NULL	ENSG00000081052		0.582	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	10	0.00	0	G	NM_000092		227886853	227886853	-1	no_errors	ENST00000396625	ensembl	human	known	69_37n	missense	42	31.15	19	SNP	1.000	C
COL4A4	1286	genome.wustl.edu	37	2	227886853	227886853	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:227886853G>C	ENST00000396625.3	-	44	4334	c.4127C>G	c.(4126-4128)cCc>cGc	p.P1376R	COL4A4_ENST00000329662.7_Missense_Mutation_p.P1373R	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1376	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P1376R(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGGGATTCGGGGACAGTCATC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											139.0	147.0	145.0					2																	227886853		1917	4112	6029	-	-	-	SO:0001583	missense	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4127C>G	2.37:g.227886853G>C	ENSP00000379866:p.Pro1376Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P1376R	ENST00000396625.3	37	c.4127	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980826	0.34942	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.91068	-2.78;-2.74	5.63	4.74	0.60224	.	.	.	.	.	D	0.90290	0.6963	L	0.45137	1.4	0.49483	D	0.999799	D	0.58268	0.982	P	0.58013	0.831	D	0.87007	0.2120	9	0.16896	T	0.51	.	11.1937	0.48700	0.0863:0.0:0.9137:0.0	.	1376	P53420	CO4A4_HUMAN	R	1376;1373	ENSP00000379866:P1376R;ENSP00000328553:P1373R	ENSP00000328553:P1373R	P	-	2	0	COL4A4	227595097	0.999000	0.42202	0.996000	0.52242	0.782000	0.44232	3.398000	0.52579	1.479000	0.48272	0.561000	0.74099	CCC	COL4A4	-	NULL	ENSG00000081052		0.582	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	8	0.00	0	G	NM_000092		227886853	227886853	-1	no_errors	ENST00000396625	ensembl	human	known	69_37n	missense	42	31.15	19	SNP	1.000	C
COL6A6	131873	genome.wustl.edu	37	3	130284028	130284028	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:130284028C>A	ENST00000358511.6	+	3	883	c.852C>A	c.(850-852)agC>agA	p.S284R	COL6A6_ENST00000453409.2_Missense_Mutation_p.S284R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	284	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.S284R(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						ATTCACTGAGCATGGGCATAA	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	106.0	106.0					3																	130284028		1872	4105	5977	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.852C>A	3.37:g.130284028C>A	ENSP00000351310:p.Ser284Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S284R	ENST00000358511.6	37	c.852	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109470	0.37242	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82711	-1.64;-1.64	5.21	3.41	0.39046	von Willebrand factor, type A (3);	0.353536	0.28459	N	0.015279	T	0.78039	0.4221	N	0.17922	0.545	0.29366	N	0.864343	D	0.56521	0.976	P	0.53988	0.739	T	0.71807	-0.4481	10	0.24483	T	0.36	.	11.6339	0.51192	0.0:0.8527:0.0:0.1473	.	284	A6NMZ7	CO6A6_HUMAN	R	284	ENSP00000351310:S284R;ENSP00000399236:S284R	ENSP00000351310:S284R	S	+	3	2	COL6A6	131766718	0.008000	0.16893	0.597000	0.28824	0.697000	0.40408	0.143000	0.16115	0.695000	0.31675	0.561000	0.74099	AGC	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.448	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	51	0.00	0	C	NM_001102608		130284028	130284028	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	55	32.10	26	SNP	0.971	A
COL6A6	131873	genome.wustl.edu	37	3	130284028	130284028	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:130284028C>A	ENST00000358511.6	+	3	883	c.852C>A	c.(850-852)agC>agA	p.S284R	COL6A6_ENST00000453409.2_Missense_Mutation_p.S284R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	284	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.S284R(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						ATTCACTGAGCATGGGCATAA	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	106.0	106.0					3																	130284028		1872	4105	5977	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.852C>A	3.37:g.130284028C>A	ENSP00000351310:p.Ser284Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S284R	ENST00000358511.6	37	c.852	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109470	0.37242	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82711	-1.64;-1.64	5.21	3.41	0.39046	von Willebrand factor, type A (3);	0.353536	0.28459	N	0.015279	T	0.78039	0.4221	N	0.17922	0.545	0.29366	N	0.864343	D	0.56521	0.976	P	0.53988	0.739	T	0.71807	-0.4481	10	0.24483	T	0.36	.	11.6339	0.51192	0.0:0.8527:0.0:0.1473	.	284	A6NMZ7	CO6A6_HUMAN	R	284	ENSP00000351310:S284R;ENSP00000399236:S284R	ENSP00000351310:S284R	S	+	3	2	COL6A6	131766718	0.008000	0.16893	0.597000	0.28824	0.697000	0.40408	0.143000	0.16115	0.695000	0.31675	0.561000	0.74099	AGC	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.448	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	69	0.00	0	C	NM_001102608		130284028	130284028	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	55	32.10	26	SNP	0.971	A
CPSF2	53981	genome.wustl.edu	37	14	92628064	92628064	+	Silent	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:92628064A>G	ENST00000298875.4	+	16	2610	c.2325A>G	c.(2323-2325)ttA>ttG	p.L775L		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	775					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)	p.L775L(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		GAGACCTTTTATATGAACAAT	0.338																																					Ovarian(78;28 1788 18702 44111)	dbGAP											1	Substitution - coding silent(1)	breast(1)											66.0	64.0	65.0					14																	92628064		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.2325A>G	14.37:g.92628064A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KME1|Q6NSJ1|Q9H3W7	Silent	SNP	pfam_Beta_Casp,pfam_RMMBL,pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.L775	ENST00000298875.4	37	c.2325	CCDS9902.1	14																																																																																			CPSF2	-	NULL	ENSG00000165934		0.338	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF2	HGNC	protein_coding	OTTHUMT00000412123.1	189	0.00	0	A			92628064	92628064	+1	no_errors	ENST00000298875	ensembl	human	known	69_37n	silent	44	36.23	25	SNP	1.000	G
CPSF2	53981	genome.wustl.edu	37	14	92628064	92628064	+	Silent	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:92628064A>G	ENST00000298875.4	+	16	2610	c.2325A>G	c.(2323-2325)ttA>ttG	p.L775L		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	775					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)	p.L775L(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		GAGACCTTTTATATGAACAAT	0.338																																					Ovarian(78;28 1788 18702 44111)	dbGAP											1	Substitution - coding silent(1)	breast(1)											66.0	64.0	65.0					14																	92628064		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.2325A>G	14.37:g.92628064A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KME1|Q6NSJ1|Q9H3W7	Silent	SNP	pfam_Beta_Casp,pfam_RMMBL,pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.L775	ENST00000298875.4	37	c.2325	CCDS9902.1	14																																																																																			CPSF2	-	NULL	ENSG00000165934		0.338	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF2	HGNC	protein_coding	OTTHUMT00000412123.1	262	0.00	0	A			92628064	92628064	+1	no_errors	ENST00000298875	ensembl	human	known	69_37n	silent	44	36.23	25	SNP	1.000	G
CSMD2	114784	genome.wustl.edu	37	1	34191097	34191097	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:34191097C>T	ENST00000373381.4	-	17	2724	c.2548G>A	c.(2548-2550)Gat>Aat	p.D850N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	810	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D810Y(1)|p.D810N(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTCCGCCCATCGCGTACTTCC	0.493																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											94.0	97.0	96.0					1																	34191097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2548G>A	1.37:g.34191097C>T	ENSP00000362479:p.Asp850Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.D850N	ENST00000373381.4	37	c.2548		1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098543	0.76870	.	.	ENSG00000121904	ENST00000373381	T	0.66995	-0.24	5.89	5.89	0.94794	CUB (5);	0.000000	0.85682	D	0.000000	T	0.79021	0.4376	L	0.49350	1.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	T	0.76369	-0.2984	10	0.42905	T	0.14	.	19.2499	0.93919	0.0:1.0:0.0:0.0	.	810;850	Q7Z408;E7EUA6	CSMD2_HUMAN;.	N	850	ENSP00000362479:D850N	ENSP00000241312:D810N	D	-	1	0	CSMD2	33963684	1.000000	0.71417	0.997000	0.53966	0.012000	0.07955	7.796000	0.85898	2.793000	0.96121	0.655000	0.94253	GAT	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.493	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		32	0.00	0	C	NM_052896		34191097	34191097	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	126	39.42	82	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	34191097	34191097	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:34191097C>T	ENST00000373381.4	-	17	2724	c.2548G>A	c.(2548-2550)Gat>Aat	p.D850N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	810	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D810Y(1)|p.D810N(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTCCGCCCATCGCGTACTTCC	0.493																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											94.0	97.0	96.0					1																	34191097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2548G>A	1.37:g.34191097C>T	ENSP00000362479:p.Asp850Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.D850N	ENST00000373381.4	37	c.2548		1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098543	0.76870	.	.	ENSG00000121904	ENST00000373381	T	0.66995	-0.24	5.89	5.89	0.94794	CUB (5);	0.000000	0.85682	D	0.000000	T	0.79021	0.4376	L	0.49350	1.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	T	0.76369	-0.2984	10	0.42905	T	0.14	.	19.2499	0.93919	0.0:1.0:0.0:0.0	.	810;850	Q7Z408;E7EUA6	CSMD2_HUMAN;.	N	850	ENSP00000362479:D850N	ENSP00000241312:D810N	D	-	1	0	CSMD2	33963684	1.000000	0.71417	0.997000	0.53966	0.012000	0.07955	7.796000	0.85898	2.793000	0.96121	0.655000	0.94253	GAT	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.493	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		54	0.00	0	C	NM_052896		34191097	34191097	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	126	39.42	82	SNP	1.000	T
CSPP1	79848	genome.wustl.edu	37	8	68089921	68089921	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:68089921T>C	ENST00000262210.5	+	25	3132	c.3101T>C	c.(3100-3102)tTa>tCa	p.L1034S	CSPP1_ENST00000521168.1_3'UTR|ARFGEF1_ENST00000520381.1_Intron|CSPP1_ENST00000412460.1_Missense_Mutation_p.L689S	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1069					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.L1034S(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ACAGTTGACTTAGATGCCATC	0.318																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	115.0	116.0					8																	68089921		1821	4073	5894	-	-	-	SO:0001583	missense	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3101T>C	8.37:g.68089921T>C	ENSP00000262210:p.Leu1034Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	NULL	p.L1034S	ENST00000262210.5	37	c.3101	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	T	18.33	3.600421	0.66332	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.33865	1.39;1.42;1.42	5.55	5.55	0.83447	.	0.510172	0.16777	N	0.199961	T	0.54806	0.1881	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.996;0.996	D;D;D;P	0.85130	0.997;0.951;0.936;0.893	T	0.53464	-0.8435	10	0.59425	D	0.04	-1.7766	12.3717	0.55258	0.0:0.0:0.0:1.0	.	192;689;1034;1069	Q9H688;Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;.;CSPP1_HUMAN	S	1034;1069;689;689	ENSP00000262210:L1034S;ENSP00000415782:L689S;ENSP00000430092:L689S	ENSP00000262210:L1034S	L	+	2	0	CSPP1	68252475	0.909000	0.30893	0.783000	0.31826	0.857000	0.48899	3.640000	0.54350	2.238000	0.73509	0.477000	0.44152	TTA	CSPP1	-	NULL	ENSG00000104218		0.318	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	201	0.00	0	T	NM_024790		68089921	68089921	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	missense	72	28.71	29	SNP	0.757	C
CSPP1	79848	genome.wustl.edu	37	8	68089921	68089921	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:68089921T>C	ENST00000262210.5	+	25	3132	c.3101T>C	c.(3100-3102)tTa>tCa	p.L1034S	CSPP1_ENST00000521168.1_3'UTR|ARFGEF1_ENST00000520381.1_Intron|CSPP1_ENST00000412460.1_Missense_Mutation_p.L689S	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1069					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.L1034S(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ACAGTTGACTTAGATGCCATC	0.318																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	115.0	116.0					8																	68089921		1821	4073	5894	-	-	-	SO:0001583	missense	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3101T>C	8.37:g.68089921T>C	ENSP00000262210:p.Leu1034Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	NULL	p.L1034S	ENST00000262210.5	37	c.3101	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	T	18.33	3.600421	0.66332	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.33865	1.39;1.42;1.42	5.55	5.55	0.83447	.	0.510172	0.16777	N	0.199961	T	0.54806	0.1881	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.996;0.996	D;D;D;P	0.85130	0.997;0.951;0.936;0.893	T	0.53464	-0.8435	10	0.59425	D	0.04	-1.7766	12.3717	0.55258	0.0:0.0:0.0:1.0	.	192;689;1034;1069	Q9H688;Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;.;CSPP1_HUMAN	S	1034;1069;689;689	ENSP00000262210:L1034S;ENSP00000415782:L689S;ENSP00000430092:L689S	ENSP00000262210:L1034S	L	+	2	0	CSPP1	68252475	0.909000	0.30893	0.783000	0.31826	0.857000	0.48899	3.640000	0.54350	2.238000	0.73509	0.477000	0.44152	TTA	CSPP1	-	NULL	ENSG00000104218		0.318	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	316	0.00	0	T	NM_024790		68089921	68089921	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	missense	72	28.71	29	SNP	0.757	C
CXorf22	170063	genome.wustl.edu	37	X	35985882	35985882	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:35985882A>G	ENST00000297866.5	+	10	1813	c.1747A>G	c.(1747-1749)Atg>Gtg	p.M583V		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	583								p.M583V(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGTGAAGGATATGCTATTAGC	0.413																																						dbGAP											2	Substitution - Missense(2)	breast(2)											115.0	86.0	96.0					X																	35985882		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1747A>G	X.37:g.35985882A>G	ENSP00000297866:p.Met583Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	superfamily_PapD-like	p.M583V	ENST00000297866.5	37	c.1747	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	A	3.136	-0.177291	0.06380	.	.	ENSG00000165164	ENST00000297866	T	0.12255	2.7	5.2	2.4	0.29515	.	0.652578	0.14781	N	0.298792	T	0.04907	0.0132	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42716	-0.9435	10	0.21540	T	0.41	-32.924	4.3427	0.11117	0.1978:0.0:0.6241:0.1782	.	583	Q6ZTR5	CX022_HUMAN	V	583	ENSP00000297866:M583V	ENSP00000297866:M583V	M	+	1	0	CXorf22	35895803	0.112000	0.22096	0.000000	0.03702	0.000000	0.00434	1.931000	0.40134	0.071000	0.16664	-0.869000	0.02991	ATG	CXorf22	-	NULL	ENSG00000165164		0.413	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	54	0.00	0	A	NM_152632		35985882	35985882	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	missense	42	28.81	17	SNP	0.001	G
CXorf22	170063	genome.wustl.edu	37	X	35985882	35985882	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:35985882A>G	ENST00000297866.5	+	10	1813	c.1747A>G	c.(1747-1749)Atg>Gtg	p.M583V		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	583								p.M583V(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGTGAAGGATATGCTATTAGC	0.413																																						dbGAP											2	Substitution - Missense(2)	breast(2)											115.0	86.0	96.0					X																	35985882		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1747A>G	X.37:g.35985882A>G	ENSP00000297866:p.Met583Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	superfamily_PapD-like	p.M583V	ENST00000297866.5	37	c.1747	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	A	3.136	-0.177291	0.06380	.	.	ENSG00000165164	ENST00000297866	T	0.12255	2.7	5.2	2.4	0.29515	.	0.652578	0.14781	N	0.298792	T	0.04907	0.0132	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42716	-0.9435	10	0.21540	T	0.41	-32.924	4.3427	0.11117	0.1978:0.0:0.6241:0.1782	.	583	Q6ZTR5	CX022_HUMAN	V	583	ENSP00000297866:M583V	ENSP00000297866:M583V	M	+	1	0	CXorf22	35895803	0.112000	0.22096	0.000000	0.03702	0.000000	0.00434	1.931000	0.40134	0.071000	0.16664	-0.869000	0.02991	ATG	CXorf22	-	NULL	ENSG00000165164		0.413	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	75	0.00	0	A	NM_152632		35985882	35985882	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	missense	42	28.81	17	SNP	0.001	G
CYP4F2	8529	genome.wustl.edu	37	19	15990642	15990642	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:15990642G>C	ENST00000221700.6	-	10	1276	c.1181C>G	c.(1180-1182)cCa>cGa	p.P394R		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2									p.P394R(1)		NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GACCGGGACTGGGGGATGCAG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	91.0	90.0					19																	15990642		2203	4300	6503	-	-	-	SO:0001583	missense	0			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1181C>G	19.37:g.15990642G>C	ENSP00000221700:p.Pro394Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.P394R	ENST00000221700.6	37	c.1181	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	g	12.63	1.995369	0.35226	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.73363	-0.74	2.78	2.78	0.32641	.	0.000000	0.64402	U	0.000004	D	0.89969	0.6869	H	0.98005	4.125	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.92106	0.5692	10	0.87932	D	0	.	11.279	0.49184	0.0:0.0:1.0:0.0	.	394	P78329	CP4F2_HUMAN	R	394;245	ENSP00000221700:P394R	ENSP00000221700:P394R	P	-	2	0	CYP4F2	15851642	1.000000	0.71417	0.020000	0.16555	0.110000	0.19582	6.810000	0.75216	1.528000	0.49103	0.491000	0.48974	CCA	CYP4F2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	ENSG00000186115		0.617	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	HGNC	protein_coding	OTTHUMT00000460372.3	20	0.00	0	G	NM_001082		15990642	15990642	-1	no_errors	ENST00000221700	ensembl	human	known	69_37n	missense	171	19.34	41	SNP	0.992	C
CYP4F2	8529	genome.wustl.edu	37	19	15990642	15990642	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:15990642G>C	ENST00000221700.6	-	10	1276	c.1181C>G	c.(1180-1182)cCa>cGa	p.P394R		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2									p.P394R(1)		NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GACCGGGACTGGGGGATGCAG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	91.0	90.0					19																	15990642		2203	4300	6503	-	-	-	SO:0001583	missense	0			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1181C>G	19.37:g.15990642G>C	ENSP00000221700:p.Pro394Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.P394R	ENST00000221700.6	37	c.1181	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	g	12.63	1.995369	0.35226	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.73363	-0.74	2.78	2.78	0.32641	.	0.000000	0.64402	U	0.000004	D	0.89969	0.6869	H	0.98005	4.125	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.92106	0.5692	10	0.87932	D	0	.	11.279	0.49184	0.0:0.0:1.0:0.0	.	394	P78329	CP4F2_HUMAN	R	394;245	ENSP00000221700:P394R	ENSP00000221700:P394R	P	-	2	0	CYP4F2	15851642	1.000000	0.71417	0.020000	0.16555	0.110000	0.19582	6.810000	0.75216	1.528000	0.49103	0.491000	0.48974	CCA	CYP4F2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	ENSG00000186115		0.617	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	HGNC	protein_coding	OTTHUMT00000460372.3	33	0.00	0	G	NM_001082		15990642	15990642	-1	no_errors	ENST00000221700	ensembl	human	known	69_37n	missense	171	19.34	41	SNP	0.992	C
CYP4F11	57834	genome.wustl.edu	37	19	16034822	16034822	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:16034822G>C	ENST00000402119.4	-	6	1144	c.718C>G	c.(718-720)Ctc>Gtc	p.L240V	CYP4F11_ENST00000326742.8_Missense_Mutation_p.L240V|CYP4F11_ENST00000248041.8_Missense_Mutation_p.L240V|CYP4F11_ENST00000591841.1_5'UTR	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11									p.L240V(1)		NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GTGTGCAAGAGAATCTGCTGG	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	97.0	99.0					19																	16034822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.718C>G	19.37:g.16034822G>C	ENSP00000384588:p.Leu240Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.L240V	ENST00000402119.4	37	c.718	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	g	6.960	0.547103	0.13312	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	T;T;T	0.69685	-0.42;-0.42;-0.42	2.52	-4.55	0.03441	.	0.321305	0.24412	U	0.038749	T	0.51805	0.1696	L	0.58354	1.805	0.09310	N	1	B;B	0.31290	0.176;0.318	B;B	0.39119	0.192;0.291	T	0.49011	-0.8983	10	0.17369	T	0.5	.	1.0964	0.01674	0.237:0.17:0.4202:0.1728	.	240;240	F8W978;Q9HBI6	.;CP4FB_HUMAN	V	240	ENSP00000384588:L240V;ENSP00000248041:L240V;ENSP00000319859:L240V	ENSP00000248041:L240V	L	-	1	0	CYP4F11	15895822	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.338000	0.07842	-0.966000	0.03587	0.305000	0.20034	CTC	CYP4F11	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000171903		0.507	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	36	0.00	0	G	NM_021187		16034822	16034822	-1	no_errors	ENST00000248041	ensembl	human	known	69_37n	missense	99	22.48	29	SNP	0.001	C
CYP4F11	57834	genome.wustl.edu	37	19	16034822	16034822	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:16034822G>C	ENST00000402119.4	-	6	1144	c.718C>G	c.(718-720)Ctc>Gtc	p.L240V	CYP4F11_ENST00000326742.8_Missense_Mutation_p.L240V|CYP4F11_ENST00000248041.8_Missense_Mutation_p.L240V|CYP4F11_ENST00000591841.1_5'UTR	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11									p.L240V(1)		NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GTGTGCAAGAGAATCTGCTGG	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	97.0	99.0					19																	16034822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.718C>G	19.37:g.16034822G>C	ENSP00000384588:p.Leu240Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.L240V	ENST00000402119.4	37	c.718	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	g	6.960	0.547103	0.13312	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	T;T;T	0.69685	-0.42;-0.42;-0.42	2.52	-4.55	0.03441	.	0.321305	0.24412	U	0.038749	T	0.51805	0.1696	L	0.58354	1.805	0.09310	N	1	B;B	0.31290	0.176;0.318	B;B	0.39119	0.192;0.291	T	0.49011	-0.8983	10	0.17369	T	0.5	.	1.0964	0.01674	0.237:0.17:0.4202:0.1728	.	240;240	F8W978;Q9HBI6	.;CP4FB_HUMAN	V	240	ENSP00000384588:L240V;ENSP00000248041:L240V;ENSP00000319859:L240V	ENSP00000248041:L240V	L	-	1	0	CYP4F11	15895822	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.338000	0.07842	-0.966000	0.03587	0.305000	0.20034	CTC	CYP4F11	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000171903		0.507	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	52	0.00	0	G	NM_021187		16034822	16034822	-1	no_errors	ENST00000248041	ensembl	human	known	69_37n	missense	99	22.48	29	SNP	0.001	C
DALRD3	55152	genome.wustl.edu	37	3	49053734	49053734	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:49053734C>A	ENST00000341949.4	-	9	1192	c.1186G>T	c.(1186-1188)Ggc>Tgc	p.G396C	DALRD3_ENST00000440857.1_Missense_Mutation_p.G229C|DALRD3_ENST00000441576.2_Missense_Mutation_p.G396C|DALRD3_ENST00000313778.5_Missense_Mutation_p.G229C|DALRD3_ENST00000496568.1_5'Flank|DALRD3_ENST00000395462.4_Missense_Mutation_p.G229C	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	396					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)	p.G229C(1)|p.G396C(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CTCTTTGTGCCCTTCGTGGAG	0.517																																						dbGAP											2	Substitution - Missense(2)	breast(2)											69.0	67.0	68.0					3																	49053734		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.1186G>T	3.37:g.49053734C>A	ENSP00000344989:p.Gly396Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.G396C	ENST00000341949.4	37	c.1186	CCDS33754.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.51|19.51	3.841886|3.841886	0.71488|0.71488	.|.	.|.	ENSG00000178149|ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778|ENST00000438585	T;T;T;T;T|.	0.54675|.	0.58;0.68;0.69;0.56;0.69|.	5.69|5.69	4.82|4.82	0.62117|0.62117	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.70334|0.70334	0.3212|0.3212	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.999;1.0;0.999;0.999|.	T|T	0.69870|0.69870	-0.5028|-0.5028	10|6	0.87932|.	D|.	0|.	-21.5214|-21.5214	12.8332|12.8332	0.57759|0.57759	0.0:0.9245:0.0:0.0755|0.0:0.9245:0.0:0.0755	.|.	396;229;396;396|.	B7Z727;C9JJG6;Q5D0E6-2;Q5D0E6|.	.;.;.;DALD3_HUMAN|.	C|V	396;396;229;229;229|42	ENSP00000410623:G396C;ENSP00000344989:G396C;ENSP00000378846:G229C;ENSP00000403770:G229C;ENSP00000323265:G229C|.	ENSP00000323265:G229C|.	G|G	-|-	1|2	0|0	DALRD3|DALRD3	49028738|49028738	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.932000|0.932000	0.56968|0.56968	6.355000|6.355000	0.73041|0.73041	1.404000|1.404000	0.46819|0.46819	0.561000|0.561000	0.74099|0.74099	GGC|GGG	DALRD3	-	NULL	ENSG00000178149		0.517	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	33	0.00	0	C	NM_018114		49053734	49053734	-1	no_errors	ENST00000341949	ensembl	human	known	69_37n	missense	51	40.00	34	SNP	1.000	A
DALRD3	55152	genome.wustl.edu	37	3	49053734	49053734	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:49053734C>A	ENST00000341949.4	-	9	1192	c.1186G>T	c.(1186-1188)Ggc>Tgc	p.G396C	DALRD3_ENST00000440857.1_Missense_Mutation_p.G229C|DALRD3_ENST00000441576.2_Missense_Mutation_p.G396C|DALRD3_ENST00000313778.5_Missense_Mutation_p.G229C|DALRD3_ENST00000496568.1_5'Flank|DALRD3_ENST00000395462.4_Missense_Mutation_p.G229C	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	396					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)	p.G229C(1)|p.G396C(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CTCTTTGTGCCCTTCGTGGAG	0.517																																						dbGAP											2	Substitution - Missense(2)	breast(2)											69.0	67.0	68.0					3																	49053734		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.1186G>T	3.37:g.49053734C>A	ENSP00000344989:p.Gly396Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.G396C	ENST00000341949.4	37	c.1186	CCDS33754.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.51|19.51	3.841886|3.841886	0.71488|0.71488	.|.	.|.	ENSG00000178149|ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778|ENST00000438585	T;T;T;T;T|.	0.54675|.	0.58;0.68;0.69;0.56;0.69|.	5.69|5.69	4.82|4.82	0.62117|0.62117	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.70334|0.70334	0.3212|0.3212	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.999;1.0;0.999;0.999|.	T|T	0.69870|0.69870	-0.5028|-0.5028	10|6	0.87932|.	D|.	0|.	-21.5214|-21.5214	12.8332|12.8332	0.57759|0.57759	0.0:0.9245:0.0:0.0755|0.0:0.9245:0.0:0.0755	.|.	396;229;396;396|.	B7Z727;C9JJG6;Q5D0E6-2;Q5D0E6|.	.;.;.;DALD3_HUMAN|.	C|V	396;396;229;229;229|42	ENSP00000410623:G396C;ENSP00000344989:G396C;ENSP00000378846:G229C;ENSP00000403770:G229C;ENSP00000323265:G229C|.	ENSP00000323265:G229C|.	G|G	-|-	1|2	0|0	DALRD3|DALRD3	49028738|49028738	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.932000|0.932000	0.56968|0.56968	6.355000|6.355000	0.73041|0.73041	1.404000|1.404000	0.46819|0.46819	0.561000|0.561000	0.74099|0.74099	GGC|GGG	DALRD3	-	NULL	ENSG00000178149		0.517	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	40	0.00	0	C	NM_018114		49053734	49053734	-1	no_errors	ENST00000341949	ensembl	human	known	69_37n	missense	51	40.00	34	SNP	1.000	A
DEAF1	10522	genome.wustl.edu	37	11	654016	654016	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:654016G>A	ENST00000382409.3	-	11	2023	c.1539C>T	c.(1537-1539)agC>agT	p.S513S	DEAF1_ENST00000338675.6_Silent_p.S438S|DEAF1_ENST00000525904.1_5'UTR	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	513					anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S513S(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CGGTGCACTCGCTCATAGCCT	0.632																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											148.0	113.0	125.0					11																	654016		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.1539C>T	11.37:g.654016G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Nonsense_Mutation	SNP	pfam_SAND_dom,pfam_Znf_MYND,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_Znf_MYND,pfscan_SAND_dom	p.R301*	ENST00000382409.3	37	c.901	CCDS31327.1	11																																																																																			DEAF1	-	pfam_Znf_MYND,pfscan_Znf_MYND	ENSG00000177030		0.632	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEAF1	HGNC	protein_coding	OTTHUMT00000383614.3	10	0.00	0	G	NM_021008		654016	654016	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000527170	ensembl	human	known	69_37n	nonsense	78	29.09	32	SNP	0.974	A
DEAF1	10522	genome.wustl.edu	37	11	654016	654016	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:654016G>A	ENST00000382409.3	-	11	2023	c.1539C>T	c.(1537-1539)agC>agT	p.S513S	DEAF1_ENST00000338675.6_Silent_p.S438S|DEAF1_ENST00000525904.1_5'UTR	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	513					anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S513S(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CGGTGCACTCGCTCATAGCCT	0.632																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											148.0	113.0	125.0					11																	654016		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.1539C>T	11.37:g.654016G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Nonsense_Mutation	SNP	pfam_SAND_dom,pfam_Znf_MYND,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_Znf_MYND,pfscan_SAND_dom	p.R301*	ENST00000382409.3	37	c.901	CCDS31327.1	11																																																																																			DEAF1	-	pfam_Znf_MYND,pfscan_Znf_MYND	ENSG00000177030		0.632	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEAF1	HGNC	protein_coding	OTTHUMT00000383614.3	8	0.00	0	G	NM_021008		654016	654016	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000527170	ensembl	human	known	69_37n	nonsense	78	29.09	32	SNP	0.974	A
DNAH5	1767	genome.wustl.edu	37	5	13841155	13841155	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:13841155G>A	ENST00000265104.4	-	34	5673	c.5569C>T	c.(5569-5571)Cag>Tag	p.Q1857*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1857	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q1857*(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTAGTTTTCTGCATGATTTTT	0.393									Kartagener syndrome																													dbGAP											1	Substitution - Nonsense(1)	breast(1)											144.0	140.0	141.0					5																	13841155		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5569C>T	5.37:g.13841155G>A	ENSP00000265104:p.Gln1857*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q1857*	ENST00000265104.4	37	c.5569	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	47	13.182302	0.99725	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.77	5.77	0.91146	.	0.263878	0.39909	N	0.001233	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9863	0.92771	0.0:0.0:1.0:0.0	.	.	.	.	X	1857	.	ENSP00000265104:Q1857X	Q	-	1	0	DNAH5	13894155	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.766000	0.47629	2.729000	0.93468	0.655000	0.94253	CAG	DNAH5	-	NULL	ENSG00000039139		0.393	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	268	0.00	0	G	NM_001369		13841155	13841155	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	nonsense	114	21.38	31	SNP	1.000	A
DNAH5	1767	genome.wustl.edu	37	5	13841155	13841155	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:13841155G>A	ENST00000265104.4	-	34	5673	c.5569C>T	c.(5569-5571)Cag>Tag	p.Q1857*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1857	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q1857*(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTAGTTTTCTGCATGATTTTT	0.393									Kartagener syndrome																													dbGAP											1	Substitution - Nonsense(1)	breast(1)											144.0	140.0	141.0					5																	13841155		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5569C>T	5.37:g.13841155G>A	ENSP00000265104:p.Gln1857*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q1857*	ENST00000265104.4	37	c.5569	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	47	13.182302	0.99725	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.77	5.77	0.91146	.	0.263878	0.39909	N	0.001233	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9863	0.92771	0.0:0.0:1.0:0.0	.	.	.	.	X	1857	.	ENSP00000265104:Q1857X	Q	-	1	0	DNAH5	13894155	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.766000	0.47629	2.729000	0.93468	0.655000	0.94253	CAG	DNAH5	-	NULL	ENSG00000039139		0.393	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	383	0.00	0	G	NM_001369		13841155	13841155	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	nonsense	114	21.38	31	SNP	1.000	A
GNL2	29889	genome.wustl.edu	37	1	38030643	38030643	+	IGR	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:38030643T>C	ENST00000373062.3	-	0	2334				DNALI1_ENST00000296218.7_Missense_Mutation_p.I275T|DNALI1_ENST00000497858.1_3'UTR|DNALI1_ENST00000541606.1_Missense_Mutation_p.I127T|GNL2_ENST00000462812.1_5'Flank	NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)						GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.I275T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				CTGGAAGGCATTATTGCACCA	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	120.0	123.0					1																	38030643		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322		1.37:g.38030643T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWN7	Missense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.I275T	ENST00000373062.3	37	c.824	CCDS421.1	1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.502190	0.85176	.	.	ENSG00000163879	ENST00000296218;ENST00000541606	T	0.54675	0.56	5.61	5.61	0.85477	.	0.089605	0.85682	D	0.000000	T	0.76535	0.4001	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81360	-0.0968	10	0.87932	D	0	-5.9419	15.8076	0.78527	0.0:0.0:0.0:1.0	.	253	O14645	IDLC_HUMAN	T	275;127	ENSP00000296218:I275T	ENSP00000296218:I275T	I	+	2	0	DNALI1	37803230	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.282000	0.65615	2.147000	0.66899	0.533000	0.62120	ATT	DNALI1	-	NULL	ENSG00000163879		0.383	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNALI1	HGNC	protein_coding	OTTHUMT00000012478.1	216	0.00	0	T	NM_013285		38030643	38030643	+1	no_errors	ENST00000296218	ensembl	human	known	69_37n	missense	58	36.26	33	SNP	1.000	C
GNL2	29889	genome.wustl.edu	37	1	38030643	38030643	+	IGR	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:38030643T>C	ENST00000373062.3	-	0	2334				DNALI1_ENST00000296218.7_Missense_Mutation_p.I275T|DNALI1_ENST00000497858.1_3'UTR|DNALI1_ENST00000541606.1_Missense_Mutation_p.I127T|GNL2_ENST00000462812.1_5'Flank	NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)						GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.I275T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				CTGGAAGGCATTATTGCACCA	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	120.0	123.0					1																	38030643		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322		1.37:g.38030643T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWN7	Missense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.I275T	ENST00000373062.3	37	c.824	CCDS421.1	1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.502190	0.85176	.	.	ENSG00000163879	ENST00000296218;ENST00000541606	T	0.54675	0.56	5.61	5.61	0.85477	.	0.089605	0.85682	D	0.000000	T	0.76535	0.4001	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81360	-0.0968	10	0.87932	D	0	-5.9419	15.8076	0.78527	0.0:0.0:0.0:1.0	.	253	O14645	IDLC_HUMAN	T	275;127	ENSP00000296218:I275T	ENSP00000296218:I275T	I	+	2	0	DNALI1	37803230	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.282000	0.65615	2.147000	0.66899	0.533000	0.62120	ATT	DNALI1	-	NULL	ENSG00000163879		0.383	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNALI1	HGNC	protein_coding	OTTHUMT00000012478.1	334	0.00	0	T	NM_013285		38030643	38030643	+1	no_errors	ENST00000296218	ensembl	human	known	69_37n	missense	58	36.26	33	SNP	1.000	C
DOCK2	1794	genome.wustl.edu	37	5	169507239	169507239	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:169507239G>T	ENST00000256935.8	+	50	5319	c.5239G>T	c.(5239-5241)Gtc>Ttc	p.V1747F	DOCK2_ENST00000520908.1_Missense_Mutation_p.V1239F|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.V808F	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1747					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.V1747F(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAAGGCGTCTGTCCTCTCTCA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	108.0	116.0					5																	169507239		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5239G>T	5.37:g.169507239G>T	ENSP00000256935:p.Val1747Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.V1747F	ENST00000256935.8	37	c.5239	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	8.606	0.888008	0.17540	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.10573	3.52;3.14;2.86	5.42	-4.41	0.03590	.	0.879286	0.09736	N	0.762503	T	0.08980	0.0222	N	0.19112	0.55	0.09310	N	1	B;P;B	0.41366	0.151;0.747;0.119	B;B;B	0.40782	0.084;0.34;0.034	T	0.07481	-1.0770	10	0.49607	T	0.09	.	17.6379	0.88128	0.1465:0.0:0.8535:0.0	.	1239;303;1747	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	F	1747;1239;808	ENSP00000256935:V1747F;ENSP00000429283:V1239F;ENSP00000438827:V808F	ENSP00000256935:V1747F	V	+	1	0	DOCK2	169439817	0.006000	0.16342	0.006000	0.13384	0.025000	0.11179	-0.101000	0.10973	-1.474000	0.01879	-0.781000	0.03364	GTC	DOCK2	-	NULL	ENSG00000134516		0.567	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	11	0.00	0	G	NM_004946		169507239	169507239	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	missense	66	31.25	30	SNP	0.027	T
DOCK2	1794	genome.wustl.edu	37	5	169507239	169507239	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:169507239G>T	ENST00000256935.8	+	50	5319	c.5239G>T	c.(5239-5241)Gtc>Ttc	p.V1747F	DOCK2_ENST00000520908.1_Missense_Mutation_p.V1239F|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.V808F	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1747					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.V1747F(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAAGGCGTCTGTCCTCTCTCA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	108.0	116.0					5																	169507239		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5239G>T	5.37:g.169507239G>T	ENSP00000256935:p.Val1747Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.V1747F	ENST00000256935.8	37	c.5239	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	8.606	0.888008	0.17540	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.10573	3.52;3.14;2.86	5.42	-4.41	0.03590	.	0.879286	0.09736	N	0.762503	T	0.08980	0.0222	N	0.19112	0.55	0.09310	N	1	B;P;B	0.41366	0.151;0.747;0.119	B;B;B	0.40782	0.084;0.34;0.034	T	0.07481	-1.0770	10	0.49607	T	0.09	.	17.6379	0.88128	0.1465:0.0:0.8535:0.0	.	1239;303;1747	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	F	1747;1239;808	ENSP00000256935:V1747F;ENSP00000429283:V1239F;ENSP00000438827:V808F	ENSP00000256935:V1747F	V	+	1	0	DOCK2	169439817	0.006000	0.16342	0.006000	0.13384	0.025000	0.11179	-0.101000	0.10973	-1.474000	0.01879	-0.781000	0.03364	GTC	DOCK2	-	NULL	ENSG00000134516		0.567	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	16	0.00	0	G	NM_004946		169507239	169507239	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	missense	66	31.25	30	SNP	0.027	T
DOCK5	80005	genome.wustl.edu	37	8	25193755	25193755	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:25193755G>A	ENST00000276440.7	+	22	2237	c.2193G>A	c.(2191-2193)gtG>gtA	p.V731V		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	731					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.V731V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TTCTTCTAAGGAAACTCTCCA	0.418											OREG0005429	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=DOCK5|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									Pancreas(145;34 1887 3271 10937 30165)	dbGAP											1	Substitution - coding silent(1)	breast(1)											84.0	82.0	83.0					8																	25193755		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2193-1G>A	8.37:g.25193755G>A		Somatic	777	WXS	Illumina GAIIx	Phase_IV	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E503K	ENST00000276440.7	37	c.1507	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308972	0.40895	.	.	ENSG00000147459	ENST00000444569	.	.	.	5.76	3.92	0.45320	.	.	.	.	.	T	0.61223	0.2330	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57365	-0.7824	4	.	.	.	.	10.1875	0.43006	0.2203:0.0:0.7797:0.0	.	.	.	.	K	503	.	.	E	+	1	0	DOCK5	25249672	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.754000	0.74909	0.845000	0.35118	0.650000	0.86243	GAA	DOCK5	-	superfamily_ARM-type_fold	ENSG00000147459		0.418	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	258	0.39	1	G	NM_024940	Silent	25193755	25193755	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444569	ensembl	human	novel	69_37n	missense	47	41.98	34	SNP	1.000	A
DOCK5	80005	genome.wustl.edu	37	8	25193755	25193755	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:25193755G>A	ENST00000276440.7	+	22	2237	c.2193G>A	c.(2191-2193)gtG>gtA	p.V731V		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	731					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.V731V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TTCTTCTAAGGAAACTCTCCA	0.418											OREG0005429	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=DOCK5|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									Pancreas(145;34 1887 3271 10937 30165)	dbGAP											1	Substitution - coding silent(1)	breast(1)											84.0	82.0	83.0					8																	25193755		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2193-1G>A	8.37:g.25193755G>A		Somatic	777	WXS	Illumina GAIIx	Phase_IV	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E503K	ENST00000276440.7	37	c.1507	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308972	0.40895	.	.	ENSG00000147459	ENST00000444569	.	.	.	5.76	3.92	0.45320	.	.	.	.	.	T	0.61223	0.2330	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57365	-0.7824	4	.	.	.	.	10.1875	0.43006	0.2203:0.0:0.7797:0.0	.	.	.	.	K	503	.	.	E	+	1	0	DOCK5	25249672	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.754000	0.74909	0.845000	0.35118	0.650000	0.86243	GAA	DOCK5	-	superfamily_ARM-type_fold	ENSG00000147459		0.418	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	359	0.28	1	G	NM_024940	Silent	25193755	25193755	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444569	ensembl	human	novel	69_37n	missense	47	41.98	34	SNP	1.000	A
DSCAML1	57453	genome.wustl.edu	37	11	117302417	117302434	+	In_Frame_Del	DEL	GACTTCACATTCTTCCTG	GACTTCACATTCTTCCTG	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	GACTTCACATTCTTCCTG	GACTTCACATTCTTCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:117302417_117302434delGACTTCACATTCTTCCTG	ENST00000321322.6	-	31	5371_5388	c.5370_5387delCAGGAAGAATGTGAAGTC	c.(5368-5388)tccaggaagaatgtgaagtca>tca	p.1790_1796SRKNVKS>S	DSCAML1_ENST00000527706.1_In_Frame_Del_p.1520_1526SRKNVKS>S	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1730					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R1791_S1796delRKNVKS(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCTGTGGGCTGACTTCACATTCTTCCTGGACACTGGAT	0.61																																						dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5370_5387delCAGGAAGAATGTGAAGTC	11.37:g.117302417_117302434delGACTTCACATTCTTCCTG	ENSP00000315465:p.Ser1790_Lys1795del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.RKNVKS1791in_frame_del	ENST00000321322.6	37	c.5387_5370	CCDS8384.1	11																																																																																			DSCAML1	-	NULL	ENSG00000177103		0.610	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	17	0.00	0	GACTTCACATTCTTCCTG	NM_020693		117302417	117302434	-1	no_errors	ENST00000321322	ensembl	human	known	69_37n	in_frame_del	135	16.56	27	DEL	1.000:1.000:1.000:1.000:1.000:0.985:1.000:0.994:0.435:0.992:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
DSCAML1	57453	genome.wustl.edu	37	11	117302417	117302434	+	In_Frame_Del	DEL	GACTTCACATTCTTCCTG	GACTTCACATTCTTCCTG	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	GACTTCACATTCTTCCTG	GACTTCACATTCTTCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:117302417_117302434delGACTTCACATTCTTCCTG	ENST00000321322.6	-	31	5371_5388	c.5370_5387delCAGGAAGAATGTGAAGTC	c.(5368-5388)tccaggaagaatgtgaagtca>tca	p.1790_1796SRKNVKS>S	DSCAML1_ENST00000527706.1_In_Frame_Del_p.1520_1526SRKNVKS>S	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1730					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R1791_S1796delRKNVKS(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCTGTGGGCTGACTTCACATTCTTCCTGGACACTGGAT	0.61																																						dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5370_5387delCAGGAAGAATGTGAAGTC	11.37:g.117302417_117302434delGACTTCACATTCTTCCTG	ENSP00000315465:p.Ser1790_Lys1795del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.RKNVKS1791in_frame_del	ENST00000321322.6	37	c.5387_5370	CCDS8384.1	11																																																																																			DSCAML1	-	NULL	ENSG00000177103		0.610	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	28	0.00	0	GACTTCACATTCTTCCTG	NM_020693		117302417	117302434	-1	no_errors	ENST00000321322	ensembl	human	known	69_37n	in_frame_del	135	16.56	27	DEL	1.000:1.000:1.000:1.000:1.000:0.985:1.000:0.994:0.435:0.992:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
EEF1D	1936	genome.wustl.edu	37	8	144669010	144669010	+	Silent	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:144669010A>T	ENST00000529272.1	-	2	406	c.6T>A	c.(4-6)gcT>gcA	p.A2A	EEF1D_ENST00000524624.1_Silent_p.A2A|EEF1D_ENST00000528610.1_Silent_p.A2A|EEF1D_ENST00000423316.2_Silent_p.A368A|EEF1D_ENST00000317198.6_Silent_p.A2A|EEF1D_ENST00000419152.2_Silent_p.A2A|EEF1D_ENST00000531621.1_Silent_p.A2A|EEF1D_ENST00000532400.1_Silent_p.A2A|EEF1D_ENST00000526838.1_Silent_p.A2A|EEF1D_ENST00000532741.1_Silent_p.A418A|EEF1D_ENST00000442189.2_Silent_p.A368A|EEF1D_ENST00000395119.3_Silent_p.A2A			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	2					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)	p.A368A(1)		breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GGAAGTTTGTAGCCATTTTTC	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											121.0	123.0	123.0					8																	144669010		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.6T>A	8.37:g.144669010A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	NULL	p.L82Q	ENST00000529272.1	37	c.245	CCDS6405.1	8																																																																																			EEF1D	-	NULL	ENSG00000104529		0.537	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	EEF1D	HGNC	protein_coding	OTTHUMT00000382592.2	57	0.00	0	A	NM_032378		144669010	144669010	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530616	ensembl	human	known	69_37n	missense	78	24.27	25	SNP	0.740	T
EEF1D	1936	genome.wustl.edu	37	8	144669010	144669010	+	Silent	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:144669010A>T	ENST00000529272.1	-	2	406	c.6T>A	c.(4-6)gcT>gcA	p.A2A	EEF1D_ENST00000524624.1_Silent_p.A2A|EEF1D_ENST00000528610.1_Silent_p.A2A|EEF1D_ENST00000423316.2_Silent_p.A368A|EEF1D_ENST00000317198.6_Silent_p.A2A|EEF1D_ENST00000419152.2_Silent_p.A2A|EEF1D_ENST00000531621.1_Silent_p.A2A|EEF1D_ENST00000532400.1_Silent_p.A2A|EEF1D_ENST00000526838.1_Silent_p.A2A|EEF1D_ENST00000532741.1_Silent_p.A418A|EEF1D_ENST00000442189.2_Silent_p.A368A|EEF1D_ENST00000395119.3_Silent_p.A2A			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	2					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)	p.A368A(1)		breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GGAAGTTTGTAGCCATTTTTC	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											121.0	123.0	123.0					8																	144669010		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.6T>A	8.37:g.144669010A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	NULL	p.L82Q	ENST00000529272.1	37	c.245	CCDS6405.1	8																																																																																			EEF1D	-	NULL	ENSG00000104529		0.537	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	EEF1D	HGNC	protein_coding	OTTHUMT00000382592.2	89	0.00	0	A	NM_032378		144669010	144669010	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530616	ensembl	human	known	69_37n	missense	78	24.27	25	SNP	0.740	T
RP11-1396O13.13	0	genome.wustl.edu	37	4	9388948	9388948	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:9388948G>A	ENST00000508324.1	-	2	65	c.66C>T	c.(64-66)gcC>gcT	p.A22A															p.A22A(3)		breast(2)|lung(7)	9						TGTCCATCATGGCCCACTCTT	0.423																																						dbGAP											3	Substitution - coding silent(3)	breast(3)																																								-	-	-	SO:0001819	synonymous_variant	0																														ENST00000508324.1:c.66C>T	4.37:g.9388948G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A22	ENST00000508324.1	37	c.66		4																																																																																			RP11-1396O13.13	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000219492		0.423	RP11-1396O13.13-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ENSG00000219492	Clone_based_vega_gene	protein_coding	OTTHUMT00000359605.2	263	0.75	2	G			9388948	9388948	-1	no_errors	ENST00000508324	ensembl	human	novel	69_37n	silent	77	37.40	46	SNP	0.845	A
ZHX1	11244	genome.wustl.edu	37	8	124275187	124275187	+	Intron	DEL	G	G	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:124275187delG	ENST00000522655.1	-	2	316				ZHX1_ENST00000395571.3_Intron|ZHX1_ENST00000522595.1_Intron|RNU6-628P_ENST00000410675.1_RNA|ZHX1_ENST00000297857.2_Intron|ZHX1-C8ORF76_ENST00000357082.4_Intron			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1						cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			AAAAAAAAAAGAAAGAAaaga	0.458																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.224+4325C>-	8.37:g.124275187delG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWD8	RNA	DEL	-	NULL	ENST00000522655.1	37	NULL	CCDS6342.1	8																																																																																			U6	-	-	ENSG00000222607		0.458	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000222607	RFAM	protein_coding	OTTHUMT00000381759.1	8	0.00	0	G			124275187	124275187	+1	no_errors	ENST00000410675	ensembl	human	known	69_37n	rna	4	33.33	2	DEL	0.007	-
EPN2	22905	genome.wustl.edu	37	17	19235190	19235211	+	Frame_Shift_Del	DEL	CCCAAAACAATGGAACTACCAG	CCCAAAACAATGGAACTACCAG	-	rs372962496|rs369490057|rs375956789|rs188455064		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CCCAAAACAATGGAACTACCAG	CCCAAAACAATGGAACTACCAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:19235190_19235211delCCCAAAACAATGGAACTACCAG	ENST00000314728.5	+	10	1920_1941	c.1436_1457delCCCAAAACAATGGAACTACCAG	c.(1435-1458)tcccaaaacaatggaactaccagcfs	p.SQNNGTTS479fs	EPN2_ENST00000575595.1_Frame_Shift_Del_p.SQNNGTTS187fs|EPN2_ENST00000395620.2_Frame_Shift_Del_p.SQNNGTTS422fs|EPN2_ENST00000571254.1_Frame_Shift_Del_p.SQNNGTTS415fs|EPN2_ENST00000395626.1_Intron|RP11-135L13.4_ENST00000581122.1_RNA|EPN2_ENST00000395618.3_Frame_Shift_Del_p.SQNNGTTS194fs|EPN2_ENST00000347697.2_Frame_Shift_Del_p.SQNNGTTS422fs	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	479	6 X 3 AA repeats of [DE]-P-W.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)	p.Q480fs*9(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					TCTCTGCCATCCCAAAACAATGGAACTACCAGCCCTGACCCC	0.554																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.1436_1457delCCCAAAACAATGGAACTACCAG	17.37:g.19235190_19235211delCCCAAAACAATGGAACTACCAG	ENSP00000320543:p.Ser479fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Frame_Shift_Del	DEL	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.Q480fs	ENST00000314728.5	37	c.1436_1457	CCDS11203.1	17																																																																																			EPN2	-	NULL	ENSG00000072134		0.554	EPN2-001	KNOWN	basic|CCDS	protein_coding	EPN2	HGNC	protein_coding	OTTHUMT00000132283.3	36	0.00	0	CCCAAAACAATGGAACTACCAG	NM_014964		19235190	19235211	+1	no_errors	ENST00000314728	ensembl	human	known	69_37n	frame_shift_del	113	11.63	15	DEL	1.000:1.000:1.000:0.951:0.625:0.713:0.835:0.990:0.995:0.974:0.954:0.967:0.976:0.947:0.969:0.969:0.080:0.095:0.181:0.002:0.966:1.000	-
EPN2	22905	genome.wustl.edu	37	17	19235190	19235211	+	Frame_Shift_Del	DEL	CCCAAAACAATGGAACTACCAG	CCCAAAACAATGGAACTACCAG	-	rs372962496|rs369490057|rs375956789|rs188455064		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CCCAAAACAATGGAACTACCAG	CCCAAAACAATGGAACTACCAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:19235190_19235211delCCCAAAACAATGGAACTACCAG	ENST00000314728.5	+	10	1920_1941	c.1436_1457delCCCAAAACAATGGAACTACCAG	c.(1435-1458)tcccaaaacaatggaactaccagcfs	p.SQNNGTTS479fs	EPN2_ENST00000575595.1_Frame_Shift_Del_p.SQNNGTTS187fs|EPN2_ENST00000395620.2_Frame_Shift_Del_p.SQNNGTTS422fs|EPN2_ENST00000571254.1_Frame_Shift_Del_p.SQNNGTTS415fs|EPN2_ENST00000395626.1_Intron|RP11-135L13.4_ENST00000581122.1_RNA|EPN2_ENST00000395618.3_Frame_Shift_Del_p.SQNNGTTS194fs|EPN2_ENST00000347697.2_Frame_Shift_Del_p.SQNNGTTS422fs	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	479	6 X 3 AA repeats of [DE]-P-W.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)	p.Q480fs*9(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					TCTCTGCCATCCCAAAACAATGGAACTACCAGCCCTGACCCC	0.554																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.1436_1457delCCCAAAACAATGGAACTACCAG	17.37:g.19235190_19235211delCCCAAAACAATGGAACTACCAG	ENSP00000320543:p.Ser479fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Frame_Shift_Del	DEL	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.Q480fs	ENST00000314728.5	37	c.1436_1457	CCDS11203.1	17																																																																																			EPN2	-	NULL	ENSG00000072134		0.554	EPN2-001	KNOWN	basic|CCDS	protein_coding	EPN2	HGNC	protein_coding	OTTHUMT00000132283.3	57	0.00	0	CCCAAAACAATGGAACTACCAG	NM_014964		19235190	19235211	+1	no_errors	ENST00000314728	ensembl	human	known	69_37n	frame_shift_del	113	11.63	15	DEL	1.000:1.000:1.000:0.951:0.625:0.713:0.835:0.990:0.995:0.974:0.954:0.967:0.976:0.947:0.969:0.969:0.080:0.095:0.181:0.002:0.966:1.000	-
