#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD30BL	554226	genome.wustl.edu	37	2	133015302	133015302	+	5'UTR	SNP	T	T	G	rs75692539		TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr2:133015302T>G	ENST00000470729.1	-	0	240				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCAGAGGCGCTCAGGGACGCC	0.677																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1185A>C	2.37:g.133015302T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.677	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	10	0.00	0	T	NR_027019		133015302	133015302	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	42	37.31	25	SNP	0.013	G
ARMCX2	9823	genome.wustl.edu	37	X	100911424	100911424	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chrX:100911424C>T	ENST00000328766.5	-	5	1604	c.1151G>A	c.(1150-1152)gGt>gAt	p.G384D	ARMCX2_ENST00000330154.2_Missense_Mutation_p.G384D|ARMCX2_ENST00000356824.4_Missense_Mutation_p.G384D|ARMCX2_ENST00000467416.1_5'Flank	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	384						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						ATCGCGGACACCCAGAATCTC	0.507																																						dbGAP											0													98.0	88.0	91.0					X																	100911424		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1151G>A	X.37:g.100911424C>T	ENSP00000331662:p.Gly384Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60267|Q5H9D9	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo	p.G384D	ENST00000328766.5	37	c.1151	CCDS14490.1	X	.	.	.	.	.	.	.	.	.	.	C	11.66	1.704374	0.30232	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.26957	1.7;1.7;1.7	3.77	3.77	0.43336	.	0.293840	0.37348	N	0.002126	T	0.12433	0.0302	N	0.05078	-0.115	0.34754	D	0.73207	B	0.28470	0.213	B	0.37989	0.262	T	0.18967	-1.0320	10	0.02654	T	1	-9.0795	10.0786	0.42375	0.0:1.0:0.0:0.0	.	384	Q7L311	ARMX2_HUMAN	D	384	ENSP00000331662:G384D;ENSP00000328631:G384D;ENSP00000349281:G384D	ENSP00000331662:G384D	G	-	2	0	ARMCX2	100798080	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	2.160000	0.42348	2.131000	0.65755	0.422000	0.28245	GGT	ARMCX2	-	pfam_ARM-rpt_dom	ENSG00000184867		0.507	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX2	HGNC	protein_coding	OTTHUMT00000057586.1	80	0.00	0	C	NM_014782		100911424	100911424	-1	no_errors	ENST00000328766	ensembl	human	known	69_37n	missense	103	39.05	66	SNP	0.998	T
BPHL	670	genome.wustl.edu	37	6	3119540	3119540	+	Intron	SNP	C	C	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr6:3119540C>A	ENST00000380379.5	+	1	156				BPHL_ENST00000380368.2_5'UTR|BPHL_ENST00000434640.1_5'UTR|BPHL_ENST00000380375.3_5'UTR	NM_004332.2	NP_004323.2	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like (serine hydrolase)						cellular amino acid metabolic process (GO:0006520)|response to toxic substance (GO:0009636)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)	13	Ovarian(93;0.0386)	all_hematologic(90;0.108)				AGCCTGAGTACCGCTAAGGCT	0.458																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X81372	CCDS4483.2	6p25	2008-08-29	2008-08-29		ENSG00000137274	ENSG00000137274			1094	protein-coding gene	gene with protein product	"""breast epithelial mucin-associated antigen"""	603156		MCNAA		7759552, 9721218, 15832508	Standard	NM_004332		Approved	Bph-rp	uc003mva.3	Q86WA6	OTTHUMG00000014140	ENST00000380379.5:c.107+459C>A	6.37:g.3119540C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q00306|Q13855|Q3KP51	Nonsense_Mutation	SNP	NULL	p.Y43*	ENST00000380379.5	37	c.129	CCDS4483.2	6																																																																																			BPHL	-	NULL	ENSG00000137274		0.458	BPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPHL	HGNC	protein_coding	OTTHUMT00000039670.5	37	0.00	0	C			3119540	3119540	+1	no_errors	ENST00000424847	ensembl	human	known	69_37n	nonsense	55	11.29	7	SNP	0.001	A
C7orf71	285941	genome.wustl.edu	37	7	26686000	26686001	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr7:26686000_26686001insAA	ENST00000409974.3	+	4	1067_1068	c.351_352insAA	c.(352-354)aaafs	p.K118fs		NM_001145531.1	NP_001139003.1	A4D174	CG071_HUMAN	chromosome 7 open reading frame 71	118																	ACACCTTGAAGAAAGCATTCAC	0.46																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS47565.1	7p15.2	2009-09-11			ENSG00000222004	ENSG00000222004			22364	protein-coding gene	gene with protein product							Standard	NM_001145531		Approved		uc003syb.3	A4D174	OTTHUMG00000152860	ENST00000409974.3:c.352_353dupAA	7.37:g.26686001_26686002dupAA	ENSP00000386749:p.Lys118fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	NULL	p.A118fs	ENST00000409974.3	37	c.351_352	CCDS47565.1	7																																																																																			C7orf71	-	NULL	ENSG00000222004		0.460	C7orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf71	HGNC	protein_coding	OTTHUMT00000328272.1	94	0.00	0	-	NM_001145531		26686000	26686001	+1	no_errors	ENST00000409974	ensembl	human	known	69_37n	frame_shift_ins	293	14.08	48	INS	0.769:0.680	AA
CELSR2	1952	genome.wustl.edu	37	1	109808508	109808509	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr1:109808508_109808509insT	ENST00000271332.3	+	14	5940_5941	c.5879_5880insT	c.(5878-5883)ccttttfs	p.PF1960fs		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1960	Laminin EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TGTGACAACCCTTTTGCTGAGG	0.604																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.5883dupT	1.37:g.109808512_109808512dupT	ENSP00000271332:p.Pro1960fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.A1962fs	ENST00000271332.3	37	c.5879_5880	CCDS796.1	1																																																																																			CELSR2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_GPCR_2_extracellular_dom	ENSG00000143126		0.604	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	26	0.00	0	-	NM_001408		109808508	109808509	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	frame_shift_ins	15	65.91	29	INS	1.000:0.968	T
CFHR2	3080	genome.wustl.edu	37	1	196884227	196884227	+	Intron	SNP	C	C	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr1:196884227C>A	ENST00000367421.3	+	2	135				CFHR4_ENST00000367418.2_Missense_Mutation_p.T253K|CFHR4_ENST00000251424.4_Missense_Mutation_p.T253K|CFHR4_ENST00000608469.1_Missense_Mutation_p.T123K|CFHR4_ENST00000367416.2_Missense_Mutation_p.T499K			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						AATTATGTAACATGTAGTAAT	0.388																																						dbGAP											0													147.0	150.0	149.0					1																	196884227		2201	4298	6499	-	-	-	SO:0001627	intron_variant	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-34358C>A	1.37:g.196884227C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.T499K	ENST00000367421.3	37	c.1496		1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.736211	0.49045	.	.	ENSG00000134365	ENST00000367416;ENST00000367418;ENST00000251424;ENST00000538553	T;T;T	0.69435	-0.4;-0.4;-0.4	3.33	-5.32	0.02722	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.66944	0.2841	M	0.72353	2.195	0.09310	N	1	D;D;D	0.63880	0.993;0.984;0.992	P;P;B	0.51453	0.67;0.601;0.343	T	0.62124	-0.6920	9	0.30078	T	0.28	.	9.7745	0.40609	0.0:0.7338:0.0:0.2662	.	499;500;253	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	K	499;253;253;253	ENSP00000356386:T499K;ENSP00000356388:T253K;ENSP00000251424:T253K	ENSP00000251424:T253K	T	+	2	0	CFHR4	195150850	0.000000	0.05858	0.000000	0.03702	0.517000	0.34286	-1.803000	0.01740	-1.473000	0.01881	0.436000	0.28706	ACA	CFHR4	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000134365		0.388	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	HGNC	protein_coding		159	0.00	0	C	NM_005666		196884227	196884227	+1	no_errors	ENST00000367416	ensembl	human	known	69_37n	missense	293	21.87	82	SNP	0.000	A
