#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS2	9509	genome.wustl.edu	37	5	178548677	178548677	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr5:178548677G>A	ENST00000251582.7	-	21	3264	c.3163C>T	c.(3163-3165)Cgg>Tgg	p.R1055W		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1055					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GAGATCTTCCGGATGGGCGAG	0.617																																						dbGAP											0													190.0	202.0	198.0					5																	178548677		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3163C>T	5.37:g.178548677G>A	ENSP00000251582:p.Arg1055Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.R1055W	ENST00000251582.7	37	c.3163	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775543	0.31411	.	.	ENSG00000087116	ENST00000251582	T	0.60171	0.21	5.74	3.93	0.45458	.	0.612045	0.14715	N	0.302680	T	0.38453	0.1041	N	0.08118	0	0.24552	N	0.994017	P	0.41978	0.767	B	0.36766	0.232	T	0.21211	-1.0252	10	0.66056	D	0.02	.	15.1671	0.72837	0.0:0.2986:0.7014:0.0	.	1055	O95450	ATS2_HUMAN	W	1055	ENSP00000251582:R1055W	ENSP00000251582:R1055W	R	-	1	2	ADAMTS2	178481283	1.000000	0.71417	0.005000	0.12908	0.711000	0.40976	3.160000	0.50739	0.738000	0.32606	0.555000	0.69702	CGG	ADAMTS2	-	NULL	ENSG00000087116		0.617	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	132	0.00	0	G	NM_014244		178548677	178548677	-1	no_errors	ENST00000251582	ensembl	human	known	69_37n	missense	97	11.82	13	SNP	0.028	A
AKIRIN1	79647	genome.wustl.edu	37	1	39463917	39463917	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr1:39463917C>T	ENST00000432648.3	+	2	453	c.295C>T	c.(295-297)Cag>Tag	p.Q99*	AKIRIN1_ENST00000446189.2_Nonsense_Mutation_p.Q99*|AKIRIN1_ENST00000372984.4_Intron	NM_024595.2	NP_078871.1	Q9H9L7	AKIR1_HUMAN	akirin 1	99						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				lung(1)|prostate(1)|skin(1)	3						TGTTCTTAATCAGAGTGAAGC	0.388																																						dbGAP											0													91.0	89.0	90.0					1																	39463917		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022728	CCDS433.1, CCDS44113.1	1p34.3	2013-10-11	2008-06-23	2008-06-23	ENSG00000174574	ENSG00000174574			25744	protein-coding gene	gene with protein product		615164	"""chromosome 1 open reading frame 108"""	C1orf108		19200367	Standard	NM_024595		Approved	FLJ12666	uc001ccw.3	Q9H9L7	OTTHUMG00000007496	ENST00000432648.3:c.295C>T	1.37:g.39463917C>T	ENSP00000392678:p.Gln99*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZU6|Q0VDB3|Q53FK8	Nonsense_Mutation	SNP	NULL	p.Q99*	ENST00000432648.3	37	c.295	CCDS433.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.558427	0.96514	.	.	ENSG00000174574	ENST00000432648;ENST00000446189	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-11.0614	16.4569	0.84021	0.0:1.0:0.0:0.0	.	.	.	.	X	99	.	ENSP00000392678:Q99X	Q	+	1	0	AKIRIN1	39236504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.785000	0.75089	2.534000	0.85438	0.563000	0.77884	CAG	AKIRIN1	-	NULL	ENSG00000174574		0.388	AKIRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKIRIN1	HGNC	protein_coding	OTTHUMT00000019687.2	152	0.00	0	C	NM_024595		39463917	39463917	+1	no_errors	ENST00000432648	ensembl	human	known	69_37n	nonsense	181	30.92	81	SNP	1.000	T