EPN3	55040	genome.wustl.edu	37	17	48614030	48614030	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:48614030C>T	ENST00000268933.3	+	2	692	c.113C>T	c.(112-114)tCg>tTg	p.S38L	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Intron|EPN3_ENST00000537145.1_Intron	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	38	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)	p.S38L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CCCCCTAGTTCGCTCATGTCC	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	66.0	67.0					17																	48614030		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.113C>T	17.37:g.48614030C>T	ENSP00000268933:p.Ser38Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_Ubiquitin-int_motif,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.S38L	ENST00000268933.3	37	c.113	CCDS11570.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319868	0.81469	.	.	ENSG00000049283	ENST00000268933;ENST00000503246;ENST00000514874;ENST00000515126;ENST00000507467;ENST00000411703	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.16	5.16	0.70880	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.068821	0.64402	D	0.000012	T	0.71668	0.3367	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.78974	-0.1992	10	0.87932	D	0	.	18.2431	0.89974	0.0:1.0:0.0:0.0	.	38	Q9H201	EPN3_HUMAN	L	38	ENSP00000268933:S38L;ENSP00000426762:S38L;ENSP00000422682:S38L;ENSP00000422601:S38L;ENSP00000421515:S38L	ENSP00000268933:S38L	S	+	2	0	EPN3	45969029	1.000000	0.71417	0.997000	0.53966	0.292000	0.27327	7.818000	0.86416	2.399000	0.81585	0.462000	0.41574	TCG	EPN3	-	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	ENSG00000049283		0.607	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN3	HGNC	protein_coding	OTTHUMT00000367573.1	14	0.00	0	C	NM_017957		48614030	48614030	+1	no_errors	ENST00000268933	ensembl	human	known	69_37n	missense	75	26.47	27	SNP	1.000	T
EPN3	55040	genome.wustl.edu	37	17	48614030	48614030	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:48614030C>T	ENST00000268933.3	+	2	692	c.113C>T	c.(112-114)tCg>tTg	p.S38L	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Intron|EPN3_ENST00000537145.1_Intron	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	38	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)	p.S38L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CCCCCTAGTTCGCTCATGTCC	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	66.0	67.0					17																	48614030		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.113C>T	17.37:g.48614030C>T	ENSP00000268933:p.Ser38Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_Ubiquitin-int_motif,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.S38L	ENST00000268933.3	37	c.113	CCDS11570.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319868	0.81469	.	.	ENSG00000049283	ENST00000268933;ENST00000503246;ENST00000514874;ENST00000515126;ENST00000507467;ENST00000411703	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.16	5.16	0.70880	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.068821	0.64402	D	0.000012	T	0.71668	0.3367	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.78974	-0.1992	10	0.87932	D	0	.	18.2431	0.89974	0.0:1.0:0.0:0.0	.	38	Q9H201	EPN3_HUMAN	L	38	ENSP00000268933:S38L;ENSP00000426762:S38L;ENSP00000422682:S38L;ENSP00000422601:S38L;ENSP00000421515:S38L	ENSP00000268933:S38L	S	+	2	0	EPN3	45969029	1.000000	0.71417	0.997000	0.53966	0.292000	0.27327	7.818000	0.86416	2.399000	0.81585	0.462000	0.41574	TCG	EPN3	-	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	ENSG00000049283		0.607	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN3	HGNC	protein_coding	OTTHUMT00000367573.1	23	0.00	0	C	NM_017957		48614030	48614030	+1	no_errors	ENST00000268933	ensembl	human	known	69_37n	missense	75	26.47	27	SNP	1.000	T
ETV6	2120	genome.wustl.edu	37	12	12037502	12037502	+	Missense_Mutation	SNP	G	G	C	rs146280653		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:12037502G>C	ENST00000396373.4	+	6	1407	c.1133G>C	c.(1132-1134)cGa>cCa	p.R378P		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	378					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R378P(1)	ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GGACTGGCTCGACTGTGGGGA	0.463			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																	dbGAP		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	1	Substitution - Missense(1)	breast(1)											78.0	75.0	76.0					12																	12037502		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1133G>C	12.37:g.12037502G>C	ENSP00000379658:p.Arg378Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.R378P	ENST00000396373.4	37	c.1133	CCDS8643.1	12	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253907	0.80135	.	.	ENSG00000139083	ENST00000396373	T	0.28895	1.59	5.63	5.63	0.86233	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.64746	0.2626	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71133	-0.4681	10	0.87932	D	0	.	19.2738	0.94021	0.0:0.0:1.0:0.0	.	378	P41212	ETV6_HUMAN	P	378	ENSP00000379658:R378P	ENSP00000379658:R378P	R	+	2	0	ETV6	11928769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.062000	0.89475	2.636000	0.89361	0.655000	0.94253	CGA	ETV6	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000139083		0.463	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	HGNC	protein_coding	OTTHUMT00000400130.2	66	0.00	0	G	NM_001987		12037502	12037502	+1	no_errors	ENST00000396373	ensembl	human	known	69_37n	missense	34	44.26	27	SNP	1.000	C
ETV6	2120	genome.wustl.edu	37	12	12037502	12037502	+	Missense_Mutation	SNP	G	G	C	rs146280653		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:12037502G>C	ENST00000396373.4	+	6	1407	c.1133G>C	c.(1132-1134)cGa>cCa	p.R378P		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	378					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R378P(1)	ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GGACTGGCTCGACTGTGGGGA	0.463			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																	dbGAP		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	1	Substitution - Missense(1)	breast(1)											78.0	75.0	76.0					12																	12037502		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1133G>C	12.37:g.12037502G>C	ENSP00000379658:p.Arg378Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.R378P	ENST00000396373.4	37	c.1133	CCDS8643.1	12	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253907	0.80135	.	.	ENSG00000139083	ENST00000396373	T	0.28895	1.59	5.63	5.63	0.86233	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.64746	0.2626	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71133	-0.4681	10	0.87932	D	0	.	19.2738	0.94021	0.0:0.0:1.0:0.0	.	378	P41212	ETV6_HUMAN	P	378	ENSP00000379658:R378P	ENSP00000379658:R378P	R	+	2	0	ETV6	11928769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.062000	0.89475	2.636000	0.89361	0.655000	0.94253	CGA	ETV6	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000139083		0.463	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	HGNC	protein_coding	OTTHUMT00000400130.2	82	0.00	0	G	NM_001987		12037502	12037502	+1	no_errors	ENST00000396373	ensembl	human	known	69_37n	missense	34	44.26	27	SNP	1.000	C
FCGR1B	2210	genome.wustl.edu	37	1	120927202	120927202	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:120927202G>A	ENST00000369384.4	-	5	820	c.778C>T	c.(778-780)Cag>Tag	p.Q260*	RP11-439A17.10_ENST00000426275.1_RNA|RP11-439A17.9_ENST00000457996.1_RNA|FCGR1B_ENST00000472543.1_5'Flank|FCGR1B_ENST00000369383.4_Nonsense_Mutation_p.Q168*	NM_001017986.3	NP_001017986.1	Q92637	FCGRB_HUMAN	Fc fragment of IgG, high affinity Ib, receptor (CD64)	260					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|Fc receptor signaling pathway (GO:0038093)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	immunoglobulin receptor activity (GO:0019763)	p.Q260*(1)		breast(1)|endometrium(1)|lung(2)	4	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)	Intravenous Immunoglobulin(DB00028)	TTTTGTTCCTGACATTTCAGC	0.488																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											8.0	8.0	8.0					1																	120927202		2125	4164	6289	-	-	-	SO:0001587	stop_gained	0				CCDS72844.1, CCDS72845.1, CCDS72846.1	1p11.2	2013-01-11	2005-02-02		ENSG00000198019	ENSG00000198019		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3614	protein-coding gene	gene with protein product		601502	"""Fc fragment of IgG, high affinity Ib, receptor for (CD64)"""			8697799, 9763663	Standard	NM_001017986		Approved	CD64b	uc001eip.3	Q92637	OTTHUMG00000040903	ENST00000369384.4:c.778C>T	1.37:g.120927202G>A	ENSP00000358391:p.Gln260*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7KZ13|Q92638	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q260*	ENST00000369384.4	37	c.778	CCDS30821.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.493|6.493	0.459090|0.459090	0.12342|0.12342	.|.	.|.	ENSG00000198019|ENSG00000198019	ENST00000369384;ENST00000369383|ENST00000369178	.|.	.|.	.|.	1.96|1.96	0.928|0.928	0.19443|0.19443	.|.	2.074870|.	0.02666|.	N|.	0.108011|.	.|T	.|0.35885	.|0.0947	.|.	.|.	.|.	0.44702|0.44702	D|D	0.997694|0.997694	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.20706	.|-1.0267	.|4	0.37606|.	T|.	0.19|.	.|.	5.3031|5.3031	0.15790|0.15790	0.0:0.0:0.6402:0.3598|0.0:0.0:0.6402:0.3598	.|.	.|.	.|.	.|.	X|L	260;168|244	.|.	ENSP00000358390:Q168X|.	Q|S	-|-	1|2	0|0	FCGR1B|FCGR1B	120728725|120728725	0.002000|0.002000	0.14202|0.14202	0.003000|0.003000	0.11579|0.11579	0.081000|0.081000	0.17604|0.17604	0.863000|0.863000	0.27913|0.27913	0.331000|0.331000	0.23511|0.23511	0.184000|0.184000	0.17185|0.17185	CAG|TCA	FCGR1B	-	NULL	ENSG00000198019		0.488	FCGR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGR1B	HGNC	protein_coding	OTTHUMT00000098241.1	109	0.00	0	G			120927202	120927202	-1	no_errors	ENST00000369384	ensembl	human	known	69_37n	nonsense	111	17.16	23	SNP	0.003	A
FCGR1B	2210	genome.wustl.edu	37	1	120927202	120927202	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:120927202G>A	ENST00000369384.4	-	5	820	c.778C>T	c.(778-780)Cag>Tag	p.Q260*	RP11-439A17.10_ENST00000426275.1_RNA|RP11-439A17.9_ENST00000457996.1_RNA|FCGR1B_ENST00000472543.1_5'Flank|FCGR1B_ENST00000369383.4_Nonsense_Mutation_p.Q168*	NM_001017986.3	NP_001017986.1	Q92637	FCGRB_HUMAN	Fc fragment of IgG, high affinity Ib, receptor (CD64)	260					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|Fc receptor signaling pathway (GO:0038093)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	immunoglobulin receptor activity (GO:0019763)	p.Q260*(1)		breast(1)|endometrium(1)|lung(2)	4	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)	Intravenous Immunoglobulin(DB00028)	TTTTGTTCCTGACATTTCAGC	0.488																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											8.0	8.0	8.0					1																	120927202		2125	4164	6289	-	-	-	SO:0001587	stop_gained	0				CCDS72844.1, CCDS72845.1, CCDS72846.1	1p11.2	2013-01-11	2005-02-02		ENSG00000198019	ENSG00000198019		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3614	protein-coding gene	gene with protein product		601502	"""Fc fragment of IgG, high affinity Ib, receptor for (CD64)"""			8697799, 9763663	Standard	NM_001017986		Approved	CD64b	uc001eip.3	Q92637	OTTHUMG00000040903	ENST00000369384.4:c.778C>T	1.37:g.120927202G>A	ENSP00000358391:p.Gln260*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7KZ13|Q92638	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q260*	ENST00000369384.4	37	c.778	CCDS30821.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.493|6.493	0.459090|0.459090	0.12342|0.12342	.|.	.|.	ENSG00000198019|ENSG00000198019	ENST00000369384;ENST00000369383|ENST00000369178	.|.	.|.	.|.	1.96|1.96	0.928|0.928	0.19443|0.19443	.|.	2.074870|.	0.02666|.	N|.	0.108011|.	.|T	.|0.35885	.|0.0947	.|.	.|.	.|.	0.44702|0.44702	D|D	0.997694|0.997694	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.20706	.|-1.0267	.|4	0.37606|.	T|.	0.19|.	.|.	5.3031|5.3031	0.15790|0.15790	0.0:0.0:0.6402:0.3598|0.0:0.0:0.6402:0.3598	.|.	.|.	.|.	.|.	X|L	260;168|244	.|.	ENSP00000358390:Q168X|.	Q|S	-|-	1|2	0|0	FCGR1B|FCGR1B	120728725|120728725	0.002000|0.002000	0.14202|0.14202	0.003000|0.003000	0.11579|0.11579	0.081000|0.081000	0.17604|0.17604	0.863000|0.863000	0.27913|0.27913	0.331000|0.331000	0.23511|0.23511	0.184000|0.184000	0.17185|0.17185	CAG|TCA	FCGR1B	-	NULL	ENSG00000198019		0.488	FCGR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGR1B	HGNC	protein_coding	OTTHUMT00000098241.1	163	0.00	0	G			120927202	120927202	-1	no_errors	ENST00000369384	ensembl	human	known	69_37n	nonsense	111	17.16	23	SNP	0.003	A
FMN2	56776	genome.wustl.edu	37	1	240555839	240555839	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:240555839T>G	ENST00000319653.9	+	15	5117	c.4887T>G	c.(4885-4887)aaT>aaG	p.N1629K	FMN2_ENST00000545751.1_Missense_Mutation_p.N225K	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1629	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CAGAGGAAAATTCACTGACAG	0.338																																						dbGAP											0													122.0	129.0	127.0					1																	240555839		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4887T>G	1.37:g.240555839T>G	ENSP00000318884:p.Asn1629Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.N1629K	ENST00000319653.9	37	c.4887	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	T	3.649	-0.071911	0.07228	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993	T;T	0.15834	2.39;2.39	5.47	-1.85	0.07784	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.517354	0.16655	N	0.205035	T	0.03390	0.0098	N	0.00823	-1.155	0.49299	D	0.999778	B;B;B;B	0.17852	0.0;0.0;0.0;0.024	B;B;B;B	0.18871	0.0;0.001;0.001;0.023	T	0.44757	-0.9307	10	0.06236	T	0.91	.	6.829	0.23898	0.0:0.3711:0.1256:0.5033	.	225;244;258;1629	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	K	1629;225;256;105	ENSP00000318884:N1629K;ENSP00000437918:N225K	ENSP00000318884:N1629K	N	+	3	2	FMN2	238622462	0.975000	0.34042	0.839000	0.33178	0.910000	0.53928	-0.137000	0.10389	-0.103000	0.12175	-0.256000	0.11100	AAT	FMN2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.338	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	278	0.00	0	T	XM_371352		240555839	240555839	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	127	22.09	36	SNP	0.628	G
FMN2	56776	genome.wustl.edu	37	1	240555839	240555839	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:240555839T>G	ENST00000319653.9	+	15	5117	c.4887T>G	c.(4885-4887)aaT>aaG	p.N1629K	FMN2_ENST00000545751.1_Missense_Mutation_p.N225K	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1629	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CAGAGGAAAATTCACTGACAG	0.338																																						dbGAP											0													122.0	129.0	127.0					1																	240555839		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4887T>G	1.37:g.240555839T>G	ENSP00000318884:p.Asn1629Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.N1629K	ENST00000319653.9	37	c.4887	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	T	3.649	-0.071911	0.07228	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993	T;T	0.15834	2.39;2.39	5.47	-1.85	0.07784	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.517354	0.16655	N	0.205035	T	0.03390	0.0098	N	0.00823	-1.155	0.49299	D	0.999778	B;B;B;B	0.17852	0.0;0.0;0.0;0.024	B;B;B;B	0.18871	0.0;0.001;0.001;0.023	T	0.44757	-0.9307	10	0.06236	T	0.91	.	6.829	0.23898	0.0:0.3711:0.1256:0.5033	.	225;244;258;1629	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	K	1629;225;256;105	ENSP00000318884:N1629K;ENSP00000437918:N225K	ENSP00000318884:N1629K	N	+	3	2	FMN2	238622462	0.975000	0.34042	0.839000	0.33178	0.910000	0.53928	-0.137000	0.10389	-0.103000	0.12175	-0.256000	0.11100	AAT	FMN2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.338	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	413	0.00	0	T	XM_371352		240555839	240555839	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	127	22.09	36	SNP	0.628	G
GP5	2814	genome.wustl.edu	37	3	194118427	194118427	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:194118427C>T	ENST00000401815.1	-	1	656	c.585G>A	c.(583-585)aaG>aaA	p.K195K	GP5_ENST00000323007.3_Silent_p.K195K			P40197	GPV_HUMAN	glycoprotein V (platelet)	195					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.K195K(2)		breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		GTCTCTCGAGCTTAGCCTGTG	0.562																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											73.0	79.0	76.0					3																	194118427		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.585G>A	3.37:g.194118427C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D1MER9	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.K195	ENST00000401815.1	37	c.585	CCDS3307.1	3																																																																																			GP5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000178732		0.562	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP5	HGNC	protein_coding	OTTHUMT00000317710.1	11	0.00	0	C	NM_004488		194118427	194118427	-1	no_errors	ENST00000323007	ensembl	human	known	69_37n	silent	42	26.32	15	SNP	0.082	T
GP5	2814	genome.wustl.edu	37	3	194118427	194118427	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:194118427C>T	ENST00000401815.1	-	1	656	c.585G>A	c.(583-585)aaG>aaA	p.K195K	GP5_ENST00000323007.3_Silent_p.K195K			P40197	GPV_HUMAN	glycoprotein V (platelet)	195					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.K195K(2)		breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		GTCTCTCGAGCTTAGCCTGTG	0.562																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											73.0	79.0	76.0					3																	194118427		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.585G>A	3.37:g.194118427C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D1MER9	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.K195	ENST00000401815.1	37	c.585	CCDS3307.1	3																																																																																			GP5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000178732		0.562	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP5	HGNC	protein_coding	OTTHUMT00000317710.1	15	0.00	0	C	NM_004488		194118427	194118427	-1	no_errors	ENST00000323007	ensembl	human	known	69_37n	silent	42	26.32	15	SNP	0.082	T
GPR108	56927	genome.wustl.edu	37	19	6731281	6731281	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:6731281C>T	ENST00000264080.7	-	16	1389	c.1363G>A	c.(1363-1365)Gtc>Atc	p.V455I	GPR108_ENST00000430424.4_Missense_Mutation_p.V213I|GPR108_ENST00000598626.1_5'UTR	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	455						integral component of membrane (GO:0016021)		p.V455I(1)		breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						GTGAAGTAGACGTAGCAGATG	0.677																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	45.0	43.0					19																	6731281		2173	4263	6436	-	-	-	SO:0001583	missense	0				CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.1363G>A	19.37:g.6731281C>T	ENSP00000264080:p.Val455Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJD7	Missense_Mutation	SNP	pfam_TM_rcpt_euk	p.V455I	ENST00000264080.7	37	c.1363	CCDS42479.1	19	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.666984	0.00765	.	.	ENSG00000125734	ENST00000548402;ENST00000264080;ENST00000430424	T	0.19250	2.16	3.79	-4.41	0.03590	.	0.381500	0.22884	N	0.054480	T	0.04272	0.0118	N	0.00746	-1.225	0.23994	N	0.996233	B	0.09022	0.002	B	0.08055	0.003	T	0.31586	-0.9938	10	0.02654	T	1	-1.4883	11.8466	0.52387	0.0:0.1524:0.0:0.8476	.	455	Q9NPR9	GP108_HUMAN	I	47;455;213	ENSP00000264080:V455I	ENSP00000264080:V455I	V	-	1	0	GPR108	6682281	0.979000	0.34478	0.145000	0.22337	0.007000	0.05969	0.247000	0.18179	-1.005000	0.03417	-0.704000	0.03662	GTC	GPR108	-	pfam_TM_rcpt_euk	ENSG00000125734		0.677	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR108	HGNC	protein_coding	OTTHUMT00000407508.2	14	0.00	0	C			6731281	6731281	-1	no_errors	ENST00000264080	ensembl	human	known	69_37n	missense	83	29.66	35	SNP	0.995	T
GPR37	2861	genome.wustl.edu	37	7	124387321	124387321	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:124387321T>G	ENST00000303921.2	-	2	1750	c.1100A>C	c.(1099-1101)cAg>cCg	p.Q367P		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	367					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)	p.Q367P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTAGTACATCTGTACGTTGGT	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	77.0	77.0					7																	124387321		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1100A>C	7.37:g.124387321T>G	ENSP00000306449:p.Gln367Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_GPR37_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q367P	ENST00000303921.2	37	c.1100	CCDS5792.1	7	.	.	.	.	.	.	.	.	.	.	T	16.73	3.203123	0.58234	.	.	ENSG00000170775	ENST00000303921	T	0.37235	1.21	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	T	0.48995	0.1531	L	0.38531	1.155	0.58432	D	0.999995	D	0.69078	0.997	D	0.67725	0.953	T	0.43032	-0.9416	10	0.44086	T	0.13	-21.8047	15.228	0.73364	0.0:0.0:0.0:1.0	.	367	O15354	GPR37_HUMAN	P	367	ENSP00000306449:Q367P	ENSP00000306449:Q367P	Q	-	2	0	GPR37	124174557	1.000000	0.71417	0.998000	0.56505	0.860000	0.49131	6.289000	0.72696	2.194000	0.70268	0.460000	0.39030	CAG	GPR37	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000170775		0.473	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	HGNC	protein_coding	OTTHUMT00000347873.1	25	0.00	0	T	NM_005302		124387321	124387321	-1	no_errors	ENST00000303921	ensembl	human	known	69_37n	missense	68	47.69	62	SNP	1.000	G
GPR37	2861	genome.wustl.edu	37	7	124387321	124387321	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:124387321T>G	ENST00000303921.2	-	2	1750	c.1100A>C	c.(1099-1101)cAg>cCg	p.Q367P		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	367					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)	p.Q367P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTAGTACATCTGTACGTTGGT	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	77.0	77.0					7																	124387321		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1100A>C	7.37:g.124387321T>G	ENSP00000306449:p.Gln367Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_GPR37_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q367P	ENST00000303921.2	37	c.1100	CCDS5792.1	7	.	.	.	.	.	.	.	.	.	.	T	16.73	3.203123	0.58234	.	.	ENSG00000170775	ENST00000303921	T	0.37235	1.21	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	T	0.48995	0.1531	L	0.38531	1.155	0.58432	D	0.999995	D	0.69078	0.997	D	0.67725	0.953	T	0.43032	-0.9416	10	0.44086	T	0.13	-21.8047	15.228	0.73364	0.0:0.0:0.0:1.0	.	367	O15354	GPR37_HUMAN	P	367	ENSP00000306449:Q367P	ENSP00000306449:Q367P	Q	-	2	0	GPR37	124174557	1.000000	0.71417	0.998000	0.56505	0.860000	0.49131	6.289000	0.72696	2.194000	0.70268	0.460000	0.39030	CAG	GPR37	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000170775		0.473	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	HGNC	protein_coding	OTTHUMT00000347873.1	33	0.00	0	T	NM_005302		124387321	124387321	-1	no_errors	ENST00000303921	ensembl	human	known	69_37n	missense	68	47.69	62	SNP	1.000	G
GRIA1	2890	genome.wustl.edu	37	5	153144138	153144138	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:153144138G>C	ENST00000285900.5	+	12	2311	c.1968G>C	c.(1966-1968)caG>caC	p.Q656H	GRIA1_ENST00000521843.2_Missense_Mutation_p.Q587H|GRIA1_ENST00000448073.4_Missense_Mutation_p.Q666H|GRIA1_ENST00000518783.1_Missense_Mutation_p.Q666H|GRIA1_ENST00000518142.1_Missense_Mutation_p.Q576H|GRIA1_ENST00000340592.5_Missense_Mutation_p.Q656H	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	656					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.Q656H(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TAGCGAAGCAGACAGAAATTG	0.512																																						dbGAP											2	Substitution - Missense(2)	breast(2)											116.0	96.0	103.0					5																	153144138		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1968G>C	5.37:g.153144138G>C	ENSP00000285900:p.Gln656His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q666H	ENST00000285900.5	37	c.1998	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579616	0.65992	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.57907	1.64;1.64;0.37;1.64;1.64;1.64;0.37	5.27	2.06	0.26882	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.73426	0.3585	M	0.90705	3.14	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.998;0.999;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.944;0.998;1.0	T	0.75496	-0.3297	10	0.87932	D	0	.	9.3176	0.37943	0.3334:0.0:0.6666:0.0	.	666;666;576;656;656	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	H	656;656;576;610;656;589;587;666;666	ENSP00000285900:Q656H;ENSP00000427920:Q576H;ENSP00000339343:Q656H;ENSP00000427864:Q589H;ENSP00000442108:Q587H;ENSP00000428994:Q666H;ENSP00000415569:Q666H	ENSP00000285900:Q656H	Q	+	3	2	GRIA1	153124331	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.378000	0.44309	0.610000	0.30035	0.561000	0.74099	CAG	GRIA1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000155511		0.512	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	21	0.00	0	G			153144138	153144138	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	missense	78	23.53	24	SNP	1.000	C
GRIA1	2890	genome.wustl.edu	37	5	153144138	153144138	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:153144138G>C	ENST00000285900.5	+	12	2311	c.1968G>C	c.(1966-1968)caG>caC	p.Q656H	GRIA1_ENST00000521843.2_Missense_Mutation_p.Q587H|GRIA1_ENST00000448073.4_Missense_Mutation_p.Q666H|GRIA1_ENST00000518783.1_Missense_Mutation_p.Q666H|GRIA1_ENST00000518142.1_Missense_Mutation_p.Q576H|GRIA1_ENST00000340592.5_Missense_Mutation_p.Q656H	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	656					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.Q656H(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TAGCGAAGCAGACAGAAATTG	0.512																																						dbGAP											2	Substitution - Missense(2)	breast(2)											116.0	96.0	103.0					5																	153144138		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1968G>C	5.37:g.153144138G>C	ENSP00000285900:p.Gln656His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q666H	ENST00000285900.5	37	c.1998	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579616	0.65992	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.57907	1.64;1.64;0.37;1.64;1.64;1.64;0.37	5.27	2.06	0.26882	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.73426	0.3585	M	0.90705	3.14	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.998;0.999;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.944;0.998;1.0	T	0.75496	-0.3297	10	0.87932	D	0	.	9.3176	0.37943	0.3334:0.0:0.6666:0.0	.	666;666;576;656;656	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	H	656;656;576;610;656;589;587;666;666	ENSP00000285900:Q656H;ENSP00000427920:Q576H;ENSP00000339343:Q656H;ENSP00000427864:Q589H;ENSP00000442108:Q587H;ENSP00000428994:Q666H;ENSP00000415569:Q666H	ENSP00000285900:Q656H	Q	+	3	2	GRIA1	153124331	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.378000	0.44309	0.610000	0.30035	0.561000	0.74099	CAG	GRIA1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000155511		0.512	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	31	0.00	0	G			153144138	153144138	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	missense	78	23.53	24	SNP	1.000	C
HDAC6	10013	genome.wustl.edu	37	X	48682346	48682346	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:48682346T>C	ENST00000334136.5	+	27	3496	c.3318T>C	c.(3316-3318)gcT>gcC	p.A1106A	HDAC6_ENST00000444343.2_Silent_p.A1120A|HDAC6_ENST00000376619.2_Silent_p.A1106A			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1106					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.A1106A(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	TATTTTATGCTGTGACACCAC	0.522																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											1	Substitution - coding silent(1)	breast(1)											92.0	84.0	87.0					X																	48682346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.3318T>C	X.37:g.48682346T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.A1120	ENST00000334136.5	37	c.3360	CCDS14306.1	X																																																																																			HDAC6	-	NULL	ENSG00000094631		0.522	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	41	0.00	0	T	NM_006044		48682346	48682346	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	silent	139	22.35	40	SNP	0.885	C
HDAC6	10013	genome.wustl.edu	37	X	48682346	48682346	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:48682346T>C	ENST00000334136.5	+	27	3496	c.3318T>C	c.(3316-3318)gcT>gcC	p.A1106A	HDAC6_ENST00000444343.2_Silent_p.A1120A|HDAC6_ENST00000376619.2_Silent_p.A1106A			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1106					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.A1106A(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	TATTTTATGCTGTGACACCAC	0.522																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											1	Substitution - coding silent(1)	breast(1)											92.0	84.0	87.0					X																	48682346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.3318T>C	X.37:g.48682346T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.A1120	ENST00000334136.5	37	c.3360	CCDS14306.1	X																																																																																			HDAC6	-	NULL	ENSG00000094631		0.522	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	61	0.00	0	T	NM_006044		48682346	48682346	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	silent	139	22.35	40	SNP	0.885	C
MROH7	374977	genome.wustl.edu	37	1	55175761	55175761	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:55175761C>A	ENST00000421030.2	+	24	4158	c.3873C>A	c.(3871-3873)caC>caA	p.H1291Q	MROH7-TTC4_ENST00000414150.2_Intron|MROH7_ENST00000409996.1_Missense_Mutation_p.H859Q|MROH7_ENST00000454855.2_Missense_Mutation_p.H809Q	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1291						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.H1288Q(1)|p.H1291Q(1)									CCACCACCCACCGCTGGAGCC	0.627																																						dbGAP											2	Substitution - Missense(2)	breast(2)											37.0	41.0	40.0					1																	55175761		2008	4163	6171	-	-	-	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3873C>A	1.37:g.55175761C>A	ENSP00000396622:p.His1291Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H1291Q	ENST00000421030.2	37	c.3873	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	c	14.13	2.444580	0.43429	.	.	ENSG00000184313	ENST00000421030;ENST00000409996;ENST00000454855;ENST00000371287	T;T;T;T	0.16597	4.48;4.3;4.18;2.33	5.17	4.26	0.50523	.	.	.	.	.	T	0.35799	0.0944	L	0.57536	1.79	0.30480	N	0.772421	D;D	0.76494	0.999;0.997	D;D	0.85130	0.997;0.991	T	0.25676	-1.0125	9	0.66056	D	0.02	.	9.7796	0.40640	0.0:0.9041:0.0:0.0959	.	1291;1290	Q68CQ1;Q68CQ1-9	HEAT8_HUMAN;.	Q	1291;859;809;360	ENSP00000396622:H1291Q;ENSP00000387048:H859Q;ENSP00000401130:H809Q;ENSP00000360336:H360Q	ENSP00000360336:H360Q	H	+	3	2	HEATR8	54948349	1.000000	0.71417	0.981000	0.43875	0.150000	0.21749	1.507000	0.35758	1.167000	0.42706	0.586000	0.80456	CAC	HEATR8	-	NULL	ENSG00000184313		0.627	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	11	0.00	0	C	NM_198547		55175761	55175761	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	missense	59	23.38	18	SNP	0.998	A
HEATR1	55127	genome.wustl.edu	37	1	236739603	236739603	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:236739603C>G	ENST00000366582.3	-	22	3114	c.3000G>C	c.(2998-3000)ttG>ttC	p.L1000F	HEATR1_ENST00000366581.2_Missense_Mutation_p.L1000F	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1000					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.L1000F(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GTAAGTTTTTCAAAGTTTCAG	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	151.0	149.0					1																	236739603		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3000G>C	1.37:g.236739603C>G	ENSP00000355541:p.Leu1000Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.L1000F	ENST00000366582.3	37	c.3000	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128967	0.56721	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.72505	-0.24;-0.66	5.33	0.668	0.17912	Armadillo-type fold (2);	0.362025	0.25464	N	0.030492	T	0.76983	0.4064	M	0.66939	2.045	0.80722	D	1	B;D	0.76494	0.053;0.999	B;D	0.66602	0.028;0.945	T	0.74569	-0.3622	10	0.46703	T	0.11	.	8.2935	0.31971	0.0:0.6038:0.2434:0.1527	.	1000;1000	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	F	1000	ENSP00000355541:L1000F;ENSP00000355540:L1000F	ENSP00000355540:L1000F	L	-	3	2	HEATR1	234806226	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	0.870000	0.28010	0.600000	0.29862	0.460000	0.39030	TTG	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.343	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	259	0.00	0	C	XM_375853		236739603	236739603	-1	no_errors	ENST00000366582	ensembl	human	known	69_37n	missense	146	13.61	23	SNP	0.824	G
HEATR1	55127	genome.wustl.edu	37	1	236739603	236739603	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:236739603C>G	ENST00000366582.3	-	22	3114	c.3000G>C	c.(2998-3000)ttG>ttC	p.L1000F	HEATR1_ENST00000366581.2_Missense_Mutation_p.L1000F	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1000					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.L1000F(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GTAAGTTTTTCAAAGTTTCAG	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	151.0	149.0					1																	236739603		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3000G>C	1.37:g.236739603C>G	ENSP00000355541:p.Leu1000Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.L1000F	ENST00000366582.3	37	c.3000	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128967	0.56721	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.72505	-0.24;-0.66	5.33	0.668	0.17912	Armadillo-type fold (2);	0.362025	0.25464	N	0.030492	T	0.76983	0.4064	M	0.66939	2.045	0.80722	D	1	B;D	0.76494	0.053;0.999	B;D	0.66602	0.028;0.945	T	0.74569	-0.3622	10	0.46703	T	0.11	.	8.2935	0.31971	0.0:0.6038:0.2434:0.1527	.	1000;1000	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	F	1000	ENSP00000355541:L1000F;ENSP00000355540:L1000F	ENSP00000355540:L1000F	L	-	3	2	HEATR1	234806226	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	0.870000	0.28010	0.600000	0.29862	0.460000	0.39030	TTG	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.343	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	389	0.00	0	C	XM_375853		236739603	236739603	-1	no_errors	ENST00000366582	ensembl	human	known	69_37n	missense	146	13.61	23	SNP	0.824	G
HERC5	51191	genome.wustl.edu	37	4	89388332	89388332	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:89388332C>A	ENST00000264350.3	+	7	1187	c.1034C>A	c.(1033-1035)tCa>tAa	p.S345*	HERC5_ENST00000508159.1_5'Flank	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	345					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S345*(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GTGAAAGTATCATCAAGTGAA	0.393																																					Esophageal Squamous(39;887 1012 34045 50514)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											110.0	106.0	108.0					4																	89388332		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1034C>A	4.37:g.89388332C>A	ENSP00000264350:p.Ser345*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ1|Q69G20	Nonsense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Haem_Oase-like_multi-hlx,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S345*	ENST00000264350.3	37	c.1034	CCDS3630.1	4	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707928	0.89018	.	.	ENSG00000138646	ENST00000264350	.	.	.	4.32	3.48	0.39840	.	0.932943	0.08982	N	0.865563	.	.	.	.	.	.	0.46631	D	0.999137	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1379	0.42717	0.0:0.9042:0.0:0.0958	.	.	.	.	X	345	.	ENSP00000264350:S345X	S	+	2	0	HERC5	89607355	0.001000	0.12720	0.026000	0.17262	0.034000	0.12701	0.844000	0.27654	1.422000	0.47177	0.585000	0.79938	TCA	HERC5	-	pfam_Reg_chr_condens,pfscan_Reg_chr_condens	ENSG00000138646		0.393	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC5	HGNC	protein_coding	OTTHUMT00000253554.2	119	0.00	0	C	NM_016323		89388332	89388332	+1	no_errors	ENST00000264350	ensembl	human	known	69_37n	nonsense	71	28.28	28	SNP	0.324	A
HERC5	51191	genome.wustl.edu	37	4	89388332	89388332	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:89388332C>A	ENST00000264350.3	+	7	1187	c.1034C>A	c.(1033-1035)tCa>tAa	p.S345*	HERC5_ENST00000508159.1_5'Flank	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	345					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S345*(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GTGAAAGTATCATCAAGTGAA	0.393																																					Esophageal Squamous(39;887 1012 34045 50514)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											110.0	106.0	108.0					4																	89388332		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1034C>A	4.37:g.89388332C>A	ENSP00000264350:p.Ser345*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ1|Q69G20	Nonsense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Haem_Oase-like_multi-hlx,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S345*	ENST00000264350.3	37	c.1034	CCDS3630.1	4	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707928	0.89018	.	.	ENSG00000138646	ENST00000264350	.	.	.	4.32	3.48	0.39840	.	0.932943	0.08982	N	0.865563	.	.	.	.	.	.	0.46631	D	0.999137	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1379	0.42717	0.0:0.9042:0.0:0.0958	.	.	.	.	X	345	.	ENSP00000264350:S345X	S	+	2	0	HERC5	89607355	0.001000	0.12720	0.026000	0.17262	0.034000	0.12701	0.844000	0.27654	1.422000	0.47177	0.585000	0.79938	TCA	HERC5	-	pfam_Reg_chr_condens,pfscan_Reg_chr_condens	ENSG00000138646		0.393	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC5	HGNC	protein_coding	OTTHUMT00000253554.2	185	0.00	0	C	NM_016323		89388332	89388332	+1	no_errors	ENST00000264350	ensembl	human	known	69_37n	nonsense	71	28.28	28	SNP	0.324	A
HIBCH	26275	genome.wustl.edu	37	2	191117010	191117010	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:191117010C>G	ENST00000359678.5	-	8	835	c.541G>C	c.(541-543)Ggt>Cgt	p.G181R	HIBCH_ENST00000392332.3_Missense_Mutation_p.G181R|HIBCH_ENST00000410045.1_5'Flank	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	181					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)	p.G181R(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			AAGAAATAACCTCCACCCACA	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	64.0	66.0					2																	191117010		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.541G>C	2.37:g.191117010C>G	ENSP00000352706:p.Gly181Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	pfam_Crotonase_core	p.G181R	ENST00000359678.5	37	c.541	CCDS2304.1	2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625754	0.87560	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.71698	-0.59;-0.59;-0.22	4.98	4.98	0.66077	Crotonase, core (1);	0.000000	0.85682	D	0.000000	D	0.85243	0.5652	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.988	D	0.87674	0.2543	10	0.72032	D	0.01	-9.2306	17.2423	0.87016	0.0:1.0:0.0:0.0	.	181;181	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	R	181;181;235	ENSP00000376144:G181R;ENSP00000352706:G181R;ENSP00000387247:G235R	ENSP00000352706:G181R	G	-	1	0	HIBCH	190825255	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.309000	0.77851	0.467000	0.42956	GGT	HIBCH	-	pfam_Crotonase_core	ENSG00000198130		0.373	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIBCH	HGNC	protein_coding	OTTHUMT00000255933.1	127	0.00	0	C			191117010	191117010	-1	no_errors	ENST00000359678	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	1.000	G
HIBCH	26275	genome.wustl.edu	37	2	191117010	191117010	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:191117010C>G	ENST00000359678.5	-	8	835	c.541G>C	c.(541-543)Ggt>Cgt	p.G181R	HIBCH_ENST00000392332.3_Missense_Mutation_p.G181R|HIBCH_ENST00000410045.1_5'Flank	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	181					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)	p.G181R(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			AAGAAATAACCTCCACCCACA	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	64.0	66.0					2																	191117010		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.541G>C	2.37:g.191117010C>G	ENSP00000352706:p.Gly181Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	pfam_Crotonase_core	p.G181R	ENST00000359678.5	37	c.541	CCDS2304.1	2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625754	0.87560	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.71698	-0.59;-0.59;-0.22	4.98	4.98	0.66077	Crotonase, core (1);	0.000000	0.85682	D	0.000000	D	0.85243	0.5652	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.988	D	0.87674	0.2543	10	0.72032	D	0.01	-9.2306	17.2423	0.87016	0.0:1.0:0.0:0.0	.	181;181	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	R	181;181;235	ENSP00000376144:G181R;ENSP00000352706:G181R;ENSP00000387247:G235R	ENSP00000352706:G181R	G	-	1	0	HIBCH	190825255	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.309000	0.77851	0.467000	0.42956	GGT	HIBCH	-	pfam_Crotonase_core	ENSG00000198130		0.373	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIBCH	HGNC	protein_coding	OTTHUMT00000255933.1	84	0.00	0	C			191117010	191117010	-1	no_errors	ENST00000359678	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	1.000	G
HIST1H2BC	8347	genome.wustl.edu	37	6	26123995	26123995	+	Silent	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr6:26123995C>G	ENST00000314332.5	-	1	143	c.138G>C	c.(136-138)ctG>ctC	p.L46L	HIST1H2BC_ENST00000396984.1_Silent_p.L46L|HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	46					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L46L(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						GGACCTGTTTCAGCACCTTGT	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											216.0	191.0	199.0					6																	26123995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.138G>C	6.37:g.26123995C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.L46	ENST00000314332.5	37	c.138	CCDS4584.1	6																																																																																			HIST1H2BC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000180596		0.537	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	40	0.00	0	C	NM_003526		26123995	26123995	-1	no_errors	ENST00000314332	ensembl	human	known	69_37n	silent	146	24.74	48	SNP	1.000	G
HIST1H2BC	8347	genome.wustl.edu	37	6	26123995	26123995	+	Silent	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr6:26123995C>G	ENST00000314332.5	-	1	143	c.138G>C	c.(136-138)ctG>ctC	p.L46L	HIST1H2BC_ENST00000396984.1_Silent_p.L46L|HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	46					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L46L(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						GGACCTGTTTCAGCACCTTGT	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											216.0	191.0	199.0					6																	26123995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.138G>C	6.37:g.26123995C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.L46	ENST00000314332.5	37	c.138	CCDS4584.1	6																																																																																			HIST1H2BC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000180596		0.537	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	64	0.00	0	C	NM_003526		26123995	26123995	-1	no_errors	ENST00000314332	ensembl	human	known	69_37n	silent	146	24.74	48	SNP	1.000	G
HSD17B4	3295	genome.wustl.edu	37	5	118824925	118824925	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:118824925C>G	ENST00000256216.6	+	9	794	c.661C>G	c.(661-663)Ctt>Gtt	p.L221V	HSD17B4_ENST00000515320.1_Missense_Mutation_p.L203V|HSD17B4_ENST00000414835.2_Missense_Mutation_p.L81V|HSD17B4_ENST00000509514.1_5'UTR|HSD17B4_ENST00000504811.1_Missense_Mutation_p.L246V|HSD17B4_ENST00000510025.1_Missense_Mutation_p.L197V|HSD17B4_ENST00000513628.1_Missense_Mutation_p.L84V	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	221	(3R)-hydroxyacyl-CoA dehydrogenase.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.L221V(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		TGTGGCACCTCTTGTCCTTTG	0.378																																					Colon(35;490 801 34689 41394 43344)	dbGAP											1	Substitution - Missense(1)	breast(1)											220.0	213.0	215.0					5																	118824925		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.661C>G	5.37:g.118824925C>G	ENSP00000256216:p.Leu221Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.L221V	ENST00000256216.6	37	c.661	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	C	8.001	0.755448	0.15846	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628	D;D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54;-2.54	5.97	5.1	0.69264	NAD(P)-binding domain (1);	0.062102	0.64402	D	0.000006	D	0.88570	0.6472	M	0.65677	2.01	0.80722	D	1	B;B;B;B	0.24768	0.097;0.111;0.043;0.011	B;B;B;B	0.35607	0.206;0.037;0.037;0.035	D	0.84476	0.0602	10	0.25751	T	0.34	-4.6229	12.2759	0.54735	0.0:0.8598:0.0:0.1402	.	246;203;197;221	F5HE57;E9PB82;E7EWE5;P51659	.;.;.;DHB4_HUMAN	V	221;203;197;246;81;84	ENSP00000256216:L221V;ENSP00000424613:L203V;ENSP00000424940:L197V;ENSP00000420914:L246V;ENSP00000411960:L81V;ENSP00000425993:L84V	ENSP00000256216:L221V	L	+	1	0	HSD17B4	118852824	0.096000	0.21769	0.906000	0.35671	0.127000	0.20565	0.597000	0.24059	1.539000	0.49286	-0.145000	0.13849	CTT	HSD17B4	-	prints_Glc/ribitol_DH	ENSG00000133835		0.378	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	189	0.00	0	C	NM_000414		118824925	118824925	+1	no_errors	ENST00000256216	ensembl	human	known	69_37n	missense	119	29.17	49	SNP	0.672	G
HSD17B4	3295	genome.wustl.edu	37	5	118824925	118824925	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:118824925C>G	ENST00000256216.6	+	9	794	c.661C>G	c.(661-663)Ctt>Gtt	p.L221V	HSD17B4_ENST00000515320.1_Missense_Mutation_p.L203V|HSD17B4_ENST00000414835.2_Missense_Mutation_p.L81V|HSD17B4_ENST00000509514.1_5'UTR|HSD17B4_ENST00000504811.1_Missense_Mutation_p.L246V|HSD17B4_ENST00000510025.1_Missense_Mutation_p.L197V|HSD17B4_ENST00000513628.1_Missense_Mutation_p.L84V	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	221	(3R)-hydroxyacyl-CoA dehydrogenase.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.L221V(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		TGTGGCACCTCTTGTCCTTTG	0.378																																					Colon(35;490 801 34689 41394 43344)	dbGAP											1	Substitution - Missense(1)	breast(1)											220.0	213.0	215.0					5																	118824925		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.661C>G	5.37:g.118824925C>G	ENSP00000256216:p.Leu221Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.L221V	ENST00000256216.6	37	c.661	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	C	8.001	0.755448	0.15846	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628	D;D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54;-2.54	5.97	5.1	0.69264	NAD(P)-binding domain (1);	0.062102	0.64402	D	0.000006	D	0.88570	0.6472	M	0.65677	2.01	0.80722	D	1	B;B;B;B	0.24768	0.097;0.111;0.043;0.011	B;B;B;B	0.35607	0.206;0.037;0.037;0.035	D	0.84476	0.0602	10	0.25751	T	0.34	-4.6229	12.2759	0.54735	0.0:0.8598:0.0:0.1402	.	246;203;197;221	F5HE57;E9PB82;E7EWE5;P51659	.;.;.;DHB4_HUMAN	V	221;203;197;246;81;84	ENSP00000256216:L221V;ENSP00000424613:L203V;ENSP00000424940:L197V;ENSP00000420914:L246V;ENSP00000411960:L81V;ENSP00000425993:L84V	ENSP00000256216:L221V	L	+	1	0	HSD17B4	118852824	0.096000	0.21769	0.906000	0.35671	0.127000	0.20565	0.597000	0.24059	1.539000	0.49286	-0.145000	0.13849	CTT	HSD17B4	-	prints_Glc/ribitol_DH	ENSG00000133835		0.378	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	258	0.00	0	C	NM_000414		118824925	118824925	+1	no_errors	ENST00000256216	ensembl	human	known	69_37n	missense	119	29.17	49	SNP	0.672	G
HSPA4	3308	genome.wustl.edu	37	5	132412489	132412489	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:132412489G>C	ENST00000304858.2	+	7	1096	c.807G>C	c.(805-807)gaG>gaC	p.E269D	HSPA4_ENST00000504328.1_3'UTR	NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	269					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.E269D(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTCTCAGGAGTGTGAGAAAC	0.353																																					Colon(114;1299 1588 6063 12302 48757)	dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	120.0	120.0					5																	132412489		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.807G>C	5.37:g.132412489G>C	ENSP00000302961:p.Glu269Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O95756|Q2TAL4|Q9BUK9	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.E269D	ENST00000304858.2	37	c.807	CCDS4166.1	5	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908332	0.72868	.	.	ENSG00000170606	ENST00000304858;ENST00000537974	T	0.01092	5.35	5.52	1.76	0.24704	.	0.000000	0.85682	D	0.000000	T	0.08802	0.0218	H	0.94847	3.59	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.00867	-1.1534	10	0.66056	D	0.02	-21.4569	10.1457	0.42762	0.3931:0.0:0.6069:0.0	.	269	P34932	HSP74_HUMAN	D	269	ENSP00000302961:E269D	ENSP00000302961:E269D	E	+	3	2	HSPA4	132440388	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.017000	0.29989	0.389000	0.25086	0.591000	0.81541	GAG	HSPA4	-	pfam_Hsp_70_fam,pfam_MreB_Mrl	ENSG00000170606		0.353	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA4	HGNC	protein_coding	OTTHUMT00000251011.1	157	0.63	1	G	NM_002154, NM_198431		132412489	132412489	+1	no_errors	ENST00000304858	ensembl	human	known	69_37n	missense	55	39.56	36	SNP	1.000	C
HSPA4	3308	genome.wustl.edu	37	5	132412489	132412489	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:132412489G>C	ENST00000304858.2	+	7	1096	c.807G>C	c.(805-807)gaG>gaC	p.E269D	HSPA4_ENST00000504328.1_3'UTR	NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	269					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.E269D(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTCTCAGGAGTGTGAGAAAC	0.353																																					Colon(114;1299 1588 6063 12302 48757)	dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	120.0	120.0					5																	132412489		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.807G>C	5.37:g.132412489G>C	ENSP00000302961:p.Glu269Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O95756|Q2TAL4|Q9BUK9	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.E269D	ENST00000304858.2	37	c.807	CCDS4166.1	5	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908332	0.72868	.	.	ENSG00000170606	ENST00000304858;ENST00000537974	T	0.01092	5.35	5.52	1.76	0.24704	.	0.000000	0.85682	D	0.000000	T	0.08802	0.0218	H	0.94847	3.59	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.00867	-1.1534	10	0.66056	D	0.02	-21.4569	10.1457	0.42762	0.3931:0.0:0.6069:0.0	.	269	P34932	HSP74_HUMAN	D	269	ENSP00000302961:E269D	ENSP00000302961:E269D	E	+	3	2	HSPA4	132440388	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.017000	0.29989	0.389000	0.25086	0.591000	0.81541	GAG	HSPA4	-	pfam_Hsp_70_fam,pfam_MreB_Mrl	ENSG00000170606		0.353	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA4	HGNC	protein_coding	OTTHUMT00000251011.1	237	0.42	1	G	NM_002154, NM_198431		132412489	132412489	+1	no_errors	ENST00000304858	ensembl	human	known	69_37n	missense	55	39.56	36	SNP	1.000	C
IDI1	3422	genome.wustl.edu	37	10	1089851	1089869	+	Intron	DEL	TGCACTTCCTTGAACAGAG	TGCACTTCCTTGAACAGAG	-	rs528259267		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	TGCACTTCCTTGAACAGAG	TGCACTTCCTTGAACAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:1089851_1089869delTGCACTTCCTTGAACAGAG	ENST00000381344.3	-	2	480				RNU7-163P_ENST00000459467.1_RNA|IDI1_ENST00000491735.1_Intron|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000420381.1_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000536039.1_RNA	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1						cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)			large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		TACTGAAGACTGCACTTCCTTGAACAGAGTGCTCTTCTC	0.416																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.313+69CTCTGTTCAAGGAAGTGCA>-	10.37:g.1089851_1089869delTGCACTTCCTTGAACAGAG		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	RNA	DEL	-	NULL	ENST00000381344.3	37	NULL	CCDS7056.1	10																																																																																			IDI2-AS1	-	-	ENSG00000232656		0.416	IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI2-AS1	HGNC	protein_coding	OTTHUMT00000046409.2	111	0.00	0	TGCACTTCCTTGAACAGAG	NM_004508		1089851	1089869	+1	no_errors	ENST00000428780	ensembl	human	known	69_37n	rna	58	38.95	37	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.010:0.009:0.000:0.000:0.000	-