CLIP4	79745	genome.wustl.edu	37	2	29366667	29366667	+	Silent	SNP	C	C	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr2:29366667C>A	ENST00000320081.5	+	7	996	c.741C>A	c.(739-741)atC>atA	p.I247I	CLIP4_ENST00000401617.2_Silent_p.I140I|CLIP4_ENST00000401605.1_Silent_p.I247I|CLIP4_ENST00000404424.1_Silent_p.I247I	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	247										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					CTAAGGAAATCAAGCAGATGC	0.478																																						dbGAP											0													144.0	133.0	137.0					2																	29366667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.741C>A	2.37:g.29366667C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Silent	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.I247	ENST00000320081.5	37	c.741	CCDS1770.1	2																																																																																			CLIP4	-	NULL	ENSG00000115295		0.478	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP4	HGNC	protein_coding	OTTHUMT00000215123.2	68	0.00	0	C	NM_024692		29366667	29366667	+1	no_errors	ENST00000402240	ensembl	human	known	69_37n	silent	79	36.80	46	SNP	1.000	A
COL6A3	1293	genome.wustl.edu	37	2	238290029	238290029	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr2:238290029C>A	ENST00000295550.4	-	5	1878	c.1426G>T	c.(1426-1428)Gaa>Taa	p.E476*	COL6A3_ENST00000353578.4_Nonsense_Mutation_p.E270*|COL6A3_ENST00000472056.1_Nonsense_Mutation_p.E69*|COL6A3_ENST00000392004.3_Nonsense_Mutation_p.E270*|COL6A3_ENST00000392003.2_Nonsense_Mutation_p.E69*|COL6A3_ENST00000347401.3_Nonsense_Mutation_p.E275*|COL6A3_ENST00000409809.1_Nonsense_Mutation_p.E270*|COL6A3_ENST00000346358.4_Nonsense_Mutation_p.E476*	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	476	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGTCCGATTTCCAGCCTCTGG	0.483																																						dbGAP											0													61.0	62.0	62.0					2																	238290029		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1426G>T	2.37:g.238290029C>A	ENSP00000295550:p.Glu476*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Nonsense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.E476*	ENST00000295550.4	37	c.1426	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	C	38	7.046563	0.98025	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	.	.	.	5.16	5.16	0.70880	.	0.000000	0.53938	D	0.000054	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	18.6471	0.91415	0.0:1.0:0.0:0.0	.	.	.	.	X	476;275;270;69;270;476;270;69;476	.	ENSP00000295550:E476X	E	-	1	0	COL6A3	237954768	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	2.009000	0.40903	2.390000	0.81377	0.655000	0.94253	GAA	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.483	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	28	0.00	0	C	NM_004369		238290029	238290029	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	nonsense	34	27.66	13	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16955128	16955128	+	lincRNA	SNP	A	A	G	rs1762949	byFrequency	TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr1:16955128A>G	ENST00000412962.1	-	0	311							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CAGGCTGTGGACCAGGTTGCT	0.682																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16955128A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.682	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	A	NR_026752.1		16955128	16955128	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	44	20.00	11	SNP	0.562	G
DGKI	9162	genome.wustl.edu	37	7	137092668	137092668	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr7:137092668G>A	ENST00000288490.5	-	31	2897	c.2897C>T	c.(2896-2898)gCa>gTa	p.A966V	DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000453654.2_Missense_Mutation_p.A635V|DGKI_ENST00000446122.1_Missense_Mutation_p.A948V|DGKI_ENST00000424189.2_Missense_Mutation_p.A979V	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	966					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GGTTTTAGCTGCGTAGTGAAG	0.433																																						dbGAP											0													210.0	180.0	190.0					7																	137092668		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2897C>T	7.37:g.137092668G>A	ENSP00000288490:p.Ala966Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A969V	ENST00000288490.5	37	c.2906	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960248	0.92791	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.79653	-1.29;-1.29;-1.29	5.7	5.7	0.88788	Ankyrin repeat-containing domain (3);	0.051890	0.85682	D	0.000000	D	0.92747	0.7694	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.986;0.992	D	0.94294	0.7531	10	0.87932	D	0	.	18.0216	0.89257	0.0:0.0:1.0:0.0	.	635;966	E9PFX6;O75912	.;DGKI_HUMAN	V	635;883;969;966;948	ENSP00000392161:A635V;ENSP00000288490:A966V;ENSP00000399131:A948V	ENSP00000288490:A966V	A	-	2	0	DGKI	136743208	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.370000	0.73114	2.683000	0.91414	0.655000	0.94253	GCA	DGKI	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000157680		0.433	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	140	0.00	0	G	NM_004717		137092668	137092668	-1	no_errors	ENST00000424189	ensembl	human	known	69_37n	missense	403	20.83	106	SNP	1.000	A