ANKRD27	84079	genome.wustl.edu	37	19	33098731	33098731	+	Missense_Mutation	SNP	G	G	C	rs201798259		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr19:33098731G>C	ENST00000306065.4	-	23	2341	c.2183C>G	c.(2182-2184)gCg>gGg	p.A728G	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	728					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					AGGAACCTTCGCCAGCCTCTG	0.627																																						dbGAP											0													14.0	15.0	14.0					19																	33098731		2201	4288	6489	-	-	-	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2183C>G	19.37:g.33098731G>C	ENSP00000304292:p.Ala728Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.A728G	ENST00000306065.4	37	c.2183	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	G	7.285	0.609828	0.14066	.	.	ENSG00000105186	ENST00000306065	T	0.72051	-0.62	5.16	4.06	0.47325	Ankyrin repeat-containing domain (2);	0.556851	0.17161	N	0.184664	T	0.54967	0.1891	L	0.28054	0.825	0.20074	N	0.999936	P	0.40794	0.729	B	0.42214	0.38	T	0.42832	-0.9428	10	0.25751	T	0.34	-6.707	5.7055	0.17905	0.0791:0.1382:0.6404:0.1422	.	728	Q96NW4	ANR27_HUMAN	G	728	ENSP00000304292:A728G	ENSP00000304292:A728G	A	-	2	0	ANKRD27	37790571	0.094000	0.21725	0.966000	0.40874	0.035000	0.12851	1.053000	0.30442	2.578000	0.87016	0.655000	0.94253	GCG	ANKRD27	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000105186		0.627	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	22	0.00	0	G	NM_032139		33098731	33098731	-1	no_errors	ENST00000306065	ensembl	human	known	69_37n	missense	6	66.67	12	SNP	0.167	C
ARL2	402	genome.wustl.edu	37	11	64786087	64786087	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr11:64786087G>T	ENST00000246747.4	+	3	316	c.221G>T	c.(220-222)cGg>cTg	p.R74L	RP11-399J13.3_ENST00000301886.3_Missense_Mutation_p.R74L|ARL2_ENST00000529384.1_Missense_Mutation_p.R74L|ARL2_ENST00000533729.1_Missense_Mutation_p.R74L	NM_001667.3	NP_001658.2	P36404	ARL2_HUMAN	ADP-ribosylation factor-like 2	74					cell cycle (GO:0007049)|centrosome organization (GO:0051297)|GTP catabolic process (GO:0006184)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of GTPase activity (GO:0034260)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of microtubule polymerization (GO:0031116)|regulation of microtubule polymerization (GO:0031113)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|tubulin complex assembly (GO:0007021)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|GTPase inhibitor activity (GO:0005095)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	5						AAGTCCCTGCGGTCCTACTGG	0.632																																						dbGAP											0													50.0	45.0	47.0					11																	64786087		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF493888	CCDS8088.1, CCDS55770.1	11q13	2014-05-09			ENSG00000213465	ENSG00000213465		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	693	protein-coding gene	gene with protein product		601175				8415637, 9253601	Standard	NM_001667		Approved	ARFL2	uc001och.4	P36404	OTTHUMG00000165728	ENST00000246747.4:c.221G>T	11.37:g.64786087G>T	ENSP00000246747:p.Arg74Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V184|Q9BUK8	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R74L	ENST00000246747.4	37	c.221	CCDS8088.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.313999	0.95655	.	.	ENSG00000213465	ENST00000246747;ENST00000529384;ENST00000533729	T;T;T	0.79247	-1.25;-1.25;-1.25	5.06	5.06	0.68205	Small GTP-binding protein domain (1);	0.000000	0.64402	U	0.000001	D	0.92766	0.7700	H	0.98446	4.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95200	0.8316	10	0.87932	D	0	-26.0364	15.9666	0.79979	0.0:0.0:1.0:0.0	.	74;74	B4DGG0;P36404	.;ARL2_HUMAN	L	74	ENSP00000246747:R74L;ENSP00000436021:R74L;ENSP00000432971:R74L	ENSP00000246747:R74L	R	+	2	0	ARL2	64542663	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.164000	0.94755	2.639000	0.89480	0.650000	0.86243	CGG	ARL2	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000213465		0.632	ARL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL2	HGNC	protein_coding	OTTHUMT00000385963.1	74	0.00	0	G	NM_001667		64786087	64786087	+1	no_errors	ENST00000246747	ensembl	human	known	69_37n	missense	84	16.67	17	SNP	1.000	T