IDI1	3422	genome.wustl.edu	37	10	1089851	1089869	+	Intron	DEL	TGCACTTCCTTGAACAGAG	TGCACTTCCTTGAACAGAG	-	rs528259267		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	TGCACTTCCTTGAACAGAG	TGCACTTCCTTGAACAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:1089851_1089869delTGCACTTCCTTGAACAGAG	ENST00000381344.3	-	2	480				RNU7-163P_ENST00000459467.1_RNA|IDI1_ENST00000491735.1_Intron|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000420381.1_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000536039.1_RNA	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1						cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)			large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		TACTGAAGACTGCACTTCCTTGAACAGAGTGCTCTTCTC	0.416																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.313+69CTCTGTTCAAGGAAGTGCA>-	10.37:g.1089851_1089869delTGCACTTCCTTGAACAGAG		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	RNA	DEL	-	NULL	ENST00000381344.3	37	NULL	CCDS7056.1	10																																																																																			IDI2-AS1	-	-	ENSG00000232656		0.416	IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI2-AS1	HGNC	protein_coding	OTTHUMT00000046409.2	80	0.00	0	TGCACTTCCTTGAACAGAG	NM_004508		1089851	1089869	+1	no_errors	ENST00000428780	ensembl	human	known	69_37n	rna	58	38.95	37	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.010:0.009:0.000:0.000:0.000	-
IGHV2-26	28455	genome.wustl.edu	37	14	106757830	106757830	+	RNA	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:106757830A>G	ENST00000390611.2	-	0	200									immunoglobulin heavy variable 2-26																		CTGGGGGCTGACGGATCCAGC	0.552																																						dbGAP											0													62.0	59.0	60.0					14																	106757830		1973	4145	6118	-	-	-			0			M99648		14q32.33	2012-02-08			ENSG00000211951	ENSG00000211951		"""Immunoglobulins / IGH locus"""	5575	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152100		14.37:g.106757830A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R59	ENST00000390611.2	37	c.177		14																																																																																			IGHV2-26	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211951		0.552	IGHV2-26-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV2-26	HGNC	IG_V_gene	OTTHUMT00000325197.1	27	0.00	0	A	NG_001019		106757830	106757830	-1	no_stop_codon	ENST00000390611	ensembl	human	known	69_37n	silent	111	21.28	30	SNP	0.550	G
IGHV2-26	28455	genome.wustl.edu	37	14	106757830	106757830	+	RNA	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:106757830A>G	ENST00000390611.2	-	0	200									immunoglobulin heavy variable 2-26																		CTGGGGGCTGACGGATCCAGC	0.552																																						dbGAP											0													62.0	59.0	60.0					14																	106757830		1973	4145	6118	-	-	-			0			M99648		14q32.33	2012-02-08			ENSG00000211951	ENSG00000211951		"""Immunoglobulins / IGH locus"""	5575	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152100		14.37:g.106757830A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R59	ENST00000390611.2	37	c.177		14																																																																																			IGHV2-26	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211951		0.552	IGHV2-26-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV2-26	HGNC	IG_V_gene	OTTHUMT00000325197.1	47	0.00	0	A	NG_001019		106757830	106757830	-1	no_stop_codon	ENST00000390611	ensembl	human	known	69_37n	silent	111	21.28	30	SNP	0.550	G
ITIH1	3697	genome.wustl.edu	37	3	52820422	52820422	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:52820422C>G	ENST00000273283.2	+	13	1729	c.1705C>G	c.(1705-1707)Ctc>Gtc	p.L569V	ITIH1_ENST00000405128.3_5'Flank|ITIH1_ENST00000537050.1_Missense_Mutation_p.L281V|ITIH1_ENST00000542827.1_Missense_Mutation_p.L569V|ITIH1_ENST00000540715.1_Missense_Mutation_p.L427V	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	569	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L569V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CTGGGCCTACCTCACCATCCA	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											31.0	26.0	27.0					3																	52820422		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1705C>G	3.37:g.52820422C>G	ENSP00000273283:p.Leu569Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.L569V	ENST00000273283.2	37	c.1705	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160322	0.78226	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.81054	0.4743	M	0.84433	2.695	0.40584	D	0.981427	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79108	0.974;0.955;0.992	D	0.84793	0.0780	10	0.87932	D	0	-34.4049	16.163	0.81732	0.0:1.0:0.0:0.0	.	427;170;569	F5H165;Q9P1C5;P19827	.;.;ITIH1_HUMAN	V	569;569;427;281;122	ENSP00000442584:L569V;ENSP00000273283:L569V;ENSP00000443973:L427V;ENSP00000443847:L281V;ENSP00000395836:L122V	ENSP00000273283:L569V	L	+	1	0	ITIH1	52795462	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.300000	0.51834	2.582000	0.87167	0.462000	0.41574	CTC	ITIH1	-	NULL	ENSG00000055957		0.627	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	16	0.00	0	C	NM_002215		52820422	52820422	+1	no_errors	ENST00000273283	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	G
ITIH1	3697	genome.wustl.edu	37	3	52820422	52820422	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:52820422C>G	ENST00000273283.2	+	13	1729	c.1705C>G	c.(1705-1707)Ctc>Gtc	p.L569V	ITIH1_ENST00000405128.3_5'Flank|ITIH1_ENST00000537050.1_Missense_Mutation_p.L281V|ITIH1_ENST00000542827.1_Missense_Mutation_p.L569V|ITIH1_ENST00000540715.1_Missense_Mutation_p.L427V	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	569	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L569V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CTGGGCCTACCTCACCATCCA	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											31.0	26.0	27.0					3																	52820422		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1705C>G	3.37:g.52820422C>G	ENSP00000273283:p.Leu569Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.L569V	ENST00000273283.2	37	c.1705	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160322	0.78226	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.81054	0.4743	M	0.84433	2.695	0.40584	D	0.981427	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79108	0.974;0.955;0.992	D	0.84793	0.0780	10	0.87932	D	0	-34.4049	16.163	0.81732	0.0:1.0:0.0:0.0	.	427;170;569	F5H165;Q9P1C5;P19827	.;.;ITIH1_HUMAN	V	569;569;427;281;122	ENSP00000442584:L569V;ENSP00000273283:L569V;ENSP00000443973:L427V;ENSP00000443847:L281V;ENSP00000395836:L122V	ENSP00000273283:L569V	L	+	1	0	ITIH1	52795462	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.300000	0.51834	2.582000	0.87167	0.462000	0.41574	CTC	ITIH1	-	NULL	ENSG00000055957		0.627	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	23	0.00	0	C	NM_002215		52820422	52820422	+1	no_errors	ENST00000273283	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	G
KAT2A	2648	genome.wustl.edu	37	17	40266620	40266620	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:40266620G>A	ENST00000225916.5	-	14	2075	c.2022C>T	c.(2020-2022)atC>atT	p.I674I	DHX58_ENST00000251642.3_5'Flank	NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	674					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GCTTCTTGATGATCTGAGGGA	0.622																																						dbGAP											0													74.0	69.0	71.0					17																	40266620		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.2022C>T	17.37:g.40266620G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.H66Y	ENST00000225916.5	37	c.196	CCDS11417.1	17																																																																																			KAT2A	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000108773		0.622	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2A	HGNC	protein_coding	OTTHUMT00000257458.1	21	0.00	0	G	NM_021078		40266620	40266620	-1	no_start_codon	ENST00000588759	ensembl	human	known	69_37n	missense	110	24.14	35	SNP	0.998	A
KAT2A	2648	genome.wustl.edu	37	17	40266620	40266620	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:40266620G>A	ENST00000225916.5	-	14	2075	c.2022C>T	c.(2020-2022)atC>atT	p.I674I	DHX58_ENST00000251642.3_5'Flank	NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	674					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GCTTCTTGATGATCTGAGGGA	0.622																																						dbGAP											0													74.0	69.0	71.0					17																	40266620		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.2022C>T	17.37:g.40266620G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.H66Y	ENST00000225916.5	37	c.196	CCDS11417.1	17																																																																																			KAT2A	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000108773		0.622	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2A	HGNC	protein_coding	OTTHUMT00000257458.1	34	0.00	0	G	NM_021078		40266620	40266620	-1	no_start_codon	ENST00000588759	ensembl	human	known	69_37n	missense	110	24.14	35	SNP	0.998	A
KCNN3	3782	genome.wustl.edu	37	1	154842243	154842244	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:154842243_154842244AA>CT	ENST00000271915.4	-	1	512_513	c.197_198TT>AG	c.(196-198)cTT>cAG	p.L66Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggagg	0.703																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197_198delinsCT	1.37:g.154842243_154842244delinsCT	ENSP00000271915:p.Leu66Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent|Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.L66|p.L66H	ENST00000271915.4	37	c.198|c.197	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.703	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	9	0.00	0	A	NM_002249		154842243|154842244	154842243|154842244	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent|missense	62|63	22.22|21.43	18	SNP	0.000|0.166	C|T
KIAA0195	9772	genome.wustl.edu	37	17	73491664	73491664	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:73491664C>G	ENST00000314256.7	+	22	3278	c.2884C>G	c.(2884-2886)Ctg>Gtg	p.L962V	KIAA0195_ENST00000375248.5_Missense_Mutation_p.L972V|KIAA0195_ENST00000579208.1_Missense_Mutation_p.L613V|AC100787.1_ENST00000579379.1_RNA	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	962						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.L962V(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCGGCCCCACCTGCAGAACAT	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											155.0	154.0	154.0					17																	73491664		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.2884C>G	17.37:g.73491664C>G	ENSP00000313885:p.Leu962Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75536|Q86XF1	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.L962V	ENST00000314256.7	37	c.2884	CCDS32732.1	17	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978121	0.34942	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.60920	0.15;0.15	5.83	4.67	0.58626	.	0.000000	0.64402	D	0.000001	T	0.74114	0.3674	M	0.73372	2.23	0.58432	D	0.999999	D;D;D	0.71674	0.993;0.998;0.997	D;D;D	0.83275	0.987;0.996;0.991	T	0.73658	-0.3913	10	0.44086	T	0.13	-13.8633	15.8073	0.78524	0.0:0.9243:0.0:0.0757	.	972;972;962	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	V	962;972	ENSP00000313885:L962V;ENSP00000364397:L972V	ENSP00000313885:L962V	L	+	1	2	KIAA0195	71003259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.273000	0.33121	2.764000	0.94973	0.555000	0.69702	CTG	KIAA0195	-	NULL	ENSG00000177728		0.632	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	11	0.00	0	C	NM_014738		73491664	73491664	+1	no_errors	ENST00000314256	ensembl	human	known	69_37n	missense	43	35.82	24	SNP	1.000	G
KIAA0825	285600	genome.wustl.edu	37	5	93752964	93752964	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:93752964G>C	ENST00000513200.3	-	14	2676	c.2604C>G	c.(2602-2604)aaC>aaG	p.N868K	KIAA0825_ENST00000312498.7_Missense_Mutation_p.N873K|KIAA0825_ENST00000427991.2_Missense_Mutation_p.N868K	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	868								p.N873K(1)|p.N868K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TCACAAAAACGTTTGCAAATG	0.353																																						dbGAP											2	Substitution - Missense(2)	breast(2)											171.0	142.0	151.0					5																	93752964		692	1591	2283	-	-	-	SO:0001583	missense	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.2604C>G	5.37:g.93752964G>C	ENSP00000424618:p.Asn868Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94914|Q6ZNN2	Missense_Mutation	SNP	NULL	p.N868K	ENST00000513200.3	37	c.2604		5	.	.	.	.	.	.	.	.	.	.	G	1.642	-0.516275	0.04200	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498	T;T;T	0.41400	1.0;1.0;1.0	5.72	3.18	0.36537	.	0.591441	0.16462	N	0.213368	T	0.33527	0.0866	L	0.50333	1.59	0.24258	N	0.995297	P	0.42203	0.773	B	0.41440	0.357	T	0.10314	-1.0635	10	0.10377	T	0.69	.	8.1452	0.31108	0.7759:0.1442:0.0799:0.0	.	868	Q8IV33	K0825_HUMAN	K	868;868;873	ENSP00000424618:N868K;ENSP00000400288:N868K;ENSP00000312205:N873K	ENSP00000312205:N873K	N	-	3	2	KIAA0825	93778720	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.345000	0.33953	0.982000	0.38575	-0.416000	0.06073	AAC	KIAA0825	-	NULL	ENSG00000185261		0.353	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000254102.5	163	0.00	0	G	NM_173665		93752964	93752964	-1	no_errors	ENST00000427991	ensembl	human	known	69_37n	missense	48	39.24	31	SNP	1.000	C
KIAA0825	285600	genome.wustl.edu	37	5	93752964	93752964	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:93752964G>C	ENST00000513200.3	-	14	2676	c.2604C>G	c.(2602-2604)aaC>aaG	p.N868K	KIAA0825_ENST00000312498.7_Missense_Mutation_p.N873K|KIAA0825_ENST00000427991.2_Missense_Mutation_p.N868K	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	868								p.N873K(1)|p.N868K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TCACAAAAACGTTTGCAAATG	0.353																																						dbGAP											2	Substitution - Missense(2)	breast(2)											171.0	142.0	151.0					5																	93752964		692	1591	2283	-	-	-	SO:0001583	missense	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.2604C>G	5.37:g.93752964G>C	ENSP00000424618:p.Asn868Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94914|Q6ZNN2	Missense_Mutation	SNP	NULL	p.N868K	ENST00000513200.3	37	c.2604		5	.	.	.	.	.	.	.	.	.	.	G	1.642	-0.516275	0.04200	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498	T;T;T	0.41400	1.0;1.0;1.0	5.72	3.18	0.36537	.	0.591441	0.16462	N	0.213368	T	0.33527	0.0866	L	0.50333	1.59	0.24258	N	0.995297	P	0.42203	0.773	B	0.41440	0.357	T	0.10314	-1.0635	10	0.10377	T	0.69	.	8.1452	0.31108	0.7759:0.1442:0.0799:0.0	.	868	Q8IV33	K0825_HUMAN	K	868;868;873	ENSP00000424618:N868K;ENSP00000400288:N868K;ENSP00000312205:N873K	ENSP00000312205:N873K	N	-	3	2	KIAA0825	93778720	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.345000	0.33953	0.982000	0.38575	-0.416000	0.06073	AAC	KIAA0825	-	NULL	ENSG00000185261		0.353	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000254102.5	219	0.00	0	G	NM_173665		93752964	93752964	-1	no_errors	ENST00000427991	ensembl	human	known	69_37n	missense	48	39.24	31	SNP	1.000	C
KIAA1841	84542	genome.wustl.edu	37	2	61343192	61343192	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:61343192A>G	ENST00000402291.1	+	17	2064	c.1823A>G	c.(1822-1824)aAg>aGg	p.K608R	KIAA1841_ENST00000356719.2_Missense_Mutation_p.K608R|KIAA1841_ENST00000295031.5_Missense_Mutation_p.K608R|KIAA1841_ENST00000453873.1_Missense_Mutation_p.K608R	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	608								p.K608R(2)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			AGGAAAGAAAAGGCATTGGAG	0.358																																						dbGAP											2	Substitution - Missense(2)	breast(2)											117.0	128.0	124.0					2																	61343192		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1823A>G	2.37:g.61343192A>G	ENSP00000385579:p.Lys608Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	pfam_DUF3342,superfamily_BTB/POZ_fold,superfamily_Homeodomain-like	p.K608R	ENST00000402291.1	37	c.1823	CCDS46296.1	2	.	.	.	.	.	.	.	.	.	.	A	11.15	1.553238	0.27739	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.51	5.51	0.81932	.	0.046988	0.85682	D	0.000000	T	0.40815	0.1132	L	0.43152	1.355	0.44268	D	0.997121	B;B	0.24368	0.102;0.061	B;B	0.27380	0.079;0.039	T	0.33523	-0.9865	10	0.49607	T	0.09	-19.8755	10.0378	0.42139	0.9236:0.0:0.0764:0.0	.	608;608	Q6NSI8-2;Q6NSI8	.;K1841_HUMAN	R	608	ENSP00000385579:K608R;ENSP00000295031:K608R;ENSP00000349154:K608R;ENSP00000416795:K608R	ENSP00000295031:K608R	K	+	2	0	KIAA1841	61196696	1.000000	0.71417	0.954000	0.39281	0.548000	0.35241	4.770000	0.62309	2.211000	0.71520	0.460000	0.39030	AAG	KIAA1841	-	NULL	ENSG00000162929		0.358	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1841	HGNC	protein_coding	OTTHUMT00000325477.1	175	0.00	0	A	NM_032506		61343192	61343192	+1	no_errors	ENST00000356719	ensembl	human	known	69_37n	missense	226	16.61	45	SNP	0.971	G
KIAA1841	84542	genome.wustl.edu	37	2	61343192	61343192	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:61343192A>G	ENST00000402291.1	+	17	2064	c.1823A>G	c.(1822-1824)aAg>aGg	p.K608R	KIAA1841_ENST00000356719.2_Missense_Mutation_p.K608R|KIAA1841_ENST00000295031.5_Missense_Mutation_p.K608R|KIAA1841_ENST00000453873.1_Missense_Mutation_p.K608R	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	608								p.K608R(2)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			AGGAAAGAAAAGGCATTGGAG	0.358																																						dbGAP											2	Substitution - Missense(2)	breast(2)											117.0	128.0	124.0					2																	61343192		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1823A>G	2.37:g.61343192A>G	ENSP00000385579:p.Lys608Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	pfam_DUF3342,superfamily_BTB/POZ_fold,superfamily_Homeodomain-like	p.K608R	ENST00000402291.1	37	c.1823	CCDS46296.1	2	.	.	.	.	.	.	.	.	.	.	A	11.15	1.553238	0.27739	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.51	5.51	0.81932	.	0.046988	0.85682	D	0.000000	T	0.40815	0.1132	L	0.43152	1.355	0.44268	D	0.997121	B;B	0.24368	0.102;0.061	B;B	0.27380	0.079;0.039	T	0.33523	-0.9865	10	0.49607	T	0.09	-19.8755	10.0378	0.42139	0.9236:0.0:0.0764:0.0	.	608;608	Q6NSI8-2;Q6NSI8	.;K1841_HUMAN	R	608	ENSP00000385579:K608R;ENSP00000295031:K608R;ENSP00000349154:K608R;ENSP00000416795:K608R	ENSP00000295031:K608R	K	+	2	0	KIAA1841	61196696	1.000000	0.71417	0.954000	0.39281	0.548000	0.35241	4.770000	0.62309	2.211000	0.71520	0.460000	0.39030	AAG	KIAA1841	-	NULL	ENSG00000162929		0.358	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1841	HGNC	protein_coding	OTTHUMT00000325477.1	239	0.00	0	A	NM_032506		61343192	61343192	+1	no_errors	ENST00000356719	ensembl	human	known	69_37n	missense	226	16.61	45	SNP	0.971	G
KRT85	3891	genome.wustl.edu	37	12	52760852	52760852	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:52760852T>A	ENST00000257901.3	-	1	413	c.338A>T	c.(337-339)gAc>gTc	p.D113V	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	113	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.D113V(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCGTTGGGGTCGATCTCCAG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	136.0	138.0					12																	52760852		2203	4297	6500	-	-	-	SO:0001583	missense	0			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.338A>T	12.37:g.52760852T>A	ENSP00000257901:p.Asp113Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSB1	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.D113V	ENST00000257901.3	37	c.338	CCDS8824.1	12	.	.	.	.	.	.	.	.	.	.	T	22.0	4.225451	0.79576	.	.	ENSG00000135443	ENST00000257901	T	0.78707	-1.2	4.61	4.61	0.57282	.	0.000000	0.56097	D	0.000022	D	0.90868	0.7131	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93373	0.6737	10	0.87932	D	0	.	14.4646	0.67475	0.0:0.0:0.0:1.0	.	113	P78386	KRT85_HUMAN	V	113	ENSP00000257901:D113V	ENSP00000257901:D113V	D	-	2	0	KRT85	51047119	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.825000	0.86693	2.063000	0.61619	0.379000	0.24179	GAC	KRT85	-	NULL	ENSG00000135443		0.632	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	24	0.00	0	T	NM_002283		52760852	52760852	-1	no_errors	ENST00000257901	ensembl	human	known	69_37n	missense	130	29.73	55	SNP	1.000	A
KRT85	3891	genome.wustl.edu	37	12	52760852	52760852	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:52760852T>A	ENST00000257901.3	-	1	413	c.338A>T	c.(337-339)gAc>gTc	p.D113V	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	113	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.D113V(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCGTTGGGGTCGATCTCCAG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	136.0	138.0					12																	52760852		2203	4297	6500	-	-	-	SO:0001583	missense	0			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.338A>T	12.37:g.52760852T>A	ENSP00000257901:p.Asp113Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSB1	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.D113V	ENST00000257901.3	37	c.338	CCDS8824.1	12	.	.	.	.	.	.	.	.	.	.	T	22.0	4.225451	0.79576	.	.	ENSG00000135443	ENST00000257901	T	0.78707	-1.2	4.61	4.61	0.57282	.	0.000000	0.56097	D	0.000022	D	0.90868	0.7131	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93373	0.6737	10	0.87932	D	0	.	14.4646	0.67475	0.0:0.0:0.0:1.0	.	113	P78386	KRT85_HUMAN	V	113	ENSP00000257901:D113V	ENSP00000257901:D113V	D	-	2	0	KRT85	51047119	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.825000	0.86693	2.063000	0.61619	0.379000	0.24179	GAC	KRT85	-	NULL	ENSG00000135443		0.632	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	49	0.00	0	T	NM_002283		52760852	52760852	-1	no_errors	ENST00000257901	ensembl	human	known	69_37n	missense	130	29.73	55	SNP	1.000	A
KRT73	319101	genome.wustl.edu	37	12	53002195	53002195	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:53002195C>T	ENST00000305748.3	-	9	1442	c.1408G>A	c.(1408-1410)Gct>Act	p.A470T	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	470	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.A470T(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCAAAGCCAGCCCCTGTGCCT	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											42.0	39.0	40.0					12																	53002195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.1408G>A	12.37:g.53002195C>T	ENSP00000307014:p.Ala470Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MB2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.A470T	ENST00000305748.3	37	c.1408	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	C	9.364	1.068666	0.20147	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	T;D	0.82081	-1.49;-1.57	4.77	-9.08	0.00720	.	0.601458	0.13858	N	0.357879	T	0.64170	0.2574	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46693	-0.9173	10	0.18710	T	0.47	.	9.1427	0.36914	0.0:0.1326:0.2966:0.5709	.	470	Q86Y46	K2C73_HUMAN	T	470;215	ENSP00000307014:A470T;ENSP00000449081:A215T	ENSP00000307014:A470T	A	-	1	0	KRT73	51288462	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-1.958000	0.01519	-2.056000	0.00898	-0.175000	0.13238	GCT	KRT73	-	NULL	ENSG00000186049		0.617	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1	18	0.00	0	C	NM_175068		53002195	53002195	-1	no_errors	ENST00000305748	ensembl	human	known	69_37n	missense	46	37.84	28	SNP	0.000	T
KRT73	319101	genome.wustl.edu	37	12	53002195	53002195	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:53002195C>T	ENST00000305748.3	-	9	1442	c.1408G>A	c.(1408-1410)Gct>Act	p.A470T	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	470	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.A470T(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCAAAGCCAGCCCCTGTGCCT	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											42.0	39.0	40.0					12																	53002195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.1408G>A	12.37:g.53002195C>T	ENSP00000307014:p.Ala470Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MB2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.A470T	ENST00000305748.3	37	c.1408	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	C	9.364	1.068666	0.20147	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	T;D	0.82081	-1.49;-1.57	4.77	-9.08	0.00720	.	0.601458	0.13858	N	0.357879	T	0.64170	0.2574	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46693	-0.9173	10	0.18710	T	0.47	.	9.1427	0.36914	0.0:0.1326:0.2966:0.5709	.	470	Q86Y46	K2C73_HUMAN	T	470;215	ENSP00000307014:A470T;ENSP00000449081:A215T	ENSP00000307014:A470T	A	-	1	0	KRT73	51288462	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-1.958000	0.01519	-2.056000	0.00898	-0.175000	0.13238	GCT	KRT73	-	NULL	ENSG00000186049		0.617	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1	32	0.00	0	C	NM_175068		53002195	53002195	-1	no_errors	ENST00000305748	ensembl	human	known	69_37n	missense	46	37.84	28	SNP	0.000	T
KRTAP20-3	337985	genome.wustl.edu	37	21	32015243	32015243	+	Silent	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:32015243C>A	ENST00000382826.2	+	1	61	c.36C>A	c.(34-36)ggC>ggA	p.G12G		NM_001128077.1	NP_001121549.1	Q3LI60	KR203_HUMAN	keratin associated protein 20-3	12						intermediate filament (GO:0005882)		p.G12G(2)		breast(1)	1						GAGGACTGGGCTATGGCTATG	0.443																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											197.0	163.0	173.0					21																	32015243		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46642.1	21q22.11	2010-07-07	2008-02-26	2008-02-26	ENSG00000206104	ENSG00000206104		"""Keratin associated proteins"""	34001	protein-coding gene	gene with protein product			"""keratin associated protein 19 pseudogene 4"""	KRTAP19P4			Standard	NM_001128077		Approved	KAP20.3, KAP19D	uc010gls.1	Q3LI60	OTTHUMG00000057798	ENST00000382826.2:c.36C>A	21.37:g.32015243C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_KRTAP	p.G12	ENST00000382826.2	37	c.36	CCDS46642.1	21																																																																																			KRTAP20-3	-	pfam_KRTAP	ENSG00000206104		0.443	KRTAP20-3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KRTAP20-3	HGNC	protein_coding	OTTHUMT00000128250.2	109	0.00	0	C	NM_001128077		32015243	32015243	+1	no_errors	ENST00000382826	ensembl	human	novel	69_37n	silent	86	27.12	32	SNP	0.126	A
KRTAP20-3	337985	genome.wustl.edu	37	21	32015243	32015243	+	Silent	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:32015243C>A	ENST00000382826.2	+	1	61	c.36C>A	c.(34-36)ggC>ggA	p.G12G		NM_001128077.1	NP_001121549.1	Q3LI60	KR203_HUMAN	keratin associated protein 20-3	12						intermediate filament (GO:0005882)		p.G12G(2)		breast(1)	1						GAGGACTGGGCTATGGCTATG	0.443																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											197.0	163.0	173.0					21																	32015243		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46642.1	21q22.11	2010-07-07	2008-02-26	2008-02-26	ENSG00000206104	ENSG00000206104		"""Keratin associated proteins"""	34001	protein-coding gene	gene with protein product			"""keratin associated protein 19 pseudogene 4"""	KRTAP19P4			Standard	NM_001128077		Approved	KAP20.3, KAP19D	uc010gls.1	Q3LI60	OTTHUMG00000057798	ENST00000382826.2:c.36C>A	21.37:g.32015243C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_KRTAP	p.G12	ENST00000382826.2	37	c.36	CCDS46642.1	21																																																																																			KRTAP20-3	-	pfam_KRTAP	ENSG00000206104		0.443	KRTAP20-3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KRTAP20-3	HGNC	protein_coding	OTTHUMT00000128250.2	67	0.00	0	C	NM_001128077		32015243	32015243	+1	no_errors	ENST00000382826	ensembl	human	novel	69_37n	silent	86	27.12	32	SNP	0.126	A
LETM1	3954	genome.wustl.edu	37	4	1838173	1838173	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:1838173C>T	ENST00000302787.2	-	4	1017	c.721G>A	c.(721-723)Gag>Aag	p.E241K		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	241	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.E241K(1)		breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			GACTGAGTCTCAAATGTGGAT	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	133.0	140.0					4																	1838173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.721G>A	4.37:g.1838173C>T	ENSP00000305653:p.Glu241Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DED2|Q9UF65	Missense_Mutation	SNP	pfam_LETM1,pfscan_EF_HAND_2	p.E241K	ENST00000302787.2	37	c.721	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299748	0.81136	.	.	ENSG00000168924	ENST00000302787;ENST00000417150	T	0.45276	0.9	4.14	4.14	0.48551	LETM1-like (1);	0.000000	0.85682	D	0.000000	T	0.56124	0.1964	M	0.67625	2.065	0.80722	D	1	D;P;P	0.52996	0.957;0.907;0.674	P;P;B	0.55087	0.768;0.62;0.327	T	0.59984	-0.7351	10	0.45353	T	0.12	-40.4316	16.5961	0.84796	0.0:1.0:0.0:0.0	.	241;201;241	O95202-3;O95202-2;O95202	.;.;LETM1_HUMAN	K	241;201	ENSP00000305653:E241K	ENSP00000305653:E241K	E	-	1	0	LETM1	1807971	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.821000	0.69257	2.147000	0.66899	0.655000	0.94253	GAG	LETM1	-	pfam_LETM1	ENSG00000168924		0.493	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	25	0.00	0	C			1838173	1838173	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	missense	85	34.62	45	SNP	1.000	T
LETM1	3954	genome.wustl.edu	37	4	1838173	1838173	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:1838173C>T	ENST00000302787.2	-	4	1017	c.721G>A	c.(721-723)Gag>Aag	p.E241K		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	241	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.E241K(1)		breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			GACTGAGTCTCAAATGTGGAT	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	133.0	140.0					4																	1838173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.721G>A	4.37:g.1838173C>T	ENSP00000305653:p.Glu241Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DED2|Q9UF65	Missense_Mutation	SNP	pfam_LETM1,pfscan_EF_HAND_2	p.E241K	ENST00000302787.2	37	c.721	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299748	0.81136	.	.	ENSG00000168924	ENST00000302787;ENST00000417150	T	0.45276	0.9	4.14	4.14	0.48551	LETM1-like (1);	0.000000	0.85682	D	0.000000	T	0.56124	0.1964	M	0.67625	2.065	0.80722	D	1	D;P;P	0.52996	0.957;0.907;0.674	P;P;B	0.55087	0.768;0.62;0.327	T	0.59984	-0.7351	10	0.45353	T	0.12	-40.4316	16.5961	0.84796	0.0:1.0:0.0:0.0	.	241;201;241	O95202-3;O95202-2;O95202	.;.;LETM1_HUMAN	K	241;201	ENSP00000305653:E241K	ENSP00000305653:E241K	E	-	1	0	LETM1	1807971	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.821000	0.69257	2.147000	0.66899	0.655000	0.94253	GAG	LETM1	-	pfam_LETM1	ENSG00000168924		0.493	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	42	0.00	0	C			1838173	1838173	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	missense	85	34.62	45	SNP	1.000	T
LINC00152	112597	genome.wustl.edu	37	2	87820957	87820964	+	lincRNA	DEL	TCGGTTTC	TCGGTTTC	-	rs180714303|rs559048844	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	TCGGTTTC	TCGGTTTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:87820957_87820964delTCGGTTTC	ENST00000409054.1	+	0	278					NR_015395.1				long intergenic non-protein coding RNA 152																		GCTGGTCTGGTCGGTTTCCCATTTGTCT	0.466																																						dbGAP											0																																										-	-	-			0			BC009508		2p11.2	2014-02-14	2011-08-11	2011-08-11	ENSG00000222041	ENSG00000222041		"""Long non-coding RNAs"""	28717	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 59"", ""non-protein coding RNA 152"""	C2orf59, NCRNA00152		24523021, 23801869, 22689435, 24036268	Standard	NR_024204		Approved	MGC4677	uc002ssk.4		OTTHUMG00000130273		2.37:g.87820957_87820964delTCGGTTTC		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000409054.1	37	NULL		2																																																																																			LINC00152	-	-	ENSG00000222041		0.466	LINC00152-005	KNOWN	basic	lincRNA	LINC00152	HGNC	lincRNA	OTTHUMT00000330387.3	37	0.00	0	TCGGTTTC	XR_042051		87820957	87820964	+1	no_errors	ENST00000414584	ensembl	human	known	69_37n	rna	134	12.10	19	DEL	0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000	-
LINC00152	112597	genome.wustl.edu	37	2	87820957	87820964	+	lincRNA	DEL	TCGGTTTC	TCGGTTTC	-	rs180714303|rs559048844	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	TCGGTTTC	TCGGTTTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:87820957_87820964delTCGGTTTC	ENST00000409054.1	+	0	278					NR_015395.1				long intergenic non-protein coding RNA 152																		GCTGGTCTGGTCGGTTTCCCATTTGTCT	0.466																																						dbGAP											0																																										-	-	-			0			BC009508		2p11.2	2014-02-14	2011-08-11	2011-08-11	ENSG00000222041	ENSG00000222041		"""Long non-coding RNAs"""	28717	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 59"", ""non-protein coding RNA 152"""	C2orf59, NCRNA00152		24523021, 23801869, 22689435, 24036268	Standard	NR_024204		Approved	MGC4677	uc002ssk.4		OTTHUMG00000130273		2.37:g.87820957_87820964delTCGGTTTC		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000409054.1	37	NULL		2																																																																																			LINC00152	-	-	ENSG00000222041		0.466	LINC00152-005	KNOWN	basic	lincRNA	LINC00152	HGNC	lincRNA	OTTHUMT00000330387.3	59	0.00	0	TCGGTTTC	XR_042051		87820957	87820964	+1	no_errors	ENST00000414584	ensembl	human	known	69_37n	rna	134	12.10	19	DEL	0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000	-
LMOD1	25802	genome.wustl.edu	37	1	201869266	201869266	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:201869266T>C	ENST00000367288.4	-	2	1121	c.875A>G	c.(874-876)gAg>gGg	p.E292G	RP11-307B6.3_ENST00000458139.1_RNA|RP11-307B6.3_ENST00000414927.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	292	8 X approximate tandem repeats.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)		p.E292G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CGTCTGTTTCTCGGGTGTTTT	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	78.0	78.0					1																	201869266		2001	4173	6174	-	-	-	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.875A>G	1.37:g.201869266T>C	ENSP00000356257:p.Glu292Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.E292G	ENST00000367288.4	37	c.875	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.253993	0.22965	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.95137	-3.62	5.21	2.87	0.33458	.	0.178028	0.27004	N	0.021405	D	0.87269	0.6135	N	0.22421	0.69	0.09310	N	1	B;B	0.12013	0.005;0.005	B;B	0.11329	0.004;0.006	T	0.75590	-0.3265	10	0.30854	T	0.27	-25.0002	6.9266	0.24418	0.0:0.1908:0.0:0.8092	.	241;292	B4E3S9;P29536	.;LMOD1_HUMAN	G	292;292;241	ENSP00000356257:E292G	ENSP00000356257:E292G	E	-	2	0	LMOD1	200135889	0.000000	0.05858	0.008000	0.14137	0.009000	0.06853	0.349000	0.20055	0.829000	0.34733	0.491000	0.48974	GAG	LMOD1	-	NULL	ENSG00000163431		0.522	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2	113	0.00	0	T			201869266	201869266	-1	no_errors	ENST00000367288	ensembl	human	known	69_37n	missense	198	20.16	50	SNP	0.001	C
LMOD1	25802	genome.wustl.edu	37	1	201869266	201869266	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:201869266T>C	ENST00000367288.4	-	2	1121	c.875A>G	c.(874-876)gAg>gGg	p.E292G	RP11-307B6.3_ENST00000458139.1_RNA|RP11-307B6.3_ENST00000414927.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	292	8 X approximate tandem repeats.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)		p.E292G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CGTCTGTTTCTCGGGTGTTTT	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	78.0	78.0					1																	201869266		2001	4173	6174	-	-	-	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.875A>G	1.37:g.201869266T>C	ENSP00000356257:p.Glu292Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.E292G	ENST00000367288.4	37	c.875	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.253993	0.22965	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.95137	-3.62	5.21	2.87	0.33458	.	0.178028	0.27004	N	0.021405	D	0.87269	0.6135	N	0.22421	0.69	0.09310	N	1	B;B	0.12013	0.005;0.005	B;B	0.11329	0.004;0.006	T	0.75590	-0.3265	10	0.30854	T	0.27	-25.0002	6.9266	0.24418	0.0:0.1908:0.0:0.8092	.	241;292	B4E3S9;P29536	.;LMOD1_HUMAN	G	292;292;241	ENSP00000356257:E292G	ENSP00000356257:E292G	E	-	2	0	LMOD1	200135889	0.000000	0.05858	0.008000	0.14137	0.009000	0.06853	0.349000	0.20055	0.829000	0.34733	0.491000	0.48974	GAG	LMOD1	-	NULL	ENSG00000163431		0.522	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2	144	0.00	0	T			201869266	201869266	-1	no_errors	ENST00000367288	ensembl	human	known	69_37n	missense	198	20.16	50	SNP	0.001	C
LRRC70	100130733	genome.wustl.edu	37	5	61875866	61875866	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:61875866C>T	ENST00000334994.5	+	2	840	c.601C>T	c.(601-603)Caa>Taa	p.Q201*	LRRC70_ENST00000448151.2_Intron|IPO11_ENST00000409296.3_Intron|LRRC70_ENST00000491184.2_Intron|IPO11_ENST00000325324.6_Intron|IPO11_ENST00000409534.1_Intron	NM_181506.4	NP_852607.3	Q7Z2Q7	LRR70_HUMAN	leucine rich repeat containing 70	201						integral component of membrane (GO:0016021)		p.Q201*(1)		breast(1)|endometrium(1)	2						ATCAGGCTTTCAACATCTTGA	0.348																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											135.0	107.0	116.0					5																	61875866		692	1591	2283	-	-	-	SO:0001587	stop_gained	0				CCDS47218.1	5q12.1	2008-12-18			ENSG00000186105	ENSG00000186105			35155	protein-coding gene	gene with protein product	"""synleurin"""						Standard	NM_181506		Approved	SLRN, LOC100130733	uc011cqs.1	Q7Z2Q7	OTTHUMG00000154401	ENST00000334994.5:c.601C>T	5.37:g.61875866C>T	ENSP00000399441:p.Gln201*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZWI5	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Q201*	ENST00000334994.5	37	c.601	CCDS47218.1	5	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557873	0.86231	.	.	ENSG00000186105	ENST00000334994	.	.	.	4.68	2.88	0.33553	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1143	0.48252	0.0:0.7826:0.0:0.2174	.	.	.	.	X	201	.	.	Q	+	1	0	LRRC70	61911622	0.280000	0.24249	0.998000	0.56505	0.772000	0.43724	0.155000	0.16362	1.308000	0.44962	0.655000	0.94253	CAA	LRRC70	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000186105		0.348	LRRC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC70	HGNC	protein_coding	OTTHUMT00000335067.3	131	0.00	0	C	XR_042302		61875866	61875866	+1	no_errors	ENST00000334994	ensembl	human	known	69_37n	nonsense	27	48.08	25	SNP	0.994	T
LRRC70	100130733	genome.wustl.edu	37	5	61875866	61875866	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:61875866C>T	ENST00000334994.5	+	2	840	c.601C>T	c.(601-603)Caa>Taa	p.Q201*	LRRC70_ENST00000448151.2_Intron|IPO11_ENST00000409296.3_Intron|LRRC70_ENST00000491184.2_Intron|IPO11_ENST00000325324.6_Intron|IPO11_ENST00000409534.1_Intron	NM_181506.4	NP_852607.3	Q7Z2Q7	LRR70_HUMAN	leucine rich repeat containing 70	201						integral component of membrane (GO:0016021)		p.Q201*(1)		breast(1)|endometrium(1)	2						ATCAGGCTTTCAACATCTTGA	0.348																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											135.0	107.0	116.0					5																	61875866		692	1591	2283	-	-	-	SO:0001587	stop_gained	0				CCDS47218.1	5q12.1	2008-12-18			ENSG00000186105	ENSG00000186105			35155	protein-coding gene	gene with protein product	"""synleurin"""						Standard	NM_181506		Approved	SLRN, LOC100130733	uc011cqs.1	Q7Z2Q7	OTTHUMG00000154401	ENST00000334994.5:c.601C>T	5.37:g.61875866C>T	ENSP00000399441:p.Gln201*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZWI5	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Q201*	ENST00000334994.5	37	c.601	CCDS47218.1	5	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557873	0.86231	.	.	ENSG00000186105	ENST00000334994	.	.	.	4.68	2.88	0.33553	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1143	0.48252	0.0:0.7826:0.0:0.2174	.	.	.	.	X	201	.	.	Q	+	1	0	LRRC70	61911622	0.280000	0.24249	0.998000	0.56505	0.772000	0.43724	0.155000	0.16362	1.308000	0.44962	0.655000	0.94253	CAA	LRRC70	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000186105		0.348	LRRC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC70	HGNC	protein_coding	OTTHUMT00000335067.3	205	0.00	0	C	XR_042302		61875866	61875866	+1	no_errors	ENST00000334994	ensembl	human	known	69_37n	nonsense	27	48.08	25	SNP	0.994	T
MADD	8567	genome.wustl.edu	37	11	47296330	47296330	+	Silent	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:47296330C>A	ENST00000311027.5	+	3	444	c.279C>A	c.(277-279)atC>atA	p.I93I	MADD_ENST00000402799.1_Silent_p.I93I|MADD_ENST00000406482.1_Silent_p.I93I|MADD_ENST00000342922.4_Silent_p.I93I|MADD_ENST00000407859.3_Silent_p.I93I|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000349238.3_Silent_p.I93I|MADD_ENST00000402192.2_Silent_p.I93I|RP11-17G12.3_ENST00000543925.1_RNA|MADD_ENST00000395336.3_Silent_p.I93I|MADD_ENST00000395344.3_Silent_p.I93I	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.I93I(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GATATGGCATCTGTGTTAACT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											86.0	85.0	85.0					11																	47296330		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.279C>A	11.37:g.47296330C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.I93	ENST00000311027.5	37	c.279	CCDS7930.1	11																																																																																			MADD	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000110514		0.572	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	18	0.00	0	C			47296330	47296330	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	silent	47	24.19	15	SNP	1.000	A
MADD	8567	genome.wustl.edu	37	11	47296330	47296330	+	Silent	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:47296330C>A	ENST00000311027.5	+	3	444	c.279C>A	c.(277-279)atC>atA	p.I93I	MADD_ENST00000402799.1_Silent_p.I93I|MADD_ENST00000406482.1_Silent_p.I93I|MADD_ENST00000342922.4_Silent_p.I93I|MADD_ENST00000407859.3_Silent_p.I93I|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000349238.3_Silent_p.I93I|MADD_ENST00000402192.2_Silent_p.I93I|RP11-17G12.3_ENST00000543925.1_RNA|MADD_ENST00000395336.3_Silent_p.I93I|MADD_ENST00000395344.3_Silent_p.I93I	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.I93I(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GATATGGCATCTGTGTTAACT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											86.0	85.0	85.0					11																	47296330		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.279C>A	11.37:g.47296330C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.I93	ENST00000311027.5	37	c.279	CCDS7930.1	11																																																																																			MADD	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000110514		0.572	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	24	0.00	0	C			47296330	47296330	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	silent	47	24.19	15	SNP	1.000	A
MAP3K2	10746	genome.wustl.edu	37	2	128084359	128084359	+	Silent	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:128084359T>A	ENST00000409947.1	-	8	783	c.501A>T	c.(499-501)ccA>ccT	p.P167P	MAP3K2_ENST00000344908.5_Silent_p.P167P			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	167					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.P167P(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	GAATGTAACCTGGGGGAGGAG	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											80.0	81.0	81.0					2																	128084359		1825	4078	5903	-	-	-	SO:0001819	synonymous_variant	0			AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.501A>T	2.37:g.128084359T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P167	ENST00000409947.1	37	c.501	CCDS46404.1	2																																																																																			MAP3K2	-	NULL	ENSG00000169967		0.393	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K2	HGNC	protein_coding	OTTHUMT00000331014.1	135	0.00	0	T	NM_006609		128084359	128084359	-1	no_errors	ENST00000344908	ensembl	human	known	69_37n	silent	44	35.29	24	SNP	0.625	A
MAP3K2	10746	genome.wustl.edu	37	2	128084359	128084359	+	Silent	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:128084359T>A	ENST00000409947.1	-	8	783	c.501A>T	c.(499-501)ccA>ccT	p.P167P	MAP3K2_ENST00000344908.5_Silent_p.P167P			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	167					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.P167P(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	GAATGTAACCTGGGGGAGGAG	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											80.0	81.0	81.0					2																	128084359		1825	4078	5903	-	-	-	SO:0001819	synonymous_variant	0			AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.501A>T	2.37:g.128084359T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P167	ENST00000409947.1	37	c.501	CCDS46404.1	2																																																																																			MAP3K2	-	NULL	ENSG00000169967		0.393	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K2	HGNC	protein_coding	OTTHUMT00000331014.1	92	0.00	0	T	NM_006609		128084359	128084359	-1	no_errors	ENST00000344908	ensembl	human	known	69_37n	silent	44	35.29	24	SNP	0.625	A
MAPK6	5597	genome.wustl.edu	37	15	52356303	52356303	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr15:52356303T>C	ENST00000261845.5	+	6	2079	c.1272T>C	c.(1270-1272)tgT>tgC	p.C424C	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	424					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)	p.C424C(1)		breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CTGAGCCTTGTTGGCAATACT	0.373																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	55.0	56.0					15																	52356303		2195	4292	6487	-	-	-	SO:0001819	synonymous_variant	0			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1272T>C	15.37:g.52356303T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R945|B5BU65|Q68DH4|Q8IYN8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.C424	ENST00000261845.5	37	c.1272	CCDS10147.1	15																																																																																			MAPK6	-	NULL	ENSG00000069956		0.373	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	110	0.00	0	T	NM_002748		52356303	52356303	+1	no_errors	ENST00000261845	ensembl	human	known	69_37n	silent	26	55.17	32	SNP	0.998	C
MAPK6	5597	genome.wustl.edu	37	15	52356303	52356303	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr15:52356303T>C	ENST00000261845.5	+	6	2079	c.1272T>C	c.(1270-1272)tgT>tgC	p.C424C	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	424					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)	p.C424C(1)		breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CTGAGCCTTGTTGGCAATACT	0.373																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	55.0	56.0					15																	52356303		2195	4292	6487	-	-	-	SO:0001819	synonymous_variant	0			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1272T>C	15.37:g.52356303T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R945|B5BU65|Q68DH4|Q8IYN8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.C424	ENST00000261845.5	37	c.1272	CCDS10147.1	15																																																																																			MAPK6	-	NULL	ENSG00000069956		0.373	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	75	0.00	0	T	NM_002748		52356303	52356303	+1	no_errors	ENST00000261845	ensembl	human	known	69_37n	silent	26	55.17	32	SNP	0.998	C
METTL11B	149281	genome.wustl.edu	37	1	170129793	170129793	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:170129793G>T	ENST00000439373.2	+	2	396	c.289G>T	c.(289-291)Gac>Tac	p.D97Y	METTL11B_ENST00000367764.3_3'UTR	NM_001136107.1	NP_001129579.1	Q5VVY1	NTM1B_HUMAN	methyltransferase like 11B	97						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)	p.D97Y(1)		NS(1)|breast(2)|endometrium(3)|prostate(2)	8						GTCCAGCCCAGACATCCAGGC	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	70.0	73.0					1																	170129793		692	1591	2283	-	-	-	SO:0001583	missense	0			AL445203, CAH72139	CCDS44275.1	1q24.2	2012-11-05	2008-06-11	2008-06-11	ENSG00000203740	ENSG00000203740			31932	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 184"""	C1orf184			Standard	NM_001136107		Approved	HOMT1B	uc009wvv.1	Q5VVY1	OTTHUMG00000035959	ENST00000439373.2:c.289G>T	1.37:g.170129793G>T	ENSP00000408058:p.Asp97Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXI0	Missense_Mutation	SNP	pfam_DUF858_MeTrfase_lik,pfam_Methyltransf_11,pirsf_DUF858_MeTrfase_lik	p.D97Y	ENST00000439373.2	37	c.289	CCDS44275.1	1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252171	0.59212	.	.	ENSG00000203740	ENST00000439373	T	0.42513	0.97	4.6	3.66	0.41972	.	0.091051	0.85682	D	0.000000	T	0.65354	0.2683	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76493	-0.2939	10	0.87932	D	0	-3.7744	13.5385	0.61659	0.0:0.0:0.8428:0.1572	.	97	Q5VVY1	NTM1B_HUMAN	Y	97	ENSP00000408058:D97Y	ENSP00000408058:D97Y	D	+	1	0	METTL11B	168396417	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	5.991000	0.70602	1.087000	0.41251	0.643000	0.83706	GAC	METTL11B	-	pfam_DUF858_MeTrfase_lik,pirsf_DUF858_MeTrfase_lik	ENSG00000203740		0.448	METTL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL11B	HGNC	protein_coding	OTTHUMT00000087586.2	59	0.00	0	G	NM_001136107		170129793	170129793	+1	no_errors	ENST00000439373	ensembl	human	known	69_37n	missense	83	15.31	15	SNP	1.000	T
METTL11B	149281	genome.wustl.edu	37	1	170129793	170129793	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:170129793G>T	ENST00000439373.2	+	2	396	c.289G>T	c.(289-291)Gac>Tac	p.D97Y	METTL11B_ENST00000367764.3_3'UTR	NM_001136107.1	NP_001129579.1	Q5VVY1	NTM1B_HUMAN	methyltransferase like 11B	97						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)	p.D97Y(1)		NS(1)|breast(2)|endometrium(3)|prostate(2)	8						GTCCAGCCCAGACATCCAGGC	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	70.0	73.0					1																	170129793		692	1591	2283	-	-	-	SO:0001583	missense	0			AL445203, CAH72139	CCDS44275.1	1q24.2	2012-11-05	2008-06-11	2008-06-11	ENSG00000203740	ENSG00000203740			31932	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 184"""	C1orf184			Standard	NM_001136107		Approved	HOMT1B	uc009wvv.1	Q5VVY1	OTTHUMG00000035959	ENST00000439373.2:c.289G>T	1.37:g.170129793G>T	ENSP00000408058:p.Asp97Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXI0	Missense_Mutation	SNP	pfam_DUF858_MeTrfase_lik,pfam_Methyltransf_11,pirsf_DUF858_MeTrfase_lik	p.D97Y	ENST00000439373.2	37	c.289	CCDS44275.1	1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252171	0.59212	.	.	ENSG00000203740	ENST00000439373	T	0.42513	0.97	4.6	3.66	0.41972	.	0.091051	0.85682	D	0.000000	T	0.65354	0.2683	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76493	-0.2939	10	0.87932	D	0	-3.7744	13.5385	0.61659	0.0:0.0:0.8428:0.1572	.	97	Q5VVY1	NTM1B_HUMAN	Y	97	ENSP00000408058:D97Y	ENSP00000408058:D97Y	D	+	1	0	METTL11B	168396417	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	5.991000	0.70602	1.087000	0.41251	0.643000	0.83706	GAC	METTL11B	-	pfam_DUF858_MeTrfase_lik,pirsf_DUF858_MeTrfase_lik	ENSG00000203740		0.448	METTL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL11B	HGNC	protein_coding	OTTHUMT00000087586.2	93	0.00	0	G	NM_001136107		170129793	170129793	+1	no_errors	ENST00000439373	ensembl	human	known	69_37n	missense	83	15.31	15	SNP	1.000	T
MIS18BP1	55320	genome.wustl.edu	37	14	45693126	45693135	+	Frame_Shift_Del	DEL	AAGTTTCTGT	AAGTTTCTGT	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	AAGTTTCTGT	AAGTTTCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:45693126_45693135delAAGTTTCTGT	ENST00000310806.4	-	11	3113_3122	c.2655_2664delACAGAAACTT	c.(2653-2664)ttacagaaacttfs	p.LQKL885fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	885	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						CTTACCAATGAAGTTTCTGTAACTCCTTCT	0.367																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2655_2664delACAGAAACTT	14.37:g.45693126_45693135delAAGTTTCTGT	ENSP00000309790:p.Leu885fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Del	DEL	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L885fs	ENST00000310806.4	37	c.2664_2655	CCDS9684.1	14																																																																																			MIS18BP1	-	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000129534		0.367	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	142	0.00	0	AAGTTTCTGT			45693126	45693135	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	frame_shift_del	45	13.21	7	DEL	1.000:0.999:0.962:0.597:0.787:0.983:0.998:1.000:0.998:0.997	-
MIS18BP1	55320	genome.wustl.edu	37	14	45693126	45693135	+	Frame_Shift_Del	DEL	AAGTTTCTGT	AAGTTTCTGT	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	AAGTTTCTGT	AAGTTTCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:45693126_45693135delAAGTTTCTGT	ENST00000310806.4	-	11	3113_3122	c.2655_2664delACAGAAACTT	c.(2653-2664)ttacagaaacttfs	p.LQKL885fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	885	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						CTTACCAATGAAGTTTCTGTAACTCCTTCT	0.367																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2655_2664delACAGAAACTT	14.37:g.45693126_45693135delAAGTTTCTGT	ENSP00000309790:p.Leu885fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Del	DEL	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L885fs	ENST00000310806.4	37	c.2664_2655	CCDS9684.1	14																																																																																			MIS18BP1	-	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000129534		0.367	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	207	0.00	0	AAGTTTCTGT			45693126	45693135	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	frame_shift_del	45	13.21	7	DEL	1.000:0.999:0.962:0.597:0.787:0.983:0.998:1.000:0.998:0.997	-
MS4A15	219995	genome.wustl.edu	37	11	60540906	60540906	+	Silent	SNP	G	G	A	rs539829291		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:60540906G>A	ENST00000405633.3	+	5	526	c.447G>A	c.(445-447)gcG>gcA	p.A149A	MS4A15_ENST00000337911.4_Silent_p.A56A|MS4A15_ENST00000528170.1_Silent_p.A108A	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	149						integral component of membrane (GO:0016021)		p.A56A(1)|p.A149A(1)		breast(1)|large_intestine(2)|lung(3)	6						GCGTCATGGCGGCCTTTGCTG	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		22193	0.0		0.0	False		,,,				2504	0.001					dbGAP											2	Substitution - coding silent(2)	breast(2)											97.0	79.0	85.0					11																	60540906		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.447G>A	11.37:g.60540906G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9UJY6|A9UJY7|F2Z2J5	Silent	SNP	pfam_CD20-like	p.A149	ENST00000405633.3	37	c.447	CCDS44617.1	11																																																																																			MS4A15	-	pfam_CD20-like	ENSG00000166961		0.552	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MS4A15	HGNC	protein_coding	OTTHUMT00000395618.1	15	0.00	0	G			60540906	60540906	+1	no_errors	ENST00000405633	ensembl	human	known	69_37n	silent	114	23.49	35	SNP	0.717	A