ELTD1	64123	genome.wustl.edu	37	1	79358816	79358816	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr1:79358816A>G	ENST00000370742.3	-	13	1871	c.1808T>C	c.(1807-1809)tTg>tCg	p.L603S		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	603					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TTCTGGTTTCAACCCTGCAGT	0.308																																						dbGAP											0													73.0	68.0	70.0					1																	79358816		1820	4069	5889	-	-	-	SO:0001583	missense	0			AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1808T>C	1.37:g.79358816A>G	ENSP00000359778:p.Leu603Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AR71|Q5KU34	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.L603S	ENST00000370742.3	37	c.1808	CCDS41352.1	1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.081441	0.76528	.	.	ENSG00000162618	ENST00000370742;ENST00000401034	T;T	0.39997	1.05;3.13	5.55	5.55	0.83447	GPCR, family 2-like (1);	0.210891	0.40469	N	0.001090	T	0.35422	0.0931	M	0.72353	2.195	0.38782	D	0.954789	B	0.26744	0.158	B	0.36335	0.222	T	0.28776	-1.0033	9	.	.	.	.	15.7093	0.77612	1.0:0.0:0.0:0.0	.	603	Q9HBW9	ELTD1_HUMAN	S	603;61	ENSP00000359778:L603S;ENSP00000383813:L61S	.	L	-	2	0	ELTD1	79131404	1.000000	0.71417	0.924000	0.36721	0.989000	0.77384	5.501000	0.66950	2.111000	0.64477	0.533000	0.62120	TTG	ELTD1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000162618		0.308	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELTD1	HGNC	protein_coding	OTTHUMT00000026859.1	81	0.00	0	A	NM_022159		79358816	79358816	-1	no_errors	ENST00000370742	ensembl	human	known	69_37n	missense	113	19.86	28	SNP	0.989	G
NUTM2A	728118	genome.wustl.edu	37	10	88988363	88988363	+	Silent	SNP	G	G	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr10:88988363G>T	ENST00000381707.2	+	2	1109	c.726G>T	c.(724-726)gtG>gtT	p.V242V	NUTM2A_ENST00000381689.4_Silent_p.V242V|NUTM2A-AS1_ENST00000451940.2_RNA	NM_001099338.1	NP_001092808.1	Q8IVF1	NTM2A_HUMAN	NUT family member 2A	242																	GAGGTGTTGTGTGTCCACCTC	0.677																																						dbGAP											0													1.0	2.0	1.0					10																	88988363		671	1850	2521	-	-	-	SO:0001819	synonymous_variant	0				CCDS44452.1	10q23.2	2013-03-15	2013-03-14	2013-03-14	ENSG00000184923	ENSG00000184923			23438	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member A"""	FAM22A			Standard	NM_001099338		Approved		uc001kek.3	Q8IVF1	OTTHUMG00000018670	ENST00000381707.2:c.726G>T	10.37:g.88988363G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMX5|C9JDI1|Q5VZW1	Missense_Mutation	SNP	NULL	p.V20L	ENST00000381707.2	37	c.58	CCDS44452.1	10	.	.	.	.	.	.	.	.	.	.	.	2.400	-0.337854	0.05278	.	.	ENSG00000184923	ENST00000451286	.	.	.	1.18	-1.53	0.08611	.	1.022450	0.07794	N	0.955377	T	0.09992	0.0245	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30001	-0.9993	6	0.06625	T	0.88	.	2.5871	0.04833	0.2355:0.3128:0.4517:0.0	.	.	.	.	L	20	.	ENSP00000390723:V20L	V	+	1	0	FAM22A	88978343	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-1.585000	0.02112	-0.374000	0.07967	0.374000	0.22700	GTG	FAM22A	-	NULL	ENSG00000184923		0.677	NUTM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM22A	HGNC	protein_coding	OTTHUMT00000049198.2	13	0.00	0	G	NM_001099338		88988363	88988363	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451286	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.000	T
FAM9B	171483	genome.wustl.edu	37	X	8998340	8998340	+	Silent	SNP	G	G	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chrX:8998340G>A	ENST00000327220.5	-	5	607	c.243C>T	c.(241-243)aaC>aaT	p.N81N	FAM9B_ENST00000362066.3_Intron|FAM9B_ENST00000428477.1_Silent_p.N81N			Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	81						nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11		Hepatocellular(5;0.219)				GTTTACTTTTGTTCTTTGTTT	0.284																																						dbGAP											0													226.0	178.0	194.0					X																	8998340		2196	4294	6490	-	-	-	SO:0001819	synonymous_variant	0				CCDS14132.1	Xp22.31	2014-02-17			ENSG00000177138	ENSG00000177138			18404	protein-coding gene	gene with protein product	"""testis expressed 39B"""	300478				12213195, 21085121, 21998597, 22936694	Standard	XM_005274456		Approved	TEX39B	uc011mhu.2	Q8IZU0	OTTHUMG00000021114	ENST00000327220.5:c.243C>T	X.37:g.8998340G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0IJ68|Q8N7Z8	Silent	SNP	pfam_Cor1/Xlr/Xmr	p.N81	ENST00000327220.5	37	c.243	CCDS14132.1	X																																																																																			FAM9B	-	pfam_Cor1/Xlr/Xmr	ENSG00000177138		0.284	FAM9B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9B	HGNC	protein_coding	OTTHUMT00000055702.2	402	0.00	0	G	NM_205849		8998340	8998340	-1	no_errors	ENST00000327220	ensembl	human	known	69_37n	silent	433	29.66	183	SNP	0.047	A
FAM9B	171483	genome.wustl.edu	37	X	9000382	9000382	+	Splice_Site	SNP	C	C	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chrX:9000382C>A	ENST00000327220.5	-	3	513	c.149G>T	c.(148-150)gGg>gTg	p.G50V	FAM9B_ENST00000362066.3_Splice_Site_p.G95V|FAM9B_ENST00000428477.1_Splice_Site_p.G50V			Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	50						nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11		Hepatocellular(5;0.219)				AACACTTTACCCCGTGTGTTC	0.413																																						dbGAP											0													241.0	200.0	214.0					X																	9000382		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS14132.1	Xp22.31	2014-02-17			ENSG00000177138	ENSG00000177138			18404	protein-coding gene	gene with protein product	"""testis expressed 39B"""	300478				12213195, 21085121, 21998597, 22936694	Standard	XM_005274456		Approved	TEX39B	uc011mhu.2	Q8IZU0	OTTHUMG00000021114	ENST00000327220.5:c.149+1G>T	X.37:g.9000382C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0IJ68|Q8N7Z8	Missense_Mutation	SNP	pfam_Cor1/Xlr/Xmr	p.G50V	ENST00000327220.5	37	c.149	CCDS14132.1	X	.	.	.	.	.	.	.	.	.	.	C	9.077	0.998257	0.19043	.	.	ENSG00000177138	ENST00000362066;ENST00000327220;ENST00000428477	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	T	0.46229	0.1382	L	0.32530	0.975	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.71184	0.972;0.972	T	0.31558	-0.9939	6	.	.	.	.	.	.	.	.	50;95	Q8IZU0;Q8N7Z8	FAM9B_HUMAN;.	V	95;50;50	.	.	G	-	2	0	FAM9B	8960382	0.030000	0.19436	0.022000	0.16811	0.022000	0.10575	1.141000	0.31528	0.280000	0.22209	0.284000	0.19432	GGG	FAM9B	-	NULL	ENSG00000177138		0.413	FAM9B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9B	HGNC	protein_coding	OTTHUMT00000055702.2	224	0.00	0	C	NM_205849	Missense_Mutation	9000382	9000382	-1	no_errors	ENST00000327220	ensembl	human	known	69_37n	missense	278	30.67	123	SNP	0.023	A
PAXBP1	94104	genome.wustl.edu	37	21	34127560	34127560	+	Silent	SNP	C	C	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr21:34127560C>T	ENST00000331923.4	-	8	1677	c.1488G>A	c.(1486-1488)tcG>tcA	p.S496S	PAXBP1_ENST00000472588.1_5'Flank|PAXBP1_ENST00000290178.4_Silent_p.S496S	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	496	Necessary and sufficient for interaction with PAX7. {ECO:0000250}.				muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTGAAAACTCCGAAGATTCAT	0.363																																						dbGAP											0													73.0	70.0	71.0					21																	34127560		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1488G>A	21.37:g.34127560C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSE7|Q96DU8|Q9NYQ0	Silent	SNP	pfam_GCFC_dom	p.S496	ENST00000331923.4	37	c.1488	CCDS13619.1	21																																																																																			GCFC1	-	NULL	ENSG00000159086		0.363	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC1	HGNC	protein_coding	OTTHUMT00000139563.1	56	0.00	0	C	NM_013329		34127560	34127560	-1	no_errors	ENST00000331923	ensembl	human	known	69_37n	silent	118	29.59	50	SNP	1.000	T