PHF7	51533	genome.wustl.edu	37	3	52442611	52442611	+	5'Flank	SNP	C	C	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr3:52442611C>T	ENST00000327906.3	+	0	0				PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000296288.5_Missense_Mutation_p.G45E|BAP1_ENST00000460680.1_Missense_Mutation_p.G45E	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		GAAGATAAATCCATATACAGG	0.488																																						dbGAP											0													32.0	31.0	32.0					3																	52442611		2203	4299	6502	-	-	-	SO:0001631	upstream_gene_variant	0			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52442611C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	K4DI82	Missense_Mutation	SNP	pfam_Peptidase_C12,prints_Peptidase_C12	p.G45E	ENST00000327906.3	37	c.134	CCDS2854.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.361737	0.95877	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.61392	0.11;0.11	5.43	5.43	0.79202	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.099859	0.64402	D	0.000002	D	0.84999	0.5597	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90012	0.4122	10	0.87932	D	0	-3.095	19.2289	0.93829	0.0:1.0:0.0:0.0	.	45	Q92560	BAP1_HUMAN	E	45	ENSP00000417132:G45E;ENSP00000296288:G45E	ENSP00000296288:G45E	G	-	2	0	BAP1	52417651	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.550000	0.86006	0.655000	0.94253	GGA	BAP1	-	pfam_Peptidase_C12	ENSG00000163930		0.488	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAP1	HGNC	protein_coding	OTTHUMT00000351155.1	61	0.00	0	C	NM_016483		52442611	52442611	-1	no_errors	ENST00000460680	ensembl	human	known	69_37n	missense	38	63.81	67	SNP	1.000	T
C10orf2	56652	genome.wustl.edu	37	10	102748742	102748742	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr10:102748742G>A	ENST00000311916.2	+	1	960	c.775G>A	c.(775-777)Gag>Aag	p.E259K	MRPL43_ENST00000299179.5_5'Flank|C10orf2_ENST00000370228.1_Missense_Mutation_p.E259K|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000342071.1_5'Flank|MRPL43_ENST00000370236.1_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000318325.2_5'Flank|MRPL43_ENST00000370241.3_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|MRPL43_ENST00000370242.4_5'Flank	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	259					cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TCGAGATGCTGAGGTGGTACT	0.572																																						dbGAP											0													126.0	111.0	116.0					10																	102748742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.775G>A	10.37:g.102748742G>A	ENSP00000309595:p.Glu259Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Missense_Mutation	SNP	pfam_Circ_KaiC/RadA,pfam_DNA_helicase_DnaB-like_C,pfscan_DNA_helicase_DnaB-like_C	p.E259K	ENST00000311916.2	37	c.775	CCDS7506.1	10	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807841	0.70797	.	.	ENSG00000107815	ENST00000311916;ENST00000370228	D;D	0.91407	-2.84;-2.84	5.54	5.54	0.83059	.	0.049845	0.85682	D	0.000000	D	0.93077	0.7796	L	0.58925	1.835	0.53005	D	0.999969	D;D	0.69078	0.99;0.997	P;D	0.63703	0.896;0.917	D	0.89997	0.4112	10	0.12430	T	0.62	-10.3847	18.0542	0.89358	0.0:0.0:1.0:0.0	.	259;259	Q96RR1-2;Q96RR1	.;PEO1_HUMAN	K	259	ENSP00000309595:E259K;ENSP00000359248:E259K	ENSP00000309595:E259K	E	+	1	0	C10orf2	102738732	1.000000	0.71417	0.922000	0.36590	0.549000	0.35272	7.930000	0.87610	2.618000	0.88619	0.462000	0.41574	GAG	C10orf2	-	NULL	ENSG00000107815		0.572	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf2	HGNC	protein_coding	OTTHUMT00000049886.1	74	0.00	0	G	NM_021830		102748742	102748742	+1	no_errors	ENST00000311916	ensembl	human	known	69_37n	missense	31	53.73	36	SNP	1.000	A