MS4A15	219995	genome.wustl.edu	37	11	60540906	60540906	+	Silent	SNP	G	G	A	rs539829291		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:60540906G>A	ENST00000405633.3	+	5	526	c.447G>A	c.(445-447)gcG>gcA	p.A149A	MS4A15_ENST00000337911.4_Silent_p.A56A|MS4A15_ENST00000528170.1_Silent_p.A108A	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	149						integral component of membrane (GO:0016021)		p.A56A(1)|p.A149A(1)		breast(1)|large_intestine(2)|lung(3)	6						GCGTCATGGCGGCCTTTGCTG	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		22193	0.0		0.0	False		,,,				2504	0.001					dbGAP											2	Substitution - coding silent(2)	breast(2)											97.0	79.0	85.0					11																	60540906		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.447G>A	11.37:g.60540906G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9UJY6|A9UJY7|F2Z2J5	Silent	SNP	pfam_CD20-like	p.A149	ENST00000405633.3	37	c.447	CCDS44617.1	11																																																																																			MS4A15	-	pfam_CD20-like	ENSG00000166961		0.552	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MS4A15	HGNC	protein_coding	OTTHUMT00000395618.1	22	0.00	0	G			60540906	60540906	+1	no_errors	ENST00000405633	ensembl	human	known	69_37n	silent	114	23.49	35	SNP	0.717	A
MUC16	94025	genome.wustl.edu	37	19	9086543	9086543	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:9086543G>T	ENST00000397910.4	-	1	5475	c.5272C>A	c.(5272-5274)Cct>Act	p.P1758T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1758	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P1758T(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCACATCAGGAGTTGTAGGA	0.502																																						dbGAP											2	Substitution - Missense(2)	breast(2)											119.0	111.0	113.0					19																	9086543		1970	4153	6123	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5272C>A	19.37:g.9086543G>T	ENSP00000381008:p.Pro1758Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.P1758T	ENST00000397910.4	37	c.5272	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.362	-0.588471	0.03799	.	.	ENSG00000181143	ENST00000397910	T	0.03181	4.02	1.33	-1.31	0.09230	.	.	.	.	.	T	0.01454	0.0047	N	0.08118	0	.	.	.	P	0.44344	0.833	B	0.32022	0.139	T	0.45101	-0.9284	8	0.87932	D	0	.	2.6062	0.04878	0.227:0.3142:0.4588:0.0	.	1758	B5ME49	.	T	1758	ENSP00000381008:P1758T	ENSP00000381008:P1758T	P	-	1	0	MUC16	8947543	0.001000	0.12720	0.000000	0.03702	0.063000	0.16089	0.023000	0.13533	-0.310000	0.08766	0.313000	0.20887	CCT	MUC16	-	NULL	ENSG00000181143		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	107	0.00	0	G	NM_024690		9086543	9086543	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	175	34.70	93	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9086543	9086543	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:9086543G>T	ENST00000397910.4	-	1	5475	c.5272C>A	c.(5272-5274)Cct>Act	p.P1758T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1758	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P1758T(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCACATCAGGAGTTGTAGGA	0.502																																						dbGAP											2	Substitution - Missense(2)	breast(2)											119.0	111.0	113.0					19																	9086543		1970	4153	6123	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5272C>A	19.37:g.9086543G>T	ENSP00000381008:p.Pro1758Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.P1758T	ENST00000397910.4	37	c.5272	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.362	-0.588471	0.03799	.	.	ENSG00000181143	ENST00000397910	T	0.03181	4.02	1.33	-1.31	0.09230	.	.	.	.	.	T	0.01454	0.0047	N	0.08118	0	.	.	.	P	0.44344	0.833	B	0.32022	0.139	T	0.45101	-0.9284	8	0.87932	D	0	.	2.6062	0.04878	0.227:0.3142:0.4588:0.0	.	1758	B5ME49	.	T	1758	ENSP00000381008:P1758T	ENSP00000381008:P1758T	P	-	1	0	MUC16	8947543	0.001000	0.12720	0.000000	0.03702	0.063000	0.16089	0.023000	0.13533	-0.310000	0.08766	0.313000	0.20887	CCT	MUC16	-	NULL	ENSG00000181143		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	69	0.00	0	G	NM_024690		9086543	9086543	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	175	34.70	93	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195512196	195512196	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:195512196G>A	ENST00000463781.3	-	2	6714	c.6255C>T	c.(6253-6255)gaC>gaT	p.D2085D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.D2085D|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D2085D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TTGAGGAAGCGTCGGTGACAA	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)																																								-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6255C>T	3.37:g.195512196G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.D2085	ENST00000463781.3	37	c.6255	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	121	0.82	1	G	NM_018406		195512196	195512196	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	167	15.23	30	SNP	0.104	A
MUC4	4585	genome.wustl.edu	37	3	195512196	195512196	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:195512196G>A	ENST00000463781.3	-	2	6714	c.6255C>T	c.(6253-6255)gaC>gaT	p.D2085D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.D2085D|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D2085D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TTGAGGAAGCGTCGGTGACAA	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)																																								-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6255C>T	3.37:g.195512196G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.D2085	ENST00000463781.3	37	c.6255	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	76	0.00	0	G	NM_018406		195512196	195512196	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	167	15.23	30	SNP	0.104	A
MX1	4599	genome.wustl.edu	37	21	42824598	42824598	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:42824598G>A	ENST00000398600.2	+	18	2585	c.1560G>A	c.(1558-1560)ctG>ctA	p.L520L	MX1_ENST00000455164.2_Silent_p.L520L|MX1_ENST00000398598.3_Silent_p.L520L|MX1_ENST00000288383.6_Silent_p.L497L	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	520	Middle domain.|Stalk.				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L520L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GTGAGAAGCTGATCCGCCTCC	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											98.0	103.0	101.0					21																	42824598		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1560G>A	21.37:g.42824598G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.L520	ENST00000398600.2	37	c.1560	CCDS13673.1	21																																																																																			MX1	-	pfam_Dynamin_central	ENSG00000157601		0.433	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	HGNC	protein_coding	OTTHUMT00000195161.2	45	0.00	0	G			42824598	42824598	+1	no_errors	ENST00000398598	ensembl	human	known	69_37n	silent	75	20.21	19	SNP	0.000	A
MX1	4599	genome.wustl.edu	37	21	42824598	42824598	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:42824598G>A	ENST00000398600.2	+	18	2585	c.1560G>A	c.(1558-1560)ctG>ctA	p.L520L	MX1_ENST00000455164.2_Silent_p.L520L|MX1_ENST00000398598.3_Silent_p.L520L|MX1_ENST00000288383.6_Silent_p.L497L	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	520	Middle domain.|Stalk.				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L520L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GTGAGAAGCTGATCCGCCTCC	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											98.0	103.0	101.0					21																	42824598		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1560G>A	21.37:g.42824598G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.L520	ENST00000398600.2	37	c.1560	CCDS13673.1	21																																																																																			MX1	-	pfam_Dynamin_central	ENSG00000157601		0.433	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	HGNC	protein_coding	OTTHUMT00000195161.2	65	0.00	0	G			42824598	42824598	+1	no_errors	ENST00000398598	ensembl	human	known	69_37n	silent	75	20.21	19	SNP	0.000	A
MYH11	4629	genome.wustl.edu	37	16	15833955	15833955	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:15833955C>G	ENST00000300036.5	-	23	3059	c.2950G>C	c.(2950-2952)Gag>Cag	p.E984Q	AF001548.6_ENST00000577048.1_RNA|MYH11_ENST00000576790.2_Missense_Mutation_p.E984Q|MYH11_ENST00000396324.3_Missense_Mutation_p.E991Q|MYH11_ENST00000452625.2_Missense_Mutation_p.E991Q	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	984					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.E991Q(1)|p.E984Q(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						ATCTCATCCTCCAGTTTCTTG	0.512			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	2	Substitution - Missense(2)	breast(2)											159.0	140.0	146.0					16																	15833955		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2950G>C	16.37:g.15833955C>G	ENSP00000300036:p.Glu984Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E991Q	ENST00000300036.5	37	c.2971	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350433	0.82132	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	4.28	4.28	0.50868	.	0.124501	0.53938	D	0.000057	T	0.79482	0.4453	L	0.39245	1.2	0.80722	D	1	P;P;P;P;P	0.47677	0.899;0.899;0.899;0.753;0.899	P;P;P;P;P	0.53401	0.725;0.725;0.725;0.725;0.53	T	0.82510	-0.0421	10	0.72032	D	0.01	.	15.7506	0.77983	0.0:1.0:0.0:0.0	.	991;984;991;984;991	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	Q	984;984;991;991;991	ENSP00000300036:E984Q;ENSP00000345136:E984Q;ENSP00000379616:E991Q;ENSP00000407821:E991Q	ENSP00000300036:E984Q	E	-	1	0	MYH11	15741456	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.672000	0.83956	1.952000	0.56665	0.486000	0.48141	GAG	MYH11	-	superfamily_Prefoldin	ENSG00000133392		0.512	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	50	0.00	0	C	NM_001040113		15833955	15833955	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	95	29.93	41	SNP	1.000	G
MYH11	4629	genome.wustl.edu	37	16	15833955	15833955	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:15833955C>G	ENST00000300036.5	-	23	3059	c.2950G>C	c.(2950-2952)Gag>Cag	p.E984Q	AF001548.6_ENST00000577048.1_RNA|MYH11_ENST00000576790.2_Missense_Mutation_p.E984Q|MYH11_ENST00000396324.3_Missense_Mutation_p.E991Q|MYH11_ENST00000452625.2_Missense_Mutation_p.E991Q	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	984					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.E991Q(1)|p.E984Q(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						ATCTCATCCTCCAGTTTCTTG	0.512			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	2	Substitution - Missense(2)	breast(2)											159.0	140.0	146.0					16																	15833955		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2950G>C	16.37:g.15833955C>G	ENSP00000300036:p.Glu984Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E991Q	ENST00000300036.5	37	c.2971	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350433	0.82132	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	4.28	4.28	0.50868	.	0.124501	0.53938	D	0.000057	T	0.79482	0.4453	L	0.39245	1.2	0.80722	D	1	P;P;P;P;P	0.47677	0.899;0.899;0.899;0.753;0.899	P;P;P;P;P	0.53401	0.725;0.725;0.725;0.725;0.53	T	0.82510	-0.0421	10	0.72032	D	0.01	.	15.7506	0.77983	0.0:1.0:0.0:0.0	.	991;984;991;984;991	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	Q	984;984;991;991;991	ENSP00000300036:E984Q;ENSP00000345136:E984Q;ENSP00000379616:E991Q;ENSP00000407821:E991Q	ENSP00000300036:E984Q	E	-	1	0	MYH11	15741456	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.672000	0.83956	1.952000	0.56665	0.486000	0.48141	GAG	MYH11	-	superfamily_Prefoldin	ENSG00000133392		0.512	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	71	0.00	0	C	NM_001040113		15833955	15833955	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	95	29.93	41	SNP	1.000	G
MYH11	4629	genome.wustl.edu	37	16	15850316	15850316	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:15850316G>T	ENST00000300036.5	-	14	1740	c.1631C>A	c.(1630-1632)gCc>gAc	p.A544D	MYH11_ENST00000576790.2_Missense_Mutation_p.A544D|MYH11_ENST00000396324.3_Missense_Mutation_p.A551D|MYH11_ENST00000452625.2_Missense_Mutation_p.A551D	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	544	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.A551D(1)|p.A544D(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTTGTCCGTGGCTTTGGGGAA	0.567			T	CBFB	AML						OREG0023636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	2	Substitution - Missense(2)	breast(2)											110.0	88.0	95.0					16																	15850316		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1631C>A	16.37:g.15850316G>T	ENSP00000300036:p.Ala544Asp	Somatic	705	WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A551D	ENST00000300036.5	37	c.1652	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.293823	0.95546	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57	5.37	5.37	0.77165	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.97216	0.9090	H	0.99211	4.47	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.99041	1.0824	10	0.87932	D	0	.	18.0824	0.89445	0.0:0.0:1.0:0.0	.	551;544;544;551;544;551	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	D	544;544;551;551;551	ENSP00000300036:A544D;ENSP00000345136:A544D;ENSP00000379616:A551D;ENSP00000407821:A551D	ENSP00000300036:A544D	A	-	2	0	MYH11	15757817	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.518000	0.84900	0.555000	0.69702	GCC	MYH11	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133392		0.567	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	26	0.00	0	G	NM_001040113		15850316	15850316	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	91	32.09	43	SNP	1.000	T
MYH11	4629	genome.wustl.edu	37	16	15850316	15850316	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:15850316G>T	ENST00000300036.5	-	14	1740	c.1631C>A	c.(1630-1632)gCc>gAc	p.A544D	MYH11_ENST00000576790.2_Missense_Mutation_p.A544D|MYH11_ENST00000396324.3_Missense_Mutation_p.A551D|MYH11_ENST00000452625.2_Missense_Mutation_p.A551D	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	544	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.A551D(1)|p.A544D(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTTGTCCGTGGCTTTGGGGAA	0.567			T	CBFB	AML						OREG0023636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	2	Substitution - Missense(2)	breast(2)											110.0	88.0	95.0					16																	15850316		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1631C>A	16.37:g.15850316G>T	ENSP00000300036:p.Ala544Asp	Somatic	705	WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A551D	ENST00000300036.5	37	c.1652	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.293823	0.95546	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57	5.37	5.37	0.77165	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.97216	0.9090	H	0.99211	4.47	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.99041	1.0824	10	0.87932	D	0	.	18.0824	0.89445	0.0:0.0:1.0:0.0	.	551;544;544;551;544;551	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	D	544;544;551;551;551	ENSP00000300036:A544D;ENSP00000345136:A544D;ENSP00000379616:A551D;ENSP00000407821:A551D	ENSP00000300036:A544D	A	-	2	0	MYH11	15757817	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.518000	0.84900	0.555000	0.69702	GCC	MYH11	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133392		0.567	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	36	0.00	0	G	NM_001040113		15850316	15850316	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	91	32.09	43	SNP	1.000	T
NBAS	51594	genome.wustl.edu	37	2	15378705	15378705	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:15378705C>T	ENST00000281513.5	-	45	5855	c.5830G>A	c.(5830-5832)Gct>Act	p.A1944T	NBAS_ENST00000441750.1_Missense_Mutation_p.A1824T	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1944					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.A1944T(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GAATCCTTAGCTTCTTGAGCT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	126.0	126.0					2																	15378705		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5830G>A	2.37:g.15378705C>T	ENSP00000281513:p.Ala1944Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.A1944T	ENST00000281513.5	37	c.5830	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	C	4.222	0.040114	0.08148	.	.	ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000417461	T;T;T	0.46819	2.88;3.06;0.86	5.97	-0.297	0.12820	.	1.215600	0.05346	N	0.530982	T	0.36110	0.0955	L	0.46157	1.445	0.09310	N	1	P;B	0.39352	0.669;0.0	B;B	0.30943	0.122;0.002	T	0.34403	-0.9830	10	0.87932	D	0	.	5.8284	0.18566	0.0:0.4762:0.2254:0.2984	.	1824;1944	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	T	1824;1944;36	ENSP00000413201:A1824T;ENSP00000281513:A1944T;ENSP00000392421:A36T	ENSP00000281513:A1944T	A	-	1	0	NBAS	15296156	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.117000	0.15583	-0.070000	0.12908	0.655000	0.94253	GCT	NBAS	-	NULL	ENSG00000151779		0.413	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	334	0.00	0	C	NM_015909		15378705	15378705	-1	no_errors	ENST00000281513	ensembl	human	known	69_37n	missense	137	33.50	69	SNP	0.000	T
NBAS	51594	genome.wustl.edu	37	2	15378705	15378705	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:15378705C>T	ENST00000281513.5	-	45	5855	c.5830G>A	c.(5830-5832)Gct>Act	p.A1944T	NBAS_ENST00000441750.1_Missense_Mutation_p.A1824T	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1944					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.A1944T(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GAATCCTTAGCTTCTTGAGCT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	126.0	126.0					2																	15378705		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5830G>A	2.37:g.15378705C>T	ENSP00000281513:p.Ala1944Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.A1944T	ENST00000281513.5	37	c.5830	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	C	4.222	0.040114	0.08148	.	.	ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000417461	T;T;T	0.46819	2.88;3.06;0.86	5.97	-0.297	0.12820	.	1.215600	0.05346	N	0.530982	T	0.36110	0.0955	L	0.46157	1.445	0.09310	N	1	P;B	0.39352	0.669;0.0	B;B	0.30943	0.122;0.002	T	0.34403	-0.9830	10	0.87932	D	0	.	5.8284	0.18566	0.0:0.4762:0.2254:0.2984	.	1824;1944	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	T	1824;1944;36	ENSP00000413201:A1824T;ENSP00000281513:A1944T;ENSP00000392421:A36T	ENSP00000281513:A1944T	A	-	1	0	NBAS	15296156	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.117000	0.15583	-0.070000	0.12908	0.655000	0.94253	GCT	NBAS	-	NULL	ENSG00000151779		0.413	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	445	0.00	0	C	NM_015909		15378705	15378705	-1	no_errors	ENST00000281513	ensembl	human	known	69_37n	missense	137	33.50	69	SNP	0.000	T
NPAT	4863	genome.wustl.edu	37	11	108040720	108040720	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:108040720C>T	ENST00000278612.8	-	14	2941	c.2836G>A	c.(2836-2838)Gta>Ata	p.V946I	NPAT_ENST00000610253.1_5'Flank	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	946					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.V946I(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ATCATCCCTACCATTCCTTGG	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	110.0	113.0					11																	108040720		1880	4103	5983	-	-	-	SO:0001583	missense	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.2836G>A	11.37:g.108040720C>T	ENSP00000278612:p.Val946Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.V946I	ENST00000278612.8	37	c.2836	CCDS41710.1	11	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742059	0.89573	.	.	ENSG00000149308	ENST00000278612	T	0.10573	2.86	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000011	T	0.34135	0.0887	M	0.71581	2.175	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.01405	-1.1363	10	0.62326	D	0.03	-10.5763	17.93	0.88993	0.0:1.0:0.0:0.0	.	946	Q14207	NPAT_HUMAN	I	946	ENSP00000278612:V946I	ENSP00000278612:V946I	V	-	1	0	NPAT	107545930	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.866000	0.69590	2.735000	0.93741	0.557000	0.71058	GTA	NPAT	-	NULL	ENSG00000149308		0.398	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2	140	0.00	0	C	NM_002519		108040720	108040720	-1	no_errors	ENST00000278612	ensembl	human	known	69_37n	missense	49	33.78	25	SNP	1.000	T
NPAT	4863	genome.wustl.edu	37	11	108040720	108040720	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:108040720C>T	ENST00000278612.8	-	14	2941	c.2836G>A	c.(2836-2838)Gta>Ata	p.V946I	NPAT_ENST00000610253.1_5'Flank	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	946					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.V946I(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ATCATCCCTACCATTCCTTGG	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	110.0	113.0					11																	108040720		1880	4103	5983	-	-	-	SO:0001583	missense	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.2836G>A	11.37:g.108040720C>T	ENSP00000278612:p.Val946Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.V946I	ENST00000278612.8	37	c.2836	CCDS41710.1	11	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742059	0.89573	.	.	ENSG00000149308	ENST00000278612	T	0.10573	2.86	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000011	T	0.34135	0.0887	M	0.71581	2.175	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.01405	-1.1363	10	0.62326	D	0.03	-10.5763	17.93	0.88993	0.0:1.0:0.0:0.0	.	946	Q14207	NPAT_HUMAN	I	946	ENSP00000278612:V946I	ENSP00000278612:V946I	V	-	1	0	NPAT	107545930	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.866000	0.69590	2.735000	0.93741	0.557000	0.71058	GTA	NPAT	-	NULL	ENSG00000149308		0.398	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2	96	0.00	0	C	NM_002519		108040720	108040720	-1	no_errors	ENST00000278612	ensembl	human	known	69_37n	missense	49	33.78	25	SNP	1.000	T
NTNG1	22854	genome.wustl.edu	37	1	107963749	107963749	+	Intron	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:107963749T>C	ENST00000370068.1	+	6	1933				NTNG1_ENST00000370067.1_Intron|NTNG1_ENST00000370070.2_Intron|NTNG1_ENST00000370073.2_Intron|NTNG1_ENST00000542803.1_Intron|NTNG1_ENST00000370071.2_Silent_p.V399V|NTNG1_ENST00000370065.1_Intron|NTNG1_ENST00000370072.3_Intron|NTNG1_ENST00000370061.3_Intron|NTNG1_ENST00000370074.4_Intron|NTNG1_ENST00000370066.1_Silent_p.V399V			Q9Y2I2	NTNG1_HUMAN	netrin G1						axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.V399V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CTGTTCAAGTTGCAAACCACA	0.353																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											114.0	101.0	105.0					1																	107963749		1568	3581	5149	-	-	-	SO:0001627	intron_variant	0			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1088-9623T>C	1.37:g.107963749T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_N	p.V399	ENST00000370068.1	37	c.1197	CCDS44180.1	1																																																																																			NTNG1	-	NULL	ENSG00000162631		0.353	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTNG1	HGNC	protein_coding	OTTHUMT00000030340.1	241	0.00	0	T	NM_014917		107963749	107963749	+1	no_errors	ENST00000370066	ensembl	human	known	69_37n	silent	83	25.89	29	SNP	1.000	C
NTNG1	22854	genome.wustl.edu	37	1	107963749	107963749	+	Intron	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:107963749T>C	ENST00000370068.1	+	6	1933				NTNG1_ENST00000370067.1_Intron|NTNG1_ENST00000370070.2_Intron|NTNG1_ENST00000370073.2_Intron|NTNG1_ENST00000542803.1_Intron|NTNG1_ENST00000370071.2_Silent_p.V399V|NTNG1_ENST00000370065.1_Intron|NTNG1_ENST00000370072.3_Intron|NTNG1_ENST00000370061.3_Intron|NTNG1_ENST00000370074.4_Intron|NTNG1_ENST00000370066.1_Silent_p.V399V			Q9Y2I2	NTNG1_HUMAN	netrin G1						axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.V399V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CTGTTCAAGTTGCAAACCACA	0.353																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											114.0	101.0	105.0					1																	107963749		1568	3581	5149	-	-	-	SO:0001627	intron_variant	0			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1088-9623T>C	1.37:g.107963749T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_N	p.V399	ENST00000370068.1	37	c.1197	CCDS44180.1	1																																																																																			NTNG1	-	NULL	ENSG00000162631		0.353	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTNG1	HGNC	protein_coding	OTTHUMT00000030340.1	314	0.00	0	T	NM_014917		107963749	107963749	+1	no_errors	ENST00000370066	ensembl	human	known	69_37n	silent	83	25.89	29	SNP	1.000	C
NUDT21	11051	genome.wustl.edu	37	16	56481707	56481707	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:56481707A>C	ENST00000300291.5	-	2	483	c.311T>G	c.(310-312)tTc>tGc	p.F104C		NM_007006.2	NP_008937.1	O43809	CPSF5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 21	104	Interaction with RNA.|Necessary for RNA-binding.|Necessary for interactions with PAPOLA and PABPN1.|Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	AU-rich element binding (GO:0017091)|histone deacetylase binding (GO:0042826)|hydrolase activity (GO:0016787)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.F104C(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)	7						TTACAGTTTGAAGAAAGTTGT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	84.0	89.0					16																	56481707		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ001810	CCDS10760.1	16q12.2	2013-06-18	2005-07-11	2005-07-11	ENSG00000167005	ENSG00000167005		"""Nudix motif containing"""	13870	protein-coding gene	gene with protein product	"""cleavage factor Im complex 25 kDa subunit"""	604978	"""cleavage and polyadenylation specific factor 5, 25 kDa"", ""cleavage and polyadenylation specific factor 5, 25 kD subunit"""	CPSF5		9659921	Standard	NM_007006		Approved	CFIM25	uc002eja.3	O43809	OTTHUMG00000133240	ENST00000300291.5:c.311T>G	16.37:g.56481707A>C	ENSP00000300291:p.Phe104Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IB85|Q6NE84	Missense_Mutation	SNP	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5	p.F104C	ENST00000300291.5	37	c.311	CCDS10760.1	16	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323021	0.81580	.	.	ENSG00000167005	ENST00000300291	T	0.14766	2.48	5.91	5.91	0.95273	NUDIX hydrolase domain (2);	0.000000	0.85682	D	0.000000	T	0.42404	0.1201	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.36529	-0.9744	10	0.52906	T	0.07	-5.9579	16.3436	0.83110	1.0:0.0:0.0:0.0	.	104	O43809	CPSF5_HUMAN	C	104	ENSP00000300291:F104C	ENSP00000300291:F104C	F	-	2	0	NUDT21	55039208	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.269000	0.75478	0.533000	0.62120	TTC	NUDT21	-	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5	ENSG00000167005		0.413	NUDT21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT21	HGNC	protein_coding	OTTHUMT00000256980.3	44	0.00	0	A	NM_007006		56481707	56481707	-1	no_errors	ENST00000300291	ensembl	human	known	69_37n	missense	73	34.82	39	SNP	1.000	C
NUDT21	11051	genome.wustl.edu	37	16	56481707	56481707	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:56481707A>C	ENST00000300291.5	-	2	483	c.311T>G	c.(310-312)tTc>tGc	p.F104C		NM_007006.2	NP_008937.1	O43809	CPSF5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 21	104	Interaction with RNA.|Necessary for RNA-binding.|Necessary for interactions with PAPOLA and PABPN1.|Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	AU-rich element binding (GO:0017091)|histone deacetylase binding (GO:0042826)|hydrolase activity (GO:0016787)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.F104C(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)	7						TTACAGTTTGAAGAAAGTTGT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	84.0	89.0					16																	56481707		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ001810	CCDS10760.1	16q12.2	2013-06-18	2005-07-11	2005-07-11	ENSG00000167005	ENSG00000167005		"""Nudix motif containing"""	13870	protein-coding gene	gene with protein product	"""cleavage factor Im complex 25 kDa subunit"""	604978	"""cleavage and polyadenylation specific factor 5, 25 kDa"", ""cleavage and polyadenylation specific factor 5, 25 kD subunit"""	CPSF5		9659921	Standard	NM_007006		Approved	CFIM25	uc002eja.3	O43809	OTTHUMG00000133240	ENST00000300291.5:c.311T>G	16.37:g.56481707A>C	ENSP00000300291:p.Phe104Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IB85|Q6NE84	Missense_Mutation	SNP	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5	p.F104C	ENST00000300291.5	37	c.311	CCDS10760.1	16	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323021	0.81580	.	.	ENSG00000167005	ENST00000300291	T	0.14766	2.48	5.91	5.91	0.95273	NUDIX hydrolase domain (2);	0.000000	0.85682	D	0.000000	T	0.42404	0.1201	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.36529	-0.9744	10	0.52906	T	0.07	-5.9579	16.3436	0.83110	1.0:0.0:0.0:0.0	.	104	O43809	CPSF5_HUMAN	C	104	ENSP00000300291:F104C	ENSP00000300291:F104C	F	-	2	0	NUDT21	55039208	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.269000	0.75478	0.533000	0.62120	TTC	NUDT21	-	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5	ENSG00000167005		0.413	NUDT21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT21	HGNC	protein_coding	OTTHUMT00000256980.3	59	0.00	0	A	NM_007006		56481707	56481707	-1	no_errors	ENST00000300291	ensembl	human	known	69_37n	missense	73	34.82	39	SNP	1.000	C
NUP98	4928	genome.wustl.edu	37	11	3752719	3752725	+	Frame_Shift_Del	DEL	CCGGACT	CCGGACT	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CCGGACT	CCGGACT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:3752719_3752725delCCGGACT	ENST00000324932.7	-	14	2046_2052	c.1626_1632delAGTCCGG	c.(1624-1632)agagtccggfs	p.RVR542fs	NUP98_ENST00000397007.4_Frame_Shift_Del_p.RVR559fs|NUP98_ENST00000397004.4_Frame_Shift_Del_p.RVR542fs|NUP98_ENST00000355260.3_Frame_Shift_Del_p.RVR542fs|NUP98_ENST00000359171.4_Frame_Shift_Del_p.RVR542fs	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	559					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.R542fs*26(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AAGCCTTTGGCCGGACTCTAGTGGCAG	0.478			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																	dbGAP		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.1626_1632delAGTCCGG	11.37:g.3752719_3752725delCCGGACT	ENSP00000316032:p.Arg542fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Frame_Shift_Del	DEL	pfam_Nup96,pfam_Peptidase_S59,superfamily_Peptidase_S59	p.R542fs	ENST00000324932.7	37	c.1632_1626	CCDS7746.1	11																																																																																			NUP98	-	NULL	ENSG00000110713		0.478	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	HGNC	protein_coding	OTTHUMT00000032766.3	144	0.00	0	CCGGACT	NM_016320		3752719	3752725	-1	no_errors	ENST00000324932	ensembl	human	known	69_37n	frame_shift_del	143	20.11	36	DEL	0.695:0.999:0.998:0.666:1.000:1.000:1.000	-
NUP98	4928	genome.wustl.edu	37	11	3752719	3752725	+	Frame_Shift_Del	DEL	CCGGACT	CCGGACT	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CCGGACT	CCGGACT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:3752719_3752725delCCGGACT	ENST00000324932.7	-	14	2046_2052	c.1626_1632delAGTCCGG	c.(1624-1632)agagtccggfs	p.RVR542fs	NUP98_ENST00000397007.4_Frame_Shift_Del_p.RVR559fs|NUP98_ENST00000397004.4_Frame_Shift_Del_p.RVR542fs|NUP98_ENST00000355260.3_Frame_Shift_Del_p.RVR542fs|NUP98_ENST00000359171.4_Frame_Shift_Del_p.RVR542fs	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	559					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.R542fs*26(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AAGCCTTTGGCCGGACTCTAGTGGCAG	0.478			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																	dbGAP		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.1626_1632delAGTCCGG	11.37:g.3752719_3752725delCCGGACT	ENSP00000316032:p.Arg542fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Frame_Shift_Del	DEL	pfam_Nup96,pfam_Peptidase_S59,superfamily_Peptidase_S59	p.R542fs	ENST00000324932.7	37	c.1632_1626	CCDS7746.1	11																																																																																			NUP98	-	NULL	ENSG00000110713		0.478	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	HGNC	protein_coding	OTTHUMT00000032766.3	89	0.00	0	CCGGACT	NM_016320		3752719	3752725	-1	no_errors	ENST00000324932	ensembl	human	known	69_37n	frame_shift_del	143	20.11	36	DEL	0.695:0.999:0.998:0.666:1.000:1.000:1.000	-
OR2G3	81469	genome.wustl.edu	37	1	247768964	247768964	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:247768964T>C	ENST00000320002.2	+	1	109	c.77T>C	c.(76-78)gTt>gCt	p.V26A	RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V26A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CTGGAGGCTGTTCTCTTTGTA	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	200.0	198.0					1																	247768964		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.77T>C	1.37:g.247768964T>C	ENSP00000326301:p.Val26Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V26A	ENST00000320002.2	37	c.77	CCDS31093.1	1	.	.	.	.	.	.	.	.	.	.	T	7.160	0.585536	0.13749	.	.	ENSG00000177476	ENST00000320002	T	0.00448	7.38	3.64	3.64	0.41730	.	0.483083	0.14907	U	0.291491	T	0.00412	0.0013	L	0.58510	1.815	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.38178	-0.9673	10	0.34782	T	0.22	.	10.5557	0.45117	0.0:0.0:0.0:1.0	.	26	Q8NGZ4	OR2G3_HUMAN	A	26	ENSP00000326301:V26A	ENSP00000326301:V26A	V	+	2	0	OR2G3	245835587	0.000000	0.05858	0.007000	0.13788	0.618000	0.37518	-0.368000	0.07543	1.656000	0.50722	0.398000	0.26397	GTT	OR2G3	-	prints_7TM_GPCR_Rhodpsn	ENSG00000177476		0.488	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	174	0.57	1	T			247768964	247768964	+1	no_errors	ENST00000320002	ensembl	human	known	69_37n	missense	284	18.86	66	SNP	0.001	C
OR2G3	81469	genome.wustl.edu	37	1	247768964	247768964	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:247768964T>C	ENST00000320002.2	+	1	109	c.77T>C	c.(76-78)gTt>gCt	p.V26A	RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V26A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CTGGAGGCTGTTCTCTTTGTA	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	200.0	198.0					1																	247768964		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.77T>C	1.37:g.247768964T>C	ENSP00000326301:p.Val26Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V26A	ENST00000320002.2	37	c.77	CCDS31093.1	1	.	.	.	.	.	.	.	.	.	.	T	7.160	0.585536	0.13749	.	.	ENSG00000177476	ENST00000320002	T	0.00448	7.38	3.64	3.64	0.41730	.	0.483083	0.14907	U	0.291491	T	0.00412	0.0013	L	0.58510	1.815	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.38178	-0.9673	10	0.34782	T	0.22	.	10.5557	0.45117	0.0:0.0:0.0:1.0	.	26	Q8NGZ4	OR2G3_HUMAN	A	26	ENSP00000326301:V26A	ENSP00000326301:V26A	V	+	2	0	OR2G3	245835587	0.000000	0.05858	0.007000	0.13788	0.618000	0.37518	-0.368000	0.07543	1.656000	0.50722	0.398000	0.26397	GTT	OR2G3	-	prints_7TM_GPCR_Rhodpsn	ENSG00000177476		0.488	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	248	0.40	1	T			247768964	247768964	+1	no_errors	ENST00000320002	ensembl	human	known	69_37n	missense	284	18.86	66	SNP	0.001	C
OR2T34	127068	genome.wustl.edu	37	1	248737771	248737771	+	Silent	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:248737771G>T	ENST00000328782.2	-	1	309	c.288C>A	c.(286-288)acC>acA	p.T96T		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T96T(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACGGGGAAATGGTATCATCTC	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											64.0	57.0	59.0					1																	248737771		2132	4270	6402	-	-	-	SO:0001819	synonymous_variant	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.288C>A	1.37:g.248737771G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T96	ENST00000328782.2	37	c.288	CCDS31120.1	1																																																																																			OR2T34	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183310		0.552	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	32	0.00	0	G	NM_001001821		248737771	248737771	-1	no_errors	ENST00000328782	ensembl	human	known	69_37n	silent	222	16.54	44	SNP	0.000	T
OR2T34	127068	genome.wustl.edu	37	1	248737771	248737771	+	Silent	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:248737771G>T	ENST00000328782.2	-	1	309	c.288C>A	c.(286-288)acC>acA	p.T96T		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T96T(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACGGGGAAATGGTATCATCTC	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											64.0	57.0	59.0					1																	248737771		2132	4270	6402	-	-	-	SO:0001819	synonymous_variant	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.288C>A	1.37:g.248737771G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T96	ENST00000328782.2	37	c.288	CCDS31120.1	1																																																																																			OR2T34	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183310		0.552	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	43	0.00	0	G	NM_001001821		248737771	248737771	-1	no_errors	ENST00000328782	ensembl	human	known	69_37n	silent	222	16.54	44	SNP	0.000	T
OR2T10	127069	genome.wustl.edu	37	1	248756246	248756246	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:248756246G>T	ENST00000330500.2	-	1	854	c.824C>A	c.(823-825)tCc>tAc	p.S275Y	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S275Y(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTAGAAAAAGGATGACATCAT	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	62.0	60.0					1																	248756246		2043	4234	6277	-	-	-	SO:0001583	missense	0				CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.824C>A	1.37:g.248756246G>T	ENSP00000329210:p.Ser275Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNK7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S275Y	ENST00000330500.2	37	c.824	CCDS31121.1	1	.	.	.	.	.	.	.	.	.	.	.	7.114	0.576634	0.13686	.	.	ENSG00000184022	ENST00000330500	T	0.00274	8.35	2.35	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01222	0.0040	H	0.98786	4.33	0.09310	N	1	D	0.71674	0.998	D	0.70227	0.968	T	0.18871	-1.0323	9	0.87932	D	0	.	11.4637	0.50225	0.0:0.0:1.0:0.0	.	275	Q8NGZ9	O2T10_HUMAN	Y	275	ENSP00000329210:S275Y	ENSP00000329210:S275Y	S	-	2	0	OR2T10	246822869	0.028000	0.19301	0.052000	0.19188	0.003000	0.03518	2.429000	0.44758	1.123000	0.41961	0.447000	0.29281	TCC	OR2T10	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184022		0.428	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T10	HGNC	protein_coding	OTTHUMT00000097139.1	60	0.00	0	G	NM_001004693		248756246	248756246	-1	no_errors	ENST00000330500	ensembl	human	known	69_37n	missense	89	16.82	18	SNP	0.039	T
OR2T10	127069	genome.wustl.edu	37	1	248756246	248756246	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:248756246G>T	ENST00000330500.2	-	1	854	c.824C>A	c.(823-825)tCc>tAc	p.S275Y	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S275Y(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTAGAAAAAGGATGACATCAT	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	62.0	60.0					1																	248756246		2043	4234	6277	-	-	-	SO:0001583	missense	0				CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.824C>A	1.37:g.248756246G>T	ENSP00000329210:p.Ser275Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNK7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S275Y	ENST00000330500.2	37	c.824	CCDS31121.1	1	.	.	.	.	.	.	.	.	.	.	.	7.114	0.576634	0.13686	.	.	ENSG00000184022	ENST00000330500	T	0.00274	8.35	2.35	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01222	0.0040	H	0.98786	4.33	0.09310	N	1	D	0.71674	0.998	D	0.70227	0.968	T	0.18871	-1.0323	9	0.87932	D	0	.	11.4637	0.50225	0.0:0.0:1.0:0.0	.	275	Q8NGZ9	O2T10_HUMAN	Y	275	ENSP00000329210:S275Y	ENSP00000329210:S275Y	S	-	2	0	OR2T10	246822869	0.028000	0.19301	0.052000	0.19188	0.003000	0.03518	2.429000	0.44758	1.123000	0.41961	0.447000	0.29281	TCC	OR2T10	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184022		0.428	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T10	HGNC	protein_coding	OTTHUMT00000097139.1	87	0.00	0	G	NM_001004693		248756246	248756246	-1	no_errors	ENST00000330500	ensembl	human	known	69_37n	missense	89	16.82	18	SNP	0.039	T
OR4M1	441670	genome.wustl.edu	37	14	20249295	20249295	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:20249295G>A	ENST00000315957.4	+	1	895	c.814G>A	c.(814-816)Gtg>Atg	p.V272M		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V272M(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTAGATAAAGTGGTGTCTGT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											198.0	189.0	192.0					14																	20249295		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.814G>A	14.37:g.20249295G>A	ENSP00000319654:p.Val272Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH18|Q6IFA3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V272M	ENST00000315957.4	37	c.814	CCDS32021.1	14	.	.	.	.	.	.	.	.	.	.	.	7.454	0.643385	0.14451	.	.	ENSG00000176299	ENST00000315957	T	0.00265	8.39	4.42	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	0.175531	0.28624	N	0.014692	T	0.00109	0.0003	L	0.37800	1.135	0.19300	N	0.999971	B	0.12630	0.006	B	0.17098	0.017	T	0.30090	-0.9990	10	0.27082	T	0.32	-12.8909	3.1345	0.06435	0.3077:0.0:0.5036:0.1887	.	272	Q8NGD0	OR4M1_HUMAN	M	272	ENSP00000319654:V272M	ENSP00000319654:V272M	V	+	1	0	OR4M1	19319135	0.001000	0.12720	0.994000	0.49952	0.716000	0.41182	0.001000	0.13038	0.608000	0.30000	0.506000	0.49869	GTG	OR4M1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176299		0.413	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	HGNC	protein_coding	OTTHUMT00000409770.1	167	0.00	0	G			20249295	20249295	+1	no_errors	ENST00000315957	ensembl	human	known	69_37n	missense	125	31.32	57	SNP	0.349	A
OR4M1	441670	genome.wustl.edu	37	14	20249295	20249295	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:20249295G>A	ENST00000315957.4	+	1	895	c.814G>A	c.(814-816)Gtg>Atg	p.V272M		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V272M(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTAGATAAAGTGGTGTCTGT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											198.0	189.0	192.0					14																	20249295		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.814G>A	14.37:g.20249295G>A	ENSP00000319654:p.Val272Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH18|Q6IFA3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V272M	ENST00000315957.4	37	c.814	CCDS32021.1	14	.	.	.	.	.	.	.	.	.	.	.	7.454	0.643385	0.14451	.	.	ENSG00000176299	ENST00000315957	T	0.00265	8.39	4.42	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	0.175531	0.28624	N	0.014692	T	0.00109	0.0003	L	0.37800	1.135	0.19300	N	0.999971	B	0.12630	0.006	B	0.17098	0.017	T	0.30090	-0.9990	10	0.27082	T	0.32	-12.8909	3.1345	0.06435	0.3077:0.0:0.5036:0.1887	.	272	Q8NGD0	OR4M1_HUMAN	M	272	ENSP00000319654:V272M	ENSP00000319654:V272M	V	+	1	0	OR4M1	19319135	0.001000	0.12720	0.994000	0.49952	0.716000	0.41182	0.001000	0.13038	0.608000	0.30000	0.506000	0.49869	GTG	OR4M1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176299		0.413	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	HGNC	protein_coding	OTTHUMT00000409770.1	244	0.00	0	G			20249295	20249295	+1	no_errors	ENST00000315957	ensembl	human	known	69_37n	missense	125	31.32	57	SNP	0.349	A
OR7D2	162998	genome.wustl.edu	37	19	9297338	9297338	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:9297338A>G	ENST00000344248.2	+	1	1060	c.881A>G	c.(880-882)aAc>aGc	p.N294S		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	294					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N294S(1)		breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						AGCCTGAGGAACAAGGATGTG	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	60.0	60.0					19																	9297338		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.881A>G	19.37:g.9297338A>G	ENSP00000345563:p.Asn294Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ7|Q8N133	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.N294S	ENST00000344248.2	37	c.881	CCDS32900.1	19	.	.	.	.	.	.	.	.	.	.	A	10.79	1.450135	0.26074	.	.	ENSG00000188000	ENST00000344248	T	0.39997	1.05	2.2	2.2	0.27929	.	0.000000	0.43416	U	0.000566	T	0.64527	0.2606	M	0.93420	3.415	0.21762	N	0.999554	D	0.71674	0.998	D	0.65010	0.931	T	0.55560	-0.8122	10	0.72032	D	0.01	.	5.1822	0.15165	0.8508:0.0:0.1492:0.0	.	294	Q96RA2	OR7D2_HUMAN	S	294	ENSP00000345563:N294S	ENSP00000345563:N294S	N	+	2	0	OR7D2	9158338	0.715000	0.27946	0.845000	0.33349	0.332000	0.28634	1.262000	0.32992	1.292000	0.44672	0.413000	0.27773	AAC	OR7D2	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000188000		0.547	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D2	HGNC	protein_coding	OTTHUMT00000449002.1	17	0.00	0	A			9297338	9297338	+1	no_errors	ENST00000344248	ensembl	human	known	69_37n	missense	29	42.00	21	SNP	0.878	G
OR7D2	162998	genome.wustl.edu	37	19	9297338	9297338	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:9297338A>G	ENST00000344248.2	+	1	1060	c.881A>G	c.(880-882)aAc>aGc	p.N294S		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	294					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N294S(1)		breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						AGCCTGAGGAACAAGGATGTG	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	60.0	60.0					19																	9297338		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.881A>G	19.37:g.9297338A>G	ENSP00000345563:p.Asn294Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ7|Q8N133	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.N294S	ENST00000344248.2	37	c.881	CCDS32900.1	19	.	.	.	.	.	.	.	.	.	.	A	10.79	1.450135	0.26074	.	.	ENSG00000188000	ENST00000344248	T	0.39997	1.05	2.2	2.2	0.27929	.	0.000000	0.43416	U	0.000566	T	0.64527	0.2606	M	0.93420	3.415	0.21762	N	0.999554	D	0.71674	0.998	D	0.65010	0.931	T	0.55560	-0.8122	10	0.72032	D	0.01	.	5.1822	0.15165	0.8508:0.0:0.1492:0.0	.	294	Q96RA2	OR7D2_HUMAN	S	294	ENSP00000345563:N294S	ENSP00000345563:N294S	N	+	2	0	OR7D2	9158338	0.715000	0.27946	0.845000	0.33349	0.332000	0.28634	1.262000	0.32992	1.292000	0.44672	0.413000	0.27773	AAC	OR7D2	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000188000		0.547	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D2	HGNC	protein_coding	OTTHUMT00000449002.1	24	0.00	0	A			9297338	9297338	+1	no_errors	ENST00000344248	ensembl	human	known	69_37n	missense	29	42.00	21	SNP	0.878	G
P4HB	5034	genome.wustl.edu	37	17	79803027	79803027	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:79803027T>A	ENST00000331483.4	-	10	1661	c.1439A>T	c.(1438-1440)gAt>gTt	p.D480V	RP11-498C9.2_ENST00000576784.1_RNA|P4HB_ENST00000439918.2_Missense_Mutation_p.D436V|P4HB_ENST00000576390.1_Intron|P4HB_ENST00000472244.1_5'Flank	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	480					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)	p.D480V(1)		NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			CACGTCATCATCCCCTGCCCC	0.587																																					Colon(49;444 983 1296 7887 42561)	dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	84.0	88.0					17																	79803027		2203	4298	6501	-	-	-	SO:0001583	missense	0			J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.1439A>T	17.37:g.79803027T>A	ENSP00000327801:p.Asp480Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.D480V	ENST00000331483.4	37	c.1439	CCDS11787.1	17	.	.	.	.	.	.	.	.	.	.	T	14.16	2.453442	0.43531	.	.	ENSG00000185624	ENST00000331483;ENST00000537205;ENST00000436463	T	0.03831	3.79	5.16	4.08	0.47627	Thioredoxin-like fold (1);	0.501721	0.22692	N	0.056812	T	0.03011	0.0089	N	0.08118	0	0.80722	D	1	P	0.49635	0.926	P	0.44597	0.454	T	0.61865	-0.6975	10	0.27082	T	0.32	.	7.3629	0.26756	0.0:0.0779:0.144:0.778	.	480	P07237	PDIA1_HUMAN	V	480;423;464	ENSP00000327801:D480V	ENSP00000327801:D480V	D	-	2	0	P4HB	77396316	1.000000	0.71417	0.240000	0.24138	0.780000	0.44128	3.655000	0.54460	0.816000	0.34421	0.482000	0.46254	GAT	P4HB	-	superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase	ENSG00000185624		0.587	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HB	HGNC	protein_coding	OTTHUMT00000317250.3	21	0.00	0	T	NM_000918		79803027	79803027	-1	no_errors	ENST00000331483	ensembl	human	known	69_37n	missense	151	40.54	105	SNP	0.966	A
P4HB	5034	genome.wustl.edu	37	17	79803027	79803027	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:79803027T>A	ENST00000331483.4	-	10	1661	c.1439A>T	c.(1438-1440)gAt>gTt	p.D480V	RP11-498C9.2_ENST00000576784.1_RNA|P4HB_ENST00000439918.2_Missense_Mutation_p.D436V|P4HB_ENST00000576390.1_Intron|P4HB_ENST00000472244.1_5'Flank	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	480					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)	p.D480V(1)		NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			CACGTCATCATCCCCTGCCCC	0.587																																					Colon(49;444 983 1296 7887 42561)	dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	84.0	88.0					17																	79803027		2203	4298	6501	-	-	-	SO:0001583	missense	0			J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.1439A>T	17.37:g.79803027T>A	ENSP00000327801:p.Asp480Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.D480V	ENST00000331483.4	37	c.1439	CCDS11787.1	17	.	.	.	.	.	.	.	.	.	.	T	14.16	2.453442	0.43531	.	.	ENSG00000185624	ENST00000331483;ENST00000537205;ENST00000436463	T	0.03831	3.79	5.16	4.08	0.47627	Thioredoxin-like fold (1);	0.501721	0.22692	N	0.056812	T	0.03011	0.0089	N	0.08118	0	0.80722	D	1	P	0.49635	0.926	P	0.44597	0.454	T	0.61865	-0.6975	10	0.27082	T	0.32	.	7.3629	0.26756	0.0:0.0779:0.144:0.778	.	480	P07237	PDIA1_HUMAN	V	480;423;464	ENSP00000327801:D480V	ENSP00000327801:D480V	D	-	2	0	P4HB	77396316	1.000000	0.71417	0.240000	0.24138	0.780000	0.44128	3.655000	0.54460	0.816000	0.34421	0.482000	0.46254	GAT	P4HB	-	superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase	ENSG00000185624		0.587	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HB	HGNC	protein_coding	OTTHUMT00000317250.3	31	0.00	0	T	NM_000918		79803027	79803027	-1	no_errors	ENST00000331483	ensembl	human	known	69_37n	missense	151	40.54	105	SNP	0.966	A
PCDHB16	57717	genome.wustl.edu	37	5	140562836	140562836	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:140562836C>T	ENST00000361016.2	+	1	1857	c.702C>T	c.(700-702)gaC>gaT	p.D234D		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	234	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D234D(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGTGGTGGACATCAATGATA	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											77.0	74.0	75.0					5																	140562836		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.702C>T	5.37:g.140562836C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D234	ENST00000361016.2	37	c.702	CCDS4251.1	5																																																																																			PCDHB16	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196963		0.552	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	19	0.00	0	C	NM_020957		140562836	140562836	+1	no_errors	ENST00000361016	ensembl	human	known	69_37n	silent	49	30.99	22	SNP	0.381	T
PCDHB16	57717	genome.wustl.edu	37	5	140562836	140562836	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:140562836C>T	ENST00000361016.2	+	1	1857	c.702C>T	c.(700-702)gaC>gaT	p.D234D		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	234	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D234D(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGTGGTGGACATCAATGATA	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											77.0	74.0	75.0					5																	140562836		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.702C>T	5.37:g.140562836C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D234	ENST00000361016.2	37	c.702	CCDS4251.1	5																																																																																			PCDHB16	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196963		0.552	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	30	0.00	0	C	NM_020957		140562836	140562836	+1	no_errors	ENST00000361016	ensembl	human	known	69_37n	silent	49	30.99	22	SNP	0.381	T
PCNXL2	80003	genome.wustl.edu	37	1	233395012	233395012	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:233395012G>C	ENST00000258229.9	-	5	830	c.596C>G	c.(595-597)gCg>gGg	p.A199G	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	199						integral component of membrane (GO:0016021)		p.A199G(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGCTTGAGACGCAGGTAAGCT	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	106.0	108.0					1																	233395012		1989	4180	6169	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.596C>G	1.37:g.233395012G>C	ENSP00000258229:p.Ala199Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.A199G	ENST00000258229.9	37	c.596	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	G	8.354	0.831497	0.16820	.	.	ENSG00000135749	ENST00000258229	T	0.64618	-0.11	4.28	0.98	0.19750	.	.	.	.	.	T	0.49881	0.1583	N	0.24115	0.695	0.18873	N	0.999989	P	0.48911	0.917	P	0.47528	0.549	T	0.36744	-0.9735	9	0.44086	T	0.13	.	6.9772	0.24683	0.5527:0.0:0.4473:0.0	.	199	A6NKB5	PCX2_HUMAN	G	199	ENSP00000258229:A199G	ENSP00000258229:A199G	A	-	2	0	PCNXL2	231461635	0.042000	0.20092	0.005000	0.12908	0.056000	0.15407	0.408000	0.21065	0.114000	0.18032	0.561000	0.74099	GCG	PCNXL2	-	NULL	ENSG00000135749		0.443	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	41	0.00	0	G	NM_014801		233395012	233395012	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	179	14.62	31	SNP	0.050	C