GRIN3A	116443	genome.wustl.edu	37	9	104432629	104432629	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr9:104432629C>A	ENST00000361820.3	-	3	2665	c.2065G>T	c.(2065-2067)Gcc>Tcc	p.A689S		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	689					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	AGGAAGACGGCAGTGATGTGC	0.493																																						dbGAP											0													95.0	102.0	100.0					9																	104432629		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2065G>T	9.37:g.104432629C>A	ENSP00000355155:p.Ala689Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.A689S	ENST00000361820.3	37	c.2065	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570209	0.86542	.	.	ENSG00000198785	ENST00000361820	T	0.49720	0.77	5.63	5.63	0.86233	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.73575	0.3604	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72766	-0.4194	10	0.40728	T	0.16	.	20.1163	0.97934	0.0:1.0:0.0:0.0	.	689	Q8TCU5	NMD3A_HUMAN	S	689	ENSP00000355155:A689S	ENSP00000355155:A689S	A	-	1	0	GRIN3A	103472450	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	7.773000	0.85462	2.829000	0.97493	0.580000	0.79431	GCC	GRIN3A	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000198785		0.493	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	43	0.00	0	C			104432629	104432629	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	missense	54	47.57	49	SNP	1.000	A
HIRA	7290	genome.wustl.edu	37	22	19348811	19348811	+	Silent	SNP	T	T	C			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr22:19348811T>C	ENST00000263208.5	-	17	2290	c.2034A>G	c.(2032-2034)gcA>gcG	p.A678A	HIRA_ENST00000541063.1_Silent_p.A634A|HIRA_ENST00000340170.4_Intron|HIRA_ENST00000546308.1_Silent_p.A634A	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	678	Interaction with CCNA1.|Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					TCAGTGCAAGTGCTGGTGCAG	0.567																																						dbGAP											0													138.0	126.0	130.0					22																	19348811		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.2034A>G	22.37:g.19348811T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BU9|Q8IXN2	Silent	SNP	pfam_Hira,pfam_WD40_repeat,pfam_HIRA_B_motif,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A678	ENST00000263208.5	37	c.2034	CCDS13759.1	22																																																																																			HIRA	-	NULL	ENSG00000100084		0.567	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRA	HGNC	protein_coding	OTTHUMT00000316488.2	108	0.00	0	T	NM_003325		19348811	19348811	-1	no_errors	ENST00000263208	ensembl	human	known	69_37n	silent	288	20.44	74	SNP	1.000	C
KIAA1045	23349	genome.wustl.edu	37	9	34976648	34976648	+	Missense_Mutation	SNP	G	G	T	rs201976530		TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr9:34976648G>T	ENST00000242315.3	+	5	842	c.760G>T	c.(760-762)Gcc>Tcc	p.A254S	KIAA1045_ENST00000476115.2_3'UTR|KIAA1045_ENST00000544237.1_Missense_Mutation_p.A254S	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	254							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCAGTTTGCTGCCCTGGACCC	0.632																																						dbGAP											0													56.0	61.0	60.0					9																	34976648		2000	4164	6164	-	-	-	SO:0001583	missense	0			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.760G>T	9.37:g.34976648G>T	ENSP00000242315:p.Ala254Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.A254S	ENST00000242315.3	37	c.760	CCDS43796.1	9	.	.	.	.	.	.	.	.	.	.	G	17.68	3.450443	0.63290	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	T;T	0.22539	1.95;1.95	4.92	4.92	0.64577	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.13927	0.0337	N	0.20986	0.625	0.58432	D	0.999999	P	0.41450	0.75	B	0.38327	0.271	T	0.07986	-1.0744	10	0.10902	T	0.67	-6.2722	15.2674	0.73672	0.0:0.0:1.0:0.0	.	254	Q9UPV7	K1045_HUMAN	S	254	ENSP00000444138:A254S;ENSP00000242315:A254S	ENSP00000242315:A254S	A	+	1	0	KIAA1045	34966648	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.750000	0.68712	2.282000	0.76494	0.561000	0.74099	GCC	KIAA1045	-	NULL	ENSG00000122733		0.632	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1045	HGNC	protein_coding	OTTHUMT00000052256.2	33	0.00	0	G	XM_048592		34976648	34976648	+1	no_errors	ENST00000242315	ensembl	human	known	69_37n	missense	74	24.49	24	SNP	1.000	T
KLHL22	84861	genome.wustl.edu	37	22	20843516	20843516	+	5'UTR	SNP	C	C	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr22:20843516C>T	ENST00000328879.4	-	0	139				KLHL22_ENST00000440659.2_5'UTR|KLHL22_ENST00000470335.1_5'UTR	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22						cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCACAAGATCCCTTACAACT	0.597																																						dbGAP											0													73.0	59.0	64.0					22																	20843516		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.-18G>A	22.37:g.20843516C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.D27N	ENST00000328879.4	37	c.79	CCDS13780.1	22	.	.	.	.	.	.	.	.	.	.	c	11.64	1.698609	0.30142	.	.	ENSG00000099910	ENST00000444967;ENST00000443285;ENST00000423364	T;T	0.73152	-0.58;-0.72	3.31	1.18	0.20946	.	.	.	.	.	T	0.40247	0.1109	.	.	.	0.19300	N	0.99997	.	.	.	.	.	.	T	0.26087	-1.0113	6	0.06891	T	0.86	.	4.1967	0.10447	0.3785:0.4441:0.1775:0.0	.	.	.	.	N	27;29;27	ENSP00000403999:D27N;ENSP00000397882:D29N	ENSP00000402746:D27N	D	-	1	0	KLHL22	19173516	0.000000	0.05858	0.003000	0.11579	0.015000	0.08874	-0.390000	0.07332	0.315000	0.23110	0.550000	0.68814	GAT	KLHL22	-	NULL	ENSG00000099910		0.597	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL22	HGNC	protein_coding	OTTHUMT00000320045.2	36	0.00	0	C	NM_032775		20843516	20843516	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000444967	ensembl	human	putative	69_37n	missense	111	17.78	24	SNP	0.004	T
LHFPL4	375323	genome.wustl.edu	37	3	9547779	9547779	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr3:9547779G>T	ENST00000287585.6	-	3	800	c.515C>A	c.(514-516)tCa>tAa	p.S172*		NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4	185						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					CCAGCGCACTGAACAGTCCCC	0.612																																						dbGAP											0													172.0	135.0	147.0					3																	9547779		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.515C>A	3.37:g.9547779G>T	ENSP00000287585:p.Ser172*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L383|A4D0Q5	Nonsense_Mutation	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.S172*	ENST00000287585.6	37	c.515	CCDS33691.1	3	.	.	.	.	.	.	.	.	.	.	G	38	7.031014	0.98013	.	.	ENSG00000156959	ENST00000287585	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	U	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.3967	18.6874	0.91570	0.0:0.0:1.0:0.0	.	.	.	.	X	172	.	ENSP00000287585:S172X	S	-	2	0	LHFPL4	9522779	1.000000	0.71417	0.997000	0.53966	0.809000	0.45718	9.869000	0.99810	2.532000	0.85374	0.591000	0.81541	TCA	LHFPL4	-	pfam_Lipome_HGMIC_fus_partner-like	ENSG00000156959		0.612	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL4	HGNC	protein_coding	OTTHUMT00000338298.1	41	0.00	0	G	NM_198560		9547779	9547779	-1	no_errors	ENST00000287585	ensembl	human	known	69_37n	nonsense	61	22.50	18	SNP	1.000	T