C3	718	genome.wustl.edu	37	19	6697740	6697740	+	Missense_Mutation	SNP	G	G	T	rs200388595		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr19:6697740G>T	ENST00000245907.6	-	20	2598	c.2506C>A	c.(2506-2508)Ccc>Acc	p.P836T		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	836					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ACAGAGTAGGGTAGCCGCAGG	0.572																																						dbGAP											0													49.0	45.0	47.0					19																	6697740		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2506C>A	19.37:g.6697740G>T	ENSP00000245907:p.Pro836Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E236	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.P836T	ENST00000245907.6	37	c.2506	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541323	0.65085	.	.	ENSG00000125730	ENST00000245907	D	0.86694	-2.16	5.96	5.96	0.96718	Alpha-2-macroglobulin (1);	0.100752	0.64402	D	0.000001	D	0.96571	0.8881	H	0.98407	4.225	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97633	1.0143	10	0.87932	D	0	.	19.1907	0.93664	0.0:0.0:1.0:0.0	.	836	P01024	CO3_HUMAN	T	836	ENSP00000245907:P836T	ENSP00000245907:P836T	P	-	1	0	C3	6648740	1.000000	0.71417	0.967000	0.41034	0.025000	0.11179	8.881000	0.92415	2.831000	0.97527	0.650000	0.86243	CCC	C3	-	pfam_Macroglobln_a2	ENSG00000125730		0.572	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2	60	0.00	0	G	NM_000064		6697740	6697740	-1	no_errors	ENST00000245907	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	1.000	T
HMCES	56941	genome.wustl.edu	37	3	129009605	129009605	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr3:129009605G>C	ENST00000383463.4	+	4	500	c.411G>C	c.(409-411)agG>agC	p.R137S	HMCES_ENST00000417226.2_Intron|HMCES_ENST00000502878.2_Missense_Mutation_p.R137S|HMCES_ENST00000389735.3_Missense_Mutation_p.R137S	NM_020187.2	NP_064572.2	Q96FZ2	HMCES_HUMAN	5-hydroxymethylcytosine (hmC) binding, ES cell-specific	137							DNA binding (GO:0003677)|peptidase activity (GO:0008233)										CAAACCAGAGGCAGCCATACT	0.428																																						dbGAP											0													118.0	108.0	112.0					3																	129009605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201934	CCDS33852.1	3q21.3	2013-08-30	2013-08-30	2013-08-30	ENSG00000183624	ENSG00000183624			24446	protein-coding gene	gene with protein product	"""SOS response associated peptidase domain containing 1"""		"""chromosome 3 open reading frame 37"""	C3orf37		23434322, 23945014	Standard	XM_005247636		Approved	DC12, SRAPD1	uc003elt.3	Q96FZ2	OTTHUMG00000159452	ENST00000383463.4:c.411G>C	3.37:g.129009605G>C	ENSP00000372955:p.Arg137Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJR9|Q96G34|Q9NRP3	Missense_Mutation	SNP	pfam_DUF159	p.R137S	ENST00000383463.4	37	c.411	CCDS33852.1	3	.	.	.	.	.	.	.	.	.	.	G	11.73	1.724644	0.30593	.	.	ENSG00000183624	ENST00000509042;ENST00000383463;ENST00000502878;ENST00000389735;ENST00000509551	.	.	.	5.26	0.192	0.15134	.	0.310296	0.38326	N	0.001739	T	0.43875	0.1267	L	0.55213	1.73	0.40569	D	0.98128	B	0.10296	0.003	B	0.08055	0.003	T	0.32134	-0.9918	9	0.87932	D	0	-4.1144	2.1908	0.03898	0.2361:0.1326:0.4949:0.1363	.	137	Q96FZ2	CC037_HUMAN	S	89;137;137;137;137	.	ENSP00000372955:R137S	R	+	3	2	C3orf37	130492295	1.000000	0.71417	0.133000	0.22050	0.521000	0.34408	2.817000	0.48034	-0.045000	0.13468	0.585000	0.79938	AGG	C3orf37	-	pfam_DUF159	ENSG00000183624		0.428	HMCES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf37	HGNC	protein_coding	OTTHUMT00000355470.2	202	0.98	2	G	NM_020187		129009605	129009605	+1	no_errors	ENST00000383463	ensembl	human	known	69_37n	missense	206	14.34	35	SNP	0.940	C