PCNXL2	80003	genome.wustl.edu	37	1	233395012	233395012	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:233395012G>C	ENST00000258229.9	-	5	830	c.596C>G	c.(595-597)gCg>gGg	p.A199G	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	199						integral component of membrane (GO:0016021)		p.A199G(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGCTTGAGACGCAGGTAAGCT	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	106.0	108.0					1																	233395012		1989	4180	6169	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.596C>G	1.37:g.233395012G>C	ENSP00000258229:p.Ala199Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.A199G	ENST00000258229.9	37	c.596	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	G	8.354	0.831497	0.16820	.	.	ENSG00000135749	ENST00000258229	T	0.64618	-0.11	4.28	0.98	0.19750	.	.	.	.	.	T	0.49881	0.1583	N	0.24115	0.695	0.18873	N	0.999989	P	0.48911	0.917	P	0.47528	0.549	T	0.36744	-0.9735	9	0.44086	T	0.13	.	6.9772	0.24683	0.5527:0.0:0.4473:0.0	.	199	A6NKB5	PCX2_HUMAN	G	199	ENSP00000258229:A199G	ENSP00000258229:A199G	A	-	2	0	PCNXL2	231461635	0.042000	0.20092	0.005000	0.12908	0.056000	0.15407	0.408000	0.21065	0.114000	0.18032	0.561000	0.74099	GCG	PCNXL2	-	NULL	ENSG00000135749		0.443	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	69	0.00	0	G	NM_014801		233395012	233395012	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	179	14.62	31	SNP	0.050	C
PDGFRA	5156	genome.wustl.edu	37	4	55156541	55156541	+	Missense_Mutation	SNP	G	G	C	rs368266633	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:55156541G>C	ENST00000257290.5	+	22	3273	c.2942G>C	c.(2941-2943)cGt>cCt	p.R981P	FIP1L1_ENST00000507166.1_Missense_Mutation_p.R741P	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	981					adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R981P(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GCACGCATGCGTGTGGACTCA	0.448			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	dbGAP		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	1	Substitution - Missense(1)	breast(1)											153.0	133.0	139.0					4																	55156541		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2942G>C	4.37:g.55156541G>C	ENSP00000257290:p.Arg981Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR_rcpt_N	p.R981P	ENST00000257290.5	37	c.2942	CCDS3495.1	4	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328576	0.81690	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	T;T	0.78595	-1.19;-1.02	5.77	5.77	0.91146	.	0.000000	0.28257	U	0.016006	D	0.84660	0.5521	L	0.54323	1.7	0.80722	D	1	D	0.69078	0.997	P	0.59703	0.862	D	0.83919	0.0300	10	0.49607	T	0.09	.	19.9922	0.97370	0.0:0.0:1.0:0.0	.	981	P16234	PGFRA_HUMAN	P	741;981	ENSP00000423325:R741P;ENSP00000257290:R981P	ENSP00000423325:R741P	R	+	2	0	FIP1L1;PDGFRA	54851298	1.000000	0.71417	0.981000	0.43875	0.331000	0.28603	9.363000	0.97131	2.740000	0.93945	0.557000	0.71058	CGT	PDGFRA	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000134853		0.448	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRA	HGNC	protein_coding	OTTHUMT00000250598.2	42	0.00	0	G	NM_006206		55156541	55156541	+1	no_errors	ENST00000257290	ensembl	human	known	69_37n	missense	86	31.75	40	SNP	0.677	C
PDGFRA	5156	genome.wustl.edu	37	4	55156541	55156541	+	Missense_Mutation	SNP	G	G	C	rs368266633	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:55156541G>C	ENST00000257290.5	+	22	3273	c.2942G>C	c.(2941-2943)cGt>cCt	p.R981P	FIP1L1_ENST00000507166.1_Missense_Mutation_p.R741P	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	981					adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R981P(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GCACGCATGCGTGTGGACTCA	0.448			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	dbGAP		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	1	Substitution - Missense(1)	breast(1)											153.0	133.0	139.0					4																	55156541		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2942G>C	4.37:g.55156541G>C	ENSP00000257290:p.Arg981Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR_rcpt_N	p.R981P	ENST00000257290.5	37	c.2942	CCDS3495.1	4	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328576	0.81690	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	T;T	0.78595	-1.19;-1.02	5.77	5.77	0.91146	.	0.000000	0.28257	U	0.016006	D	0.84660	0.5521	L	0.54323	1.7	0.80722	D	1	D	0.69078	0.997	P	0.59703	0.862	D	0.83919	0.0300	10	0.49607	T	0.09	.	19.9922	0.97370	0.0:0.0:1.0:0.0	.	981	P16234	PGFRA_HUMAN	P	741;981	ENSP00000423325:R741P;ENSP00000257290:R981P	ENSP00000423325:R741P	R	+	2	0	FIP1L1;PDGFRA	54851298	1.000000	0.71417	0.981000	0.43875	0.331000	0.28603	9.363000	0.97131	2.740000	0.93945	0.557000	0.71058	CGT	PDGFRA	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000134853		0.448	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRA	HGNC	protein_coding	OTTHUMT00000250598.2	70	0.00	0	G	NM_006206		55156541	55156541	+1	no_errors	ENST00000257290	ensembl	human	known	69_37n	missense	86	31.75	40	SNP	0.677	C
PGLYRP4	57115	genome.wustl.edu	37	1	153312921	153312921	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:153312921G>A	ENST00000359650.5	-	7	824	c.760C>T	c.(760-762)Ctg>Ttg	p.L254L	PGLYRP4_ENST00000368739.3_Silent_p.L250L	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	254					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.L254L(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGGACCAGCAGGCGGCACTCA	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											101.0	98.0	99.0					1																	153312921		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.760C>T	1.37:g.153312921G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Silent	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.L254	ENST00000359650.5	37	c.760	CCDS30871.1	1																																																																																			PGLYRP4	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000163218		0.537	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGLYRP4	HGNC	protein_coding	OTTHUMT00000089978.1	23	0.00	0	G	NM_020393		153312921	153312921	-1	no_errors	ENST00000359650	ensembl	human	known	69_37n	silent	103	25.36	35	SNP	0.021	A
PGLYRP4	57115	genome.wustl.edu	37	1	153312921	153312921	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:153312921G>A	ENST00000359650.5	-	7	824	c.760C>T	c.(760-762)Ctg>Ttg	p.L254L	PGLYRP4_ENST00000368739.3_Silent_p.L250L	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	254					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.L254L(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGGACCAGCAGGCGGCACTCA	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											101.0	98.0	99.0					1																	153312921		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.760C>T	1.37:g.153312921G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Silent	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.L254	ENST00000359650.5	37	c.760	CCDS30871.1	1																																																																																			PGLYRP4	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000163218		0.537	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGLYRP4	HGNC	protein_coding	OTTHUMT00000089978.1	33	0.00	0	G	NM_020393		153312921	153312921	-1	no_errors	ENST00000359650	ensembl	human	known	69_37n	silent	103	25.36	35	SNP	0.021	A
PHF21B	112885	genome.wustl.edu	37	22	45312307	45312307	+	Silent	SNP	G	G	A	rs201793174	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr22:45312307G>A	ENST00000313237.5	-	4	567	c.417C>T	c.(415-417)ctC>ctT	p.L139L	PHF21B_ENST00000404079.2_Silent_p.L127L|PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000396103.3_Silent_p.L139L|PHF21B_ENST00000447824.3_Silent_p.L127L	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	139							zinc ion binding (GO:0008270)	p.L139L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GCGGAGAGGCGAGGGCGGCGG	0.716													G|||	3	0.000599042	0.0	0.0	5008	,	,		13349	0.0		0.003	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											16.0	21.0	19.0					22																	45312307		2198	4284	6482	-	-	-	SO:0001819	synonymous_variant	0			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.417C>T	22.37:g.45312307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L139	ENST00000313237.5	37	c.417	CCDS14061.1	22																																																																																			PHF21B	-	NULL	ENSG00000056487		0.716	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	HGNC	protein_coding	OTTHUMT00000321731.2	16	0.00	0	G	NM_138415		45312307	45312307	-1	no_errors	ENST00000313237	ensembl	human	known	69_37n	silent	47	34.72	25	SNP	0.028	A
PHF21B	112885	genome.wustl.edu	37	22	45312307	45312307	+	Silent	SNP	G	G	A	rs201793174	byFrequency	TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr22:45312307G>A	ENST00000313237.5	-	4	567	c.417C>T	c.(415-417)ctC>ctT	p.L139L	PHF21B_ENST00000404079.2_Silent_p.L127L|PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000396103.3_Silent_p.L139L|PHF21B_ENST00000447824.3_Silent_p.L127L	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	139							zinc ion binding (GO:0008270)	p.L139L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GCGGAGAGGCGAGGGCGGCGG	0.716													G|||	3	0.000599042	0.0	0.0	5008	,	,		13349	0.0		0.003	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											16.0	21.0	19.0					22																	45312307		2198	4284	6482	-	-	-	SO:0001819	synonymous_variant	0			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.417C>T	22.37:g.45312307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L139	ENST00000313237.5	37	c.417	CCDS14061.1	22																																																																																			PHF21B	-	NULL	ENSG00000056487		0.716	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	HGNC	protein_coding	OTTHUMT00000321731.2	28	0.00	0	G	NM_138415		45312307	45312307	-1	no_errors	ENST00000313237	ensembl	human	known	69_37n	silent	47	34.72	25	SNP	0.028	A
PLBD2	196463	genome.wustl.edu	37	12	113812735	113812735	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:113812735A>G	ENST00000280800.3	+	5	813	c.782A>G	c.(781-783)cAc>cGc	p.H261R	PLBD2_ENST00000545182.2_Missense_Mutation_p.H261R|PLBD2_ENST00000547163.1_3'UTR	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	261					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)	p.H261R(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CTGGTTGCCCACAACACCTGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	92.0	98.0					12																	113812735		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.782A>G	12.37:g.113812735A>G	ENSP00000280800:p.His261Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H5E2	Missense_Mutation	SNP	pfam_PLipase_B-like	p.H261R	ENST00000280800.3	37	c.782	CCDS9168.1	12	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237580	0.58886	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.23552	1.9;1.9	4.93	2.53	0.30540	.	0.104608	0.64402	N	0.000004	T	0.55561	0.1928	H	0.94734	3.575	0.47441	D	0.999427	D;D	0.69078	0.997;0.997	D;D	0.72982	0.951;0.979	T	0.55798	-0.8084	10	0.72032	D	0.01	-49.2378	6.6237	0.22818	0.7875:0.0:0.0753:0.1372	.	261;261	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	R	261	ENSP00000443463:H261R;ENSP00000280800:H261R	ENSP00000280800:H261R	H	+	2	0	PLBD2	112297118	1.000000	0.71417	0.950000	0.38849	0.609000	0.37215	8.917000	0.92751	0.237000	0.21200	0.334000	0.21626	CAC	PLBD2	-	pfam_PLipase_B-like	ENSG00000151176		0.582	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD2	HGNC	protein_coding	OTTHUMT00000404835.1	23	0.00	0	A	NM_173542		113812735	113812735	+1	no_errors	ENST00000280800	ensembl	human	known	69_37n	missense	51	46.88	45	SNP	1.000	G
PLBD2	196463	genome.wustl.edu	37	12	113812735	113812735	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:113812735A>G	ENST00000280800.3	+	5	813	c.782A>G	c.(781-783)cAc>cGc	p.H261R	PLBD2_ENST00000545182.2_Missense_Mutation_p.H261R|PLBD2_ENST00000547163.1_3'UTR	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	261					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)	p.H261R(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CTGGTTGCCCACAACACCTGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	92.0	98.0					12																	113812735		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.782A>G	12.37:g.113812735A>G	ENSP00000280800:p.His261Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H5E2	Missense_Mutation	SNP	pfam_PLipase_B-like	p.H261R	ENST00000280800.3	37	c.782	CCDS9168.1	12	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237580	0.58886	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.23552	1.9;1.9	4.93	2.53	0.30540	.	0.104608	0.64402	N	0.000004	T	0.55561	0.1928	H	0.94734	3.575	0.47441	D	0.999427	D;D	0.69078	0.997;0.997	D;D	0.72982	0.951;0.979	T	0.55798	-0.8084	10	0.72032	D	0.01	-49.2378	6.6237	0.22818	0.7875:0.0:0.0753:0.1372	.	261;261	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	R	261	ENSP00000443463:H261R;ENSP00000280800:H261R	ENSP00000280800:H261R	H	+	2	0	PLBD2	112297118	1.000000	0.71417	0.950000	0.38849	0.609000	0.37215	8.917000	0.92751	0.237000	0.21200	0.334000	0.21626	CAC	PLBD2	-	pfam_PLipase_B-like	ENSG00000151176		0.582	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD2	HGNC	protein_coding	OTTHUMT00000404835.1	31	0.00	0	A	NM_173542		113812735	113812735	+1	no_errors	ENST00000280800	ensembl	human	known	69_37n	missense	51	46.88	45	SNP	1.000	G
PLCL2	23228	genome.wustl.edu	37	3	17053574	17053574	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:17053574G>A	ENST00000418129.2	+	2	2823	c.2358G>A	c.(2356-2358)tgG>tgA	p.W786*	PLCL2_ENST00000396755.2_Nonsense_Mutation_p.W786*|PLCL2_ENST00000432376.1_Nonsense_Mutation_p.W786*	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	912	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.W786*(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						GAACACTGTGGATTAAAACCG	0.453																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											86.0	90.0	89.0					3																	17053574		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2358G>A	3.37:g.17053574G>A	ENSP00000409637:p.Trp786*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.W786*	ENST00000418129.2	37	c.2358	CCDS33713.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.063140|10.063140	0.99329|0.99329	.|.	.|.	ENSG00000154822|ENSG00000154822	ENST00000419842|ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.239782	.|0.44285	.|D	.|0.000465	T|.	0.62913|.	0.2467|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.68827|.	-0.5306|.	3|.	.|0.35671	.|T	.|0.21	.|.	12.7683|12.7683	0.57405|0.57405	0.0751:0.0:0.9249:0.0|0.0751:0.0:0.9249:0.0	.|.	.|.	.|.	.|.	E|X	530|786;913;786;786	.|.	.|ENSP00000285094:W913X	G|W	+|+	2|3	0|0	PLCL2|PLCL2	17028578|17028578	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	4.729000|4.729000	0.62008|0.62008	2.611000|2.611000	0.88343|0.88343	0.491000|0.491000	0.48974|0.48974	GGA|TGG	PLCL2	-	NULL	ENSG00000154822		0.453	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	122	0.00	0	G			17053574	17053574	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	nonsense	48	25.00	16	SNP	1.000	A
PLCL2	23228	genome.wustl.edu	37	3	17053574	17053574	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:17053574G>A	ENST00000418129.2	+	2	2823	c.2358G>A	c.(2356-2358)tgG>tgA	p.W786*	PLCL2_ENST00000396755.2_Nonsense_Mutation_p.W786*|PLCL2_ENST00000432376.1_Nonsense_Mutation_p.W786*	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	912	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.W786*(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						GAACACTGTGGATTAAAACCG	0.453																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											86.0	90.0	89.0					3																	17053574		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2358G>A	3.37:g.17053574G>A	ENSP00000409637:p.Trp786*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.W786*	ENST00000418129.2	37	c.2358	CCDS33713.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.063140|10.063140	0.99329|0.99329	.|.	.|.	ENSG00000154822|ENSG00000154822	ENST00000419842|ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.239782	.|0.44285	.|D	.|0.000465	T|.	0.62913|.	0.2467|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.68827|.	-0.5306|.	3|.	.|0.35671	.|T	.|0.21	.|.	12.7683|12.7683	0.57405|0.57405	0.0751:0.0:0.9249:0.0|0.0751:0.0:0.9249:0.0	.|.	.|.	.|.	.|.	E|X	530|786;913;786;786	.|.	.|ENSP00000285094:W913X	G|W	+|+	2|3	0|0	PLCL2|PLCL2	17028578|17028578	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	4.729000|4.729000	0.62008|0.62008	2.611000|2.611000	0.88343|0.88343	0.491000|0.491000	0.48974|0.48974	GGA|TGG	PLCL2	-	NULL	ENSG00000154822		0.453	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	82	0.00	0	G			17053574	17053574	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	nonsense	48	25.00	16	SNP	1.000	A
PLCL2	23228	genome.wustl.edu	37	3	17131237	17131249	+	Frame_Shift_Del	DEL	CTTTTGAAATATG	CTTTTGAAATATG	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CTTTTGAAATATG	CTTTTGAAATATG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:17131237_17131249delCTTTTGAAATATG	ENST00000418129.2	+	6	3304_3316	c.2839_2851delCTTTTGAAATATG	c.(2839-2853)cttttgaaatatgctfs	p.LLKYA947fs	PLCL2_ENST00000432376.1_Frame_Shift_Del_p.LLKYA947fs	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	1073					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.L948fs*8(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						ACAAGCAGATCTTTTGAAATATGCTAAGAATGA	0.347																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2839_2851delCTTTTGAAATATG	3.37:g.17131237_17131249delCTTTTGAAATATG	ENSP00000409637:p.Leu947fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Frame_Shift_Del	DEL	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.L948fs	ENST00000418129.2	37	c.2839_2851	CCDS33713.1	3																																																																																			PLCL2	-	NULL	ENSG00000154822		0.347	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	150	0.00	0	CTTTTGAAATATG			17131237	17131249	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	frame_shift_del	52	17.46	11	DEL	1.000:1.000:0.989:0.991:1.000:1.000:1.000:1.000:1.000:1.000:0.999:0.779:1.000	-
PLCL2	23228	genome.wustl.edu	37	3	17131237	17131249	+	Frame_Shift_Del	DEL	CTTTTGAAATATG	CTTTTGAAATATG	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CTTTTGAAATATG	CTTTTGAAATATG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:17131237_17131249delCTTTTGAAATATG	ENST00000418129.2	+	6	3304_3316	c.2839_2851delCTTTTGAAATATG	c.(2839-2853)cttttgaaatatgctfs	p.LLKYA947fs	PLCL2_ENST00000432376.1_Frame_Shift_Del_p.LLKYA947fs	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	1073					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.L948fs*8(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						ACAAGCAGATCTTTTGAAATATGCTAAGAATGA	0.347																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2839_2851delCTTTTGAAATATG	3.37:g.17131237_17131249delCTTTTGAAATATG	ENSP00000409637:p.Leu947fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Frame_Shift_Del	DEL	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.L948fs	ENST00000418129.2	37	c.2839_2851	CCDS33713.1	3																																																																																			PLCL2	-	NULL	ENSG00000154822		0.347	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	212	0.00	0	CTTTTGAAATATG			17131237	17131249	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	frame_shift_del	52	17.46	11	DEL	1.000:1.000:0.989:0.991:1.000:1.000:1.000:1.000:1.000:1.000:0.999:0.779:1.000	-
PLEC	5339	genome.wustl.edu	37	8	144994265	144994265	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:144994265G>C	ENST00000322810.4	-	32	10304	c.10135C>G	c.(10135-10137)Ccc>Gcc	p.P3379A	PLEC_ENST00000356346.3_Missense_Mutation_p.P3228A|PLEC_ENST00000354589.3_Missense_Mutation_p.P3242A|PLEC_ENST00000354958.2_Missense_Mutation_p.P3220A|PLEC_ENST00000398774.2_Missense_Mutation_p.P3210A|PLEC_ENST00000527096.1_Missense_Mutation_p.P3265A|PLEC_ENST00000357649.2_Missense_Mutation_p.P3246A|PLEC_ENST00000345136.3_Missense_Mutation_p.P3242A|PLEC_ENST00000436759.2_Missense_Mutation_p.P3269A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3379	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.P3242A(1)|p.P3379A(1)|p.P3269A(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCACCCACGGGGACCTCAACC	0.632																																						dbGAP											3	Substitution - Missense(3)	breast(3)											42.0	45.0	44.0					8																	144994265		1999	4159	6158	-	-	-	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10135C>G	8.37:g.144994265G>C	ENSP00000323856:p.Pro3379Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.P3379A	ENST00000322810.4	37	c.10135	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	G	3.134	-0.177807	0.06380	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.75938	-0.94;-0.94;-0.98;-0.97;-0.96;-0.94;-0.94;-0.94;-0.94	4.67	3.72	0.42706	.	0.437819	0.19976	U	0.101875	T	0.67239	0.2872	L	0.46741	1.465	0.31379	N	0.679211	B;B;B;B;B;B;B;B	0.18863	0.029;0.029;0.029;0.031;0.029;0.029;0.029;0.029	B;B;B;B;B;B;B;B	0.15484	0.013;0.013;0.013;0.006;0.013;0.013;0.013;0.013	T	0.67983	-0.5529	10	0.36615	T	0.2	.	14.154	0.65405	0.0:0.1511:0.8489:0.0	.	3269;3228;3220;3379;3210;3242;3246;3242	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	A	3242;3246;3242;3210;3379;3220;3228;3269;3265	ENSP00000344848:P3242A;ENSP00000350277:P3246A;ENSP00000346602:P3242A;ENSP00000381756:P3210A;ENSP00000323856:P3379A;ENSP00000347044:P3220A;ENSP00000348702:P3228A;ENSP00000388180:P3269A;ENSP00000434583:P3265A	ENSP00000323856:P3379A	P	-	1	0	PLEC	145066253	1.000000	0.71417	0.202000	0.23494	0.148000	0.21650	4.905000	0.63286	2.275000	0.75901	0.448000	0.29417	CCC	PLEC	-	NULL	ENSG00000178209		0.632	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	8	0.00	0	G	NM_000445		144994265	144994265	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	0.671	C
PMEL	6490	genome.wustl.edu	37	12	56351004	56351004	+	Silent	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:56351004A>G	ENST00000548747.1	-	6	1745	c.1083T>C	c.(1081-1083)acT>acC	p.T361T	PMEL_ENST00000539511.1_Silent_p.T275T|PMEL_ENST00000360714.4_Silent_p.T361T|PMEL_ENST00000449260.2_Silent_p.T361T|PMEL_ENST00000550447.1_Intron|PMEL_ENST00000548493.1_Silent_p.T361T|PMEL_ENST00000552882.1_Silent_p.T361T|PMEL_ENST00000550464.1_Silent_p.T275T|PMEL_ENST00000536427.1_Silent_p.T361T|PMEL_ENST00000548689.1_5'Flank			P40967	PMEL_HUMAN	premelanosome protein	361	10 X 13 AA approximate tandem repeats, RPT domain.				melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCACAGGTGCAGTGCTTATGA	0.537																																						dbGAP											0													96.0	77.0	83.0					12																	56351004		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.1083T>C	12.37:g.56351004A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.C249R	ENST00000548747.1	37	c.745	CCDS8897.1	12	.	.	.	.	.	.	.	.	.	.	A	4.342	0.062979	0.08388	.	.	ENSG00000185664	ENST00000549404	.	.	.	4.41	0.231	0.15377	.	.	.	.	.	T	0.31327	0.0793	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27938	-1.0059	4	.	.	.	-2.7701	6.9742	0.24666	0.5936:0.0:0.4064:0.0	.	.	.	.	R	249	.	.	C	-	1	0	PMEL	54637271	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.071000	0.11505	0.110000	0.17919	0.402000	0.26972	TGC	PMEL	-	NULL	ENSG00000185664		0.537	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	HGNC	protein_coding	OTTHUMT00000409626.1	16	0.00	0	A	NM_006928		56351004	56351004	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000549404	ensembl	human	novel	69_37n	missense	26	48.00	24	SNP	0.000	G
PMEL	6490	genome.wustl.edu	37	12	56351004	56351004	+	Silent	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:56351004A>G	ENST00000548747.1	-	6	1745	c.1083T>C	c.(1081-1083)acT>acC	p.T361T	PMEL_ENST00000539511.1_Silent_p.T275T|PMEL_ENST00000360714.4_Silent_p.T361T|PMEL_ENST00000449260.2_Silent_p.T361T|PMEL_ENST00000550447.1_Intron|PMEL_ENST00000548493.1_Silent_p.T361T|PMEL_ENST00000552882.1_Silent_p.T361T|PMEL_ENST00000550464.1_Silent_p.T275T|PMEL_ENST00000536427.1_Silent_p.T361T|PMEL_ENST00000548689.1_5'Flank			P40967	PMEL_HUMAN	premelanosome protein	361	10 X 13 AA approximate tandem repeats, RPT domain.				melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCACAGGTGCAGTGCTTATGA	0.537																																						dbGAP											0													96.0	77.0	83.0					12																	56351004		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.1083T>C	12.37:g.56351004A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.C249R	ENST00000548747.1	37	c.745	CCDS8897.1	12	.	.	.	.	.	.	.	.	.	.	A	4.342	0.062979	0.08388	.	.	ENSG00000185664	ENST00000549404	.	.	.	4.41	0.231	0.15377	.	.	.	.	.	T	0.31327	0.0793	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27938	-1.0059	4	.	.	.	-2.7701	6.9742	0.24666	0.5936:0.0:0.4064:0.0	.	.	.	.	R	249	.	.	C	-	1	0	PMEL	54637271	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.071000	0.11505	0.110000	0.17919	0.402000	0.26972	TGC	PMEL	-	NULL	ENSG00000185664		0.537	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	HGNC	protein_coding	OTTHUMT00000409626.1	22	0.00	0	A	NM_006928		56351004	56351004	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000549404	ensembl	human	novel	69_37n	missense	26	48.00	24	SNP	0.000	G
PNLIPRP3	119548	genome.wustl.edu	37	10	118236225	118236225	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:118236225A>T	ENST00000369230.3	+	11	1380	c.1234A>T	c.(1234-1236)Aac>Tac	p.N412Y		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	412	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.N412Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		TAACGTTGGAAACATTACAAG	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											123.0	120.0	121.0					10																	118236225		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1234A>T	10.37:g.118236225A>T	ENSP00000358232:p.Asn412Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.N412Y	ENST00000369230.3	37	c.1234	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	A	13.13	2.145361	0.37825	.	.	ENSG00000203837	ENST00000369230	T	0.72167	-0.63	4.13	4.13	0.48395	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	0.268702	0.25738	N	0.028623	T	0.78892	0.4355	L	0.57536	1.79	0.27244	N	0.959069	D	0.61697	0.99	D	0.67231	0.95	T	0.71189	-0.4666	10	0.62326	D	0.03	.	11.3315	0.49479	1.0:0.0:0.0:0.0	.	412	Q17RR3	LIPR3_HUMAN	Y	412	ENSP00000358232:N412Y	ENSP00000358232:N412Y	N	+	1	0	PNLIPRP3	118226215	0.969000	0.33509	0.739000	0.30968	0.173000	0.22820	2.037000	0.41174	1.819000	0.53055	0.533000	0.62120	AAC	PNLIPRP3	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	ENSG00000203837		0.358	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	130	0.76	1	A	XM_058404		118236225	118236225	+1	no_errors	ENST00000369230	ensembl	human	known	69_37n	missense	43	44.16	34	SNP	0.836	T
PNLIPRP3	119548	genome.wustl.edu	37	10	118236225	118236225	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:118236225A>T	ENST00000369230.3	+	11	1380	c.1234A>T	c.(1234-1236)Aac>Tac	p.N412Y		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	412	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.N412Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		TAACGTTGGAAACATTACAAG	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											123.0	120.0	121.0					10																	118236225		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1234A>T	10.37:g.118236225A>T	ENSP00000358232:p.Asn412Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.N412Y	ENST00000369230.3	37	c.1234	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	A	13.13	2.145361	0.37825	.	.	ENSG00000203837	ENST00000369230	T	0.72167	-0.63	4.13	4.13	0.48395	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	0.268702	0.25738	N	0.028623	T	0.78892	0.4355	L	0.57536	1.79	0.27244	N	0.959069	D	0.61697	0.99	D	0.67231	0.95	T	0.71189	-0.4666	10	0.62326	D	0.03	.	11.3315	0.49479	1.0:0.0:0.0:0.0	.	412	Q17RR3	LIPR3_HUMAN	Y	412	ENSP00000358232:N412Y	ENSP00000358232:N412Y	N	+	1	0	PNLIPRP3	118226215	0.969000	0.33509	0.739000	0.30968	0.173000	0.22820	2.037000	0.41174	1.819000	0.53055	0.533000	0.62120	AAC	PNLIPRP3	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	ENSG00000203837		0.358	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	194	0.51	1	A	XM_058404		118236225	118236225	+1	no_errors	ENST00000369230	ensembl	human	known	69_37n	missense	43	44.16	34	SNP	0.836	T
POLR1B	84172	genome.wustl.edu	37	2	113321941	113321941	+	Splice_Site	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:113321941A>G	ENST00000263331.5	+	10	2192		c.e10-1		POLR1B_ENST00000537335.1_Splice_Site|POLR1B_ENST00000541869.1_Splice_Site|POLR1B_ENST00000409894.3_Splice_Site|POLR1B_ENST00000417433.2_Splice_Site	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa						gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.?(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TTCCTTTACCAGGGGTCACTC	0.502																																					Ovarian(16;256 576 9537 23969 41147)	dbGAP											1	Unknown(1)	breast(1)											168.0	142.0	151.0					2																	113321941		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1613-1A>G	2.37:g.113321941A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Splice_Site	SNP	-	e11-2	ENST00000263331.5	37	c.1727-2	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485878	0.63962	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000537335;ENST00000417433	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8223	0.70082	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLR1B	113038412	1.000000	0.71417	0.998000	0.56505	0.852000	0.48524	8.901000	0.92560	2.138000	0.66242	0.528000	0.53228	.	POLR1B	-	-	ENSG00000125630		0.502	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	40	0.00	0	A	NM_019014	Intron	113321941	113321941	+1	no_errors	ENST00000541869	ensembl	human	known	69_37n	splice_site	102	27.14	38	SNP	1.000	G
POLR1B	84172	genome.wustl.edu	37	2	113321941	113321941	+	Splice_Site	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:113321941A>G	ENST00000263331.5	+	10	2192		c.e10-1		POLR1B_ENST00000537335.1_Splice_Site|POLR1B_ENST00000541869.1_Splice_Site|POLR1B_ENST00000409894.3_Splice_Site|POLR1B_ENST00000417433.2_Splice_Site	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa						gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.?(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TTCCTTTACCAGGGGTCACTC	0.502																																					Ovarian(16;256 576 9537 23969 41147)	dbGAP											1	Unknown(1)	breast(1)											168.0	142.0	151.0					2																	113321941		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1613-1A>G	2.37:g.113321941A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Splice_Site	SNP	-	e11-2	ENST00000263331.5	37	c.1727-2	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485878	0.63962	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000537335;ENST00000417433	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8223	0.70082	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLR1B	113038412	1.000000	0.71417	0.998000	0.56505	0.852000	0.48524	8.901000	0.92560	2.138000	0.66242	0.528000	0.53228	.	POLR1B	-	-	ENSG00000125630		0.502	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	52	0.00	0	A	NM_019014	Intron	113321941	113321941	+1	no_errors	ENST00000541869	ensembl	human	known	69_37n	splice_site	102	27.14	38	SNP	1.000	G
POLR2A	5430	genome.wustl.edu	37	17	7405859	7405859	+	Missense_Mutation	SNP	C	C	G	rs201063777		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:7405859C>G	ENST00000322644.6	+	16	2994	c.2595C>G	c.(2593-2595)atC>atG	p.I865M		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	865					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.I865M(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GGCGGCTGATCAAGTCCATGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	72.0	73.0					17																	7405859		2203	4300	6503	-	-	-	SO:0001583	missense	0					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2595C>G	17.37:g.7405859C>G	ENSP00000314949:p.Ile865Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_7,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_II_repeat_euk,smart_RNA_pol_N	p.I865M	ENST00000322644.6	37	c.2595	CCDS32548.1	17	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767164	0.69878	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.70986	-0.53	5.82	3.77	0.43336	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	L	0.52823	1.66	0.80722	D	1	P	0.46987	0.888	P	0.45232	0.474	T	0.67177	-0.5736	10	0.87932	D	0	-13.2288	8.2523	0.31735	0.2912:0.6346:0.0:0.0742	.	865	P24928	RPB1_HUMAN	M	821;865	ENSP00000314949:I865M	ENSP00000314949:I865M	I	+	3	3	SLC35G6	7346583	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.955000	0.49121	0.748000	0.32831	0.655000	0.94253	ATC	POLR2A	-	pfam_RNA_pol_Rpb1_5	ENSG00000181222		0.582	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	HGNC	protein_coding	OTTHUMT00000437967.1	13	0.00	0	C	NM_000937		7405859	7405859	+1	no_errors	ENST00000322644	ensembl	human	known	69_37n	missense	40	39.39	26	SNP	1.000	G
POLR2A	5430	genome.wustl.edu	37	17	7405859	7405859	+	Missense_Mutation	SNP	C	C	G	rs201063777		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:7405859C>G	ENST00000322644.6	+	16	2994	c.2595C>G	c.(2593-2595)atC>atG	p.I865M		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	865					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.I865M(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GGCGGCTGATCAAGTCCATGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	72.0	73.0					17																	7405859		2203	4300	6503	-	-	-	SO:0001583	missense	0					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2595C>G	17.37:g.7405859C>G	ENSP00000314949:p.Ile865Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_7,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_II_repeat_euk,smart_RNA_pol_N	p.I865M	ENST00000322644.6	37	c.2595	CCDS32548.1	17	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767164	0.69878	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.70986	-0.53	5.82	3.77	0.43336	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	L	0.52823	1.66	0.80722	D	1	P	0.46987	0.888	P	0.45232	0.474	T	0.67177	-0.5736	10	0.87932	D	0	-13.2288	8.2523	0.31735	0.2912:0.6346:0.0:0.0742	.	865	P24928	RPB1_HUMAN	M	821;865	ENSP00000314949:I865M	ENSP00000314949:I865M	I	+	3	3	SLC35G6	7346583	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.955000	0.49121	0.748000	0.32831	0.655000	0.94253	ATC	POLR2A	-	pfam_RNA_pol_Rpb1_5	ENSG00000181222		0.582	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	HGNC	protein_coding	OTTHUMT00000437967.1	21	0.00	0	C	NM_000937		7405859	7405859	+1	no_errors	ENST00000322644	ensembl	human	known	69_37n	missense	40	39.39	26	SNP	1.000	G
POPDC2	64091	genome.wustl.edu	37	3	119379073	119379073	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:119379073C>T	ENST00000264231.3	-	1	364	c.198G>A	c.(196-198)ctG>ctA	p.L66L	POPDC2_ENST00000493094.1_Silent_p.L66L|POPDC2_ENST00000468801.1_Silent_p.L66L|POPDC2_ENST00000538678.1_Silent_p.L66L|POPDC2_ENST00000474523.1_Intron	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	66					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)	p.L66L(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		ACCAGCCCCACAGCACGCAGC	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											126.0	109.0	115.0					3																	119379073		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.198G>A	3.37:g.119379073C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UE7	Silent	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.L66	ENST00000264231.3	37	c.198	CCDS2992.1	3																																																																																			POPDC2	-	NULL	ENSG00000121577		0.582	POPDC2-002	KNOWN	basic|CCDS	protein_coding	POPDC2	HGNC	protein_coding	OTTHUMT00000355378.1	18	0.00	0	C	NM_022135		119379073	119379073	-1	no_errors	ENST00000341124	ensembl	human	known	69_37n	silent	135	29.69	57	SNP	0.998	T
POPDC2	64091	genome.wustl.edu	37	3	119379073	119379073	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:119379073C>T	ENST00000264231.3	-	1	364	c.198G>A	c.(196-198)ctG>ctA	p.L66L	POPDC2_ENST00000493094.1_Silent_p.L66L|POPDC2_ENST00000468801.1_Silent_p.L66L|POPDC2_ENST00000538678.1_Silent_p.L66L|POPDC2_ENST00000474523.1_Intron	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	66					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)	p.L66L(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		ACCAGCCCCACAGCACGCAGC	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											126.0	109.0	115.0					3																	119379073		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.198G>A	3.37:g.119379073C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UE7	Silent	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.L66	ENST00000264231.3	37	c.198	CCDS2992.1	3																																																																																			POPDC2	-	NULL	ENSG00000121577		0.582	POPDC2-002	KNOWN	basic|CCDS	protein_coding	POPDC2	HGNC	protein_coding	OTTHUMT00000355378.1	35	0.00	0	C	NM_022135		119379073	119379073	-1	no_errors	ENST00000341124	ensembl	human	known	69_37n	silent	135	29.69	57	SNP	0.998	T
PRB4	5545	genome.wustl.edu	37	12	11461466	11461466	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:11461466G>C	ENST00000535904.1	-	3	484	c.451C>G	c.(451-453)Cag>Gag	p.Q151E	PRB4_ENST00000445719.2_Intron|PRB4_ENST00000279575.1_Missense_Mutation_p.Q151E			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	172	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region (GO:0005576)		p.Q151E(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						CCTTGGGACTGGTTACCTCCT	0.597										HNSCC(22;0.051)																												dbGAP											1	Substitution - Missense(1)	breast(1)											191.0	210.0	203.0					12																	11461466		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.451C>G	12.37:g.11461466G>C	ENSP00000442834:p.Gln151Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NULL	p.Q151E	ENST00000535904.1	37	c.451	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.444377	0.00178	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.06608	3.28;3.28	0.561	-0.491	0.12045	.	.	.	.	.	T	0.04182	0.0116	L	0.48642	1.525	0.09310	N	1	B	0.26975	0.165	B	0.12156	0.007	T	0.46062	-0.9218	8	0.02654	T	1	.	.	.	.	.	151	E9PAL0	.	E	151	ENSP00000279575:Q151E;ENSP00000442834:Q151E	ENSP00000279575:Q151E	Q	-	1	0	PRB4	11352733	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.068000	0.11561	-0.228000	0.09869	-0.505000	0.04504	CAG	PRB4	-	NULL	ENSG00000230657		0.597	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	HGNC	protein_coding	OTTHUMT00000402308.1	31	0.00	0	G	NM_002723		11461466	11461466	-1	no_errors	ENST00000279575	ensembl	human	known	69_37n	missense	74	35.65	41	SNP	0.001	C
PRB4	5545	genome.wustl.edu	37	12	11461466	11461466	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr12:11461466G>C	ENST00000535904.1	-	3	484	c.451C>G	c.(451-453)Cag>Gag	p.Q151E	PRB4_ENST00000445719.2_Intron|PRB4_ENST00000279575.1_Missense_Mutation_p.Q151E			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	172	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region (GO:0005576)		p.Q151E(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						CCTTGGGACTGGTTACCTCCT	0.597										HNSCC(22;0.051)																												dbGAP											1	Substitution - Missense(1)	breast(1)											191.0	210.0	203.0					12																	11461466		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.451C>G	12.37:g.11461466G>C	ENSP00000442834:p.Gln151Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NULL	p.Q151E	ENST00000535904.1	37	c.451	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.444377	0.00178	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.06608	3.28;3.28	0.561	-0.491	0.12045	.	.	.	.	.	T	0.04182	0.0116	L	0.48642	1.525	0.09310	N	1	B	0.26975	0.165	B	0.12156	0.007	T	0.46062	-0.9218	8	0.02654	T	1	.	.	.	.	.	151	E9PAL0	.	E	151	ENSP00000279575:Q151E;ENSP00000442834:Q151E	ENSP00000279575:Q151E	Q	-	1	0	PRB4	11352733	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.068000	0.11561	-0.228000	0.09869	-0.505000	0.04504	CAG	PRB4	-	NULL	ENSG00000230657		0.597	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	HGNC	protein_coding	OTTHUMT00000402308.1	50	0.00	0	G	NM_002723		11461466	11461466	-1	no_errors	ENST00000279575	ensembl	human	known	69_37n	missense	74	35.65	41	SNP	0.001	C
PREX2	80243	genome.wustl.edu	37	8	69033276	69033276	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:69033276T>A	ENST00000288368.4	+	30	3993	c.3716T>A	c.(3715-3717)tTt>tAt	p.F1239Y		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1239					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.F1239Y(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ATCAGGAAATTTGTTGAAGGT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	71.0	72.0					8																	69033276		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3716T>A	8.37:g.69033276T>A	ENSP00000288368:p.Phe1239Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.F1239Y	ENST00000288368.4	37	c.3716	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	T	3.220	-0.159715	0.06544	.	.	ENSG00000046889	ENST00000288368	T	0.36878	1.23	5.82	3.32	0.38043	.	0.325534	0.34435	N	0.003977	T	0.14657	0.0354	N	0.05534	-0.03	0.29217	N	0.874209	B	0.02656	0.0	B	0.04013	0.001	T	0.32666	-0.9898	10	0.02654	T	1	.	8.7127	0.34393	0.131:0.0:0.1298:0.7392	.	1239	Q70Z35	PREX2_HUMAN	Y	1239	ENSP00000288368:F1239Y	ENSP00000288368:F1239Y	F	+	2	0	PREX2	69195830	1.000000	0.71417	0.998000	0.56505	0.734000	0.41952	2.028000	0.41088	0.406000	0.25560	0.533000	0.62120	TTT	PREX2	-	NULL	ENSG00000046889		0.393	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	37	0.00	0	T	NM_025170		69033276	69033276	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	1.000	A
PREX2	80243	genome.wustl.edu	37	8	69033276	69033276	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:69033276T>A	ENST00000288368.4	+	30	3993	c.3716T>A	c.(3715-3717)tTt>tAt	p.F1239Y		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1239					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.F1239Y(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ATCAGGAAATTTGTTGAAGGT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	71.0	72.0					8																	69033276		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3716T>A	8.37:g.69033276T>A	ENSP00000288368:p.Phe1239Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.F1239Y	ENST00000288368.4	37	c.3716	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	T	3.220	-0.159715	0.06544	.	.	ENSG00000046889	ENST00000288368	T	0.36878	1.23	5.82	3.32	0.38043	.	0.325534	0.34435	N	0.003977	T	0.14657	0.0354	N	0.05534	-0.03	0.29217	N	0.874209	B	0.02656	0.0	B	0.04013	0.001	T	0.32666	-0.9898	10	0.02654	T	1	.	8.7127	0.34393	0.131:0.0:0.1298:0.7392	.	1239	Q70Z35	PREX2_HUMAN	Y	1239	ENSP00000288368:F1239Y	ENSP00000288368:F1239Y	F	+	2	0	PREX2	69195830	1.000000	0.71417	0.998000	0.56505	0.734000	0.41952	2.028000	0.41088	0.406000	0.25560	0.533000	0.62120	TTT	PREX2	-	NULL	ENSG00000046889		0.393	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	51	0.00	0	T	NM_025170		69033276	69033276	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	1.000	A
PRM2	5620	genome.wustl.edu	37	16	11367145	11367145	+	IGR	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:11367145G>T	ENST00000241808.4	-	0	680				SNORA48_ENST00000390926.1_RNA|PRM3_ENST00000327157.2_Splice_Site_p.S103Y|RMI2_ENST00000572173.1_Intron	NM_002762.2	NP_002753.2	P04554	PRM2_HUMAN	protamine 2						cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.0?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)	7						TGCGGGTCGGGAGGGTGTCCG	0.642																																						dbGAP											1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)											28.0	44.0	38.0					16																	11367145		1813	3435	5248	-	-	-	SO:0001628	intergenic_variant	0				CCDS42118.1, CCDS66944.1	16p13.13	2013-10-17			ENSG00000122304	ENSG00000122304			9448	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 2"""	182890				16632464	Standard	NM_001286356		Approved	CT94.2	uc002dau.1	P04554	OTTHUMG00000172317		16.37:g.11367145G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMM0	Missense_Mutation	SNP	NULL	p.S103Y	ENST00000241808.4	37	c.308	CCDS42118.1	16	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185593	0.38609	.	.	ENSG00000178257	ENST00000327157	T	0.52754	0.65	4.54	3.56	0.40772	.	0.000000	0.36893	N	0.002358	T	0.35008	0.0917	L	0.29908	0.895	0.80722	D	1	B	0.16802	0.019	B	0.18561	0.022	T	0.24870	-1.0148	10	0.87932	D	0	-14.8138	9.9224	0.41472	0.0:0.0:0.7967:0.2033	.	103	Q9NNZ6	PRM3_HUMAN	Y	103	ENSP00000325638:S103Y	ENSP00000325638:S103Y	S	-	2	0	PRM3	11274646	0.996000	0.38824	0.961000	0.40146	0.026000	0.11368	2.366000	0.44204	1.235000	0.43724	0.655000	0.94253	TCC	PRM3	-	NULL	ENSG00000178257		0.642	PRM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRM3	HGNC	protein_coding	OTTHUMT00000417808.1	14	0.00	0	G			11367145	11367145	-1	no_stop_codon:pseudogene	ENST00000327157	ensembl	human	known	69_37n	missense	72	37.39	43	SNP	0.842	T
PRM2	5620	genome.wustl.edu	37	16	11367145	11367145	+	IGR	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:11367145G>T	ENST00000241808.4	-	0	680				SNORA48_ENST00000390926.1_RNA|PRM3_ENST00000327157.2_Splice_Site_p.S103Y|RMI2_ENST00000572173.1_Intron	NM_002762.2	NP_002753.2	P04554	PRM2_HUMAN	protamine 2						cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.0?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)	7						TGCGGGTCGGGAGGGTGTCCG	0.642																																						dbGAP											1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)											28.0	44.0	38.0					16																	11367145		1813	3435	5248	-	-	-	SO:0001628	intergenic_variant	0				CCDS42118.1, CCDS66944.1	16p13.13	2013-10-17			ENSG00000122304	ENSG00000122304			9448	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 2"""	182890				16632464	Standard	NM_001286356		Approved	CT94.2	uc002dau.1	P04554	OTTHUMG00000172317		16.37:g.11367145G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMM0	Missense_Mutation	SNP	NULL	p.S103Y	ENST00000241808.4	37	c.308	CCDS42118.1	16	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185593	0.38609	.	.	ENSG00000178257	ENST00000327157	T	0.52754	0.65	4.54	3.56	0.40772	.	0.000000	0.36893	N	0.002358	T	0.35008	0.0917	L	0.29908	0.895	0.80722	D	1	B	0.16802	0.019	B	0.18561	0.022	T	0.24870	-1.0148	10	0.87932	D	0	-14.8138	9.9224	0.41472	0.0:0.0:0.7967:0.2033	.	103	Q9NNZ6	PRM3_HUMAN	Y	103	ENSP00000325638:S103Y	ENSP00000325638:S103Y	S	-	2	0	PRM3	11274646	0.996000	0.38824	0.961000	0.40146	0.026000	0.11368	2.366000	0.44204	1.235000	0.43724	0.655000	0.94253	TCC	PRM3	-	NULL	ENSG00000178257		0.642	PRM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRM3	HGNC	protein_coding	OTTHUMT00000417808.1	19	0.00	0	G			11367145	11367145	-1	no_stop_codon:pseudogene	ENST00000327157	ensembl	human	known	69_37n	missense	72	37.39	43	SNP	0.842	T
PTK2	5747	genome.wustl.edu	37	8	141753376	141753376	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:141753376C>A	ENST00000522684.1	-	20	1917	c.1688G>T	c.(1687-1689)gGa>gTa	p.G563V	PTK2_ENST00000521059.1_Missense_Mutation_p.G563V|PTK2_ENST00000538769.1_Missense_Mutation_p.G231V|PTK2_ENST00000520151.1_3'UTR|PTK2_ENST00000519465.1_Missense_Mutation_p.G191V|PTK2_ENST00000519419.1_Missense_Mutation_p.G607V|PTK2_ENST00000395218.2_Missense_Mutation_p.G563V|PTK2_ENST00000535192.1_Missense_Mutation_p.G563V|PTK2_ENST00000340930.3_Missense_Mutation_p.G563V|PTK2_ENST00000517887.1_Missense_Mutation_p.G607V	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	563	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)	p.G563V(1)|p.G515V(1)|p.G585V(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TCCAAAGTCTCCTAATTTTAC	0.333																																						dbGAP											3	Substitution - Missense(3)	breast(3)											127.0	122.0	124.0					8																	141753376		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1688G>T	8.37:g.141753376C>A	ENSP00000429911:p.Gly563Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G563V	ENST00000522684.1	37	c.1688	CCDS6381.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.2|24.2	4.507771|4.507771	0.85282|0.85282	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207|ENST00000519654	D;D;D;D;D;D;D;D;D;D;D|.	0.83506|.	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73|.	5.3|5.3	5.3|5.3	0.74995|0.74995	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58524|0.58524	0.2128|0.2128	L|L	0.31664|0.31664	0.95|0.95	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.995;1.0;1.0|.	D;D;D;D;D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.988;1.0;0.999|.	T|T	0.53549|0.53549	-0.8423|-0.8423	10|5	0.87932|.	D|.	0|.	.|.	18.9768|18.9768	0.92740|0.92740	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	563;258;483;563;585;563;515;411;231;191|.	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4|.	.;.;.;FAK1_HUMAN;.;.;.;.;.;.|.	V|S	563;563;191;607;563;515;563;484;258;235;563;231;607;261;409|573	ENSP00000429911:G563V;ENSP00000438009:G563V;ENSP00000429170:G191V;ENSP00000429082:G607V;ENSP00000429474:G563V;ENSP00000378644:G563V;ENSP00000428492:G235V;ENSP00000341189:G563V;ENSP00000445742:G231V;ENSP00000429129:G607V;ENSP00000430603:G261V|.	ENSP00000341189:G563V|.	G|R	-|-	2|3	0|2	PTK2|PTK2	141822558|141822558	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.832000|5.832000	0.69337|0.69337	2.489000|2.489000	0.83994|0.83994	0.591000|0.591000	0.81541|0.81541	GGA|AGG	PTK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169398		0.333	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	HGNC	protein_coding	OTTHUMT00000378054.5	285	0.00	0	C	NM_005607		141753376	141753376	-1	no_errors	ENST00000395218	ensembl	human	known	69_37n	missense	109	18.66	25	SNP	1.000	A
PTK2	5747	genome.wustl.edu	37	8	141753376	141753376	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:141753376C>A	ENST00000522684.1	-	20	1917	c.1688G>T	c.(1687-1689)gGa>gTa	p.G563V	PTK2_ENST00000521059.1_Missense_Mutation_p.G563V|PTK2_ENST00000538769.1_Missense_Mutation_p.G231V|PTK2_ENST00000520151.1_3'UTR|PTK2_ENST00000519465.1_Missense_Mutation_p.G191V|PTK2_ENST00000519419.1_Missense_Mutation_p.G607V|PTK2_ENST00000395218.2_Missense_Mutation_p.G563V|PTK2_ENST00000535192.1_Missense_Mutation_p.G563V|PTK2_ENST00000340930.3_Missense_Mutation_p.G563V|PTK2_ENST00000517887.1_Missense_Mutation_p.G607V	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	563	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)	p.G563V(1)|p.G515V(1)|p.G585V(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TCCAAAGTCTCCTAATTTTAC	0.333																																						dbGAP											3	Substitution - Missense(3)	breast(3)											127.0	122.0	124.0					8																	141753376		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1688G>T	8.37:g.141753376C>A	ENSP00000429911:p.Gly563Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G563V	ENST00000522684.1	37	c.1688	CCDS6381.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.2|24.2	4.507771|4.507771	0.85282|0.85282	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207|ENST00000519654	D;D;D;D;D;D;D;D;D;D;D|.	0.83506|.	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73|.	5.3|5.3	5.3|5.3	0.74995|0.74995	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58524|0.58524	0.2128|0.2128	L|L	0.31664|0.31664	0.95|0.95	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.995;1.0;1.0|.	D;D;D;D;D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.988;1.0;0.999|.	T|T	0.53549|0.53549	-0.8423|-0.8423	10|5	0.87932|.	D|.	0|.	.|.	18.9768|18.9768	0.92740|0.92740	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	563;258;483;563;585;563;515;411;231;191|.	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4|.	.;.;.;FAK1_HUMAN;.;.;.;.;.;.|.	V|S	563;563;191;607;563;515;563;484;258;235;563;231;607;261;409|573	ENSP00000429911:G563V;ENSP00000438009:G563V;ENSP00000429170:G191V;ENSP00000429082:G607V;ENSP00000429474:G563V;ENSP00000378644:G563V;ENSP00000428492:G235V;ENSP00000341189:G563V;ENSP00000445742:G231V;ENSP00000429129:G607V;ENSP00000430603:G261V|.	ENSP00000341189:G563V|.	G|R	-|-	2|3	0|2	PTK2|PTK2	141822558|141822558	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.832000|5.832000	0.69337|0.69337	2.489000|2.489000	0.83994|0.83994	0.591000|0.591000	0.81541|0.81541	GGA|AGG	PTK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169398		0.333	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	HGNC	protein_coding	OTTHUMT00000378054.5	401	0.00	0	C	NM_005607		141753376	141753376	-1	no_errors	ENST00000395218	ensembl	human	known	69_37n	missense	109	18.66	25	SNP	1.000	A
RAB22A	57403	genome.wustl.edu	37	20	56929271	56929272	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A|G	A|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr20:56929271_56929272AG>CT	ENST00000244040.3	+	6	718_719	c.437_438AG>CT	c.(436-438)gAG>gCT	p.E146A		NM_020673.2	NP_065724.1	Q9UL26	RB22A_HUMAN	RAB22A, member RAS oncogene family	146					endocytosis (GO:0006897)|endosome organization (GO:0007032)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(1)|large_intestine(2)|pancreas(1)	6	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)			ATTTTTGTAGAGACCAGCGCAA	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF091034	CCDS33497.1	20q13	2008-07-03			ENSG00000124209	ENSG00000124209		"""RAB, member RAS oncogene"""	9764	protein-coding gene	gene with protein product		612966					Standard	NM_020673		Approved		uc002xyz.3	Q9UL26	OTTHUMG00000032844	Exception_encountered	20.37:g.56929271_56929272delinsCT	ENSP00000244040:p.Glu146Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR86|E1P605|Q8TF12|Q9H4E6	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E146A|p.E146D	ENST00000244040.3	37	c.437|c.438	CCDS33497.1	20																																																																																			RAB22A	-	pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000124209		0.391	RAB22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB22A	HGNC	protein_coding	OTTHUMT00000079880.2	116|115	0.00	0	A|G			56929271|56929272	56929271|56929272	+1	no_errors	ENST00000244040	ensembl	human	known	69_37n	missense	137|135	21.71|21.97	38	SNP	1.000	C|T