MLANA	2315	genome.wustl.edu	37	9	5892543	5892543	+	Silent	SNP	G	G	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr9:5892543G>A	ENST00000381477.3	+	2	229	c.69G>A	c.(67-69)acG>acA	p.T23T	MLANA_ENST00000381471.1_Silent_p.T23T|snoU13_ENST00000459519.1_RNA|MLANA_ENST00000381476.1_Silent_p.T23T	NM_005511.1	NP_005502.1	Q16655	MAR1_HUMAN	melan-A	23						endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|melanosome (GO:0042470)|trans-Golgi network (GO:0005802)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	8		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(1;1.15e-06)|Lung(218;0.103)		CTTACACCACGGCTGAAGAGT	0.527																																						dbGAP											0													81.0	66.0	71.0					9																	5892543		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6466.1	9p24.1	2008-02-05			ENSG00000120215	ENSG00000120215			7124	protein-coding gene	gene with protein product		605513					Standard	NM_005511		Approved	MART1	uc003zjo.1	Q16655	OTTHUMG00000019510	ENST00000381477.3:c.69G>A	9.37:g.5892543G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICU4	Silent	SNP	NULL	p.T23	ENST00000381477.3	37	c.69	CCDS6466.1	9																																																																																			MLANA	-	NULL	ENSG00000120215		0.527	MLANA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLANA	HGNC	protein_coding	OTTHUMT00000051643.1	35	0.00	0	G			5892543	5892543	+1	no_errors	ENST00000381471	ensembl	human	known	69_37n	silent	80	29.20	33	SNP	0.038	A
MUC16	94025	genome.wustl.edu	37	19	9091513	9091513	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr19:9091513G>T	ENST00000397910.4	-	1	505	c.302C>A	c.(301-303)aCc>aAc	p.T101N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	101	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CGATGGGCTGGTTCTTTGCTC	0.537																																						dbGAP											0													138.0	135.0	136.0					19																	9091513		1980	4167	6147	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.302C>A	19.37:g.9091513G>T	ENSP00000381008:p.Thr101Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T101N	ENST00000397910.4	37	c.302	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.803	-0.476551	0.04414	.	.	ENSG00000181143	ENST00000397910	T	0.02525	4.26	1.01	-2.03	0.07365	.	.	.	.	.	T	0.01189	0.0039	N	0.08118	0	.	.	.	P	0.44344	0.833	B	0.32022	0.139	T	0.45920	-0.9228	8	0.87932	D	0	.	2.9792	0.05948	0.0:0.2991:0.3996:0.3012	.	101	B5ME49	.	N	101	ENSP00000381008:T101N	ENSP00000381008:T101N	T	-	2	0	MUC16	8952513	0.000000	0.05858	0.000000	0.03702	0.144000	0.21451	-1.249000	0.02888	-0.621000	0.05633	0.313000	0.20887	ACC	MUC16	-	NULL	ENSG00000181143		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	75	0.00	0	G	NM_024690		9091513	9091513	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	522	21.47	143	SNP	0.000	T
NETO1	81832	genome.wustl.edu	37	18	70417577	70417577	+	Silent	SNP	G	G	T	rs574511728		TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr18:70417577G>T	ENST00000327305.6	-	9	1918	c.1261C>A	c.(1261-1263)Cgg>Agg	p.R421R	RNA5SP460_ENST00000516789.1_RNA|NETO1_ENST00000583169.1_Silent_p.R421R|NETO1_ENST00000299430.2_Silent_p.R420R	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	421					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.R421R(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GATGACCTCCGCAGTTTATGG	0.458																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											96.0	87.0	90.0					18																	70417577		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1261C>A	18.37:g.70417577G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W85|Q8ND78|Q8TDF4	Silent	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.R421	ENST00000327305.6	37	c.1261	CCDS12000.1	18																																																																																			NETO1	-	NULL	ENSG00000166342		0.458	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	112	0.00	0	G	NM_138999		70417577	70417577	-1	no_errors	ENST00000327305	ensembl	human	known	69_37n	silent	192	33.10	95	SNP	1.000	T
NRXN2	9379	genome.wustl.edu	37	11	64374729	64374729	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr11:64374729G>A	ENST00000377551.1	-	22	5289	c.5078C>T	c.(5077-5079)cCg>cTg	p.P1693L	NRXN2_ENST00000409571.1_Missense_Mutation_p.P1686L|NRXN2_ENST00000301894.2_Missense_Mutation_p.P647L|NRXN2_ENST00000377559.3_Missense_Mutation_p.P1623L|NRXN2_ENST00000265459.6_Missense_Mutation_p.P1693L			Q9P2S2	NRX2A_HUMAN	neurexin 2	1693					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GGGGGCAGCCGGGGCCTTCTC	0.607																																						dbGAP											0													41.0	46.0	44.0					11																	64374729		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.5078C>T	11.37:g.64374729G>A	ENSP00000366774:p.Pro1693Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.P1693L	ENST00000377551.1	37	c.5078	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290154	0.23478	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T;T	0.61742	0.56;0.08;0.11;0.08;0.18	4.46	2.5	0.30297	.	0.130592	0.27134	U	0.020766	T	0.46014	0.1371	L	0.59436	1.845	0.42411	D	0.992605	P;P;P;D	0.57571	0.923;0.898;0.776;0.98	B;B;B;B	0.40375	0.294;0.174;0.154;0.327	T	0.38373	-0.9664	10	0.30854	T	0.27	.	6.2367	0.20766	0.102:0.0:0.7108:0.1872	.	1623;1693;1439;647	Q9P2S2-2;Q9P2S2;E7EV67;P58401	.;NRX2A_HUMAN;.;NRX2B_HUMAN	L	647;1693;1623;1693;1623;1686	ENSP00000301894:P647L;ENSP00000366774:P1693L;ENSP00000366782:P1623L;ENSP00000265459:P1693L;ENSP00000386416:P1686L	ENSP00000265459:P1693L	P	-	2	0	NRXN2	64131305	0.998000	0.40836	0.946000	0.38457	0.612000	0.37316	2.697000	0.47060	0.824000	0.34613	0.313000	0.20887	CCG	NRXN2	-	NULL	ENSG00000110076		0.607	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	51	0.00	0	G	NM_015080		64374729	64374729	-1	no_errors	ENST00000265459	ensembl	human	known	69_37n	missense	41	52.87	46	SNP	0.958	A