C8orf86	389649	genome.wustl.edu	37	8	38385862	38385862	+	Silent	SNP	T	T	G			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr8:38385862T>G	ENST00000358138.1	-	1	318	c.294A>C	c.(292-294)gcA>gcC	p.A98A	C8orf86_ENST00000437935.2_Silent_p.A98A	NM_207412.1	NP_997295.1	Q6ZUL3	CH086_HUMAN	chromosome 8 open reading frame 86	98										breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						GAAGTGGCTGTGCTCGTGGCA	0.557																																						dbGAP											0													114.0	94.0	101.0					8																	38385862		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC137511	CCDS6108.1	8p12-p11.23	2009-03-03			ENSG00000196166	ENSG00000196166			33774	protein-coding gene	gene with protein product							Standard	NM_207412		Approved	FLJ43582	uc003xlx.1	Q6ZUL3	OTTHUMG00000163992	ENST00000358138.1:c.294A>C	8.37:g.38385862T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPB7	Silent	SNP	NULL	p.A98	ENST00000358138.1	37	c.294	CCDS6108.1	8																																																																																			C8orf86	-	NULL	ENSG00000196166		0.557	C8orf86-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C8orf86	HGNC	protein_coding	OTTHUMT00000376668.1	173	0.00	0	T	NM_207412		38385862	38385862	-1	no_errors	ENST00000358138	ensembl	human	known	69_37n	silent	162	19.12	39	SNP	0.001	G
CASZ1	54897	genome.wustl.edu	37	1	10705025	10705025	+	Missense_Mutation	SNP	C	C	G	rs202119857		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr1:10705025C>G	ENST00000377022.3	-	18	4134	c.3817G>C	c.(3817-3819)Gca>Cca	p.A1273P	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1273					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CCATTGGCTGCCCGCCGCTCC	0.607																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3817G>C	1.37:g.10705025C>G	ENSP00000366221:p.Ala1273Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1273P	ENST00000377022.3	37	c.3817	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843192	0.91197	.	.	ENSG00000130940	ENST00000377022	.	.	.	5.15	4.23	0.50019	.	0.000000	0.45361	U	0.000362	T	0.68869	0.3048	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.69202	-0.5207	9	0.48119	T	0.1	-6.3643	13.3719	0.60717	0.0:0.9242:0.0:0.0758	.	1273	Q86V15	CASZ1_HUMAN	P	1273	.	ENSP00000366221:A1273P	A	-	1	0	CASZ1	10627612	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	1.170000	0.42753	0.561000	0.74099	GCA	CASZ1	-	NULL	ENSG00000130940		0.607	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	108	0.92	1	C	NM_017766		10705025	10705025	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	missense	85	20.56	22	SNP	1.000	G
CRIPAK	285464	genome.wustl.edu	37	4	1388650	1388650	+	Silent	SNP	C	C	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr4:1388650C>T	ENST00000324803.4	+	1	3311	c.351C>T	c.(349-351)tgC>tgT	p.C117C		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	117					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TGCCCGCCTGCTCACACGTGC	0.682																																						dbGAP											0													162.0	139.0	147.0					4																	1388650		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.351C>T	4.37:g.1388650C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Silent	SNP	smart_Post-SET_dom	p.C117	ENST00000324803.4	37	c.351	CCDS3349.1	4	.	.	.	.	.	.	.	.	.	.	-	5.065	0.197742	0.09652	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.21921	0.0528	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24764	-1.0151	5	0.29301	T	0.29	.	2.8685	0.05609	0.26:0.5262:0.0:0.2138	.	.	.	.	F	101	.	ENSP00000372402:L101F	L	+	1	0	CRIPAK	1378650	0.523000	0.26274	0.000000	0.03702	0.025000	0.11179	2.579000	0.46059	-0.764000	0.04651	0.121000	0.15741	CTC	CRIPAK	-	smart_Post-SET_dom	ENSG00000179979		0.682	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	154	0.00	0	C	NM_175918		1388650	1388650	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	silent	69	25.81	24	SNP	0.000	T