RAB22A	57403	genome.wustl.edu	37	20	56929271	56929272	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A|G	A|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr20:56929271_56929272AG>CT	ENST00000244040.3	+	6	718_719	c.437_438AG>CT	c.(436-438)gAG>gCT	p.E146A		NM_020673.2	NP_065724.1	Q9UL26	RB22A_HUMAN	RAB22A, member RAS oncogene family	146					endocytosis (GO:0006897)|endosome organization (GO:0007032)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(1)|large_intestine(2)|pancreas(1)	6	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)			ATTTTTGTAGAGACCAGCGCAA	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF091034	CCDS33497.1	20q13	2008-07-03			ENSG00000124209	ENSG00000124209		"""RAB, member RAS oncogene"""	9764	protein-coding gene	gene with protein product		612966					Standard	NM_020673		Approved		uc002xyz.3	Q9UL26	OTTHUMG00000032844	Exception_encountered	20.37:g.56929271_56929272delinsCT	ENSP00000244040:p.Glu146Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR86|E1P605|Q8TF12|Q9H4E6	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E146A|p.E146D	ENST00000244040.3	37	c.437|c.438	CCDS33497.1	20																																																																																			RAB22A	-	pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000124209		0.391	RAB22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB22A	HGNC	protein_coding	OTTHUMT00000079880.2	116|168	0.00	0	A|G			56929271|56929272	56929271|56929272	+1	no_errors	ENST00000244040	ensembl	human	known	69_37n	missense	137|135	21.71|21.97	38	SNP	1.000	C|T
RAB22A	57403	genome.wustl.edu	37	20	56929271	56929272	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A|G	A|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr20:56929271_56929272AG>CT	ENST00000244040.3	+	6	718_719	c.437_438AG>CT	c.(436-438)gAG>gCT	p.E146A		NM_020673.2	NP_065724.1	Q9UL26	RB22A_HUMAN	RAB22A, member RAS oncogene family	146					endocytosis (GO:0006897)|endosome organization (GO:0007032)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(1)|large_intestine(2)|pancreas(1)	6	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)			ATTTTTGTAGAGACCAGCGCAA	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF091034	CCDS33497.1	20q13	2008-07-03			ENSG00000124209	ENSG00000124209		"""RAB, member RAS oncogene"""	9764	protein-coding gene	gene with protein product		612966					Standard	NM_020673		Approved		uc002xyz.3	Q9UL26	OTTHUMG00000032844	Exception_encountered	20.37:g.56929271_56929272delinsCT	ENSP00000244040:p.Glu146Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR86|E1P605|Q8TF12|Q9H4E6	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E146A|p.E146D	ENST00000244040.3	37	c.437|c.438	CCDS33497.1	20																																																																																			RAB22A	-	pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000124209		0.391	RAB22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB22A	HGNC	protein_coding	OTTHUMT00000079880.2	168|115	0.00	0	A|G			56929271|56929272	56929271|56929272	+1	no_errors	ENST00000244040	ensembl	human	known	69_37n	missense	137|135	21.71|21.97	38	SNP	1.000	C|T
RAB22A	57403	genome.wustl.edu	37	20	56929271	56929272	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A|G	A|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr20:56929271_56929272AG>CT	ENST00000244040.3	+	6	718_719	c.437_438AG>CT	c.(436-438)gAG>gCT	p.E146A		NM_020673.2	NP_065724.1	Q9UL26	RB22A_HUMAN	RAB22A, member RAS oncogene family	146					endocytosis (GO:0006897)|endosome organization (GO:0007032)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(1)|large_intestine(2)|pancreas(1)	6	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)			ATTTTTGTAGAGACCAGCGCAA	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF091034	CCDS33497.1	20q13	2008-07-03			ENSG00000124209	ENSG00000124209		"""RAB, member RAS oncogene"""	9764	protein-coding gene	gene with protein product		612966					Standard	NM_020673		Approved		uc002xyz.3	Q9UL26	OTTHUMG00000032844	Exception_encountered	20.37:g.56929271_56929272delinsCT	ENSP00000244040:p.Glu146Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR86|E1P605|Q8TF12|Q9H4E6	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E146A|p.E146D	ENST00000244040.3	37	c.437|c.438	CCDS33497.1	20																																																																																			RAB22A	-	pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000124209		0.391	RAB22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB22A	HGNC	protein_coding	OTTHUMT00000079880.2	168	0.00	0	A|G			56929271|56929272	56929271|56929272	+1	no_errors	ENST00000244040	ensembl	human	known	69_37n	missense	137|135	21.71|21.97	38	SNP	1.000	C|T
RELN	5649	genome.wustl.edu	37	7	103216144	103216144	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:103216144C>A	ENST00000428762.1	-	29	4313	c.4154G>T	c.(4153-4155)aGa>aTa	p.R1385I	RELN_ENST00000343529.5_Missense_Mutation_p.R1385I|RELN_ENST00000424685.2_Missense_Mutation_p.R1385I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1385					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R1385I(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCATCGGAATCTGGTCTTGCT	0.433																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	104.0	113.0					7																	103216144		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4154G>T	7.37:g.103216144C>A	ENSP00000392423:p.Arg1385Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.R1385I	ENST00000428762.1	37	c.4154	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.214048	0.95104	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.42131	0.98;1.72;0.98	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.66076	0.2753	M	0.76838	2.35	0.80722	D	1	D;D	0.67145	0.996;0.986	P;P	0.62382	0.901;0.89	T	0.68164	-0.5481	10	0.87932	D	0	.	20.2982	0.98569	0.0:1.0:0.0:0.0	.	1385;1385	P78509-2;P78509	.;RELN_HUMAN	I	1385	ENSP00000392423:R1385I;ENSP00000345694:R1385I;ENSP00000388446:R1385I	ENSP00000345694:R1385I	R	-	2	0	RELN	103003380	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.873000	0.98535	0.563000	0.77884	AGA	RELN	-	superfamily_Growth_fac_rcpt	ENSG00000189056		0.433	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	53	0.00	0	C	NM_005045		103216144	103216144	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	89	25.83	31	SNP	1.000	A
RELN	5649	genome.wustl.edu	37	7	103216144	103216144	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:103216144C>A	ENST00000428762.1	-	29	4313	c.4154G>T	c.(4153-4155)aGa>aTa	p.R1385I	RELN_ENST00000343529.5_Missense_Mutation_p.R1385I|RELN_ENST00000424685.2_Missense_Mutation_p.R1385I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1385					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R1385I(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCATCGGAATCTGGTCTTGCT	0.433																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	104.0	113.0					7																	103216144		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4154G>T	7.37:g.103216144C>A	ENSP00000392423:p.Arg1385Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.R1385I	ENST00000428762.1	37	c.4154	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.214048	0.95104	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.42131	0.98;1.72;0.98	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.66076	0.2753	M	0.76838	2.35	0.80722	D	1	D;D	0.67145	0.996;0.986	P;P	0.62382	0.901;0.89	T	0.68164	-0.5481	10	0.87932	D	0	.	20.2982	0.98569	0.0:1.0:0.0:0.0	.	1385;1385	P78509-2;P78509	.;RELN_HUMAN	I	1385	ENSP00000392423:R1385I;ENSP00000345694:R1385I;ENSP00000388446:R1385I	ENSP00000345694:R1385I	R	-	2	0	RELN	103003380	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.873000	0.98535	0.563000	0.77884	AGA	RELN	-	superfamily_Growth_fac_rcpt	ENSG00000189056		0.433	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	80	0.00	0	C	NM_005045		103216144	103216144	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	89	25.83	31	SNP	1.000	A
RSPO1	284654	genome.wustl.edu	37	1	38078565	38078565	+	Silent	SNP	G	G	T	rs376389761		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:38078565G>T	ENST00000401069.1	-	7	1366	c.654C>A	c.(652-654)ggC>ggA	p.G218G	RSPO1_ENST00000401068.1_Silent_p.G218G|RSPO1_ENST00000356545.2_Silent_p.G218G|RSPO1_ENST00000373059.1_Silent_p.G191G|RSPO1_ENST00000401070.1_Silent_p.G155G|RSPO1_ENST00000401071.2_Silent_p.G155G	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	218					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.G218G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TCTCCCGCCGGCCCTGGCCTC	0.617																																					GBM(122;680 2230 27822 42821)	dbGAP											1	Substitution - coding silent(1)	breast(1)											54.0	58.0	57.0					1																	38078565		2004	4189	6193	-	-	-	SO:0001819	synonymous_variant	0			AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.654C>A	1.37:g.38078565G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Thrombospondin_1_rpt,smart_Furin_repeat,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G218	ENST00000401069.1	37	c.654	CCDS41304.1	1																																																																																			RSPO1	-	NULL	ENSG00000169218		0.617	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO1	HGNC	protein_coding	OTTHUMT00000012477.2	15	0.00	0	G	NM_173640		38078565	38078565	-1	no_errors	ENST00000356545	ensembl	human	known	69_37n	silent	73	40.48	51	SNP	0.995	T
RSPO1	284654	genome.wustl.edu	37	1	38078565	38078565	+	Silent	SNP	G	G	T	rs376389761		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:38078565G>T	ENST00000401069.1	-	7	1366	c.654C>A	c.(652-654)ggC>ggA	p.G218G	RSPO1_ENST00000401068.1_Silent_p.G218G|RSPO1_ENST00000356545.2_Silent_p.G218G|RSPO1_ENST00000373059.1_Silent_p.G191G|RSPO1_ENST00000401070.1_Silent_p.G155G|RSPO1_ENST00000401071.2_Silent_p.G155G	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	218					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.G218G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TCTCCCGCCGGCCCTGGCCTC	0.617																																					GBM(122;680 2230 27822 42821)	dbGAP											1	Substitution - coding silent(1)	breast(1)											54.0	58.0	57.0					1																	38078565		2004	4189	6193	-	-	-	SO:0001819	synonymous_variant	0			AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.654C>A	1.37:g.38078565G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Thrombospondin_1_rpt,smart_Furin_repeat,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G218	ENST00000401069.1	37	c.654	CCDS41304.1	1																																																																																			RSPO1	-	NULL	ENSG00000169218		0.617	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO1	HGNC	protein_coding	OTTHUMT00000012477.2	22	0.00	0	G	NM_173640		38078565	38078565	-1	no_errors	ENST00000356545	ensembl	human	known	69_37n	silent	73	40.48	51	SNP	0.995	T
SFMBT2	57713	genome.wustl.edu	37	10	7318923	7318923	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:7318923T>C	ENST00000361972.4	-	7	891	c.801A>G	c.(799-801)gaA>gaG	p.E267E	SFMBT2_ENST00000397167.1_Silent_p.E267E	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	267					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.E267E(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TACATTTCCATTCAGAGGCCA	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											149.0	142.0	145.0					10																	7318923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.801A>G	10.37:g.7318923T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD09|Q9HCF5	Silent	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.E267	ENST00000361972.4	37	c.801	CCDS31138.1	10																																																																																			SFMBT2	-	smart_Mbt,pfscan_Mbt	ENSG00000198879		0.403	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	149	0.00	0	T	NM_001029880		7318923	7318923	-1	no_errors	ENST00000361972	ensembl	human	known	69_37n	silent	48	59.32	70	SNP	0.057	C
SFMBT2	57713	genome.wustl.edu	37	10	7318923	7318923	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:7318923T>C	ENST00000361972.4	-	7	891	c.801A>G	c.(799-801)gaA>gaG	p.E267E	SFMBT2_ENST00000397167.1_Silent_p.E267E	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	267					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.E267E(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TACATTTCCATTCAGAGGCCA	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											149.0	142.0	145.0					10																	7318923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.801A>G	10.37:g.7318923T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD09|Q9HCF5	Silent	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.E267	ENST00000361972.4	37	c.801	CCDS31138.1	10																																																																																			SFMBT2	-	smart_Mbt,pfscan_Mbt	ENSG00000198879		0.403	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	203	0.00	0	T	NM_001029880		7318923	7318923	-1	no_errors	ENST00000361972	ensembl	human	known	69_37n	silent	48	59.32	70	SNP	0.057	C
SFXN5	94097	genome.wustl.edu	37	2	73215386	73215386	+	Splice_Site	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:73215386C>T	ENST00000272433.2	-	10	756		c.e10+1		SFXN5_ENST00000410065.1_Splice_Site|SFXN5_ENST00000474528.1_Splice_Site	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)	p.?(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						GCAGGTCTTACCTACAGCAGG	0.577																																						dbGAP											1	Unknown(1)	breast(1)											108.0	92.0	97.0					2																	73215386		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.625+1G>A	2.37:g.73215386C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K116|Q494Y3|Q53T29	Splice_Site	SNP	-	e10+1	ENST00000272433.2	37	c.625+1	CCDS1922.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098456	0.76870	.	.	ENSG00000144040	ENST00000272433;ENST00000411783;ENST00000410065	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0323	0.86464	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SFXN5	73068894	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.318000	0.72866	2.699000	0.92147	0.591000	0.81541	.	SFXN5	-	-	ENSG00000144040		0.577	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	HGNC	protein_coding	OTTHUMT00000251991.1	28	0.00	0	C	NM_144579	Intron	73215386	73215386	-1	no_errors	ENST00000272433	ensembl	human	known	69_37n	splice_site	149	26.24	53	SNP	1.000	T
SFXN5	94097	genome.wustl.edu	37	2	73215386	73215386	+	Splice_Site	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:73215386C>T	ENST00000272433.2	-	10	756		c.e10+1		SFXN5_ENST00000410065.1_Splice_Site|SFXN5_ENST00000474528.1_Splice_Site	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)	p.?(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						GCAGGTCTTACCTACAGCAGG	0.577																																						dbGAP											1	Unknown(1)	breast(1)											108.0	92.0	97.0					2																	73215386		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.625+1G>A	2.37:g.73215386C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K116|Q494Y3|Q53T29	Splice_Site	SNP	-	e10+1	ENST00000272433.2	37	c.625+1	CCDS1922.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098456	0.76870	.	.	ENSG00000144040	ENST00000272433;ENST00000411783;ENST00000410065	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0323	0.86464	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SFXN5	73068894	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.318000	0.72866	2.699000	0.92147	0.591000	0.81541	.	SFXN5	-	-	ENSG00000144040		0.577	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	HGNC	protein_coding	OTTHUMT00000251991.1	39	0.00	0	C	NM_144579	Intron	73215386	73215386	-1	no_errors	ENST00000272433	ensembl	human	known	69_37n	splice_site	149	26.24	53	SNP	1.000	T
MRPL12	6182	genome.wustl.edu	37	17	79671378	79671379	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:79671378_79671379insC	ENST00000333676.3	+	2	324_325	c.179_180insC	c.(178-183)taccccfs	p.YP60fs	SLC25A10_ENST00000541223.1_Frame_Shift_Ins_p.YP60fs|SLC25A10_ENST00000571730.1_Frame_Shift_Ins_p.YP60fs|RP13-1032I1.7_ENST00000575312.1_RNA	NM_002949.3	NP_002940.2	P52815	RM12_HUMAN	mitochondrial ribosomal protein L12	60					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|lung(2)|urinary_tract(1)	4	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CCCAAGGAGTACCCCCCCAAGA	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X79865	CCDS11785.1	17q25	2012-11-14			ENSG00000262814	ENSG00000262814		"""Mitochondrial ribosomal proteins / large subunits"""	10378	protein-coding gene	gene with protein product		602375		RPML12		8626705, 9169145	Standard	NM_002949		Approved	MRPL7/L12, MRPL7		P52815	OTTHUMG00000178171	ENST00000333676.3:c.186dupC	17.37:g.79671385_79671385dupC	ENSP00000333837:p.Tyr60fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969U0|Q9HCA2|Q9UQJ3	Frame_Shift_Ins	INS	pfam_Mitochondrial_sb/sol_carrier,pfam_Ribosomal_L7/L12_C,superfamily_Mt_carrier_dom,superfamily_Ribosomal_L7/L12_oligo,prints_Mit_uncoupling,pfscan_Mitochondrial_sb/sol_carrier	p.K63fs	ENST00000333676.3	37	c.179_180	CCDS11785.1	17																																																																																			SLC25A10	-	superfamily_Ribosomal_L7/L12_oligo	ENSG00000183048		0.599	MRPL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A10	HGNC	protein_coding	OTTHUMT00000440812.1	12	0.00	0	-	NM_002949		79671378	79671379	+1	no_errors	ENST00000541223	ensembl	human	known	69_37n	frame_shift_ins	152	44.73	123	INS	1.000:1.000	C
MRPL12	6182	genome.wustl.edu	37	17	79671378	79671379	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:79671378_79671379insC	ENST00000333676.3	+	2	324_325	c.179_180insC	c.(178-183)taccccfs	p.YP60fs	SLC25A10_ENST00000541223.1_Frame_Shift_Ins_p.YP60fs|SLC25A10_ENST00000571730.1_Frame_Shift_Ins_p.YP60fs|RP13-1032I1.7_ENST00000575312.1_RNA	NM_002949.3	NP_002940.2	P52815	RM12_HUMAN	mitochondrial ribosomal protein L12	60					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|lung(2)|urinary_tract(1)	4	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CCCAAGGAGTACCCCCCCAAGA	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X79865	CCDS11785.1	17q25	2012-11-14			ENSG00000262814	ENSG00000262814		"""Mitochondrial ribosomal proteins / large subunits"""	10378	protein-coding gene	gene with protein product		602375		RPML12		8626705, 9169145	Standard	NM_002949		Approved	MRPL7/L12, MRPL7		P52815	OTTHUMG00000178171	ENST00000333676.3:c.186dupC	17.37:g.79671385_79671385dupC	ENSP00000333837:p.Tyr60fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969U0|Q9HCA2|Q9UQJ3	Frame_Shift_Ins	INS	pfam_Mitochondrial_sb/sol_carrier,pfam_Ribosomal_L7/L12_C,superfamily_Mt_carrier_dom,superfamily_Ribosomal_L7/L12_oligo,prints_Mit_uncoupling,pfscan_Mitochondrial_sb/sol_carrier	p.K63fs	ENST00000333676.3	37	c.179_180	CCDS11785.1	17																																																																																			SLC25A10	-	superfamily_Ribosomal_L7/L12_oligo	ENSG00000183048		0.599	MRPL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A10	HGNC	protein_coding	OTTHUMT00000440812.1	22	0.00	0	-	NM_002949		79671378	79671379	+1	no_errors	ENST00000541223	ensembl	human	known	69_37n	frame_shift_ins	152	44.73	123	INS	1.000:1.000	C
SLCO4C1	353189	genome.wustl.edu	37	5	101572605	101572605	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:101572605A>G	ENST00000310954.6	-	13	2418	c.2132T>C	c.(2131-2133)gTt>gCt	p.V711A		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1									p.V711A(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TTCTGCTAAAACATTAGTCAC	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	144.0	146.0					5																	101572605		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.2132T>C	5.37:g.101572605A>G	ENSP00000309741:p.Val711Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.V711A	ENST00000310954.6	37	c.2132	CCDS34205.1	5	.	.	.	.	.	.	.	.	.	.	A	13.56	2.272390	0.40194	.	.	ENSG00000173930	ENST00000310954	T	0.42131	0.98	4.83	4.83	0.62350	.	0.899109	0.09358	N	0.813204	T	0.22859	0.0552	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.12837	0.008	T	0.11060	-1.0603	10	0.09084	T	0.74	.	10.7565	0.46241	1.0:0.0:0.0:0.0	.	711	Q6ZQN7	SO4C1_HUMAN	A	711	ENSP00000309741:V711A	ENSP00000309741:V711A	V	-	2	0	SLCO4C1	101600504	0.063000	0.20901	0.232000	0.24009	0.120000	0.20174	2.008000	0.40893	2.042000	0.60477	0.529000	0.55759	GTT	SLCO4C1	-	NULL	ENSG00000173930		0.353	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	329	0.00	0	A	NM_180991		101572605	101572605	-1	no_errors	ENST00000310954	ensembl	human	known	69_37n	missense	52	33.33	26	SNP	0.227	G
SLCO4C1	353189	genome.wustl.edu	37	5	101572605	101572605	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:101572605A>G	ENST00000310954.6	-	13	2418	c.2132T>C	c.(2131-2133)gTt>gCt	p.V711A		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1									p.V711A(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TTCTGCTAAAACATTAGTCAC	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	144.0	146.0					5																	101572605		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.2132T>C	5.37:g.101572605A>G	ENSP00000309741:p.Val711Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.V711A	ENST00000310954.6	37	c.2132	CCDS34205.1	5	.	.	.	.	.	.	.	.	.	.	A	13.56	2.272390	0.40194	.	.	ENSG00000173930	ENST00000310954	T	0.42131	0.98	4.83	4.83	0.62350	.	0.899109	0.09358	N	0.813204	T	0.22859	0.0552	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.12837	0.008	T	0.11060	-1.0603	10	0.09084	T	0.74	.	10.7565	0.46241	1.0:0.0:0.0:0.0	.	711	Q6ZQN7	SO4C1_HUMAN	A	711	ENSP00000309741:V711A	ENSP00000309741:V711A	V	-	2	0	SLCO4C1	101600504	0.063000	0.20901	0.232000	0.24009	0.120000	0.20174	2.008000	0.40893	2.042000	0.60477	0.529000	0.55759	GTT	SLCO4C1	-	NULL	ENSG00000173930		0.353	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	463	0.00	0	A	NM_180991		101572605	101572605	-1	no_errors	ENST00000310954	ensembl	human	known	69_37n	missense	52	33.33	26	SNP	0.227	G
SLITRK6	84189	genome.wustl.edu	37	13	86368270	86368270	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr13:86368270C>A	ENST00000400286.2	-	2	2972	c.2374G>T	c.(2374-2376)Gga>Tga	p.G792*		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	792					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.G792*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TCGTGGGCTCCAGGATAATGT	0.398																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											161.0	150.0	153.0					13																	86368270		1876	4105	5981	-	-	-	SO:0001587	stop_gained	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.2374G>T	13.37:g.86368270C>A	ENSP00000383143:p.Gly792*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G792*	ENST00000400286.2	37	c.2374	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	C	43	9.925829	0.99297	.	.	ENSG00000184564	ENST00000400286	.	.	.	5.84	5.84	0.93424	.	0.195432	0.45126	D	0.000390	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-16.5033	12.0883	0.53710	0.0:0.9215:0.0:0.0785	.	.	.	.	X	792	.	ENSP00000383143:G792X	G	-	1	0	SLITRK6	85266271	0.994000	0.37717	0.990000	0.47175	0.533000	0.34776	3.091000	0.50199	2.760000	0.94817	0.655000	0.94253	GGA	SLITRK6	-	NULL	ENSG00000184564		0.398	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	184	0.00	0	C	NM_032229		86368270	86368270	-1	no_errors	ENST00000400286	ensembl	human	known	69_37n	nonsense	89	44.03	70	SNP	0.997	A
SLITRK6	84189	genome.wustl.edu	37	13	86368270	86368270	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr13:86368270C>A	ENST00000400286.2	-	2	2972	c.2374G>T	c.(2374-2376)Gga>Tga	p.G792*		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	792					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.G792*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TCGTGGGCTCCAGGATAATGT	0.398																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											161.0	150.0	153.0					13																	86368270		1876	4105	5981	-	-	-	SO:0001587	stop_gained	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.2374G>T	13.37:g.86368270C>A	ENSP00000383143:p.Gly792*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G792*	ENST00000400286.2	37	c.2374	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	C	43	9.925829	0.99297	.	.	ENSG00000184564	ENST00000400286	.	.	.	5.84	5.84	0.93424	.	0.195432	0.45126	D	0.000390	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-16.5033	12.0883	0.53710	0.0:0.9215:0.0:0.0785	.	.	.	.	X	792	.	ENSP00000383143:G792X	G	-	1	0	SLITRK6	85266271	0.994000	0.37717	0.990000	0.47175	0.533000	0.34776	3.091000	0.50199	2.760000	0.94817	0.655000	0.94253	GGA	SLITRK6	-	NULL	ENSG00000184564		0.398	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	282	0.00	0	C	NM_032229		86368270	86368270	-1	no_errors	ENST00000400286	ensembl	human	known	69_37n	nonsense	89	44.03	70	SNP	0.997	A
SMARCA4	6597	genome.wustl.edu	37	19	11170528	11170528	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:11170528G>T	ENST00000429416.3	+	34	5016	c.4735G>T	c.(4735-4737)Gaa>Taa	p.E1579*	SMARCA4_ENST00000541122.2_Nonsense_Mutation_p.E1549*|SMARCA4_ENST00000344626.4_Nonsense_Mutation_p.E1579*|SMARCA4_ENST00000450717.3_Nonsense_Mutation_p.E1548*|SMARCA4_ENST00000358026.2_Nonsense_Mutation_p.E1611*|SMARCA4_ENST00000444061.3_Nonsense_Mutation_p.E1545*|SMARCA4_ENST00000413806.3_Nonsense_Mutation_p.E1549*|SMARCA4_ENST00000590574.1_Nonsense_Mutation_p.E1546*|SMARCA4_ENST00000589677.1_Nonsense_Mutation_p.E1548*	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1579	Poly-Glu.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E1611*(1)|p.E1579*(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				tgaggaggaggaagagggcga	0.612			"""F, N, Mis"""		NSCLC																																	dbGAP		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	3	Substitution - Nonsense(2)|Unknown(1)	breast(2)|lung(1)											49.0	44.0	46.0					19																	11170528		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.4735G>T	19.37:g.11170528G>T	ENSP00000395654:p.Glu1579*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.E1611*	ENST00000429416.3	37	c.4831	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	G	44	10.549081	0.99425	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.	.	.	4.35	4.35	0.52113	.	0.319657	0.27284	N	0.020069	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-8.8998	15.8073	0.78524	0.0:0.0:1.0:0.0	.	.	.	.	X	1579;1611;1613;1579;1546;1545;1548;1549	.	ENSP00000343896:E1579X	E	+	1	0	SMARCA4	11031528	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	9.362000	0.97126	2.262000	0.75019	0.561000	0.74099	GAA	SMARCA4	-	NULL	ENSG00000127616		0.612	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	8	0.00	0	G	NM_003072		11170528	11170528	+1	no_errors	ENST00000358026	ensembl	human	known	69_37n	nonsense	62	44.64	50	SNP	1.000	T
SMG1	23049	genome.wustl.edu	37	16	18869547	18869547	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:18869547C>A	ENST00000446231.2	-	29	4591	c.4179G>T	c.(4177-4179)tgG>tgT	p.W1393C	SMG1_ENST00000389467.3_Missense_Mutation_p.W1393C			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1393	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.W1389C(1)|p.W1393C(1)		NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATGCCTGCATCCATGGCCTCA	0.358																																						dbGAP											2	Substitution - Missense(2)	breast(2)											40.0	36.0	37.0					16																	18869547		1834	4082	5916	-	-	-	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.4179G>T	16.37:g.18869547C>A	ENSP00000402515:p.Trp1393Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.W1393C	ENST00000446231.2	37	c.4179	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	.	13.44	2.237042	0.39498	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.67523	-0.27;-0.27	4.77	4.77	0.60923	PIK-related kinase (1);Armadillo-type fold (1);	0.000000	0.50627	D	0.000108	T	0.60222	0.2252	N	0.19112	0.55	0.58432	D	0.999994	D	0.64830	0.994	P	0.48189	0.57	T	0.63817	-0.6551	10	0.41790	T	0.15	.	18.1465	0.89656	0.0:1.0:0.0:0.0	.	1393	Q96Q15	SMG1_HUMAN	C	1393	ENSP00000402515:W1393C;ENSP00000374118:W1393C	ENSP00000374118:W1393C	W	-	3	0	SMG1	18777048	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	4.826000	0.62715	2.330000	0.79161	0.305000	0.20034	TGG	SMG1	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000157106		0.358	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	298	0.00	0	C	NM_015092		18869547	18869547	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	missense	82	27.43	31	SNP	1.000	A
SMG1	23049	genome.wustl.edu	37	16	18869547	18869547	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:18869547C>A	ENST00000446231.2	-	29	4591	c.4179G>T	c.(4177-4179)tgG>tgT	p.W1393C	SMG1_ENST00000389467.3_Missense_Mutation_p.W1393C			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1393	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.W1389C(1)|p.W1393C(1)		NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATGCCTGCATCCATGGCCTCA	0.358																																						dbGAP											2	Substitution - Missense(2)	breast(2)											40.0	36.0	37.0					16																	18869547		1834	4082	5916	-	-	-	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.4179G>T	16.37:g.18869547C>A	ENSP00000402515:p.Trp1393Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.W1393C	ENST00000446231.2	37	c.4179	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	.	13.44	2.237042	0.39498	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.67523	-0.27;-0.27	4.77	4.77	0.60923	PIK-related kinase (1);Armadillo-type fold (1);	0.000000	0.50627	D	0.000108	T	0.60222	0.2252	N	0.19112	0.55	0.58432	D	0.999994	D	0.64830	0.994	P	0.48189	0.57	T	0.63817	-0.6551	10	0.41790	T	0.15	.	18.1465	0.89656	0.0:1.0:0.0:0.0	.	1393	Q96Q15	SMG1_HUMAN	C	1393	ENSP00000402515:W1393C;ENSP00000374118:W1393C	ENSP00000374118:W1393C	W	-	3	0	SMG1	18777048	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	4.826000	0.62715	2.330000	0.79161	0.305000	0.20034	TGG	SMG1	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000157106		0.358	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	427	0.00	0	C	NM_015092		18869547	18869547	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	missense	82	27.43	31	SNP	1.000	A
SP4	6671	genome.wustl.edu	37	7	21550872	21550872	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:21550872C>T	ENST00000222584.3	+	6	2558	c.2340C>T	c.(2338-2340)aaC>aaT	p.N780N		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	780					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.N780N(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TTTCAACCAACATGGAAGAAT	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	62.0	61.0					7																	21550872		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.2340C>T	7.37:g.21550872C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60402|Q32M52	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N780	ENST00000222584.3	37	c.2340	CCDS5373.1	7																																																																																			SP4	-	NULL	ENSG00000105866		0.423	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	33	0.00	0	C	NM_003112		21550872	21550872	+1	no_errors	ENST00000222584	ensembl	human	known	69_37n	silent	68	22.73	20	SNP	1.000	T
SP4	6671	genome.wustl.edu	37	7	21550872	21550872	+	Silent	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:21550872C>T	ENST00000222584.3	+	6	2558	c.2340C>T	c.(2338-2340)aaC>aaT	p.N780N		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	780					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.N780N(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TTTCAACCAACATGGAAGAAT	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	62.0	61.0					7																	21550872		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.2340C>T	7.37:g.21550872C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60402|Q32M52	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N780	ENST00000222584.3	37	c.2340	CCDS5373.1	7																																																																																			SP4	-	NULL	ENSG00000105866		0.423	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	53	0.00	0	C	NM_003112		21550872	21550872	+1	no_errors	ENST00000222584	ensembl	human	known	69_37n	silent	68	22.73	20	SNP	1.000	T
SPECC1L	23384	genome.wustl.edu	37	22	24717313	24717313	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr22:24717313C>T	ENST00000314328.9	+	5	650	c.365C>T	c.(364-366)aCt>aTt	p.T122I	SPECC1L_ENST00000541492.1_Missense_Mutation_p.T122I|SPECC1L_ENST00000416735.1_Intron|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.T122I|SPECC1L_ENST00000437398.1_Missense_Mutation_p.T122I	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	122					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						TCCAGTTCTACTAGAGAAAGA	0.423																																						dbGAP											0													130.0	140.0	136.0					22																	24717313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.365C>T	22.37:g.24717313C>T	ENSP00000325785:p.Thr122Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_HLH_DNA-bd,smart_CH-domain,pfscan_CH-domain	p.T122I	ENST00000314328.9	37	c.365	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855695	0.51376	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492;ENST00000440893	T;T;T;T;T	0.61627	0.09;2.56;0.09;3.08;0.76	5.72	5.72	0.89469	.	0.445356	0.26092	N	0.026389	T	0.53367	0.1792	L	0.29908	0.895	0.38956	D	0.95844	B;B	0.21905	0.062;0.037	B;B	0.31812	0.136;0.064	T	0.52132	-0.8616	10	0.49607	T	0.09	-10.7577	18.8711	0.92315	0.0:1.0:0.0:0.0	.	122;122	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	I	150;122;122;122;122;61	ENSP00000393363:T122I;ENSP00000405671:T122I;ENSP00000325785:T122I;ENSP00000439633:T122I;ENSP00000414354:T61I	ENSP00000325785:T122I	T	+	2	0	SPECC1L	23047313	0.628000	0.27138	0.998000	0.56505	0.990000	0.78478	2.644000	0.46613	2.717000	0.92951	0.650000	0.86243	ACT	SPECC1L	-	NULL	ENSG00000100014		0.423	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	65	0.00	0	C	NM_015330		24717313	24717313	+1	no_errors	ENST00000314328	ensembl	human	known	69_37n	missense	63	24.10	20	SNP	0.970	T
SPECC1L	23384	genome.wustl.edu	37	22	24717313	24717313	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr22:24717313C>T	ENST00000314328.9	+	5	650	c.365C>T	c.(364-366)aCt>aTt	p.T122I	SPECC1L_ENST00000541492.1_Missense_Mutation_p.T122I|SPECC1L_ENST00000416735.1_Intron|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.T122I|SPECC1L_ENST00000437398.1_Missense_Mutation_p.T122I	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	122					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						TCCAGTTCTACTAGAGAAAGA	0.423																																						dbGAP											0													130.0	140.0	136.0					22																	24717313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.365C>T	22.37:g.24717313C>T	ENSP00000325785:p.Thr122Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_HLH_DNA-bd,smart_CH-domain,pfscan_CH-domain	p.T122I	ENST00000314328.9	37	c.365	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855695	0.51376	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492;ENST00000440893	T;T;T;T;T	0.61627	0.09;2.56;0.09;3.08;0.76	5.72	5.72	0.89469	.	0.445356	0.26092	N	0.026389	T	0.53367	0.1792	L	0.29908	0.895	0.38956	D	0.95844	B;B	0.21905	0.062;0.037	B;B	0.31812	0.136;0.064	T	0.52132	-0.8616	10	0.49607	T	0.09	-10.7577	18.8711	0.92315	0.0:1.0:0.0:0.0	.	122;122	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	I	150;122;122;122;122;61	ENSP00000393363:T122I;ENSP00000405671:T122I;ENSP00000325785:T122I;ENSP00000439633:T122I;ENSP00000414354:T61I	ENSP00000325785:T122I	T	+	2	0	SPECC1L	23047313	0.628000	0.27138	0.998000	0.56505	0.990000	0.78478	2.644000	0.46613	2.717000	0.92951	0.650000	0.86243	ACT	SPECC1L	-	NULL	ENSG00000100014		0.423	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	90	0.00	0	C	NM_015330		24717313	24717313	+1	no_errors	ENST00000314328	ensembl	human	known	69_37n	missense	63	24.10	20	SNP	0.970	T
STAT3	6774	genome.wustl.edu	37	17	40468877	40468877	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:40468877G>A	ENST00000264657.5	-	23	2499	c.2187C>T	c.(2185-2187)cgC>cgT	p.R729R	STAT3_ENST00000389272.3_Silent_p.R631R|STAT3_ENST00000404395.3_Silent_p.R728R|STAT3_ENST00000585517.1_Intron|STAT3_ENST00000588969.1_Silent_p.R729R	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	729					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R729R(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		AATCTAAAGTGCGGGGGGACA	0.512									Hyperimmunoglobulin E Recurrent Infection Syndrome																													dbGAP											1	Substitution - coding silent(1)	breast(1)											78.0	76.0	76.0					17																	40468877		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.2187C>T	17.37:g.40468877G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B8|K7ENL3|O14916|Q9BW54	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.R729	ENST00000264657.5	37	c.2187	CCDS32656.1	17																																																																																			STAT3	-	NULL	ENSG00000168610		0.512	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT3	HGNC	protein_coding	OTTHUMT00000319353.3	23	0.00	0	G	NM_139276, NM_003150		40468877	40468877	-1	no_errors	ENST00000264657	ensembl	human	known	69_37n	silent	54	30.77	24	SNP	1.000	A
STAT3	6774	genome.wustl.edu	37	17	40468877	40468877	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr17:40468877G>A	ENST00000264657.5	-	23	2499	c.2187C>T	c.(2185-2187)cgC>cgT	p.R729R	STAT3_ENST00000389272.3_Silent_p.R631R|STAT3_ENST00000404395.3_Silent_p.R728R|STAT3_ENST00000585517.1_Intron|STAT3_ENST00000588969.1_Silent_p.R729R	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	729					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R729R(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		AATCTAAAGTGCGGGGGGACA	0.512									Hyperimmunoglobulin E Recurrent Infection Syndrome																													dbGAP											1	Substitution - coding silent(1)	breast(1)											78.0	76.0	76.0					17																	40468877		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.2187C>T	17.37:g.40468877G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B8|K7ENL3|O14916|Q9BW54	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.R729	ENST00000264657.5	37	c.2187	CCDS32656.1	17																																																																																			STAT3	-	NULL	ENSG00000168610		0.512	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT3	HGNC	protein_coding	OTTHUMT00000319353.3	36	0.00	0	G	NM_139276, NM_003150		40468877	40468877	-1	no_errors	ENST00000264657	ensembl	human	known	69_37n	silent	54	30.77	24	SNP	1.000	A
SYK	6850	genome.wustl.edu	37	9	93607735	93607735	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr9:93607735C>G	ENST00000375754.4	+	3	585	c.437C>G	c.(436-438)gCc>gGc	p.A146G	SYK_ENST00000375751.4_Missense_Mutation_p.A146G|SYK_ENST00000375747.1_Missense_Mutation_p.A146G|SYK_ENST00000375746.1_Missense_Mutation_p.A146G	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	146	Interdomain A.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.A146G(2)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						CTGGAGCAGGCCATCATCAGT	0.483			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																	dbGAP		Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	2	Substitution - Missense(2)	breast(2)											66.0	65.0	65.0					9																	93607735		2203	4300	6503	-	-	-	SO:0001583	missense	0			L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.437C>G	9.37:g.93607735C>G	ENSP00000364907:p.Ala146Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.A146G	ENST00000375754.4	37	c.437	CCDS6688.1	9	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851928	0.91355	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.1	5.1	0.69264	Tyrosine-protein kinase SYK/ZAP-70, inter-SH2 domain (1);	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	M	0.71581	2.175	0.80722	D	1	D;D;D	0.76494	0.998;0.997;0.999	D;D;D	0.85130	0.994;0.986;0.997	D	0.86830	0.2010	10	0.72032	D	0.01	.	19.0745	0.93154	0.0:1.0:0.0:0.0	.	146;146;146	P43405-2;P43405;C3W981	.;KSYK_HUMAN;.	G	146	ENSP00000364907:A146G;ENSP00000364904:A146G;ENSP00000364899:A146G;ENSP00000364898:A146G	ENSP00000364898:A146G	A	+	2	0	SYK	92647556	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.152000	0.77419	2.803000	0.96430	0.585000	0.79938	GCC	SYK	-	pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70	ENSG00000165025		0.483	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYK	HGNC	protein_coding	OTTHUMT00000053018.1	39	0.00	0	C			93607735	93607735	+1	no_errors	ENST00000375746	ensembl	human	known	69_37n	missense	55	17.91	12	SNP	1.000	G
SYK	6850	genome.wustl.edu	37	9	93607735	93607735	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr9:93607735C>G	ENST00000375754.4	+	3	585	c.437C>G	c.(436-438)gCc>gGc	p.A146G	SYK_ENST00000375751.4_Missense_Mutation_p.A146G|SYK_ENST00000375747.1_Missense_Mutation_p.A146G|SYK_ENST00000375746.1_Missense_Mutation_p.A146G	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	146	Interdomain A.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.A146G(2)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						CTGGAGCAGGCCATCATCAGT	0.483			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																	dbGAP		Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	2	Substitution - Missense(2)	breast(2)											66.0	65.0	65.0					9																	93607735		2203	4300	6503	-	-	-	SO:0001583	missense	0			L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.437C>G	9.37:g.93607735C>G	ENSP00000364907:p.Ala146Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.A146G	ENST00000375754.4	37	c.437	CCDS6688.1	9	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851928	0.91355	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.1	5.1	0.69264	Tyrosine-protein kinase SYK/ZAP-70, inter-SH2 domain (1);	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	M	0.71581	2.175	0.80722	D	1	D;D;D	0.76494	0.998;0.997;0.999	D;D;D	0.85130	0.994;0.986;0.997	D	0.86830	0.2010	10	0.72032	D	0.01	.	19.0745	0.93154	0.0:1.0:0.0:0.0	.	146;146;146	P43405-2;P43405;C3W981	.;KSYK_HUMAN;.	G	146	ENSP00000364907:A146G;ENSP00000364904:A146G;ENSP00000364899:A146G;ENSP00000364898:A146G	ENSP00000364898:A146G	A	+	2	0	SYK	92647556	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.152000	0.77419	2.803000	0.96430	0.585000	0.79938	GCC	SYK	-	pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70	ENSG00000165025		0.483	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYK	HGNC	protein_coding	OTTHUMT00000053018.1	55	0.00	0	C			93607735	93607735	+1	no_errors	ENST00000375746	ensembl	human	known	69_37n	missense	55	17.91	12	SNP	1.000	G
TARS	6897	genome.wustl.edu	37	5	33456148	33456148	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:33456148T>C	ENST00000265112.3	+	7	1046	c.735T>C	c.(733-735)aaT>aaC	p.N245N	TARS_ENST00000414361.2_Silent_p.N124N|TARS_ENST00000502553.1_Silent_p.N245N|TARS_ENST00000455217.2_Silent_p.N278N|TARS_ENST00000541634.1_Silent_p.N141N	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	245					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)	p.N245N(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	AAAAGGTGAATACTCCAACTA	0.274																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	121.0	120.0					5																	33456148		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.735T>C	5.37:g.33456148T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-synth_IIa	p.N245	ENST00000265112.3	37	c.735	CCDS3899.1	5																																																																																			TARS	-	superfamily_Thr/Ala-tRNA-synth_IIc_edit,tigrfam_Thr-tRNA-synth_IIa	ENSG00000113407		0.274	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	265	0.00	0	T	NM_152295		33456148	33456148	+1	no_errors	ENST00000265112	ensembl	human	known	69_37n	silent	96	13.51	15	SNP	1.000	C
TARS	6897	genome.wustl.edu	37	5	33456148	33456148	+	Silent	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr5:33456148T>C	ENST00000265112.3	+	7	1046	c.735T>C	c.(733-735)aaT>aaC	p.N245N	TARS_ENST00000414361.2_Silent_p.N124N|TARS_ENST00000502553.1_Silent_p.N245N|TARS_ENST00000455217.2_Silent_p.N278N|TARS_ENST00000541634.1_Silent_p.N141N	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	245					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)	p.N245N(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	AAAAGGTGAATACTCCAACTA	0.274																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	121.0	120.0					5																	33456148		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.735T>C	5.37:g.33456148T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-synth_IIa	p.N245	ENST00000265112.3	37	c.735	CCDS3899.1	5																																																																																			TARS	-	superfamily_Thr/Ala-tRNA-synth_IIc_edit,tigrfam_Thr-tRNA-synth_IIa	ENSG00000113407		0.274	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	365	0.00	0	T	NM_152295		33456148	33456148	+1	no_errors	ENST00000265112	ensembl	human	known	69_37n	silent	96	13.51	15	SNP	1.000	C
TAS2R16	50833	genome.wustl.edu	37	7	122635007	122635007	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:122635007A>C	ENST00000249284.2	-	1	747	c.682T>G	c.(682-684)Tcc>Gcc	p.S228A		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	228					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)	p.S228A(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACGGCAAGGGACCTCAGGGCA	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	128.0	136.0					7																	122635007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.682T>G	7.37:g.122635007A>C	ENSP00000249284:p.Ser228Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S228A	ENST00000249284.2	37	c.682	CCDS5785.1	7	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836938	0.50951	.	.	ENSG00000128519	ENST00000249284	T	0.36340	1.26	4.5	3.31	0.37934	.	0.274240	0.31484	N	0.007561	T	0.52108	0.1714	M	0.67625	2.065	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.36720	-0.9736	10	0.52906	T	0.07	.	7.3095	0.26467	0.8045:0.0:0.0:0.1955	.	228	Q9NYV7	T2R16_HUMAN	A	228	ENSP00000249284:S228A	ENSP00000249284:S228A	S	-	1	0	TAS2R16	122422243	0.002000	0.14202	0.012000	0.15200	0.115000	0.19883	1.569000	0.36428	0.824000	0.34613	0.533000	0.62120	TCC	TAS2R16	-	pfam_TAS2_rcpt	ENSG00000128519		0.438	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	HGNC	protein_coding	OTTHUMT00000347409.1	68	0.00	0	A	NM_016945		122635007	122635007	-1	no_errors	ENST00000249284	ensembl	human	known	69_37n	missense	47	45.35	39	SNP	0.044	C
TAS2R16	50833	genome.wustl.edu	37	7	122635007	122635007	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:122635007A>C	ENST00000249284.2	-	1	747	c.682T>G	c.(682-684)Tcc>Gcc	p.S228A		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	228					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)	p.S228A(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACGGCAAGGGACCTCAGGGCA	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	128.0	136.0					7																	122635007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.682T>G	7.37:g.122635007A>C	ENSP00000249284:p.Ser228Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S228A	ENST00000249284.2	37	c.682	CCDS5785.1	7	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836938	0.50951	.	.	ENSG00000128519	ENST00000249284	T	0.36340	1.26	4.5	3.31	0.37934	.	0.274240	0.31484	N	0.007561	T	0.52108	0.1714	M	0.67625	2.065	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.36720	-0.9736	10	0.52906	T	0.07	.	7.3095	0.26467	0.8045:0.0:0.0:0.1955	.	228	Q9NYV7	T2R16_HUMAN	A	228	ENSP00000249284:S228A	ENSP00000249284:S228A	S	-	1	0	TAS2R16	122422243	0.002000	0.14202	0.012000	0.15200	0.115000	0.19883	1.569000	0.36428	0.824000	0.34613	0.533000	0.62120	TCC	TAS2R16	-	pfam_TAS2_rcpt	ENSG00000128519		0.438	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	HGNC	protein_coding	OTTHUMT00000347409.1	92	0.00	0	A	NM_016945		122635007	122635007	-1	no_errors	ENST00000249284	ensembl	human	known	69_37n	missense	47	45.35	39	SNP	0.044	C
TCF12	6938	genome.wustl.edu	37	15	57545524	57545524	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr15:57545524C>A	ENST00000267811.5	+	15	1557	c.1253C>A	c.(1252-1254)gCt>gAt	p.A418D	TCF12_ENST00000537840.1_Missense_Mutation_p.A182D|TCF12_ENST00000343827.3_Missense_Mutation_p.A248D|TCF12_ENST00000438423.2_Missense_Mutation_p.A442D|TCF12_ENST00000559710.1_Missense_Mutation_p.A52D|TCF12_ENST00000557843.1_Missense_Mutation_p.A418D|TCF12_ENST00000559703.1_Missense_Mutation_p.A76D|TCF12_ENST00000333725.5_Missense_Mutation_p.A442D|TCF12_ENST00000543579.1_Missense_Mutation_p.A272D|TCF12_ENST00000452095.2_Missense_Mutation_p.A438D|TCF12_ENST00000560764.1_3'UTR	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	418					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.A442D(2)|p.A248D(1)|p.A438D(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CGGAACCATGCTGTGGGACCT	0.438			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	4	Substitution - Missense(4)	breast(4)											196.0	146.0	163.0					15																	57545524		2192	4292	6484	-	-	-	SO:0001583	missense	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.1253C>A	15.37:g.57545524C>A	ENSP00000267811:p.Ala418Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.A442D	ENST00000267811.5	37	c.1325	CCDS10159.1	15	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825946	0.90955	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000537840;ENST00000343827;ENST00000543417	T;T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17;0.17	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.999;1.0;1.0;0.999;0.998;0.999	D;D;D;D;D;D;D;D;D;D	0.91635	0.999;0.996;0.998;0.994;0.994;0.999;0.999;0.997;0.994;0.997	T	0.79647	-0.1716	10	0.48119	T	0.1	-21.864	20.5666	0.99351	0.0:1.0:0.0:0.0	.	438;52;272;182;438;470;272;248;418;442	B4DGI9;B4DZP2;B4DH96;B4E1W1;E9PGY0;F5H6Z6;F5GY10;Q99081-2;Q99081;Q99081-3	.;.;.;.;.;.;.;.;HTF4_HUMAN;.	D	470;418;442;438;442;272;182;248;31	ENSP00000267811:A418D;ENSP00000388940:A442D;ENSP00000396881:A438D;ENSP00000331057:A442D;ENSP00000440017:A272D;ENSP00000444696:A182D;ENSP00000342459:A248D	ENSP00000267811:A418D	A	+	2	0	TCF12	55332816	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.779000	0.85648	2.854000	0.98071	0.655000	0.94253	GCT	TCF12	-	NULL	ENSG00000140262		0.438	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	34	0.00	0	C	NM_003205		57545524	57545524	+1	no_errors	ENST00000438423	ensembl	human	known	69_37n	missense	47	31.88	22	SNP	1.000	A
TCF12	6938	genome.wustl.edu	37	15	57545524	57545524	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr15:57545524C>A	ENST00000267811.5	+	15	1557	c.1253C>A	c.(1252-1254)gCt>gAt	p.A418D	TCF12_ENST00000537840.1_Missense_Mutation_p.A182D|TCF12_ENST00000343827.3_Missense_Mutation_p.A248D|TCF12_ENST00000438423.2_Missense_Mutation_p.A442D|TCF12_ENST00000559710.1_Missense_Mutation_p.A52D|TCF12_ENST00000557843.1_Missense_Mutation_p.A418D|TCF12_ENST00000559703.1_Missense_Mutation_p.A76D|TCF12_ENST00000333725.5_Missense_Mutation_p.A442D|TCF12_ENST00000543579.1_Missense_Mutation_p.A272D|TCF12_ENST00000452095.2_Missense_Mutation_p.A438D|TCF12_ENST00000560764.1_3'UTR	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	418					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.A442D(2)|p.A248D(1)|p.A438D(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CGGAACCATGCTGTGGGACCT	0.438			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	4	Substitution - Missense(4)	breast(4)											196.0	146.0	163.0					15																	57545524		2192	4292	6484	-	-	-	SO:0001583	missense	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.1253C>A	15.37:g.57545524C>A	ENSP00000267811:p.Ala418Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.A442D	ENST00000267811.5	37	c.1325	CCDS10159.1	15	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825946	0.90955	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000537840;ENST00000343827;ENST00000543417	T;T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17;0.17	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.999;1.0;1.0;0.999;0.998;0.999	D;D;D;D;D;D;D;D;D;D	0.91635	0.999;0.996;0.998;0.994;0.994;0.999;0.999;0.997;0.994;0.997	T	0.79647	-0.1716	10	0.48119	T	0.1	-21.864	20.5666	0.99351	0.0:1.0:0.0:0.0	.	438;52;272;182;438;470;272;248;418;442	B4DGI9;B4DZP2;B4DH96;B4E1W1;E9PGY0;F5H6Z6;F5GY10;Q99081-2;Q99081;Q99081-3	.;.;.;.;.;.;.;.;HTF4_HUMAN;.	D	470;418;442;438;442;272;182;248;31	ENSP00000267811:A418D;ENSP00000388940:A442D;ENSP00000396881:A438D;ENSP00000331057:A442D;ENSP00000440017:A272D;ENSP00000444696:A182D;ENSP00000342459:A248D	ENSP00000267811:A418D	A	+	2	0	TCF12	55332816	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.779000	0.85648	2.854000	0.98071	0.655000	0.94253	GCT	TCF12	-	NULL	ENSG00000140262		0.438	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	52	0.00	0	C	NM_003205		57545524	57545524	+1	no_errors	ENST00000438423	ensembl	human	known	69_37n	missense	47	31.88	22	SNP	1.000	A
TCHH	7062	genome.wustl.edu	37	1	152083921	152083921	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:152083921T>C	ENST00000368804.1	-	2	1771	c.1772A>G	c.(1771-1773)aAg>aGg	p.K591R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	591	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.K591R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTCGCGCTTCAGCCGCTG	0.682																																						dbGAP											1	Substitution - Missense(1)	breast(1)											43.0	49.0	47.0					1																	152083921		1957	4134	6091	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1772A>G	1.37:g.152083921T>C	ENSP00000357794:p.Lys591Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.K591R	ENST00000368804.1	37	c.1772	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	t	10.57	1.387716	0.25031	.	.	ENSG00000159450	ENST00000368804	T	0.05382	3.45	2.9	-2.61	0.06171	.	.	.	.	.	T	0.00637	0.0021	N	0.04508	-0.205	0.09310	N	1	B	0.17667	0.023	B	0.14023	0.01	T	0.47446	-0.9117	9	0.15952	T	0.53	.	4.0535	0.09806	0.0:0.244:0.2001:0.5559	.	591	Q07283	TRHY_HUMAN	R	591	ENSP00000357794:K591R	ENSP00000357794:K591R	K	-	2	0	TCHH	150350545	0.000000	0.05858	0.003000	0.11579	0.169000	0.22640	-2.887000	0.00711	-0.342000	0.08363	0.157000	0.16456	AAG	TCHH	-	NULL	ENSG00000159450		0.682	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	16	0.00	0	T	NM_007113		152083921	152083921	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	54	22.54	16	SNP	0.001	C