TENM1	10178	genome.wustl.edu	37	X	123615786	123615786	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chrX:123615786C>A	ENST00000371130.3	-	21	3787	c.3724G>T	c.(3724-3726)Gct>Tct	p.A1242S	TENM1_ENST00000422452.2_Missense_Mutation_p.A1249S|TENM1_ENST00000461429.1_5'UTR	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1242					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGGTCCATAGCCAGATAGTAT	0.418																																						dbGAP											0													109.0	96.0	100.0					X																	123615786		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3724G>T	X.37:g.123615786C>A	ENSP00000360171:p.Ala1242Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.A1249S	ENST00000371130.3	37	c.3745	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029969	0.75504	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.92446	-3.04;-3.04	5.16	5.16	0.70880	Six-bladed beta-propeller, TolB-like (1);	0.064020	0.64402	D	0.000008	D	0.89649	0.6776	L	0.48260	1.515	0.54753	D	0.999988	B;P;P	0.40909	0.429;0.635;0.732	B;B;B	0.37833	0.052;0.14;0.259	D	0.90405	0.4405	10	0.54805	T	0.06	.	17.774	0.88502	0.0:1.0:0.0:0.0	.	1248;1249;1242	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	S	1242;1249	ENSP00000360171:A1242S;ENSP00000403954:A1249S	ENSP00000360171:A1242S	A	-	1	0	ODZ1	123443467	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.833000	0.62766	2.128000	0.65567	0.600000	0.82982	GCT	ODZ1	-	NULL	ENSG00000009694		0.418	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	81	0.00	0	C	NM_014253		123615786	123615786	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	107	33.95	55	SNP	1.000	A
OR8H2	390151	genome.wustl.edu	37	11	55873220	55873220	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr11:55873220G>T	ENST00000313503.1	+	1	702	c.702G>T	c.(700-702)aaG>aaT	p.K234N		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTTCAGGAAAGCAGAAAGCTT	0.373										HNSCC(53;0.14)																												dbGAP											0													113.0	110.0	111.0					11																	55873220		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.702G>T	11.37:g.55873220G>T	ENSP00000323982:p.Lys234Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFC1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K234N	ENST00000313503.1	37	c.702	CCDS31518.1	11	.	.	.	.	.	.	.	.	.	.	g	12.26	1.885103	0.33255	.	.	ENSG00000181767	ENST00000313503	T	0.00169	8.63	3.58	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	0.111644	0.40728	N	0.001028	T	0.00356	0.0011	M	0.87038	2.855	0.09310	N	1	P	0.44195	0.828	P	0.50934	0.654	T	0.21793	-1.0235	10	0.87932	D	0	.	5.4631	0.16627	0.1892:0.2773:0.5335:0.0	.	234	Q8N162	OR8H2_HUMAN	N	234	ENSP00000323982:K234N	ENSP00000323982:K234N	K	+	3	2	OR8H2	55629796	0.019000	0.18553	0.850000	0.33497	0.662000	0.39071	1.254000	0.32897	1.952000	0.56665	0.440000	0.28878	AAG	OR8H2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181767		0.373	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H2	HGNC	protein_coding	OTTHUMT00000391540.1	167	0.00	0	G	NM_001005200		55873220	55873220	+1	no_errors	ENST00000313503	ensembl	human	known	69_37n	missense	340	21.48	93	SNP	0.031	T
PARPBP	55010	genome.wustl.edu	37	12	102572481	102572481	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr12:102572481G>C	ENST00000358383.5	+	8	1162	c.1117G>C	c.(1117-1119)Gca>Cca	p.A373P	PARPBP_ENST00000378128.3_Intron|PARPBP_ENST00000541394.1_Missense_Mutation_p.A450P|PARPBP_ENST00000392911.2_Missense_Mutation_p.A292P|PARPBP_ENST00000327680.2_Missense_Mutation_p.A292P|PARPBP_ENST00000535811.1_Intron|PARPBP_ENST00000543784.1_Intron			Q9NWS1	PARI_HUMAN	PARP1 binding protein	373					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						CAAAAACAAAGCAGAGCTTTT	0.363																																						dbGAP											0													98.0	95.0	96.0					12																	102572481		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.1117G>C	12.37:g.102572481G>C	ENSP00000351153:p.Ala373Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Missense_Mutation	SNP	NULL	p.A373P	ENST00000358383.5	37	c.1117	CCDS9090.2	12	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033651	0.93575	.	.	ENSG00000185480	ENST00000327680;ENST00000541394;ENST00000358383;ENST00000392911	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.67078	0.2855	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69591	-0.5104	10	0.72032	D	0.01	-14.9099	19.1154	0.93336	0.0:0.0:1.0:0.0	.	450;373	B4DZ31;Q9NWS1	.;PR1BP_HUMAN	P	292;450;373;292	ENSP00000332915:A292P;ENSP00000440850:A450P;ENSP00000351153:A373P;ENSP00000376643:A292P	ENSP00000332915:A292P	A	+	1	0	C12orf48	101096611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.530000	0.81962	2.604000	0.88044	0.650000	0.86243	GCA	PARPBP	-	NULL	ENSG00000185480		0.363	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	147	0.00	0	G	NM_017915		102572481	102572481	+1	no_errors	ENST00000358383	ensembl	human	known	69_37n	missense	190	35.15	103	SNP	1.000	C
PGAP1	80055	genome.wustl.edu	37	2	197709278	197709278	+	Silent	SNP	G	G	A			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr2:197709278G>A	ENST00000354764.4	-	24	2421	c.2307C>T	c.(2305-2307)agC>agT	p.S769S		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	769					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						AAGTTGTTAAGCTGGCTTGCA	0.264																																						dbGAP											0													22.0	24.0	23.0					2																	197709278		2193	4270	6463	-	-	-	SO:0001819	synonymous_variant	0				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2307C>T	2.37:g.197709278G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Silent	SNP	pfam_PGAP1-like	p.S769	ENST00000354764.4	37	c.2307	CCDS2318.1	2																																																																																			PGAP1	-	NULL	ENSG00000197121		0.264	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	HGNC	protein_coding	OTTHUMT00000256103.5	14	0.00	0	G	NM_024989		197709278	197709278	-1	no_errors	ENST00000354764	ensembl	human	known	69_37n	silent	41	33.87	21	SNP	0.996	A
PHRF1	57661	genome.wustl.edu	37	11	607853	607853	+	Silent	SNP	G	G	C			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr11:607853G>C	ENST00000264555.5	+	14	2525	c.2397G>C	c.(2395-2397)acG>acC	p.T799T	PHRF1_ENST00000533464.1_Silent_p.T795T|PHRF1_ENST00000416188.2_Silent_p.T798T|PHRF1_ENST00000413872.2_Silent_p.T797T	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	799					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						TCTGTAACACGTTCCGGCCTG	0.567																																						dbGAP											0													60.0	67.0	65.0					11																	607853		2030	4176	6206	-	-	-	SO:0001819	synonymous_variant	0			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.2397G>C	11.37:g.607853G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	pfam_Znf_PHD-finger,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.T799	ENST00000264555.5	37	c.2397		11																																																																																			PHRF1	-	NULL	ENSG00000070047		0.567	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	HGNC	protein_coding	OTTHUMT00000382133.1	16	0.00	0	G	NM_020901		607853	607853	+1	no_errors	ENST00000264555	ensembl	human	known	69_37n	silent	47	21.67	13	SNP	0.061	C