CSF2RA	1438	genome.wustl.edu	37	X	1404639	1404639	+	Intron	SNP	G	G	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chrX:1404639G>T	ENST00000381524.3	+	4	262				CSF2RA_ENST00000417535.2_Intron|CSF2RA_ENST00000432318.2_Intron|CSF2RA_ENST00000355805.2_Intron|CSF2RA_ENST00000381529.3_Intron|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381509.3_Intron|CSF2RA_ENST00000501036.2_Intron|CSF2RA_ENST00000355432.3_Intron|CSF2RA_ENST00000361536.3_Intron|CSF2RA_ENST00000381500.1_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)						response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	aagaaaagaggaaaTTCTGAA	0.443																																					Esophageal Squamous(131;723 1707 25334 40494 41806)	dbGAP											0													72.0	76.0	75.0					X																	1404639		2203	4296	6499	-	-	-	SO:0001627	intron_variant	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.77-32G>T	X.37:g.1404639G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	RNA	SNP	-	NULL	ENST00000381524.3	37	NULL	CCDS35191.1	X																																																																																			CSF2RA	-	-	ENSG00000198223		0.443	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	HGNC	protein_coding	OTTHUMT00000035013.2	86	0.00	0	G			1404639	1404639	+1	no_errors	ENST00000477940	ensembl	human	putative	69_37n	rna	79	38.24	52	SNP	0.000	T
CTAGE1	64693	genome.wustl.edu	37	18	19995673	19995673	+	5'Flank	SNP	G	G	A	rs548796905		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr18:19995673G>A	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.P701L			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					AAAATAATCTGGAGAAGCTCC	0.488																																						dbGAP											0													58.0	64.0	62.0					18																	19995673		2137	4243	6380	-	-	-	SO:0001631	upstream_gene_variant	0			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995673G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ3	Missense_Mutation	SNP	NULL	p.P701L	ENST00000525417.1	37	c.2102		18	.	.	.	.	.	.	.	.	.	.	G	3.965	-0.009552	0.07727	.	.	ENSG00000212710	ENST00000391403	T	0.81247	-1.47	0.614	-1.23	0.09465	.	.	.	.	.	T	0.65883	0.2734	L	0.36672	1.1	0.09310	N	0.999996	B	0.23249	0.082	B	0.25614	0.062	T	0.47736	-0.9094	7	.	.	.	.	.	.	.	.	701	Q96RT6	CTGE2_HUMAN	L	701	ENSP00000375220:P701L	.	P	-	2	0	CTAGE1	18249671	0.998000	0.40836	0.157000	0.22605	0.024000	0.10985	0.300000	0.19156	-1.057000	0.03201	-0.789000	0.03336	CCA	CTAGE1	-	NULL	ENSG00000212710		0.488	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	HGNC	protein_coding	OTTHUMT00000386767.1	64	0.00	0	G	NM_022663, NM_172241		19995673	19995673	-1	no_errors	ENST00000391403	ensembl	human	known	69_37n	missense	31	71.56	78	SNP	0.373	A
DMXL1	1657	genome.wustl.edu	37	5	118576144	118576144	+	Silent	SNP	A	A	C			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr5:118576144A>C	ENST00000311085.8	+	41	8699	c.8619A>C	c.(8617-8619)gcA>gcC	p.A2873A	DMXL1_ENST00000539542.1_Silent_p.A2894A|DMXL1_ENST00000505312.1_3'UTR	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2873										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CTCTTGTAGCACCTGCCAATA	0.279																																						dbGAP											0													83.0	93.0	90.0					5																	118576144		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8619A>C	5.37:g.118576144A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A2894	ENST00000311085.8	37	c.8682	CCDS4125.1	5																																																																																			DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.279	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	137	0.72	1	A	NM_005509		118576144	118576144	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	silent	167	26.96	62	SNP	1.000	C