TCHH	7062	genome.wustl.edu	37	1	152083921	152083921	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:152083921T>C	ENST00000368804.1	-	2	1771	c.1772A>G	c.(1771-1773)aAg>aGg	p.K591R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	591	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.K591R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTCGCGCTTCAGCCGCTG	0.682																																						dbGAP											1	Substitution - Missense(1)	breast(1)											43.0	49.0	47.0					1																	152083921		1957	4134	6091	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1772A>G	1.37:g.152083921T>C	ENSP00000357794:p.Lys591Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.K591R	ENST00000368804.1	37	c.1772	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	t	10.57	1.387716	0.25031	.	.	ENSG00000159450	ENST00000368804	T	0.05382	3.45	2.9	-2.61	0.06171	.	.	.	.	.	T	0.00637	0.0021	N	0.04508	-0.205	0.09310	N	1	B	0.17667	0.023	B	0.14023	0.01	T	0.47446	-0.9117	9	0.15952	T	0.53	.	4.0535	0.09806	0.0:0.244:0.2001:0.5559	.	591	Q07283	TRHY_HUMAN	R	591	ENSP00000357794:K591R	ENSP00000357794:K591R	K	-	2	0	TCHH	150350545	0.000000	0.05858	0.003000	0.11579	0.169000	0.22640	-2.887000	0.00711	-0.342000	0.08363	0.157000	0.16456	AAG	TCHH	-	NULL	ENSG00000159450		0.682	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	26	0.00	0	T	NM_007113		152083921	152083921	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	54	22.54	16	SNP	0.001	C
TCIRG1	10312	genome.wustl.edu	37	11	67818248	67818248	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:67818248A>C	ENST00000265686.3	+	20	2563	c.2455A>C	c.(2455-2457)Aag>Cag	p.K819Q	RP11-802E16.3_ENST00000534517.1_RNA|TCIRG1_ENST00000532635.1_Missense_Mutation_p.K603Q|RP11-802E16.3_ENST00000529934.1_RNA|CHKA_ENST00000533728.1_5'Flank|RP11-802E16.3_ENST00000526897.1_RNA|TCIRG1_ENST00000530802.1_3'UTR	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	819					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)	p.K819Q(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						CACGGGCTACAAGCTGAGTCC	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	74.0	81.0					11																	67818248		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2455A>C	11.37:g.67818248A>C	ENSP00000265686:p.Lys819Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O75877|Q8WVC5	Missense_Mutation	SNP	pfam_ATPase_V0/A0_a	p.K819Q	ENST00000265686.3	37	c.2455	CCDS8177.1	11	.	.	.	.	.	.	.	.	.	.	A	15.72	2.917297	0.52546	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.87334	-2.24;-2.24	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	D	0.90273	0.6958	L	0.56199	1.76	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.88557	0.3120	10	0.32370	T	0.25	-53.6746	11.5887	0.50933	1.0:0.0:0.0:0.0	.	819	Q13488	VPP3_HUMAN	Q	819;603	ENSP00000265686:K819Q;ENSP00000434407:K603Q	ENSP00000265686:K819Q	K	+	1	0	TCIRG1	67574824	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	4.612000	0.61169	1.899000	0.54978	0.379000	0.24179	AAG	TCIRG1	-	pfam_ATPase_V0/A0_a	ENSG00000110719		0.587	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCIRG1	HGNC	protein_coding	OTTHUMT00000394305.1	15	0.00	0	A	NM_006019		67818248	67818248	+1	no_errors	ENST00000265686	ensembl	human	known	69_37n	missense	81	31.93	38	SNP	1.000	C
TDRKH	11022	genome.wustl.edu	37	1	151747553	151747553	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:151747553C>G	ENST00000368822.1	-	11	2157	c.1524G>C	c.(1522-1524)atG>atC	p.M508I	TDRKH_ENST00000368825.3_Missense_Mutation_p.M463I|TDRKH_ENST00000368827.6_Missense_Mutation_p.M508I|TDRKH_ENST00000440583.2_Missense_Mutation_p.M284I|TDRKH_ENST00000458431.2_Missense_Mutation_p.M508I|TDRKH_ENST00000368824.3_Missense_Mutation_p.M508I|TDRKH_ENST00000368823.1_Missense_Mutation_p.M504I			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	508					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.M508I(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGTCCTTCAACATGTCTGGGA	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	113.0	117.0					1																	151747553		1913	4134	6047	-	-	-	SO:0001583	missense	0			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1524G>C	1.37:g.151747553C>G	ENSP00000357812:p.Met508Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_Tudor,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.M508I	ENST00000368822.1	37	c.1524	CCDS41394.1	1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253270	0.59212	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000440583	T;T;T;T;T;T;T	0.23552	2.27;1.93;2.27;2.27;2.27;2.27;1.9	5.5	-3.83	0.04269	.	0.512611	0.23202	N	0.050771	T	0.04861	0.0131	L	0.47716	1.5	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.09377	0.004;0.002;0.004	T	0.37430	-0.9706	10	0.22109	T	0.4	0.0879	3.703	0.08390	0.3777:0.2561:0.0:0.3662	.	463;504;508	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	I	508;463;508;504;508;508;284	ENSP00000357819:M508I;ENSP00000357817:M463I;ENSP00000357815:M508I;ENSP00000357813:M504I;ENSP00000357812:M508I;ENSP00000395718:M508I;ENSP00000416645:M284I	ENSP00000357812:M508I	M	-	3	0	TDRKH	150014177	0.162000	0.22906	0.001000	0.08648	0.979000	0.70002	-0.124000	0.10595	-0.736000	0.04831	0.555000	0.69702	ATG	TDRKH	-	NULL	ENSG00000182134		0.418	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TDRKH	HGNC	protein_coding	OTTHUMT00000036648.2	135	0.00	0	C	NM_006862		151747553	151747553	-1	no_errors	ENST00000368822	ensembl	human	known	69_37n	missense	120	20.53	31	SNP	0.002	G
TDRKH	11022	genome.wustl.edu	37	1	151747553	151747553	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:151747553C>G	ENST00000368822.1	-	11	2157	c.1524G>C	c.(1522-1524)atG>atC	p.M508I	TDRKH_ENST00000368825.3_Missense_Mutation_p.M463I|TDRKH_ENST00000368827.6_Missense_Mutation_p.M508I|TDRKH_ENST00000440583.2_Missense_Mutation_p.M284I|TDRKH_ENST00000458431.2_Missense_Mutation_p.M508I|TDRKH_ENST00000368824.3_Missense_Mutation_p.M508I|TDRKH_ENST00000368823.1_Missense_Mutation_p.M504I			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	508					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.M508I(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGTCCTTCAACATGTCTGGGA	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	113.0	117.0					1																	151747553		1913	4134	6047	-	-	-	SO:0001583	missense	0			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1524G>C	1.37:g.151747553C>G	ENSP00000357812:p.Met508Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_Tudor,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.M508I	ENST00000368822.1	37	c.1524	CCDS41394.1	1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253270	0.59212	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000440583	T;T;T;T;T;T;T	0.23552	2.27;1.93;2.27;2.27;2.27;2.27;1.9	5.5	-3.83	0.04269	.	0.512611	0.23202	N	0.050771	T	0.04861	0.0131	L	0.47716	1.5	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.09377	0.004;0.002;0.004	T	0.37430	-0.9706	10	0.22109	T	0.4	0.0879	3.703	0.08390	0.3777:0.2561:0.0:0.3662	.	463;504;508	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	I	508;463;508;504;508;508;284	ENSP00000357819:M508I;ENSP00000357817:M463I;ENSP00000357815:M508I;ENSP00000357813:M504I;ENSP00000357812:M508I;ENSP00000395718:M508I;ENSP00000416645:M284I	ENSP00000357812:M508I	M	-	3	0	TDRKH	150014177	0.162000	0.22906	0.001000	0.08648	0.979000	0.70002	-0.124000	0.10595	-0.736000	0.04831	0.555000	0.69702	ATG	TDRKH	-	NULL	ENSG00000182134		0.418	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TDRKH	HGNC	protein_coding	OTTHUMT00000036648.2	195	0.00	0	C	NM_006862		151747553	151747553	-1	no_errors	ENST00000368822	ensembl	human	known	69_37n	missense	120	20.53	31	SNP	0.002	G
TECPR2	9895	genome.wustl.edu	37	14	102901119	102901119	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:102901119C>G	ENST00000359520.7	+	9	2191	c.1965C>G	c.(1963-1965)agC>agG	p.S655R	TECPR2_ENST00000558678.1_Missense_Mutation_p.S655R	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	655					autophagy (GO:0006914)|cell death (GO:0008219)			p.S655R(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						CCAGCCTCAGCTGGGCCCCAA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											29.0	29.0	29.0					14																	102901119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1965C>G	14.37:g.102901119C>G	ENSP00000352510:p.Ser655Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.S655R	ENST00000359520.7	37	c.1965	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	C	11.15	1.552827	0.27739	.	.	ENSG00000196663	ENST00000359520	T	0.15256	2.44	5.46	-0.24	0.13047	.	1.732940	0.02070	N	0.051458	T	0.13200	0.0320	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.24261	-1.0165	9	.	.	.	.	6.5433	0.22392	0.0:0.5584:0.1274:0.3142	.	655;655	A5PKY3;O15040	.;TCPR2_HUMAN	R	655	ENSP00000352510:S655R	.	S	+	3	2	TECPR2	101970872	0.000000	0.05858	0.000000	0.03702	0.181000	0.23173	-0.152000	0.10159	0.026000	0.15269	0.555000	0.69702	AGC	TECPR2	-	NULL	ENSG00000196663		0.602	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2	11	0.00	0	C	NM_014844		102901119	102901119	+1	no_errors	ENST00000359520	ensembl	human	known	69_37n	missense	60	28.57	24	SNP	0.000	G
TECPR2	9895	genome.wustl.edu	37	14	102901119	102901119	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr14:102901119C>G	ENST00000359520.7	+	9	2191	c.1965C>G	c.(1963-1965)agC>agG	p.S655R	TECPR2_ENST00000558678.1_Missense_Mutation_p.S655R	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	655					autophagy (GO:0006914)|cell death (GO:0008219)			p.S655R(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						CCAGCCTCAGCTGGGCCCCAA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											29.0	29.0	29.0					14																	102901119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1965C>G	14.37:g.102901119C>G	ENSP00000352510:p.Ser655Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.S655R	ENST00000359520.7	37	c.1965	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	C	11.15	1.552827	0.27739	.	.	ENSG00000196663	ENST00000359520	T	0.15256	2.44	5.46	-0.24	0.13047	.	1.732940	0.02070	N	0.051458	T	0.13200	0.0320	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.24261	-1.0165	9	.	.	.	.	6.5433	0.22392	0.0:0.5584:0.1274:0.3142	.	655;655	A5PKY3;O15040	.;TCPR2_HUMAN	R	655	ENSP00000352510:S655R	.	S	+	3	2	TECPR2	101970872	0.000000	0.05858	0.000000	0.03702	0.181000	0.23173	-0.152000	0.10159	0.026000	0.15269	0.555000	0.69702	AGC	TECPR2	-	NULL	ENSG00000196663		0.602	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2	22	0.00	0	C	NM_014844		102901119	102901119	+1	no_errors	ENST00000359520	ensembl	human	known	69_37n	missense	60	28.57	24	SNP	0.000	G
TET1	80312	genome.wustl.edu	37	10	70332118	70332118	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:70332118G>A	ENST00000373644.4	+	2	232	c.23G>A	c.(22-24)aGg>aAg	p.R8K		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	8					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.R8K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CGCCATGCAAGGCCTTCCAGA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											37.0	37.0	37.0					10																	70332118		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.23G>A	10.37:g.70332118G>A	ENSP00000362748:p.Arg8Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.R8K	ENST00000373644.4	37	c.23	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264202	0.59431	.	.	ENSG00000138336	ENST00000373644	T	0.06608	3.28	5.24	1.96	0.26148	.	2.132120	0.01993	N	0.045660	T	0.05456	0.0144	N	0.19112	0.55	0.22827	N	0.998682	B	0.28512	0.214	B	0.17433	0.018	T	0.37842	-0.9688	10	0.36615	T	0.2	.	7.4764	0.27378	0.3103:0.0:0.6897:0.0	.	8	Q8NFU7	TET1_HUMAN	K	8	ENSP00000362748:R8K	ENSP00000362748:R8K	R	+	2	0	TET1	70002124	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	2.030000	0.41108	0.081000	0.16988	0.563000	0.77884	AGG	TET1	-	NULL	ENSG00000138336		0.443	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	34	0.00	0	G	NM_030625		70332118	70332118	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	missense	16	57.89	22	SNP	0.980	A
TET1	80312	genome.wustl.edu	37	10	70332118	70332118	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:70332118G>A	ENST00000373644.4	+	2	232	c.23G>A	c.(22-24)aGg>aAg	p.R8K		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	8					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.R8K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CGCCATGCAAGGCCTTCCAGA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											37.0	37.0	37.0					10																	70332118		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.23G>A	10.37:g.70332118G>A	ENSP00000362748:p.Arg8Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.R8K	ENST00000373644.4	37	c.23	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264202	0.59431	.	.	ENSG00000138336	ENST00000373644	T	0.06608	3.28	5.24	1.96	0.26148	.	2.132120	0.01993	N	0.045660	T	0.05456	0.0144	N	0.19112	0.55	0.22827	N	0.998682	B	0.28512	0.214	B	0.17433	0.018	T	0.37842	-0.9688	10	0.36615	T	0.2	.	7.4764	0.27378	0.3103:0.0:0.6897:0.0	.	8	Q8NFU7	TET1_HUMAN	K	8	ENSP00000362748:R8K	ENSP00000362748:R8K	R	+	2	0	TET1	70002124	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	2.030000	0.41108	0.081000	0.16988	0.563000	0.77884	AGG	TET1	-	NULL	ENSG00000138336		0.443	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	56	0.00	0	G	NM_030625		70332118	70332118	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	missense	16	57.89	22	SNP	0.980	A
TIGIT	201633	genome.wustl.edu	37	3	114018446	114018446	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:114018446G>C	ENST00000486257.1	+	4	651	c.394G>C	c.(394-396)Gct>Cct	p.A132P	TIGIT_ENST00000383671.3_Missense_Mutation_p.A132P|TIGIT_ENST00000481065.1_Missense_Mutation_p.A199P			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	132					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.A132P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						CCCTCTAGTGGCTGAGCACGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	67.0	71.0					3																	114018446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.394G>C	3.37:g.114018446G>C	ENSP00000419085:p.Ala132Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.A132P	ENST00000486257.1	37	c.394	CCDS2980.1	3	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400563	0.25291	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.56275	0.56;0.47;0.51;0.51;0.56	4.38	2.51	0.30379	.	0.943803	0.08794	N	0.892761	T	0.33498	0.0865	N	0.19112	0.55	0.27294	N	0.957763	B	0.25904	0.137	B	0.21151	0.033	T	0.24119	-1.0169	10	0.23891	T	0.37	0.0817	5.9042	0.18984	0.106:0.1949:0.6991:0.0	.	132	Q495A1	TIGIT_HUMAN	P	111;199;132;132;111	ENSP00000418917:A111P;ENSP00000420552:A199P;ENSP00000419085:A132P;ENSP00000373167:A132P;ENSP00000419706:A111P	ENSP00000373167:A132P	A	+	1	0	TIGIT	115501136	0.004000	0.15560	0.815000	0.32552	0.251000	0.25915	0.483000	0.22292	0.545000	0.28902	-0.140000	0.14226	GCT	TIGIT	-	NULL	ENSG00000181847		0.582	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGIT	HGNC	protein_coding	OTTHUMT00000354690.1	19	0.00	0	G	NM_173799		114018446	114018446	+1	no_errors	ENST00000383671	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	0.617	C
TIGIT	201633	genome.wustl.edu	37	3	114018446	114018446	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:114018446G>C	ENST00000486257.1	+	4	651	c.394G>C	c.(394-396)Gct>Cct	p.A132P	TIGIT_ENST00000383671.3_Missense_Mutation_p.A132P|TIGIT_ENST00000481065.1_Missense_Mutation_p.A199P			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	132					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.A132P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						CCCTCTAGTGGCTGAGCACGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	67.0	71.0					3																	114018446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.394G>C	3.37:g.114018446G>C	ENSP00000419085:p.Ala132Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.A132P	ENST00000486257.1	37	c.394	CCDS2980.1	3	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400563	0.25291	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.56275	0.56;0.47;0.51;0.51;0.56	4.38	2.51	0.30379	.	0.943803	0.08794	N	0.892761	T	0.33498	0.0865	N	0.19112	0.55	0.27294	N	0.957763	B	0.25904	0.137	B	0.21151	0.033	T	0.24119	-1.0169	10	0.23891	T	0.37	0.0817	5.9042	0.18984	0.106:0.1949:0.6991:0.0	.	132	Q495A1	TIGIT_HUMAN	P	111;199;132;132;111	ENSP00000418917:A111P;ENSP00000420552:A199P;ENSP00000419085:A132P;ENSP00000373167:A132P;ENSP00000419706:A111P	ENSP00000373167:A132P	A	+	1	0	TIGIT	115501136	0.004000	0.15560	0.815000	0.32552	0.251000	0.25915	0.483000	0.22292	0.545000	0.28902	-0.140000	0.14226	GCT	TIGIT	-	NULL	ENSG00000181847		0.582	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGIT	HGNC	protein_coding	OTTHUMT00000354690.1	8	0.00	0	G	NM_173799		114018446	114018446	+1	no_errors	ENST00000383671	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	0.617	C
TMEM39A	55254	genome.wustl.edu	37	3	119150930	119150930	+	Silent	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:119150930G>C	ENST00000319172.5	-	9	1785	c.1365C>G	c.(1363-1365)ctC>ctG	p.L455L		NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	455						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		AGTTGCAGAAGAGGATGAGAG	0.453																																						dbGAP											0													93.0	86.0	88.0					3																	119150930		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.1365C>G	3.37:g.119150930G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Silent	SNP	pfam_Uncharacterised_TMEM39	p.L455	ENST00000319172.5	37	c.1365	CCDS2987.1	3																																																																																			TMEM39A	-	pfam_Uncharacterised_TMEM39	ENSG00000176142		0.453	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM39A	HGNC	protein_coding	OTTHUMT00000354941.3	51	0.00	0	G	NM_018266		119150930	119150930	-1	no_errors	ENST00000319172	ensembl	human	known	69_37n	silent	42	27.59	16	SNP	1.000	C
TRABD	80305	genome.wustl.edu	37	22	50632861	50632861	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr22:50632861G>T	ENST00000303434.4	+	4	324	c.205G>T	c.(205-207)Gct>Tct	p.A69S	RP3-402G11.25_ENST00000607943.1_RNA|TRABD_ENST00000395829.1_Missense_Mutation_p.A69S|TRABD_ENST00000380909.4_Missense_Mutation_p.A69S|TRABD_ENST00000395827.1_Missense_Mutation_p.A69S	NM_025204.2	NP_079480.2	Q9H4I3	TRABD_HUMAN	TraB domain containing	69								p.A69S(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	7		all_cancers(38;1.07e-07)|all_epithelial(38;9.6e-07)|all_lung(38;0.00141)|Breast(42;0.00387)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		LUAD - Lung adenocarcinoma(64;0.105)		CCAGTTGGTGGCTGAGGACGG	0.657																																						dbGAP											1	Substitution - Missense(1)	breast(1)											47.0	46.0	46.0					22																	50632861		2201	4298	6499	-	-	-	SO:0001583	missense	0			AL449244	CCDS14086.1	22q13.33	2006-07-06			ENSG00000170638	ENSG00000170638			28805	protein-coding gene	gene with protein product						12477932	Standard	NM_025204		Approved	PP2447	uc003bjs.1	Q9H4I3	OTTHUMG00000044644	ENST00000303434.4:c.205G>T	22.37:g.50632861G>T	ENSP00000305664:p.Ala69Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q19CC5|Q96ED8|Q9H7N1|Q9UGX6|Q9UGX7	Missense_Mutation	SNP	pfam_Pheromone_shutdown_TraB	p.A69S	ENST00000303434.4	37	c.205	CCDS14086.1	22	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794207	0.31777	.	.	ENSG00000170638	ENST00000380909;ENST00000303434;ENST00000395827;ENST00000395829	T;T;T;T	0.38240	1.15;1.15;1.15;1.15	5.03	3.94	0.45596	.	0.109676	0.64402	D	0.000008	T	0.17450	0.0419	N	0.17474	0.49	0.44048	D	0.996786	B	0.25850	0.136	B	0.27608	0.081	T	0.11916	-1.0568	10	0.16896	T	0.51	-27.642	3.2807	0.06915	0.4047:0.0:0.5953:0.0	.	69	Q9H4I3	TRABD_HUMAN	S	69	ENSP00000370295:A69S;ENSP00000305664:A69S;ENSP00000379171:A69S;ENSP00000379173:A69S	ENSP00000305664:A69S	A	+	1	0	TRABD	48974988	0.997000	0.39634	0.919000	0.36401	0.016000	0.09150	2.459000	0.45023	2.335000	0.79485	0.561000	0.74099	GCT	TRABD	-	NULL	ENSG00000170638		0.657	TRABD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRABD	HGNC	protein_coding	OTTHUMT00000316987.1	12	0.00	0	G	NM_025204		50632861	50632861	+1	no_errors	ENST00000303434	ensembl	human	known	69_37n	missense	102	21.97	29	SNP	0.994	T
TSPAN18	90139	genome.wustl.edu	37	11	44948291	44948292	+	Frame_Shift_Del	DEL	GG	GG	-	rs201801364		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	GG	GG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:44948291_44948292delGG	ENST00000520358.2	+	9	1097_1098	c.682_683delGG	c.(682-684)gggfs	p.G228fs	TSPAN18_ENST00000340160.3_Frame_Shift_Del_p.G228fs			Q96SJ8	TSN18_HUMAN	tetraspanin 18	228						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						CCTTGCCATCGGGGTACTGGCC	0.609											OREG0020922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.682_683delGG	11.37:g.44948293_44948294delGG	ENSP00000429993:p.Gly228fs	Somatic	927	WXS	Illumina GAIIx	Phase_IV	Q6UY44|Q8NBI9	Frame_Shift_Del	DEL	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V229fs	ENST00000520358.2	37	c.682_683	CCDS7910.1	11																																																																																			TSPAN18	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000157570		0.609	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN18	HGNC	protein_coding	OTTHUMT00000376197.3	18	0.00	0	GG	NM_130783		44948291	44948292	+1	no_errors	ENST00000340160	ensembl	human	known	69_37n	frame_shift_del	111	19.57	27	DEL	1.000:1.000	-
TSPAN18	90139	genome.wustl.edu	37	11	44948291	44948292	+	Frame_Shift_Del	DEL	GG	GG	-	rs201801364		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	GG	GG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr11:44948291_44948292delGG	ENST00000520358.2	+	9	1097_1098	c.682_683delGG	c.(682-684)gggfs	p.G228fs	TSPAN18_ENST00000340160.3_Frame_Shift_Del_p.G228fs			Q96SJ8	TSN18_HUMAN	tetraspanin 18	228						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						CCTTGCCATCGGGGTACTGGCC	0.609											OREG0020922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.682_683delGG	11.37:g.44948293_44948294delGG	ENSP00000429993:p.Gly228fs	Somatic	927	WXS	Illumina GAIIx	Phase_IV	Q6UY44|Q8NBI9	Frame_Shift_Del	DEL	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V229fs	ENST00000520358.2	37	c.682_683	CCDS7910.1	11																																																																																			TSPAN18	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000157570		0.609	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN18	HGNC	protein_coding	OTTHUMT00000376197.3	27	0.00	0	GG	NM_130783		44948291	44948292	+1	no_errors	ENST00000340160	ensembl	human	known	69_37n	frame_shift_del	111	19.57	27	DEL	1.000:1.000	-
TTC3	7267	genome.wustl.edu	37	21	38567987	38567987	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:38567987G>C	ENST00000399017.2	+	42	7976	c.5229G>C	c.(5227-5229)gaG>gaC	p.E1743D	TTC3_ENST00000355666.1_Missense_Mutation_p.E1743D|TTC3-AS1_ENST00000424733.1_RNA|TTC3_ENST00000354749.2_Missense_Mutation_p.E1743D|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1743					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E1743D(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TTCATCCCGAGTTACTCCCTG	0.522																																					Ovarian(38;194 1649 35661)	dbGAP											1	Substitution - Missense(1)	breast(1)											251.0	261.0	258.0					21																	38567987		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.5229G>C	21.37:g.38567987G>C	ENSP00000381981:p.Glu1743Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.E1743D	ENST00000399017.2	37	c.5229	CCDS13651.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.793|8.793	0.931156|0.931156	0.18131|0.18131	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749|ENST00000428693	T;T;T|.	0.08458|.	3.09;3.09;3.09|.	4.4|4.4	1.51|1.51	0.23008|0.23008	.|.	1.254910|.	0.05827|.	N|.	0.616939|.	T|T	0.21962|0.21962	0.0529|0.0529	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|.	0.26672|.	0.156|.	B|.	0.18871|.	0.023|.	T|T	0.24119|0.24119	-1.0169|-1.0169	10|5	0.17832|.	T|.	0.49|.	0.7828|0.7828	6.1593|6.1593	0.20356|0.20356	0.3318:0.0:0.6682:0.0|0.3318:0.0:0.6682:0.0	.|.	1743|.	P53804|.	TTC3_HUMAN|.	D|L	1743|35	ENSP00000347889:E1743D;ENSP00000381981:E1743D;ENSP00000346791:E1743D|.	ENSP00000346791:E1743D|.	E|V	+|+	3|1	2|0	TTC3|TTC3	37489857|37489857	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	0.154000|0.154000	0.16343|0.16343	0.429000|0.429000	0.26202|0.26202	0.563000|0.563000	0.77884|0.77884	GAG|GTT	TTC3	-	NULL	ENSG00000182670		0.522	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	11	0.00	0	G			38567987	38567987	+1	no_errors	ENST00000354749	ensembl	human	known	69_37n	missense	57	29.63	24	SNP	0.000	C
TTC3	7267	genome.wustl.edu	37	21	38567987	38567987	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:38567987G>C	ENST00000399017.2	+	42	7976	c.5229G>C	c.(5227-5229)gaG>gaC	p.E1743D	TTC3_ENST00000355666.1_Missense_Mutation_p.E1743D|TTC3-AS1_ENST00000424733.1_RNA|TTC3_ENST00000354749.2_Missense_Mutation_p.E1743D|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1743					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E1743D(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TTCATCCCGAGTTACTCCCTG	0.522																																					Ovarian(38;194 1649 35661)	dbGAP											1	Substitution - Missense(1)	breast(1)											251.0	261.0	258.0					21																	38567987		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.5229G>C	21.37:g.38567987G>C	ENSP00000381981:p.Glu1743Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.E1743D	ENST00000399017.2	37	c.5229	CCDS13651.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.793|8.793	0.931156|0.931156	0.18131|0.18131	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749|ENST00000428693	T;T;T|.	0.08458|.	3.09;3.09;3.09|.	4.4|4.4	1.51|1.51	0.23008|0.23008	.|.	1.254910|.	0.05827|.	N|.	0.616939|.	T|T	0.21962|0.21962	0.0529|0.0529	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|.	0.26672|.	0.156|.	B|.	0.18871|.	0.023|.	T|T	0.24119|0.24119	-1.0169|-1.0169	10|5	0.17832|.	T|.	0.49|.	0.7828|0.7828	6.1593|6.1593	0.20356|0.20356	0.3318:0.0:0.6682:0.0|0.3318:0.0:0.6682:0.0	.|.	1743|.	P53804|.	TTC3_HUMAN|.	D|L	1743|35	ENSP00000347889:E1743D;ENSP00000381981:E1743D;ENSP00000346791:E1743D|.	ENSP00000346791:E1743D|.	E|V	+|+	3|1	2|0	TTC3|TTC3	37489857|37489857	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	0.154000|0.154000	0.16343|0.16343	0.429000|0.429000	0.26202|0.26202	0.563000|0.563000	0.77884|0.77884	GAG|GTT	TTC3	-	NULL	ENSG00000182670		0.522	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	14	0.00	0	G			38567987	38567987	+1	no_errors	ENST00000354749	ensembl	human	known	69_37n	missense	57	29.63	24	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179398516	179398516	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:179398516G>A	ENST00000591111.1	-	308	98127	c.97903C>T	c.(97903-97905)Cgg>Tgg	p.R32635W	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R25403W|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R25211W|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R31708W|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R25336W|TTN_ENST00000589042.1_Missense_Mutation_p.R34276W|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589355.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32635	Ig-like 144.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R25336W(1)|p.R31708W(1)|p.R25403W(1)|p.R25211W(1)|p.R31706W(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCCAAACCGGACATTTTCA	0.413																																						dbGAP											5	Substitution - Missense(5)	breast(5)											90.0	83.0	85.0					2																	179398516		1893	4107	6000	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.97903C>T	2.37:g.179398516G>A	ENSP00000465570:p.Arg32635Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R31708W	ENST00000591111.1	37	c.95122		2	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292554	0.40594	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.6	4.64	0.57946	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.56834	0.2012	M	0.83774	2.66	0.45930	D	0.998765	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74674	0.984;0.984;0.984;0.984	T	0.62286	-0.6886	9	0.87932	D	0	.	13.1026	0.59228	0.0:0.0:0.7224:0.2776	.	25211;25336;25403;32635	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	W	31708;25211;25403;25336;25208	ENSP00000343764:R31708W;ENSP00000434586:R25211W;ENSP00000340554:R25403W;ENSP00000352154:R25336W	ENSP00000340554:R25403W	R	-	1	2	TTN	179106762	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.973000	0.56845	2.641000	0.89580	0.491000	0.48974	CGG	TTN	-	pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	149	0.00	0	G	NM_133378		179398516	179398516	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179398516	179398516	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:179398516G>A	ENST00000591111.1	-	308	98127	c.97903C>T	c.(97903-97905)Cgg>Tgg	p.R32635W	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R25403W|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R25211W|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R31708W|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R25336W|TTN_ENST00000589042.1_Missense_Mutation_p.R34276W|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589355.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32635	Ig-like 144.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R25336W(1)|p.R31708W(1)|p.R25403W(1)|p.R25211W(1)|p.R31706W(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCCAAACCGGACATTTTCA	0.413																																						dbGAP											5	Substitution - Missense(5)	breast(5)											90.0	83.0	85.0					2																	179398516		1893	4107	6000	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.97903C>T	2.37:g.179398516G>A	ENSP00000465570:p.Arg32635Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R31708W	ENST00000591111.1	37	c.95122		2	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292554	0.40594	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.6	4.64	0.57946	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.56834	0.2012	M	0.83774	2.66	0.45930	D	0.998765	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74674	0.984;0.984;0.984;0.984	T	0.62286	-0.6886	9	0.87932	D	0	.	13.1026	0.59228	0.0:0.0:0.7224:0.2776	.	25211;25336;25403;32635	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	W	31708;25211;25403;25336;25208	ENSP00000343764:R31708W;ENSP00000434586:R25211W;ENSP00000340554:R25403W;ENSP00000352154:R25336W	ENSP00000340554:R25403W	R	-	1	2	TTN	179106762	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.973000	0.56845	2.641000	0.89580	0.491000	0.48974	CGG	TTN	-	pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	93	0.00	0	G	NM_133378		179398516	179398516	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179437368	179437368	+	Nonsense_Mutation	SNP	A	A	T	rs545377175		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:179437368A>T	ENST00000591111.1	-	276	68792	c.68568T>A	c.(68566-68568)taT>taA	p.Y22856*	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y15624*|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y15432*|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y21929*|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y15557*|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y24497*|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22856	Ig-like 117.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Y15557*(1)|p.Y21927*(1)|p.Y21929*(1)|p.Y15624*(1)|p.Y15432*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGTTAGTATATATTTGCCAC	0.418																																						dbGAP											5	Substitution - Nonsense(5)	breast(5)											72.0	76.0	75.0					2																	179437368		1889	4105	5994	-	-	-	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.68568T>A	2.37:g.179437368A>T	ENSP00000465570:p.Tyr22856*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Y21929*	ENST00000591111.1	37	c.65787		2	.	.	.	.	.	.	.	.	.	.	A	62	70.630407	0.99992	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.9	0.351	0.16042	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.5689	0.56326	0.3936:0.0:0.6064:0.0	.	.	.	.	X	21929;15432;15624;15557;15430	.	ENSP00000340554:Y15624X	Y	-	3	2	TTN	179145614	0.879000	0.30193	0.999000	0.59377	0.983000	0.72400	0.044000	0.13992	0.107000	0.17824	-1.049000	0.02347	TAT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	28	0.00	0	A	NM_133378		179437368	179437368	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	nonsense	50	30.56	22	SNP	0.996	T
TTN	7273	genome.wustl.edu	37	2	179437368	179437368	+	Nonsense_Mutation	SNP	A	A	T	rs545377175		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:179437368A>T	ENST00000591111.1	-	276	68792	c.68568T>A	c.(68566-68568)taT>taA	p.Y22856*	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y15624*|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y15432*|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y21929*|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y15557*|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y24497*|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22856	Ig-like 117.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Y15557*(1)|p.Y21927*(1)|p.Y21929*(1)|p.Y15624*(1)|p.Y15432*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGTTAGTATATATTTGCCAC	0.418																																						dbGAP											5	Substitution - Nonsense(5)	breast(5)											72.0	76.0	75.0					2																	179437368		1889	4105	5994	-	-	-	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.68568T>A	2.37:g.179437368A>T	ENSP00000465570:p.Tyr22856*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Y21929*	ENST00000591111.1	37	c.65787		2	.	.	.	.	.	.	.	.	.	.	A	62	70.630407	0.99992	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.9	0.351	0.16042	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.5689	0.56326	0.3936:0.0:0.6064:0.0	.	.	.	.	X	21929;15432;15624;15557;15430	.	ENSP00000340554:Y15624X	Y	-	3	2	TTN	179145614	0.879000	0.30193	0.999000	0.59377	0.983000	0.72400	0.044000	0.13992	0.107000	0.17824	-1.049000	0.02347	TAT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	47	0.00	0	A	NM_133378		179437368	179437368	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	nonsense	50	30.56	22	SNP	0.996	T
TTN	7273	genome.wustl.edu	37	2	179441108	179441113	+	In_Frame_Del	DEL	CAGTGA	CAGTGA	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CAGTGA	CAGTGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:179441108_179441113delCAGTGA	ENST00000591111.1	-	276	65047_65052	c.64823_64828delTCACTG	c.(64822-64830)gtcactgat>gat	p.VT21608del	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_In_Frame_Del_p.VT14376del|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_In_Frame_Del_p.VT14184del|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000342992.6_In_Frame_Del_p.VT20681del|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_In_Frame_Del_p.VT14309del|TTN_ENST00000589042.1_In_Frame_Del_p.VT23249del|TTN-AS1_ENST00000592750.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21608	Fibronectin type-III 57. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V20679_T20680delVT(1)|p.V20681_T20682delVT(1)|p.V14309_T14310delVT(1)|p.V14376_T14377delVT(1)|p.V14184_T14185delVT(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGTAGTATCAGTGACATGCGGATT	0.398																																						dbGAP											5	Deletion - In frame(5)	breast(5)																																								-	-	-	SO:0001651	inframe_deletion	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64823_64828delTCACTG	2.37:g.179441108_179441113delCAGTGA	ENSP00000465570:p.Val21608_Thr21609del	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.VT20681in_frame_del	ENST00000591111.1	37	c.62047_62042		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	38	0.00	0	CAGTGA	NM_133378		179441108	179441113	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	in_frame_del	76	16.30	15	DEL	1.000:0.504:0.999:1.000:1.000:1.000	-
TTN	7273	genome.wustl.edu	37	2	179441108	179441113	+	In_Frame_Del	DEL	CAGTGA	CAGTGA	-			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	CAGTGA	CAGTGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr2:179441108_179441113delCAGTGA	ENST00000591111.1	-	276	65047_65052	c.64823_64828delTCACTG	c.(64822-64830)gtcactgat>gat	p.VT21608del	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_In_Frame_Del_p.VT14376del|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_In_Frame_Del_p.VT14184del|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000342992.6_In_Frame_Del_p.VT20681del|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_In_Frame_Del_p.VT14309del|TTN_ENST00000589042.1_In_Frame_Del_p.VT23249del|TTN-AS1_ENST00000592750.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21608	Fibronectin type-III 57. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V20679_T20680delVT(1)|p.V20681_T20682delVT(1)|p.V14309_T14310delVT(1)|p.V14376_T14377delVT(1)|p.V14184_T14185delVT(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGTAGTATCAGTGACATGCGGATT	0.398																																						dbGAP											5	Deletion - In frame(5)	breast(5)																																								-	-	-	SO:0001651	inframe_deletion	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64823_64828delTCACTG	2.37:g.179441108_179441113delCAGTGA	ENSP00000465570:p.Val21608_Thr21609del	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.VT20681in_frame_del	ENST00000591111.1	37	c.62047_62042		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	63	0.00	0	CAGTGA	NM_133378		179441108	179441113	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	in_frame_del	76	16.30	15	DEL	1.000:0.504:0.999:1.000:1.000:1.000	-
UBE2E1	7324	genome.wustl.edu	37	3	23932006	23932006	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:23932006C>G	ENST00000306627.3	+	6	710	c.491C>G	c.(490-492)cCc>cGc	p.P164R	UBE2E1_ENST00000424381.1_Missense_Mutation_p.P131R|UBE2E1_ENST00000475680.1_3'UTR|UBE2E1_ENST00000346855.3_Missense_Mutation_p.P147R	NM_003341.4	NP_003332.1	P51965	UB2E1_HUMAN	ubiquitin-conjugating enzyme E2E 1	164					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cytokine-mediated signaling pathway (GO:0019221)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ISG15-protein conjugation (GO:0032020)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)	p.P164R(1)		breast(1)|endometrium(2)|large_intestine(4)	7						CCAGCCGACCCCTTGGTGGGA	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	87.0	88.0					3																	23932006		2203	4300	6503	-	-	-	SO:0001583	missense	0			X92963	CCDS2638.1, CCDS2639.1, CCDS56244.1	3p24.2	2011-05-19	2011-05-19		ENSG00000170142	ENSG00000170142		"""Ubiquitin-conjugating enzymes E2"""	12477	protein-coding gene	gene with protein product		602916	"""ubiquitin-conjugating enzyme E2E 1 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)"""			8576257	Standard	NM_003341		Approved	UbcH6	uc003cch.3	P51965	OTTHUMG00000130483	ENST00000306627.3:c.491C>G	3.37:g.23932006C>G	ENSP00000303709:p.Pro164Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBX4|C9J8K2|K4DI90	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P164R	ENST00000306627.3	37	c.491	CCDS2638.1	3	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226332	0.79576	.	.	ENSG00000170142	ENST00000306627;ENST00000346855;ENST00000424381;ENST00000452012	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	5.75	5.75	0.90469	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.64402	D	0.000001	D	0.90985	0.7165	H	0.96080	3.765	0.80722	D	1	D	0.64830	0.994	P	0.57057	0.812	D	0.93339	0.6708	10	0.87932	D	0	.	19.9507	0.97198	0.0:1.0:0.0:0.0	.	164	P51965	UB2E1_HUMAN	R	164;147;131;122	ENSP00000303709:P164R;ENSP00000329113:P147R;ENSP00000411351:P131R;ENSP00000393088:P122R	ENSP00000303709:P164R	P	+	2	0	UBE2E1	23907010	1.000000	0.71417	0.977000	0.42913	0.952000	0.60782	7.814000	0.86154	2.705000	0.92388	0.655000	0.94253	CCC	UBE2E1	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000170142		0.423	UBE2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2E1	HGNC	protein_coding	OTTHUMT00000252882.2	102	0.00	0	C	NM_003341		23932006	23932006	+1	no_errors	ENST00000306627	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	1.000	G
UBE2E1	7324	genome.wustl.edu	37	3	23932006	23932006	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:23932006C>G	ENST00000306627.3	+	6	710	c.491C>G	c.(490-492)cCc>cGc	p.P164R	UBE2E1_ENST00000424381.1_Missense_Mutation_p.P131R|UBE2E1_ENST00000475680.1_3'UTR|UBE2E1_ENST00000346855.3_Missense_Mutation_p.P147R	NM_003341.4	NP_003332.1	P51965	UB2E1_HUMAN	ubiquitin-conjugating enzyme E2E 1	164					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cytokine-mediated signaling pathway (GO:0019221)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ISG15-protein conjugation (GO:0032020)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)	p.P164R(1)		breast(1)|endometrium(2)|large_intestine(4)	7						CCAGCCGACCCCTTGGTGGGA	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	87.0	88.0					3																	23932006		2203	4300	6503	-	-	-	SO:0001583	missense	0			X92963	CCDS2638.1, CCDS2639.1, CCDS56244.1	3p24.2	2011-05-19	2011-05-19		ENSG00000170142	ENSG00000170142		"""Ubiquitin-conjugating enzymes E2"""	12477	protein-coding gene	gene with protein product		602916	"""ubiquitin-conjugating enzyme E2E 1 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)"""			8576257	Standard	NM_003341		Approved	UbcH6	uc003cch.3	P51965	OTTHUMG00000130483	ENST00000306627.3:c.491C>G	3.37:g.23932006C>G	ENSP00000303709:p.Pro164Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBX4|C9J8K2|K4DI90	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P164R	ENST00000306627.3	37	c.491	CCDS2638.1	3	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226332	0.79576	.	.	ENSG00000170142	ENST00000306627;ENST00000346855;ENST00000424381;ENST00000452012	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	5.75	5.75	0.90469	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.64402	D	0.000001	D	0.90985	0.7165	H	0.96080	3.765	0.80722	D	1	D	0.64830	0.994	P	0.57057	0.812	D	0.93339	0.6708	10	0.87932	D	0	.	19.9507	0.97198	0.0:1.0:0.0:0.0	.	164	P51965	UB2E1_HUMAN	R	164;147;131;122	ENSP00000303709:P164R;ENSP00000329113:P147R;ENSP00000411351:P131R;ENSP00000393088:P122R	ENSP00000303709:P164R	P	+	2	0	UBE2E1	23907010	1.000000	0.71417	0.977000	0.42913	0.952000	0.60782	7.814000	0.86154	2.705000	0.92388	0.655000	0.94253	CCC	UBE2E1	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000170142		0.423	UBE2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2E1	HGNC	protein_coding	OTTHUMT00000252882.2	69	0.00	0	C	NM_003341		23932006	23932006	+1	no_errors	ENST00000306627	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	1.000	G
UBR4	23352	genome.wustl.edu	37	1	19464664	19464664	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:19464664T>G	ENST00000375254.3	-	60	8770	c.8743A>C	c.(8743-8745)Agc>Cgc	p.S2915R	UBR4_ENST00000375226.2_Missense_Mutation_p.S2891R|UBR4_ENST00000375267.2_Missense_Mutation_p.S2915R|UBR4_ENST00000375217.2_Missense_Mutation_p.S2908R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2915					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S2915R(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TAAGCACTGCTCCGGCCAGAT	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	56.0	57.0					1																	19464664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8743A>C	1.37:g.19464664T>G	ENSP00000364403:p.Ser2915Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.S2915R	ENST00000375254.3	37	c.8743	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.808728	0.90707	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.42513	0.97;0.97;1.33;1.31	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.63094	0.2482	M	0.67397	2.05	0.80722	D	1	D	0.61697	0.99	D	0.69142	0.962	T	0.66031	-0.6024	10	0.87932	D	0	.	16.0558	0.80805	0.0:0.0:0.0:1.0	.	2915	Q5T4S7	UBR4_HUMAN	R	2915;2915;2908;2891;523;1601	ENSP00000364403:S2915R;ENSP00000364416:S2915R;ENSP00000364365:S2908R;ENSP00000364374:S2891R	ENSP00000364365:S2908R	S	-	1	0	UBR4	19337251	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.431000	0.80335	2.281000	0.76405	0.533000	0.62120	AGC	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.517	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	26	0.00	0	T	NM_020765		19464664	19464664	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	29	46.30	25	SNP	1.000	G
UBR4	23352	genome.wustl.edu	37	1	19464664	19464664	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:19464664T>G	ENST00000375254.3	-	60	8770	c.8743A>C	c.(8743-8745)Agc>Cgc	p.S2915R	UBR4_ENST00000375226.2_Missense_Mutation_p.S2891R|UBR4_ENST00000375267.2_Missense_Mutation_p.S2915R|UBR4_ENST00000375217.2_Missense_Mutation_p.S2908R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2915					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S2915R(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TAAGCACTGCTCCGGCCAGAT	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	56.0	57.0					1																	19464664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8743A>C	1.37:g.19464664T>G	ENSP00000364403:p.Ser2915Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.S2915R	ENST00000375254.3	37	c.8743	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.808728	0.90707	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.42513	0.97;0.97;1.33;1.31	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.63094	0.2482	M	0.67397	2.05	0.80722	D	1	D	0.61697	0.99	D	0.69142	0.962	T	0.66031	-0.6024	10	0.87932	D	0	.	16.0558	0.80805	0.0:0.0:0.0:1.0	.	2915	Q5T4S7	UBR4_HUMAN	R	2915;2915;2908;2891;523;1601	ENSP00000364403:S2915R;ENSP00000364416:S2915R;ENSP00000364365:S2908R;ENSP00000364374:S2891R	ENSP00000364365:S2908R	S	-	1	0	UBR4	19337251	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.431000	0.80335	2.281000	0.76405	0.533000	0.62120	AGC	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.517	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	32	0.00	0	T	NM_020765		19464664	19464664	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	29	46.30	25	SNP	1.000	G
UBR5	51366	genome.wustl.edu	37	8	103299695	103299695	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:103299695G>A	ENST00000520539.1	-	37	5529	c.4923C>T	c.(4921-4923)agC>agT	p.S1641S	UBR5_ENST00000220959.4_Silent_p.S1641S|UBR5_ENST00000519528.1_5'Flank|UBR5_ENST00000521922.1_Silent_p.S1635S	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1641					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.S1641S(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CAGTGACAACGCTTCTGCGCC	0.468																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											1	Substitution - coding silent(1)	breast(1)											207.0	154.0	172.0					8																	103299695		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4923C>T	8.37:g.103299695G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.S1641	ENST00000520539.1	37	c.4923	CCDS34933.1	8																																																																																			UBR5	-	NULL	ENSG00000104517		0.468	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	55	0.00	0	G	NM_015902		103299695	103299695	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	silent	176	18.52	40	SNP	1.000	A
UBR5	51366	genome.wustl.edu	37	8	103299695	103299695	+	Silent	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:103299695G>A	ENST00000520539.1	-	37	5529	c.4923C>T	c.(4921-4923)agC>agT	p.S1641S	UBR5_ENST00000220959.4_Silent_p.S1641S|UBR5_ENST00000519528.1_5'Flank|UBR5_ENST00000521922.1_Silent_p.S1635S	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1641					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.S1641S(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CAGTGACAACGCTTCTGCGCC	0.468																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											1	Substitution - coding silent(1)	breast(1)											207.0	154.0	172.0					8																	103299695		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4923C>T	8.37:g.103299695G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.S1641	ENST00000520539.1	37	c.4923	CCDS34933.1	8																																																																																			UBR5	-	NULL	ENSG00000104517		0.468	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	81	0.00	0	G	NM_015902		103299695	103299695	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	silent	176	18.52	40	SNP	1.000	A
UCHL5	51377	genome.wustl.edu	37	1	192998533	192998533	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:192998533T>C	ENST00000367455.4	-	5	654	c.419A>G	c.(418-420)cAc>cGc	p.H140R	UCHL5_ENST00000367452.4_Missense_Mutation_p.H16R|UCHL5_ENST00000367451.4_Missense_Mutation_p.H140R|UCHL5_ENST00000367448.1_Missense_Mutation_p.H140R|UCHL5_ENST00000367454.1_Missense_Mutation_p.H140R|UCHL5_ENST00000530098.2_Missense_Mutation_p.H16R|UCHL5_ENST00000367449.1_Missense_Mutation_p.H140R	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	140					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)	p.H140R(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						GAAACTGTTGTGTACTTGTCG	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	88.0	87.0					1																	192998533		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.419A>G	1.37:g.192998533T>C	ENSP00000356425:p.His140Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Missense_Mutation	SNP	pfam_Peptidase_C12,pirsf_Ubiquitinyl_hydrolase_UCH37,prints_Peptidase_C12	p.H140R	ENST00000367455.4	37	c.419	CCDS1378.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.4|21.4	4.150065|4.150065	0.78001|0.78001	.|.	.|.	ENSG00000116750|ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451;ENST00000367448;ENST00000367449;ENST00000367452;ENST00000530098;ENST00000391991;ENST00000421683|ENST00000420791	T;T;T;T;T;T;T;T;T|.	0.73047|.	0.01;0.01;0.01;0.01;0.01;0.01;-0.71;-0.71;0.01|.	5.68|5.68	5.68|5.68	0.88126|0.88126	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87696|0.87696	0.6242|0.6242	H|H	0.96080|0.96080	3.765|3.765	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;1.0;0.999;1.0;0.993;0.998|.	D|D	0.91540|0.91540	0.5249|0.5249	10|5	0.87932|.	D|.	0|.	-23.6355|-23.6355	16.2269|16.2269	0.82300|0.82300	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	16;16;140;140;140;140|.	B7Z9U9;B4DW59;Q9Y5K5-2;Q9Y5K5-4;Q9Y5K5-3;Q9Y5K5|.	.;.;.;.;.;UCHL5_HUMAN|.	R|A	140;140;152;140;140;140;16;16;130;131|31	ENSP00000356425:H140R;ENSP00000356424:H140R;ENSP00000356420:H152R;ENSP00000356421:H140R;ENSP00000356418:H140R;ENSP00000356419:H140R;ENSP00000356422:H16R;ENSP00000431171:H16R;ENSP00000389563:H131R|.	ENSP00000356418:H140R|.	H|T	-|-	2|1	0|0	UCHL5|UCHL5	191265156|191265156	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	5.608000|5.608000	0.67654|0.67654	2.296000|2.296000	0.77279|0.77279	0.482000|0.482000	0.46254|0.46254	CAC|ACA	UCHL5	-	pfam_Peptidase_C12,pirsf_Ubiquitinyl_hydrolase_UCH37	ENSG00000116750		0.303	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UCHL5	HGNC	protein_coding	OTTHUMT00000086318.3	256	0.00	0	T	NM_015984		192998533	192998533	-1	no_errors	ENST00000367451	ensembl	human	known	69_37n	missense	186	13.49	29	SNP	1.000	C
UCHL5	51377	genome.wustl.edu	37	1	192998533	192998533	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr1:192998533T>C	ENST00000367455.4	-	5	654	c.419A>G	c.(418-420)cAc>cGc	p.H140R	UCHL5_ENST00000367452.4_Missense_Mutation_p.H16R|UCHL5_ENST00000367451.4_Missense_Mutation_p.H140R|UCHL5_ENST00000367448.1_Missense_Mutation_p.H140R|UCHL5_ENST00000367454.1_Missense_Mutation_p.H140R|UCHL5_ENST00000530098.2_Missense_Mutation_p.H16R|UCHL5_ENST00000367449.1_Missense_Mutation_p.H140R	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	140					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)	p.H140R(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						GAAACTGTTGTGTACTTGTCG	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	88.0	87.0					1																	192998533		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.419A>G	1.37:g.192998533T>C	ENSP00000356425:p.His140Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Missense_Mutation	SNP	pfam_Peptidase_C12,pirsf_Ubiquitinyl_hydrolase_UCH37,prints_Peptidase_C12	p.H140R	ENST00000367455.4	37	c.419	CCDS1378.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.4|21.4	4.150065|4.150065	0.78001|0.78001	.|.	.|.	ENSG00000116750|ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451;ENST00000367448;ENST00000367449;ENST00000367452;ENST00000530098;ENST00000391991;ENST00000421683|ENST00000420791	T;T;T;T;T;T;T;T;T|.	0.73047|.	0.01;0.01;0.01;0.01;0.01;0.01;-0.71;-0.71;0.01|.	5.68|5.68	5.68|5.68	0.88126|0.88126	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87696|0.87696	0.6242|0.6242	H|H	0.96080|0.96080	3.765|3.765	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;1.0;0.999;1.0;0.993;0.998|.	D|D	0.91540|0.91540	0.5249|0.5249	10|5	0.87932|.	D|.	0|.	-23.6355|-23.6355	16.2269|16.2269	0.82300|0.82300	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	16;16;140;140;140;140|.	B7Z9U9;B4DW59;Q9Y5K5-2;Q9Y5K5-4;Q9Y5K5-3;Q9Y5K5|.	.;.;.;.;.;UCHL5_HUMAN|.	R|A	140;140;152;140;140;140;16;16;130;131|31	ENSP00000356425:H140R;ENSP00000356424:H140R;ENSP00000356420:H152R;ENSP00000356421:H140R;ENSP00000356418:H140R;ENSP00000356419:H140R;ENSP00000356422:H16R;ENSP00000431171:H16R;ENSP00000389563:H131R|.	ENSP00000356418:H140R|.	H|T	-|-	2|1	0|0	UCHL5|UCHL5	191265156|191265156	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	5.608000|5.608000	0.67654|0.67654	2.296000|2.296000	0.77279|0.77279	0.482000|0.482000	0.46254|0.46254	CAC|ACA	UCHL5	-	pfam_Peptidase_C12,pirsf_Ubiquitinyl_hydrolase_UCH37	ENSG00000116750		0.303	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UCHL5	HGNC	protein_coding	OTTHUMT00000086318.3	364	0.00	0	T	NM_015984		192998533	192998533	-1	no_errors	ENST00000367451	ensembl	human	known	69_37n	missense	186	13.49	29	SNP	1.000	C