POU4F3	5459	genome.wustl.edu	37	5	145718682	145718682	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr5:145718682G>C	ENST00000230732.4	+	1	96	c.7G>C	c.(7-9)Gcc>Ccc	p.A3P	CTC-359M8.1_ENST00000515598.1_RNA|RBM27_ENST00000506502.1_Missense_Mutation_p.G988A	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	3					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAGATGATGGCCATGAACTC	0.612																																						dbGAP											0													85.0	71.0	76.0					5																	145718682		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.7G>C	5.37:g.145718682G>C	ENSP00000230732:p.Ala3Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O60557|Q2M3F8	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,prints_POU,pfscan_Homeodomain,pfscan_POU_specific	p.A3P	ENST00000230732.4	37	c.7	CCDS4281.1	5	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654662	0.47467	.	.	ENSG00000091010	ENST00000230732	T	0.23147	1.92	4.69	1.62	0.23740	.	0.071911	0.56097	D	0.000034	T	0.13756	0.0333	N	0.22421	0.69	0.37623	D	0.921384	B	0.34214	0.442	B	0.29353	0.101	T	0.11665	-1.0578	10	0.72032	D	0.01	.	6.8661	0.24094	0.181:0.0:0.6709:0.1481	.	3	Q15319	PO4F3_HUMAN	P	3	ENSP00000230732:A3P	ENSP00000230732:A3P	A	+	1	0	POU4F3	145698875	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.866000	0.27954	0.563000	0.29222	0.462000	0.41574	GCC	POU4F3	-	NULL	ENSG00000091010		0.612	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F3	HGNC	protein_coding	OTTHUMT00000251887.2	26	0.00	0	G	NM_002700		145718682	145718682	+1	no_errors	ENST00000230732	ensembl	human	known	69_37n	missense	48	37.66	29	SNP	0.999	C
TRIM37	4591	genome.wustl.edu	37	17	57057757	57057757	+	IGR	SNP	C	C	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr17:57057757C>T	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.R545C	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					CTATGATGGGCGTGTGGATTC	0.527									Mulibrey Nanism																													dbGAP											0													88.0	83.0	85.0					17																	57057757		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57057757C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.R545C	ENST00000393066.3	37	c.1633	CCDS45746.1	17	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749940	0.69533	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.26067	1.76	5.84	5.84	0.93424	.	0.218325	0.47852	D	0.000203	T	0.41373	0.1156	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.17806	-1.0357	10	0.87932	D	0	-0.026	15.365	0.74513	0.1401:0.8599:0.0:0.0	.	554;545	Q8WY54-3;Q8WY54-2	.;.	C	545;396	ENSP00000312411:R545C	ENSP00000312411:R545C	R	+	1	0	PPM1E	54412539	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.471000	0.66762	2.768000	0.95171	0.491000	0.48974	CGT	PPM1E	-	NULL	ENSG00000175175		0.527	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	HGNC	protein_coding	OTTHUMT00000445928.1	51	0.00	0	C	NM_015294		57057757	57057757	+1	no_errors	ENST00000308249	ensembl	human	known	69_37n	missense	203	13.14	31	SNP	1.000	T
PRRC2C	23215	genome.wustl.edu	37	1	171527109	171527109	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr1:171527109C>G	ENST00000338920.4	+	19	6089	c.5852C>G	c.(5851-5853)tCa>tGa	p.S1951*	PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.S1953*|PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.S1951*|PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.S1953*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1951					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TCTCAGTCTTCAAAACAACCA	0.517																																						dbGAP											0													153.0	129.0	137.0					1																	171527109		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.5852C>G	1.37:g.171527109C>G	ENSP00000343629:p.Ser1951*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	pfam_BAT2_N	p.S1953*	ENST00000338920.4	37	c.5858	CCDS1296.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	47|47	13.405403|13.405403	0.99740|0.99740	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000495585|ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	.|.	.|.	.|.	4.89|4.89	3.98|3.98	0.46160|0.46160	.|.	.|0.847661	.|0.09594	.|N	.|0.781089	T|.	0.46014|.	0.1371|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.46693|.	-0.9173|.	3|.	.|0.72032	.|D	.|0.01	.|.	10.3651|10.3651	0.44019|0.44019	0.0:0.9071:0.0:0.0929|0.0:0.9071:0.0:0.0929	.|.	.|.	.|.	.|.	E|X	499|1953;1905;1951;1953;1951;1708	.|.	.|ENSP00000343629:S1951X	Q|S	+|+	1|2	0|0	PRRC2C|PRRC2C	169793733|169793733	0.884000|0.884000	0.30299|0.30299	0.995000|0.995000	0.50966|0.50966	0.859000|0.859000	0.49053|0.49053	2.073000|2.073000	0.41519|0.41519	1.187000|1.187000	0.43000|0.43000	0.449000|0.449000	0.29647|0.29647	CAA|TCA	PRRC2C	-	NULL	ENSG00000117523		0.517	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	125	0.00	0	C	NM_015172		171527109	171527109	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	nonsense	265	23.41	81	SNP	0.989	G
SIM1	6492	genome.wustl.edu	37	6	100841453	100841453	+	Missense_Mutation	SNP	C	C	T	rs372633250		TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr6:100841453C>T	ENST00000369208.3	-	11	2262	c.1480G>A	c.(1480-1482)Gca>Aca	p.A494T	SIM1_ENST00000262901.4_Missense_Mutation_p.A494T			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	494	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GGCAAGGCTGCGCGAGAGCCC	0.607																																						dbGAP											0													72.0	75.0	74.0					6																	100841453		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1480G>A	6.37:g.100841453C>T	ENSP00000358210:p.Ala494Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDP7	Missense_Mutation	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd	p.A494T	ENST00000369208.3	37	c.1480	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180757	0.38511	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.33438	1.41;1.41	5.78	3.85	0.44370	Single-minded, C-terminal (2);	0.049896	0.85682	D	0.000000	T	0.07143	0.0181	N	0.14661	0.345	0.41039	D	0.985213	B	0.29270	0.24	B	0.25291	0.059	T	0.08411	-1.0723	10	0.46703	T	0.11	.	6.9041	0.24299	0.3684:0.541:0.0:0.0907	.	494	P81133	SIM1_HUMAN	T	494	ENSP00000358210:A494T;ENSP00000262901:A494T	ENSP00000262901:A494T	A	-	1	0	SIM1	100948174	1.000000	0.71417	0.882000	0.34594	0.214000	0.24535	4.346000	0.59367	1.455000	0.47813	-0.136000	0.14681	GCA	SIM1	-	pfam_SIM_C	ENSG00000112246		0.607	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	23	0.00	0	C	NM_005068		100841453	100841453	-1	no_errors	ENST00000262901	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	0.950	T
SIRPB1	10326	genome.wustl.edu	37	20	1559200	1559200	+	Missense_Mutation	SNP	C	C	A	rs577976401	byFrequency	TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr20:1559200C>A	ENST00000381605.4	-	2	281	c.217G>T	c.(217-219)Gca>Tca	p.A73S	RP4-576H24.4_ENST00000564763.1_Missense_Mutation_p.A73S|SIRPB1_ENST00000262929.5_Missense_Mutation_p.A72S|SIRPB1_ENST00000381603.3_Missense_Mutation_p.A73S	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	73	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						TCCCGGCCTGCTCCAGCTCCT	0.512																																						dbGAP											0													144.0	130.0	135.0					20																	1559200		2195	4238	6433	-	-	-	SO:0001583	missense	0			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.217G>T	20.37:g.1559200C>A	ENSP00000371018:p.Ala73Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_C1-set,pfscan_Ig-like	p.A73S	ENST00000381605.4	37	c.217	CCDS13019.1	20	.	.	.	.	.	.	.	.	.	.	.	0.026	-1.373700	0.01214	.	.	ENSG00000101307	ENST00000381605;ENST00000381603;ENST00000262929	T;T;T	0.02121	4.44;4.44;4.44	2.36	1.36	0.22044	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.622200	0.15220	N	0.274016	T	0.01189	0.0039	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47736	-0.9094	10	0.41790	T	0.15	.	4.7046	0.12844	0.0:0.2458:0.5019:0.2522	.	73;73	O00241;O00241-2	SIRB1_HUMAN;.	S	73;73;72	ENSP00000371018:A73S;ENSP00000371016:A73S;ENSP00000262929:A72S	ENSP00000262929:A72S	A	-	1	0	SIRPB1	1507200	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.385000	0.20685	-0.046000	0.13446	-0.357000	0.07601	GCA	SIRPB1	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	ENSG00000101307		0.512	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRPB1	HGNC	protein_coding	OTTHUMT00000077555.2	224	0.00	0	C	NM_006065		1559200	1559200	-1	no_errors	ENST00000381605	ensembl	human	known	69_37n	missense	197	43.27	151	SNP	0.003	A
ACAT2	39	genome.wustl.edu	37	6	160183182	160183182	+	Intron	SNP	G	G	C			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr6:160183182G>C	ENST00000367048.4	+	1	1815				SOD2_ENST00000535372.1_5'UTR|SOD2_ENST00000546087.1_5'UTR|ACAT2_ENST00000541436.1_5'Flank	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2						lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TAGGTGAGTGGCCGGCGGGAG	0.677																																						dbGAP											0													31.0	33.0	32.0					6																	160183182		2199	4298	6497	-	-	-	SO:0001627	intron_variant	0			AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.55+8G>C	6.37:g.160183182G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	RNA	SNP	-	NULL	ENST00000367048.4	37	NULL	CCDS5268.1	6																																																																																			SOD2	-	-	ENSG00000112096		0.677	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOD2	HGNC	protein_coding	OTTHUMT00000042912.1	13	0.00	0	G	NM_005891		160183182	160183182	-1	no_errors	ENST00000535372	ensembl	human	known	69_37n	rna	34	22.73	10	SNP	0.000	C
USP9X	8239	genome.wustl.edu	37	X	41075185	41075185	+	Silent	SNP	T	T	C			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chrX:41075185T>C	ENST00000324545.8	+	35	5998	c.5365T>C	c.(5365-5367)Tta>Cta	p.L1789L	USP9X_ENST00000378308.2_Silent_p.L1789L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1789	USP.				axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GATTAAAAAATTACCTCCTGT	0.338																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													62.0	59.0	60.0					X																	41075185		2010	4207	6217	-	-	-	SO:0001819	synonymous_variant	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5365T>C	X.37:g.41075185T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Silent	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.L1789	ENST00000324545.8	37	c.5365	CCDS43930.1	X																																																																																			USP9X	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000124486		0.338	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	63	0.00	0	T	NM_004652		41075185	41075185	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	silent	87	36.03	49	SNP	1.000	C
YEATS2	55689	genome.wustl.edu	37	3	183442226	183442226	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr3:183442226G>C	ENST00000305135.5	+	6	752	c.557G>C	c.(556-558)gGc>gCc	p.G186A		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	186					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AGAATTACTGGCTCCCATAAA	0.348																																						dbGAP											0													88.0	83.0	85.0					3																	183442226		1831	4090	5921	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.557G>C	3.37:g.183442226G>C	ENSP00000306983:p.Gly186Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.G186A	ENST00000305135.5	37	c.557	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	G	9.844	1.191707	0.21954	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.21191	2.02	5.01	5.01	0.66863	.	0.471058	0.22061	N	0.065170	T	0.15739	0.0379	L	0.36672	1.1	0.27974	N	0.936271	B	0.24317	0.101	B	0.18263	0.021	T	0.21109	-1.0255	10	0.02654	T	1	-9.2084	16.5052	0.84270	0.0:0.0:1.0:0.0	.	186	Q9ULM3	YETS2_HUMAN	A	186	ENSP00000306983:G186A	ENSP00000306983:G186A	G	+	2	0	YEATS2	184924920	0.928000	0.31464	0.991000	0.47740	0.358000	0.29455	3.570000	0.53834	2.329000	0.79093	0.467000	0.42956	GGC	YEATS2	-	NULL	ENSG00000163872		0.348	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	108	0.00	0	G	NM_018023		183442226	183442226	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	177	26.86	65	SNP	0.807	C
ZFYVE9	9372	genome.wustl.edu	37	1	52811772	52811772	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T3-01A-21D-A10Y-09	TCGA-A2-A0T3-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0ca029bb-3b3a-48ec-8ade-5591e8e8629f	2c1a2795-e195-4f8d-a062-373aab5c50fc	g.chr1:52811772C>T	ENST00000371591.1	+	18	4288	c.4157C>T	c.(4156-4158)tCg>tTg	p.S1386L	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.S1386L|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.S1327L	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1386					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						CCCCTTCCCTCGCAGTACATG	0.552																																						dbGAP											0													103.0	97.0	99.0					1																	52811772		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.4157C>T	1.37:g.52811772C>T	ENSP00000360647:p.Ser1386Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	pfam_DUF3480,pfam_SARA_Smad-bd,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.S1386L	ENST00000371591.1	37	c.4157	CCDS563.1	1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553324	0.65425	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.39056	1.13;1.1;1.1	4.78	3.87	0.44632	Domain of unknown function DUF3480 (1);	0.407020	0.27531	N	0.018941	T	0.27697	0.0681	N	0.14661	0.345	0.80722	D	1	P;P	0.51147	0.625;0.942	B;B	0.43386	0.128;0.418	T	0.08086	-1.0739	10	0.59425	D	0.04	.	10.243	0.43324	0.0:0.7888:0.1358:0.0754	.	1327;1386	O95405-2;O95405	.;ZFYV9_HUMAN	L	1327;1386;1386	ENSP00000349737:S1327L;ENSP00000287727:S1386L;ENSP00000360647:S1386L	ENSP00000287727:S1386L	S	+	2	0	ZFYVE9	52584360	0.694000	0.27738	0.995000	0.50966	0.914000	0.54420	3.182000	0.50910	1.236000	0.43740	0.655000	0.94253	TCG	ZFYVE9	-	pfam_DUF3480,pirsf_Znf_FYVE_SARA/endofin	ENSG00000157077		0.552	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE9	HGNC	protein_coding	OTTHUMT00000022083.1	73	0.00	0	C	NM_007324		52811772	52811772	+1	no_errors	ENST00000287727	ensembl	human	known	69_37n	missense	46	69.33	104	SNP	0.998	T