UGT2B15	7366	genome.wustl.edu	37	4	69519794	69519794	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:69519794T>C	ENST00000338206.5	-	5	1283	c.1274A>G	c.(1273-1275)gAt>gGt	p.D425G		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	425					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.D425G(1)								Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	ATTGAGCAAATCTCTACTTGA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											177.0	167.0	170.0					4																	69519794		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.1274A>G	4.37:g.69519794T>C	ENSP00000341045:p.Asp425Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D425G	ENST00000338206.5	37	c.1274	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	t	13.18	2.161655	0.38119	.	.	ENSG00000196620	ENST00000338206	T	0.63580	-0.05	2.5	2.5	0.30297	.	0.140866	0.43919	U	0.000505	T	0.74696	0.3750	M	0.92738	3.34	0.28278	N	0.924111	P	0.51449	0.945	P	0.51974	0.686	T	0.71178	-0.4669	10	0.72032	D	0.01	.	8.4786	0.33030	0.0:0.0:0.0:1.0	.	425	P54855	UDB15_HUMAN	G	425	ENSP00000341045:D425G	ENSP00000341045:D425G	D	-	2	0	UGT2B15	69202389	0.871000	0.30034	0.076000	0.20297	0.041000	0.13682	2.800000	0.47900	1.137000	0.42214	0.329000	0.21502	GAT	UGT2B15	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000196620		0.413	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	103	0.00	0	T	NM_001076		69519794	69519794	-1	no_errors	ENST00000338206	ensembl	human	known	69_37n	missense	77	28.04	30	SNP	0.980	C
UGT2B15	7366	genome.wustl.edu	37	4	69519794	69519794	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:69519794T>C	ENST00000338206.5	-	5	1283	c.1274A>G	c.(1273-1275)gAt>gGt	p.D425G		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	425					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.D425G(1)								Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	ATTGAGCAAATCTCTACTTGA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											177.0	167.0	170.0					4																	69519794		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.1274A>G	4.37:g.69519794T>C	ENSP00000341045:p.Asp425Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D425G	ENST00000338206.5	37	c.1274	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	t	13.18	2.161655	0.38119	.	.	ENSG00000196620	ENST00000338206	T	0.63580	-0.05	2.5	2.5	0.30297	.	0.140866	0.43919	U	0.000505	T	0.74696	0.3750	M	0.92738	3.34	0.28278	N	0.924111	P	0.51449	0.945	P	0.51974	0.686	T	0.71178	-0.4669	10	0.72032	D	0.01	.	8.4786	0.33030	0.0:0.0:0.0:1.0	.	425	P54855	UDB15_HUMAN	G	425	ENSP00000341045:D425G	ENSP00000341045:D425G	D	-	2	0	UGT2B15	69202389	0.871000	0.30034	0.076000	0.20297	0.041000	0.13682	2.800000	0.47900	1.137000	0.42214	0.329000	0.21502	GAT	UGT2B15	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000196620		0.413	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	72	0.00	0	T	NM_001076		69519794	69519794	-1	no_errors	ENST00000338206	ensembl	human	known	69_37n	missense	77	28.04	30	SNP	0.980	C
UNC5D	137970	genome.wustl.edu	37	8	35541224	35541224	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:35541224T>A	ENST00000404895.2	+	5	1058	c.730T>A	c.(730-732)Tcg>Acg	p.S244T	UNC5D_ENST00000453357.2_Missense_Mutation_p.S239T|UNC5D_ENST00000287272.2_Missense_Mutation_p.S244T|UNC5D_ENST00000416672.1_Missense_Mutation_p.S244T|UNC5D_ENST00000420357.1_Missense_Mutation_p.S244T	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	244	Ig-like C2-type.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.S239T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAGAAGCCTGTCGGCCACTGT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	49.0	51.0					8																	35541224		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.730T>A	8.37:g.35541224T>A	ENSP00000385143:p.Ser244Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death,pfam_Immunoglobulin,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.S244T	ENST00000404895.2	37	c.730	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	T	4.841	0.156354	0.09236	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.39	5.39	0.77823	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.113255	0.64402	D	0.000009	T	0.40570	0.1122	N	0.03891	-0.335	0.25951	N	0.98275	B;B;B	0.10296	0.003;0.001;0.001	B;B;B	0.10450	0.005;0.004;0.005	T	0.08330	-1.0727	10	0.02654	T	1	-13.8055	15.7214	0.77713	0.0:0.0:0.0:1.0	.	244;239;244	C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	T	244;244;244;244;239	ENSP00000385143:S244T;ENSP00000392739:S244T;ENSP00000287272:S244T;ENSP00000412652:S244T;ENSP00000394303:S239T	ENSP00000287272:S244T	S	+	1	0	UNC5D	35660766	1.000000	0.71417	0.993000	0.49108	0.707000	0.40811	4.220000	0.58567	2.188000	0.69820	0.533000	0.62120	TCG	UNC5D	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000156687		0.512	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	36	0.00	0	T			35541224	35541224	+1	no_errors	ENST00000404895	ensembl	human	known	69_37n	missense	76	24.75	25	SNP	1.000	A
UNC5D	137970	genome.wustl.edu	37	8	35541224	35541224	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr8:35541224T>A	ENST00000404895.2	+	5	1058	c.730T>A	c.(730-732)Tcg>Acg	p.S244T	UNC5D_ENST00000453357.2_Missense_Mutation_p.S239T|UNC5D_ENST00000287272.2_Missense_Mutation_p.S244T|UNC5D_ENST00000416672.1_Missense_Mutation_p.S244T|UNC5D_ENST00000420357.1_Missense_Mutation_p.S244T	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	244	Ig-like C2-type.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.S239T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAGAAGCCTGTCGGCCACTGT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	49.0	51.0					8																	35541224		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.730T>A	8.37:g.35541224T>A	ENSP00000385143:p.Ser244Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death,pfam_Immunoglobulin,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.S244T	ENST00000404895.2	37	c.730	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	T	4.841	0.156354	0.09236	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.39	5.39	0.77823	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.113255	0.64402	D	0.000009	T	0.40570	0.1122	N	0.03891	-0.335	0.25951	N	0.98275	B;B;B	0.10296	0.003;0.001;0.001	B;B;B	0.10450	0.005;0.004;0.005	T	0.08330	-1.0727	10	0.02654	T	1	-13.8055	15.7214	0.77713	0.0:0.0:0.0:1.0	.	244;239;244	C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	T	244;244;244;244;239	ENSP00000385143:S244T;ENSP00000392739:S244T;ENSP00000287272:S244T;ENSP00000412652:S244T;ENSP00000394303:S239T	ENSP00000287272:S244T	S	+	1	0	UNC5D	35660766	1.000000	0.71417	0.993000	0.49108	0.707000	0.40811	4.220000	0.58567	2.188000	0.69820	0.533000	0.62120	TCG	UNC5D	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000156687		0.512	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	51	0.00	0	T			35541224	35541224	+1	no_errors	ENST00000404895	ensembl	human	known	69_37n	missense	76	24.75	25	SNP	1.000	A
USP25	29761	genome.wustl.edu	37	21	17205712	17205712	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:17205712C>A	ENST00000285679.6	+	17	2408	c.2039C>A	c.(2038-2040)aCa>aAa	p.T680K	USP25_ENST00000400183.2_Missense_Mutation_p.T680K|USP25_ENST00000285681.2_Missense_Mutation_p.T680K|USP25_ENST00000351097.5_Intron	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	680					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.T680K(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GGTATAGAAACATTACCACCG	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											75.0	80.0	79.0					21																	17205712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2039C>A	21.37:g.17205712C>A	ENSP00000285679:p.Thr680Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Ubiquitin-int_motif,superfamily_UBA-like,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19	p.T680K	ENST00000285679.6	37	c.2039	CCDS33515.1	21	.	.	.	.	.	.	.	.	.	.	C	14.02	2.409383	0.42715	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000400183	T;T;T	0.21361	2.02;2.01;2.01	5.24	5.24	0.73138	.	0.048254	0.85682	D	0.000000	T	0.14614	0.0353	N	0.17674	0.51	0.58432	D	0.999993	B;B;B	0.10296	0.003;0.003;0.001	B;B;B	0.17979	0.02;0.008;0.001	T	0.06917	-1.0800	10	0.06099	T	0.92	.	19.1929	0.93674	0.0:1.0:0.0:0.0	.	680;680;680	Q9UHP3-3;Q9UHP3-1;Q9UHP3	.;.;UBP25_HUMAN	K	680	ENSP00000285681:T680K;ENSP00000285679:T680K;ENSP00000383044:T680K	ENSP00000285679:T680K	T	+	2	0	USP25	16127583	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.893000	0.69798	2.615000	0.88500	0.591000	0.81541	ACA	USP25	-	NULL	ENSG00000155313		0.363	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	HGNC	protein_coding	OTTHUMT00000157964.1	113	0.00	0	C			17205712	17205712	+1	no_errors	ENST00000400183	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	1.000	A
USP25	29761	genome.wustl.edu	37	21	17205712	17205712	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr21:17205712C>A	ENST00000285679.6	+	17	2408	c.2039C>A	c.(2038-2040)aCa>aAa	p.T680K	USP25_ENST00000400183.2_Missense_Mutation_p.T680K|USP25_ENST00000285681.2_Missense_Mutation_p.T680K|USP25_ENST00000351097.5_Intron	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	680					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.T680K(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GGTATAGAAACATTACCACCG	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											75.0	80.0	79.0					21																	17205712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2039C>A	21.37:g.17205712C>A	ENSP00000285679:p.Thr680Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Ubiquitin-int_motif,superfamily_UBA-like,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19	p.T680K	ENST00000285679.6	37	c.2039	CCDS33515.1	21	.	.	.	.	.	.	.	.	.	.	C	14.02	2.409383	0.42715	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000400183	T;T;T	0.21361	2.02;2.01;2.01	5.24	5.24	0.73138	.	0.048254	0.85682	D	0.000000	T	0.14614	0.0353	N	0.17674	0.51	0.58432	D	0.999993	B;B;B	0.10296	0.003;0.003;0.001	B;B;B	0.17979	0.02;0.008;0.001	T	0.06917	-1.0800	10	0.06099	T	0.92	.	19.1929	0.93674	0.0:1.0:0.0:0.0	.	680;680;680	Q9UHP3-3;Q9UHP3-1;Q9UHP3	.;.;UBP25_HUMAN	K	680	ENSP00000285681:T680K;ENSP00000285679:T680K;ENSP00000383044:T680K	ENSP00000285679:T680K	T	+	2	0	USP25	16127583	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.893000	0.69798	2.615000	0.88500	0.591000	0.81541	ACA	USP25	-	NULL	ENSG00000155313		0.363	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	HGNC	protein_coding	OTTHUMT00000157964.1	74	0.00	0	C			17205712	17205712	+1	no_errors	ENST00000400183	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	1.000	A
WDR11	55717	genome.wustl.edu	37	10	122646224	122646234	+	Frame_Shift_Del	DEL	AATCTGAACTT	AATCTGAACTT	-	rs184461171		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	AATCTGAACTT	AATCTGAACTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:122646224_122646234delAATCTGAACTT	ENST00000263461.6	+	16	2243_2253	c.1997_2007delAATCTGAACTT	c.(1996-2007)aaatctgaacttfs	p.KSEL666fs	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.L669fs*13(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GCAGAAAGTAAATCTGAACTTAGTCAGAACA	0.384																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.1997_2007delAATCTGAACTT	10.37:g.122646224_122646234delAATCTGAACTT	ENSP00000263461:p.Lys666fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.L669fs	ENST00000263461.6	37	c.1997_2007	CCDS7619.1	10																																																																																			WDR11	-	NULL	ENSG00000120008		0.384	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	46	0.00	0	AATCTGAACTT			122646224	122646234	+1	no_errors	ENST00000263461	ensembl	human	known	69_37n	frame_shift_del	30	30.23	13	DEL	1.000:1.000:1.000:1.000:0.751:1.000:1.000:1.000:1.000:1.000:0.996	-
WDR11	55717	genome.wustl.edu	37	10	122646224	122646234	+	Frame_Shift_Del	DEL	AATCTGAACTT	AATCTGAACTT	-	rs184461171		TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	AATCTGAACTT	AATCTGAACTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:122646224_122646234delAATCTGAACTT	ENST00000263461.6	+	16	2243_2253	c.1997_2007delAATCTGAACTT	c.(1996-2007)aaatctgaacttfs	p.KSEL666fs	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.L669fs*13(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GCAGAAAGTAAATCTGAACTTAGTCAGAACA	0.384																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.1997_2007delAATCTGAACTT	10.37:g.122646224_122646234delAATCTGAACTT	ENSP00000263461:p.Lys666fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.L669fs	ENST00000263461.6	37	c.1997_2007	CCDS7619.1	10																																																																																			WDR11	-	NULL	ENSG00000120008		0.384	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	64	0.00	0	AATCTGAACTT			122646224	122646234	+1	no_errors	ENST00000263461	ensembl	human	known	69_37n	frame_shift_del	30	30.23	13	DEL	1.000:1.000:1.000:1.000:0.751:1.000:1.000:1.000:1.000:1.000:0.996	-
XIRP1	165904	genome.wustl.edu	37	3	39229254	39229254	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr3:39229254C>T	ENST00000340369.3	-	2	1911	c.1683G>A	c.(1681-1683)atG>atA	p.M561I	XIRP1_ENST00000396251.1_Missense_Mutation_p.M561I|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	561	Interaction with CTNNB1. {ECO:0000250}.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.M561I(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GTTGGTGGATCATCTCCAGGG	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	51.0	51.0					3																	39229254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1683G>A	3.37:g.39229254C>T	ENSP00000343140:p.Met561Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.M561I	ENST00000340369.3	37	c.1683	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	C	9.995	1.231929	0.22626	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.04603	3.59;3.99	4.54	-1.17	0.09648	.	0.445353	0.23530	N	0.047192	T	0.02342	0.0072	N	0.14661	0.345	0.58432	D	0.999998	B;B	0.06786	0.001;0.001	B;B	0.10450	0.001;0.005	T	0.48258	-0.9051	10	0.59425	D	0.04	.	1.9949	0.03454	0.1344:0.4701:0.266:0.1295	.	561;561	Q702N8;Q702N8-2	XIRP1_HUMAN;.	I	561	ENSP00000379550:M561I;ENSP00000343140:M561I	ENSP00000343140:M561I	M	-	3	0	XIRP1	39204258	0.987000	0.35691	0.992000	0.48379	0.965000	0.64279	0.091000	0.15046	-0.038000	0.13624	0.655000	0.94253	ATG	XIRP1	-	NULL	ENSG00000168334		0.622	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	11	0.00	0	C	XM_093522		39229254	39229254	-1	no_errors	ENST00000340369	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	0.792	T
ZFP92	139735	genome.wustl.edu	37	X	152686529	152686529	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:152686529G>A	ENST00000338647.5	+	4	695	c.694G>A	c.(694-696)Ggc>Agc	p.G232S	U82695.10_ENST00000569962.1_lincRNA	NM_001136273.1	NP_001129745.1	A6NM28	ZFP92_HUMAN	ZFP92 zinc finger protein	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G311S(1)		breast(2)|endometrium(4)	6						CATCCACAGCGGCGAGCGGCC	0.697																																						dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	25.0	26.0					X																	152686529		692	1591	2283	-	-	-	SO:0001583	missense	0			U82695	CCDS59177.1	Xq28	2013-01-08	2012-11-27		ENSG00000189420	ENSG00000189420		"""Zinc fingers, C2H2-type"", ""-"""	12865	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp92 in mouse"", ""zinc finger protein 92 homolog (mouse)"""				Standard	NM_001136273		Approved	ZNF897	uc011myo.2	A6NM28	OTTHUMG00000024198	ENST00000338647.5:c.694G>A	X.37:g.152686529G>A	ENSP00000462054:p.Gly232Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G232S	ENST00000338647.5	37	c.694	CCDS59177.1	X																																																																																			ZFP92	-	pfscan_Znf_C2H2	ENSG00000189420		0.697	ZFP92-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP92	HGNC	protein_coding	OTTHUMT00000332220.2	11	0.00	0	G			152686529	152686529	+1	no_errors	ENST00000338647	ensembl	human	known	69_37n	missense	22	34.29	12	SNP	0.022	A
ZFP92	139735	genome.wustl.edu	37	X	152686529	152686529	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:152686529G>A	ENST00000338647.5	+	4	695	c.694G>A	c.(694-696)Ggc>Agc	p.G232S	U82695.10_ENST00000569962.1_lincRNA	NM_001136273.1	NP_001129745.1	A6NM28	ZFP92_HUMAN	ZFP92 zinc finger protein	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G311S(1)		breast(2)|endometrium(4)	6						CATCCACAGCGGCGAGCGGCC	0.697																																						dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	25.0	26.0					X																	152686529		692	1591	2283	-	-	-	SO:0001583	missense	0			U82695	CCDS59177.1	Xq28	2013-01-08	2012-11-27		ENSG00000189420	ENSG00000189420		"""Zinc fingers, C2H2-type"", ""-"""	12865	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp92 in mouse"", ""zinc finger protein 92 homolog (mouse)"""				Standard	NM_001136273		Approved	ZNF897	uc011myo.2	A6NM28	OTTHUMG00000024198	ENST00000338647.5:c.694G>A	X.37:g.152686529G>A	ENSP00000462054:p.Gly232Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G232S	ENST00000338647.5	37	c.694	CCDS59177.1	X																																																																																			ZFP92	-	pfscan_Znf_C2H2	ENSG00000189420		0.697	ZFP92-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP92	HGNC	protein_coding	OTTHUMT00000332220.2	8	0.00	0	G			152686529	152686529	+1	no_errors	ENST00000338647	ensembl	human	known	69_37n	missense	22	34.29	12	SNP	0.022	A
ZNF101	94039	genome.wustl.edu	37	19	19790274	19790274	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:19790274G>A	ENST00000592502.1	+	4	586	c.476G>A	c.(475-477)cGc>cAc	p.R159H	ZNF101_ENST00000415784.2_Missense_Mutation_p.R39H|ZNF101_ENST00000444249.2_3'UTR			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R159H(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						GGTGCACGGCGCACAGTAACA	0.478																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											94.0	95.0	95.0					19																	19790274		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.476G>A	19.37:g.19790274G>A	ENSP00000468049:p.Arg159His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JU83|Q0VDG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R159H	ENST00000592502.1	37	c.476	CCDS32971.1	19	.	.	.	.	.	.	.	.	.	.	G	0	-2.587963	0.00128	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.07800	3.16;3.16	0.235	-0.47	0.12131	.	.	.	.	.	T	0.03011	0.0089	N	0.08118	0	0.23138	N	0.998238	B	0.02656	0.0	B	0.01281	0.0	T	0.44907	-0.9297	9	0.02654	T	1	.	5.548	0.17076	0.7377:0.0:0.2623:0.0	.	159	Q8IZC7	ZN101_HUMAN	H	159;159;39	ENSP00000319716:R159H;ENSP00000400952:R39H	ENSP00000319716:R159H	R	+	2	0	ZNF101	19651274	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	-1.475000	0.02335	-1.768000	0.01298	-1.745000	0.00682	CGC	ZNF101	-	NULL	ENSG00000181896		0.478	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	HGNC	protein_coding	OTTHUMT00000460559.1	40	0.00	0	G	NM_033204		19790274	19790274	+1	no_errors	ENST00000318110	ensembl	human	known	69_37n	missense	104	16.80	21	SNP	0.935	A
ZNF101	94039	genome.wustl.edu	37	19	19790274	19790274	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:19790274G>A	ENST00000592502.1	+	4	586	c.476G>A	c.(475-477)cGc>cAc	p.R159H	ZNF101_ENST00000415784.2_Missense_Mutation_p.R39H|ZNF101_ENST00000444249.2_3'UTR			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R159H(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						GGTGCACGGCGCACAGTAACA	0.478																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											94.0	95.0	95.0					19																	19790274		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.476G>A	19.37:g.19790274G>A	ENSP00000468049:p.Arg159His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JU83|Q0VDG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R159H	ENST00000592502.1	37	c.476	CCDS32971.1	19	.	.	.	.	.	.	.	.	.	.	G	0	-2.587963	0.00128	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.07800	3.16;3.16	0.235	-0.47	0.12131	.	.	.	.	.	T	0.03011	0.0089	N	0.08118	0	0.23138	N	0.998238	B	0.02656	0.0	B	0.01281	0.0	T	0.44907	-0.9297	9	0.02654	T	1	.	5.548	0.17076	0.7377:0.0:0.2623:0.0	.	159	Q8IZC7	ZN101_HUMAN	H	159;159;39	ENSP00000319716:R159H;ENSP00000400952:R39H	ENSP00000319716:R159H	R	+	2	0	ZNF101	19651274	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	-1.475000	0.02335	-1.768000	0.01298	-1.745000	0.00682	CGC	ZNF101	-	NULL	ENSG00000181896		0.478	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	HGNC	protein_coding	OTTHUMT00000460559.1	51	0.00	0	G	NM_033204		19790274	19790274	+1	no_errors	ENST00000318110	ensembl	human	known	69_37n	missense	104	16.80	21	SNP	0.935	A
ZNF318	24149	genome.wustl.edu	37	6	43323219	43323219	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr6:43323219C>T	ENST00000361428.2	-	4	1930	c.1853G>A	c.(1852-1854)cGa>cAa	p.R618Q	ZNF318_ENST00000318149.3_Missense_Mutation_p.R618Q	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	618					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R618Q(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GCCATGAAGTCGTTCCTGGGT	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											153.0	139.0	144.0					6																	43323219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.1853G>A	6.37:g.43323219C>T	ENSP00000354964:p.Arg618Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.R618Q	ENST00000361428.2	37	c.1853	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019098	0.93462	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.49432	0.78;1.86	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.55497	0.1924	L	0.32530	0.975	0.58432	D	0.999995	D	0.89917	1.0	D	0.81914	0.995	T	0.56044	-0.8044	10	0.72032	D	0.01	-8.6073	20.8794	0.99867	0.0:1.0:0.0:0.0	.	618	Q5VUA4	ZN318_HUMAN	Q	618	ENSP00000323032:R618Q;ENSP00000354964:R618Q	ENSP00000323032:R618Q	R	-	2	0	ZNF318	43431197	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.205000	0.77881	2.941000	0.99782	0.655000	0.94253	CGA	ZNF318	-	NULL	ENSG00000171467		0.502	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	15	0.00	0	C	NM_014345		43323219	43323219	-1	no_errors	ENST00000361428	ensembl	human	known	69_37n	missense	71	25.26	24	SNP	1.000	T
ZNF318	24149	genome.wustl.edu	37	6	43323219	43323219	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr6:43323219C>T	ENST00000361428.2	-	4	1930	c.1853G>A	c.(1852-1854)cGa>cAa	p.R618Q	ZNF318_ENST00000318149.3_Missense_Mutation_p.R618Q	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	618					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R618Q(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GCCATGAAGTCGTTCCTGGGT	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											153.0	139.0	144.0					6																	43323219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.1853G>A	6.37:g.43323219C>T	ENSP00000354964:p.Arg618Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.R618Q	ENST00000361428.2	37	c.1853	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019098	0.93462	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.49432	0.78;1.86	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.55497	0.1924	L	0.32530	0.975	0.58432	D	0.999995	D	0.89917	1.0	D	0.81914	0.995	T	0.56044	-0.8044	10	0.72032	D	0.01	-8.6073	20.8794	0.99867	0.0:1.0:0.0:0.0	.	618	Q5VUA4	ZN318_HUMAN	Q	618	ENSP00000323032:R618Q;ENSP00000354964:R618Q	ENSP00000323032:R618Q	R	-	2	0	ZNF318	43431197	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.205000	0.77881	2.941000	0.99782	0.655000	0.94253	CGA	ZNF318	-	NULL	ENSG00000171467		0.502	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	27	0.00	0	C	NM_014345		43323219	43323219	-1	no_errors	ENST00000361428	ensembl	human	known	69_37n	missense	71	25.26	24	SNP	1.000	T
ZNF394	84124	genome.wustl.edu	37	7	99097679	99097679	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr7:99097679T>C	ENST00000337673.6	-	1	241	c.38A>G	c.(37-39)gAc>gGc	p.D13G	ZNF394_ENST00000426306.2_Missense_Mutation_p.D13G|ZNF394_ENST00000394177.3_Intron|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000493485.1_Intron	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	13					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D13G(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CAACTCGGCGTCACTGCCGCG	0.602																																					Ovarian(24;589 697 9939 12704 40742)	dbGAP											1	Substitution - Missense(1)	breast(1)											44.0	48.0	46.0					7																	99097679		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.38A>G	7.37:g.99097679T>C	ENSP00000337363:p.Asp13Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.D13G	ENST00000337673.6	37	c.38	CCDS5666.1	7	.	.	.	.	.	.	.	.	.	.	T	15.65	2.895061	0.52121	.	.	ENSG00000160908	ENST00000337673;ENST00000426306	T;T	0.05319	3.46;3.76	2.15	1.01	0.19927	.	.	.	.	.	T	0.03651	0.0104	N	0.14661	0.345	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.06405	0.002;0.002	T	0.41395	-0.9511	9	0.59425	D	0.04	.	3.6851	0.08326	0.0:0.1931:0.0:0.8069	.	13;13	Q05DA6;Q53GI3	.;ZN394_HUMAN	G	13	ENSP00000337363:D13G;ENSP00000409565:D13G	ENSP00000337363:D13G	D	-	2	0	ZNF394	98935615	0.001000	0.12720	0.017000	0.16124	0.150000	0.21749	0.236000	0.17967	0.302000	0.22762	0.533000	0.62120	GAC	ZNF394	-	NULL	ENSG00000160908		0.602	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF394	HGNC	protein_coding	OTTHUMT00000336498.1	9	0.00	0	T	NM_032164		99097679	99097679	-1	no_errors	ENST00000337673	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	0.012	C
ZSCAN32	54925	genome.wustl.edu	37	16	3433091	3433091	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:3433091G>C	ENST00000396852.4	-	7	2162	c.1855C>G	c.(1855-1857)Cag>Gag	p.Q619E	ZSCAN32_ENST00000396846.3_Missense_Mutation_p.Q619E|ZSCAN32_ENST00000304926.3_Missense_Mutation_p.Q407E|NAA60_ENST00000576906.1_Intron|ZSCAN32_ENST00000439568.2_Missense_Mutation_p.Q330E	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	619					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.Q407E(1)|p.L61L(1)									GCACTGAACTGGGAACTGTTG	0.527																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	breast(2)											146.0	134.0	138.0					16																	3433091		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1855C>G	16.37:g.3433091G>C	ENSP00000380061:p.Gln619Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q619E	ENST00000396852.4	37	c.1855		16	.	.	.	.	.	.	.	.	.	.	G	9.871	1.198837	0.22121	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000439568	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	3.68	2.62	0.31277	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05318	0.0141	N	0.03930	-0.32	0.09310	N	1	B;B	0.25486	0.09;0.127	B;B	0.21151	0.033;0.022	T	0.38329	-0.9666	9	0.02654	T	1	.	5.7716	0.18257	0.0:0.2148:0.5649:0.2203	.	407;619	Q9NX65;Q6WMU8	ZN434_HUMAN;.	E	407;619;619;330	ENSP00000302502:Q407E;ENSP00000380061:Q619E;ENSP00000380057:Q619E;ENSP00000391787:Q330E	ENSP00000302502:Q407E	Q	-	1	0	ZNF434	3373092	0.000000	0.05858	0.444000	0.26895	0.903000	0.53119	-1.221000	0.02968	1.619000	0.50296	0.655000	0.94253	CAG	ZNF434	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000140987		0.527	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	ZNF434	HGNC	protein_coding	OTTHUMT00000251509.2	62	0.00	0	G	NM_017810		3433091	3433091	-1	no_errors	ENST00000396846	ensembl	human	known	69_37n	missense	143	23.12	43	SNP	0.001	C
ZSCAN32	54925	genome.wustl.edu	37	16	3433091	3433091	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:3433091G>C	ENST00000396852.4	-	7	2162	c.1855C>G	c.(1855-1857)Cag>Gag	p.Q619E	ZSCAN32_ENST00000396846.3_Missense_Mutation_p.Q619E|ZSCAN32_ENST00000304926.3_Missense_Mutation_p.Q407E|NAA60_ENST00000576906.1_Intron|ZSCAN32_ENST00000439568.2_Missense_Mutation_p.Q330E	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	619					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.Q407E(1)|p.L61L(1)									GCACTGAACTGGGAACTGTTG	0.527																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	breast(2)											146.0	134.0	138.0					16																	3433091		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1855C>G	16.37:g.3433091G>C	ENSP00000380061:p.Gln619Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q619E	ENST00000396852.4	37	c.1855		16	.	.	.	.	.	.	.	.	.	.	G	9.871	1.198837	0.22121	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000439568	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	3.68	2.62	0.31277	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05318	0.0141	N	0.03930	-0.32	0.09310	N	1	B;B	0.25486	0.09;0.127	B;B	0.21151	0.033;0.022	T	0.38329	-0.9666	9	0.02654	T	1	.	5.7716	0.18257	0.0:0.2148:0.5649:0.2203	.	407;619	Q9NX65;Q6WMU8	ZN434_HUMAN;.	E	407;619;619;330	ENSP00000302502:Q407E;ENSP00000380061:Q619E;ENSP00000380057:Q619E;ENSP00000391787:Q330E	ENSP00000302502:Q407E	Q	-	1	0	ZNF434	3373092	0.000000	0.05858	0.444000	0.26895	0.903000	0.53119	-1.221000	0.02968	1.619000	0.50296	0.655000	0.94253	CAG	ZNF434	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000140987		0.527	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	ZNF434	HGNC	protein_coding	OTTHUMT00000251509.2	92	0.00	0	G	NM_017810		3433091	3433091	-1	no_errors	ENST00000396846	ensembl	human	known	69_37n	missense	143	23.12	43	SNP	0.001	C
ZNF438	220929	genome.wustl.edu	37	10	31139084	31139084	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:31139084G>A	ENST00000361310.3	-	6	579	c.250C>T	c.(250-252)Cag>Tag	p.Q84*	ZNF438_ENST00000538351.2_Nonsense_Mutation_p.Q35*|ZNF438_ENST00000331737.6_Nonsense_Mutation_p.Q74*|ZNF438_ENST00000452305.1_Nonsense_Mutation_p.Q74*|ZNF438_ENST00000375311.1_Intron|ZNF438_ENST00000413025.1_Nonsense_Mutation_p.Q84*|ZNF438_ENST00000436087.2_Nonsense_Mutation_p.Q84*|ZNF438_ENST00000444692.2_Nonsense_Mutation_p.Q74*|ZNF438_ENST00000442986.1_Nonsense_Mutation_p.Q84*			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	84					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q84*(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				CCAGCAACCTGCATCAGGGCA	0.532																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											123.0	122.0	123.0					10																	31139084		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.250C>T	10.37:g.31139084G>A	ENSP00000354663:p.Gln84*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q84*	ENST00000361310.3	37	c.250	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	G	44	10.716766	0.99455	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351	.	.	.	5.63	5.63	0.86233	.	0.049979	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-24.4848	13.6125	0.62088	0.0:0.0:0.845:0.155	.	.	.	.	X	74;84;84;84;84;74;74;35	.	ENSP00000333571:Q74X	Q	-	1	0	ZNF438	31179090	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.103000	0.77014	2.655000	0.90218	0.655000	0.94253	CAG	ZNF438	-	NULL	ENSG00000183621		0.532	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1	158	0.00	0	G	NM_182755		31139084	31139084	-1	no_errors	ENST00000361310	ensembl	human	known	69_37n	nonsense	124	27.49	47	SNP	1.000	A
ZNF438	220929	genome.wustl.edu	37	10	31139084	31139084	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr10:31139084G>A	ENST00000361310.3	-	6	579	c.250C>T	c.(250-252)Cag>Tag	p.Q84*	ZNF438_ENST00000538351.2_Nonsense_Mutation_p.Q35*|ZNF438_ENST00000331737.6_Nonsense_Mutation_p.Q74*|ZNF438_ENST00000452305.1_Nonsense_Mutation_p.Q74*|ZNF438_ENST00000375311.1_Intron|ZNF438_ENST00000413025.1_Nonsense_Mutation_p.Q84*|ZNF438_ENST00000436087.2_Nonsense_Mutation_p.Q84*|ZNF438_ENST00000444692.2_Nonsense_Mutation_p.Q74*|ZNF438_ENST00000442986.1_Nonsense_Mutation_p.Q84*			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	84					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q84*(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				CCAGCAACCTGCATCAGGGCA	0.532																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											123.0	122.0	123.0					10																	31139084		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.250C>T	10.37:g.31139084G>A	ENSP00000354663:p.Gln84*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q84*	ENST00000361310.3	37	c.250	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	G	44	10.716766	0.99455	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351	.	.	.	5.63	5.63	0.86233	.	0.049979	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-24.4848	13.6125	0.62088	0.0:0.0:0.845:0.155	.	.	.	.	X	74;84;84;84;84;74;74;35	.	ENSP00000333571:Q74X	Q	-	1	0	ZNF438	31179090	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.103000	0.77014	2.655000	0.90218	0.655000	0.94253	CAG	ZNF438	-	NULL	ENSG00000183621		0.532	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1	96	0.00	0	G	NM_182755		31139084	31139084	-1	no_errors	ENST00000361310	ensembl	human	known	69_37n	nonsense	124	27.49	47	SNP	1.000	A
ZNF560	147741	genome.wustl.edu	37	19	9578743	9578743	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:9578743C>A	ENST00000301480.4	-	10	1093	c.880G>T	c.(880-882)Ggc>Tgc	p.G294C		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G294C(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TAGTCAGTGCCTTCAAAGGAT	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	122.0	127.0					19																	9578743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.880G>T	19.37:g.9578743C>A	ENSP00000301480:p.Gly294Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495S9|Q495T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G294C	ENST00000301480.4	37	c.880	CCDS12214.1	19	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.371761	0.00209	.	.	ENSG00000198028	ENST00000301480	T	0.04083	3.71	1.91	-1.99	0.07457	.	.	.	.	.	T	0.00496	0.0016	N	0.00002	-3.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46693	-0.9173	9	0.02654	T	1	.	4.2613	0.10742	0.4565:0.4046:0.1389:0.0	.	294	Q96MR9	ZN560_HUMAN	C	294	ENSP00000301480:G294C	ENSP00000301480:G294C	G	-	1	0	ZNF560	9439743	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.113000	0.15499	-0.672000	0.05266	-0.494000	0.04653	GGC	ZNF560	-	NULL	ENSG00000198028		0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	HGNC	protein_coding	OTTHUMT00000449901.1	163	0.00	0	C	NM_152476		9578743	9578743	-1	no_errors	ENST00000301480	ensembl	human	known	69_37n	missense	166	18.23	37	SNP	0.048	A
ZNF560	147741	genome.wustl.edu	37	19	9578743	9578743	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:9578743C>A	ENST00000301480.4	-	10	1093	c.880G>T	c.(880-882)Ggc>Tgc	p.G294C		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G294C(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TAGTCAGTGCCTTCAAAGGAT	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	122.0	127.0					19																	9578743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.880G>T	19.37:g.9578743C>A	ENSP00000301480:p.Gly294Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495S9|Q495T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G294C	ENST00000301480.4	37	c.880	CCDS12214.1	19	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.371761	0.00209	.	.	ENSG00000198028	ENST00000301480	T	0.04083	3.71	1.91	-1.99	0.07457	.	.	.	.	.	T	0.00496	0.0016	N	0.00002	-3.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46693	-0.9173	9	0.02654	T	1	.	4.2613	0.10742	0.4565:0.4046:0.1389:0.0	.	294	Q96MR9	ZN560_HUMAN	C	294	ENSP00000301480:G294C	ENSP00000301480:G294C	G	-	1	0	ZNF560	9439743	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.113000	0.15499	-0.672000	0.05266	-0.494000	0.04653	GGC	ZNF560	-	NULL	ENSG00000198028		0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	HGNC	protein_coding	OTTHUMT00000449901.1	248	0.00	0	C	NM_152476		9578743	9578743	-1	no_errors	ENST00000301480	ensembl	human	known	69_37n	missense	166	18.23	37	SNP	0.048	A
ZNF708	7562	genome.wustl.edu	37	19	21477270	21477271	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:21477270_21477271insT	ENST00000356929.3	-	4	694_695	c.497_498insA	c.(496-498)aatfs	p.N166fs		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						ATTTGAAAGGATTTTTTCCAGT	0.327																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.498dupA	19.37:g.21477276_21477276dupT	ENSP00000349401:p.Asn166fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMR0	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N166fs	ENST00000356929.3	37	c.498_497	CCDS32980.1	19																																																																																			ZNF708	-	pfscan_Znf_C2H2	ENSG00000182141		0.327	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF708	HGNC	protein_coding	OTTHUMT00000463953.1	341	0.00	0	-	NM_021269		21477270	21477271	-1	no_errors	ENST00000356929	ensembl	human	known	69_37n	frame_shift_ins	58	19.44	14	INS	0.028:0.884	T
ZNF708	7562	genome.wustl.edu	37	19	21477270	21477271	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:21477270_21477271insT	ENST00000356929.3	-	4	694_695	c.497_498insA	c.(496-498)aatfs	p.N166fs		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						ATTTGAAAGGATTTTTTCCAGT	0.327																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.498dupA	19.37:g.21477276_21477276dupT	ENSP00000349401:p.Asn166fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMR0	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N166fs	ENST00000356929.3	37	c.498_497	CCDS32980.1	19																																																																																			ZNF708	-	pfscan_Znf_C2H2	ENSG00000182141		0.327	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF708	HGNC	protein_coding	OTTHUMT00000463953.1	452	0.00	0	-	NM_021269		21477270	21477271	-1	no_errors	ENST00000356929	ensembl	human	known	69_37n	frame_shift_ins	58	19.44	14	INS	0.028:0.884	T
ZNF528	84436	genome.wustl.edu	37	19	52918378	52918378	+	Splice_Site	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:52918378G>C	ENST00000360465.3	+	7	699	c.273G>C	c.(271-273)gaG>gaC	p.E91D	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E91D(1)		breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		CTGTTTTAGAGAGGAGCTCTA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	38.0	38.0					19																	52918378		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.272-1G>C	19.37:g.52918378G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E91D	ENST00000360465.3	37	c.273	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	G	0.937	-0.710850	0.03230	.	.	ENSG00000167555	ENST00000360465	T	0.05382	3.45	0.966	0.966	0.19667	.	.	.	.	.	T	0.02767	0.0083	N	0.17082	0.46	0.09310	N	1	P	0.40731	0.728	B	0.31946	0.138	T	0.41980	-0.9478	9	0.17369	T	0.5	.	4.8968	0.13755	0.0:0.3947:0.6052:0.0	.	91	Q3MIS6	ZN528_HUMAN	D	91	ENSP00000353652:E91D	ENSP00000353652:E91D	E	+	3	2	ZNF528	57610190	0.377000	0.25106	0.023000	0.16930	0.028000	0.11728	0.256000	0.18351	0.820000	0.34516	0.484000	0.47621	GAG	ZNF528	-	NULL	ENSG00000167555		0.393	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1	117	0.00	0	G	NM_032423	Missense_Mutation	52918378	52918378	+1	no_errors	ENST00000360465	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.021	C
ZNF528	84436	genome.wustl.edu	37	19	52918378	52918378	+	Splice_Site	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr19:52918378G>C	ENST00000360465.3	+	7	699	c.273G>C	c.(271-273)gaG>gaC	p.E91D	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E91D(1)		breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		CTGTTTTAGAGAGGAGCTCTA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	38.0	38.0					19																	52918378		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.272-1G>C	19.37:g.52918378G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E91D	ENST00000360465.3	37	c.273	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	G	0.937	-0.710850	0.03230	.	.	ENSG00000167555	ENST00000360465	T	0.05382	3.45	0.966	0.966	0.19667	.	.	.	.	.	T	0.02767	0.0083	N	0.17082	0.46	0.09310	N	1	P	0.40731	0.728	B	0.31946	0.138	T	0.41980	-0.9478	9	0.17369	T	0.5	.	4.8968	0.13755	0.0:0.3947:0.6052:0.0	.	91	Q3MIS6	ZN528_HUMAN	D	91	ENSP00000353652:E91D	ENSP00000353652:E91D	E	+	3	2	ZNF528	57610190	0.377000	0.25106	0.023000	0.16930	0.028000	0.11728	0.256000	0.18351	0.820000	0.34516	0.484000	0.47621	GAG	ZNF528	-	NULL	ENSG00000167555		0.393	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1	74	0.00	0	G	NM_032423	Missense_Mutation	52918378	52918378	+1	no_errors	ENST00000360465	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.021	C
ZNF81	347344	genome.wustl.edu	37	X	47774342	47774342	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:47774342G>C	ENST00000376954.1	+	6	665	c.297G>C	c.(295-297)aaG>aaC	p.K99N	ZNF81_ENST00000338637.7_Missense_Mutation_p.K99N			P51508	ZNF81_HUMAN	zinc finger protein 81	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K99N(2)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				TTGGAATTAAGCCTTCCCAGA	0.323																																						dbGAP											2	Substitution - Missense(2)	breast(2)											22.0	19.0	20.0					X																	47774342		1795	4057	5852	-	-	-	SO:0001583	missense	0			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.297G>C	X.37:g.47774342G>C	ENSP00000366153:p.Lys99Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K99N	ENST00000376954.1	37	c.297	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	G	0.260	-1.000297	0.02128	.	.	ENSG00000197779	ENST00000376954;ENST00000338637;ENST00000399918	T;T	0.07114	3.22;3.22	4.04	-0.0725	0.13739	.	0.151024	0.31145	N	0.008163	T	0.03915	0.0110	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.36625	-0.9740	10	0.29301	T	0.29	.	2.7586	0.05300	0.3939:0.0:0.3978:0.2083	.	99	P51508	ZNF81_HUMAN	N	99	ENSP00000366153:K99N;ENSP00000341151:K99N	ENSP00000341151:K99N	K	+	3	2	ZNF81	47659286	0.321000	0.24625	0.029000	0.17559	0.548000	0.35241	0.251000	0.18257	-0.137000	0.11455	0.600000	0.82982	AAG	ZNF81	-	NULL	ENSG00000197779		0.323	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	33	0.00	0	G	NM_007137		47774342	47774342	+1	no_errors	ENST00000338637	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.112	C
ZNF81	347344	genome.wustl.edu	37	X	47774342	47774342	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chrX:47774342G>C	ENST00000376954.1	+	6	665	c.297G>C	c.(295-297)aaG>aaC	p.K99N	ZNF81_ENST00000338637.7_Missense_Mutation_p.K99N			P51508	ZNF81_HUMAN	zinc finger protein 81	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K99N(2)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				TTGGAATTAAGCCTTCCCAGA	0.323																																						dbGAP											2	Substitution - Missense(2)	breast(2)											22.0	19.0	20.0					X																	47774342		1795	4057	5852	-	-	-	SO:0001583	missense	0			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.297G>C	X.37:g.47774342G>C	ENSP00000366153:p.Lys99Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K99N	ENST00000376954.1	37	c.297	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	G	0.260	-1.000297	0.02128	.	.	ENSG00000197779	ENST00000376954;ENST00000338637;ENST00000399918	T;T	0.07114	3.22;3.22	4.04	-0.0725	0.13739	.	0.151024	0.31145	N	0.008163	T	0.03915	0.0110	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.36625	-0.9740	10	0.29301	T	0.29	.	2.7586	0.05300	0.3939:0.0:0.3978:0.2083	.	99	P51508	ZNF81_HUMAN	N	99	ENSP00000366153:K99N;ENSP00000341151:K99N	ENSP00000341151:K99N	K	+	3	2	ZNF81	47659286	0.321000	0.24625	0.029000	0.17559	0.548000	0.35241	0.251000	0.18257	-0.137000	0.11455	0.600000	0.82982	AAG	ZNF81	-	NULL	ENSG00000197779		0.323	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	52	0.00	0	G	NM_007137		47774342	47774342	+1	no_errors	ENST00000338637	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.112	C
ZNF827	152485	genome.wustl.edu	37	4	146791465	146791465	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:146791465C>T	ENST00000508784.1	-	5	2140	c.1913G>A	c.(1912-1914)gGg>gAg	p.G638E	ZNF827_ENST00000513320.1_Missense_Mutation_p.G288E|ZNF827_ENST00000379448.4_Missense_Mutation_p.G638E|ZNF827_ENST00000511534.1_5'UTR			Q17R98	ZN827_HUMAN	zinc finger protein 827	638					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G638E(2)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					ACTTCCCTTCCCTTCCTGGGG	0.498																																						dbGAP											2	Substitution - Missense(2)	breast(2)											116.0	106.0	110.0					4																	146791465		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.1913G>A	4.37:g.146791465C>T	ENSP00000421863:p.Gly638Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G638E	ENST00000508784.1	37	c.1913		4	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653749	0.47362	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	T;T;T	0.09255	3.05;3.0;3.09	5.23	4.39	0.52855	.	0.204155	0.51477	D	0.000085	T	0.09992	0.0245	L	0.39898	1.24	0.42493	D	0.992905	B;B;B	0.30281	0.081;0.18;0.275	B;B;B	0.29598	0.088;0.048;0.104	T	0.11446	-1.0587	10	0.46703	T	0.11	-14.2436	10.5303	0.44973	0.122:0.4613:0.4168:0.0	.	288;638;638	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	E	638;288;638;637;288	ENSP00000421863:G638E;ENSP00000423130:G288E;ENSP00000368761:G638E	ENSP00000281318:G637E	G	-	2	0	ZNF827	147010915	0.476000	0.25901	0.998000	0.56505	0.977000	0.68977	0.420000	0.21263	1.339000	0.45563	0.467000	0.42956	GGG	ZNF827	-	NULL	ENSG00000151612		0.498	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF827	HGNC	protein_coding	OTTHUMT00000364654.2	42	0.00	0	C	NM_178835		146791465	146791465	-1	no_errors	ENST00000508784	ensembl	human	known	69_37n	missense	97	29.50	41	SNP	0.999	T
ZNF827	152485	genome.wustl.edu	37	4	146791465	146791465	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr4:146791465C>T	ENST00000508784.1	-	5	2140	c.1913G>A	c.(1912-1914)gGg>gAg	p.G638E	ZNF827_ENST00000513320.1_Missense_Mutation_p.G288E|ZNF827_ENST00000379448.4_Missense_Mutation_p.G638E|ZNF827_ENST00000511534.1_5'UTR			Q17R98	ZN827_HUMAN	zinc finger protein 827	638					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G638E(2)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					ACTTCCCTTCCCTTCCTGGGG	0.498																																						dbGAP											2	Substitution - Missense(2)	breast(2)											116.0	106.0	110.0					4																	146791465		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.1913G>A	4.37:g.146791465C>T	ENSP00000421863:p.Gly638Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G638E	ENST00000508784.1	37	c.1913		4	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653749	0.47362	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	T;T;T	0.09255	3.05;3.0;3.09	5.23	4.39	0.52855	.	0.204155	0.51477	D	0.000085	T	0.09992	0.0245	L	0.39898	1.24	0.42493	D	0.992905	B;B;B	0.30281	0.081;0.18;0.275	B;B;B	0.29598	0.088;0.048;0.104	T	0.11446	-1.0587	10	0.46703	T	0.11	-14.2436	10.5303	0.44973	0.122:0.4613:0.4168:0.0	.	288;638;638	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	E	638;288;638;637;288	ENSP00000421863:G638E;ENSP00000423130:G288E;ENSP00000368761:G638E	ENSP00000281318:G637E	G	-	2	0	ZNF827	147010915	0.476000	0.25901	0.998000	0.56505	0.977000	0.68977	0.420000	0.21263	1.339000	0.45563	0.467000	0.42956	GGG	ZNF827	-	NULL	ENSG00000151612		0.498	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF827	HGNC	protein_coding	OTTHUMT00000364654.2	55	0.00	0	C	NM_178835		146791465	146791465	-1	no_errors	ENST00000508784	ensembl	human	known	69_37n	missense	97	29.50	41	SNP	0.999	T
ZP2	7783	genome.wustl.edu	37	16	21212763	21212763	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:21212763C>G	ENST00000574002.1	-	15	2103	c.1621G>C	c.(1621-1623)Gtc>Ctc	p.V541L	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Missense_Mutation_p.V532L|ZP2_ENST00000219593.4_Missense_Mutation_p.V541L			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	541	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)	p.V541L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TCATCTAAGACCAGCTTGATG	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											210.0	183.0	192.0					16																	21212763		2200	4300	6500	-	-	-	SO:0001583	missense	0			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1621G>C	16.37:g.21212763C>G	ENSP00000460971:p.Val541Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.V541L	ENST00000574002.1	37	c.1621	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702053	0.68501	.	.	ENSG00000103310	ENST00000219593	D	0.81499	-1.5	5.31	5.31	0.75309	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.346233	0.23282	N	0.049895	D	0.85448	0.5699	L	0.54965	1.715	0.36294	D	0.856621	D;P	0.55800	0.973;0.656	P;B	0.60068	0.868;0.394	D	0.87171	0.2221	10	0.41790	T	0.15	-15.3461	15.5185	0.75846	0.0:0.8617:0.1383:0.0	.	532;541	Q4VAP1;Q05996	.;ZP2_HUMAN	L	541	ENSP00000219593:V541L	ENSP00000219593:V541L	V	-	1	0	ZP2	21120264	0.994000	0.37717	1.000000	0.80357	0.979000	0.70002	2.814000	0.48010	2.641000	0.89580	0.591000	0.81541	GTC	ZP2	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	ENSG00000103310		0.507	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	110	0.00	0	C			21212763	21212763	-1	no_errors	ENST00000219593	ensembl	human	known	69_37n	missense	130	29.35	54	SNP	1.000	G
ZP2	7783	genome.wustl.edu	37	16	21212763	21212763	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:21212763C>G	ENST00000574002.1	-	15	2103	c.1621G>C	c.(1621-1623)Gtc>Ctc	p.V541L	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Missense_Mutation_p.V532L|ZP2_ENST00000219593.4_Missense_Mutation_p.V541L			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	541	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)	p.V541L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TCATCTAAGACCAGCTTGATG	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											210.0	183.0	192.0					16																	21212763		2200	4300	6500	-	-	-	SO:0001583	missense	0			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1621G>C	16.37:g.21212763C>G	ENSP00000460971:p.Val541Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.V541L	ENST00000574002.1	37	c.1621	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702053	0.68501	.	.	ENSG00000103310	ENST00000219593	D	0.81499	-1.5	5.31	5.31	0.75309	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.346233	0.23282	N	0.049895	D	0.85448	0.5699	L	0.54965	1.715	0.36294	D	0.856621	D;P	0.55800	0.973;0.656	P;B	0.60068	0.868;0.394	D	0.87171	0.2221	10	0.41790	T	0.15	-15.3461	15.5185	0.75846	0.0:0.8617:0.1383:0.0	.	532;541	Q4VAP1;Q05996	.;ZP2_HUMAN	L	541	ENSP00000219593:V541L	ENSP00000219593:V541L	V	-	1	0	ZP2	21120264	0.994000	0.37717	1.000000	0.80357	0.979000	0.70002	2.814000	0.48010	2.641000	0.89580	0.591000	0.81541	GTC	ZP2	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	ENSG00000103310		0.507	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	80	0.00	0	C			21212763	21212763	-1	no_errors	ENST00000219593	ensembl	human	known	69_37n	missense	130	29.35	54	SNP	1.000	G
ZNRF1	84937	genome.wustl.edu	37	16	75138732	75138732	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:75138732C>G	ENST00000335325.4	+	3	1213	c.571C>G	c.(571-573)Ctg>Gtg	p.L191V	ZNRF1_ENST00000567962.1_Missense_Mutation_p.L191V|ZNRF1_ENST00000566250.1_Missense_Mutation_p.L191V|ZNRF1_ENST00000320619.6_Missense_Mutation_p.L242V|ZNRF1_ENST00000564320.1_3'UTR	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase	191					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L191V(1)		breast(1)	1						CCTGGAGGAGCTGCTGCAGGG	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	69.0	76.0					16																	75138732		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606	ENST00000335325.4:c.571C>G	16.37:g.75138732C>G	ENSP00000335091:p.Leu191Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUJ9|Q9H083	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L242V	ENST00000335325.4	37	c.724	CCDS10912.1	16	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146096	0.77888	.	.	ENSG00000186187	ENST00000320619;ENST00000335325	T;T	0.51071	0.72;0.72	6.17	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.64402	D	0.000001	T	0.60945	0.2308	L	0.39397	1.21	0.80722	D	1	D;D;P	0.71674	0.958;0.998;0.934	P;D;P	0.77557	0.827;0.99;0.856	T	0.64478	-0.6398	10	0.72032	D	0.01	-7.925	15.7894	0.78343	0.0:0.935:0.0:0.065	.	191;242;191	B4DG67;Q8ND25-2;Q8ND25	.;.;ZNRF1_HUMAN	V	242;191	ENSP00000323362:L242V;ENSP00000335091:L191V	ENSP00000323362:L242V	L	+	1	2	ZNRF1	73696233	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.345000	0.44018	1.626000	0.50381	0.655000	0.94253	CTG	ZNRF1	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000186187		0.587	ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNRF1	HGNC	protein_coding	OTTHUMT00000269020.2	17	0.00	0	C			75138732	75138732	+1	no_errors	ENST00000320619	ensembl	human	known	69_37n	missense	101	28.87	41	SNP	1.000	G
ZNRF1	84937	genome.wustl.edu	37	16	75138732	75138732	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0T0-01A-22D-A099-09	TCGA-A2-A0T0-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3c107ce4-a6ac-469b-b1c0-cd86674b5766	94629e5b-195d-495b-bfa5-e10c46930a47	g.chr16:75138732C>G	ENST00000335325.4	+	3	1213	c.571C>G	c.(571-573)Ctg>Gtg	p.L191V	ZNRF1_ENST00000567962.1_Missense_Mutation_p.L191V|ZNRF1_ENST00000566250.1_Missense_Mutation_p.L191V|ZNRF1_ENST00000320619.6_Missense_Mutation_p.L242V|ZNRF1_ENST00000564320.1_3'UTR	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase	191					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L191V(1)		breast(1)	1						CCTGGAGGAGCTGCTGCAGGG	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	69.0	76.0					16																	75138732		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606	ENST00000335325.4:c.571C>G	16.37:g.75138732C>G	ENSP00000335091:p.Leu191Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUJ9|Q9H083	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L242V	ENST00000335325.4	37	c.724	CCDS10912.1	16	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146096	0.77888	.	.	ENSG00000186187	ENST00000320619;ENST00000335325	T;T	0.51071	0.72;0.72	6.17	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.64402	D	0.000001	T	0.60945	0.2308	L	0.39397	1.21	0.80722	D	1	D;D;P	0.71674	0.958;0.998;0.934	P;D;P	0.77557	0.827;0.99;0.856	T	0.64478	-0.6398	10	0.72032	D	0.01	-7.925	15.7894	0.78343	0.0:0.935:0.0:0.065	.	191;242;191	B4DG67;Q8ND25-2;Q8ND25	.;.;ZNRF1_HUMAN	V	242;191	ENSP00000323362:L242V;ENSP00000335091:L191V	ENSP00000323362:L242V	L	+	1	2	ZNRF1	73696233	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.345000	0.44018	1.626000	0.50381	0.655000	0.94253	CTG	ZNRF1	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000186187		0.587	ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNRF1	HGNC	protein_coding	OTTHUMT00000269020.2	26	0.00	0	C			75138732	75138732	+1	no_errors	ENST00000320619	ensembl	human	known	69_37n	missense	101	28.87	41	SNP	1.000	G