EI24	9538	genome.wustl.edu	37	11	125445240	125445240	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr11:125445240C>T	ENST00000278903.6	+	3	366	c.124C>T	c.(124-126)Cga>Tga	p.R42*	RNU6-1156P_ENST00000410365.1_RNA|STT3A-AS1_ENST00000532714.1_RNA|EI24_ENST00000530985.1_3'UTR|STT3A-AS1_ENST00000530526.1_RNA|EI24_ENST00000343678.4_Nonsense_Mutation_p.R42*	NM_004879.3	NP_004870.3	O14681	EI24_HUMAN	etoposide induced 2.4	42	Poly-Arg.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of cell growth (GO:0030308)|neuromuscular process controlling balance (GO:0050885)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|response to drug (GO:0042493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(1)|lung(9)|ovary(1)	11	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		GGAGCAGCGTCGAAGAAGGGC	0.468																																						dbGAP											0													69.0	70.0	70.0					11																	125445240		2016	4192	6208	-	-	-	SO:0001587	stop_gained	0			AF010313	CCDS73410.1	11q24.2	2012-11-19	2012-11-16		ENSG00000149547	ENSG00000149547			13276	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 4 homolog (C. elegans)"""	605170	"""etoposide induced 2.4 mRNA"""			10594026, 9305847	Standard	NM_001290135		Approved	PIG8, TP53I8, EPG4	uc001qcb.3	O14681	OTTHUMG00000165851	ENST00000278903.6:c.124C>T	11.37:g.125445240C>T	ENSP00000278903:p.Arg42*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7D6|B4DKL6|Q9BUQ1	Nonsense_Mutation	SNP	NULL	p.R42*	ENST00000278903.6	37	c.124		11	.	.	.	.	.	.	.	.	.	.	C	36	5.830379	0.96996	.	.	ENSG00000149547	ENST00000278903;ENST00000343678;ENST00000524723;ENST00000527842;ENST00000527520;ENST00000527131	.	.	.	5.41	5.41	0.78517	.	0.235594	0.40908	D	0.000994	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7734	0.57434	0.2736:0.7264:0.0:0.0	.	.	.	.	X	42;42;42;42;28;42	.	ENSP00000278903:R42X	R	+	1	2	EI24	124950450	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.677000	0.54619	2.826000	0.97356	0.655000	0.94253	CGA	EI24	-	NULL	ENSG00000149547		0.468	EI24-201	KNOWN	basic|appris_principal	protein_coding	EI24	HGNC	protein_coding		125	0.00	0	C	NM_004879		125445240	125445240	+1	no_errors	ENST00000278903	ensembl	human	known	69_37n	nonsense	86	74.03	248	SNP	0.996	T
PDXDC2P	283970	genome.wustl.edu	37	16	70010610	70010610	+	RNA	SNP	C	C	T	rs146503764	byFrequency	TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr16:70010610C>T	ENST00000531894.1	-	0	3773				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										TGAAGAATGACGATGCTCCGC	0.493																																						dbGAP											0																																										-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010610C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z5	Missense_Mutation	SNP	pfam_NPIP	p.R223H	ENST00000531894.1	37	c.668		16	.	.	.	.	.	.	.	.	.	.	.	5.805	0.332805	0.11013	.	.	ENSG00000226232	ENST00000532298	T	0.46063	0.88	0.498	-0.996	0.10218	.	.	.	.	.	T	0.30603	0.0770	.	.	.	.	.	.	.	.	.	.	.	.	T	0.31110	-0.9955	4	0.87932	D	0	.	.	.	.	.	.	.	.	H	223	ENSP00000448651:R223H	ENSP00000448651:R223H	R	-	2	0	RP11-419C5.2	68568111	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.771000	0.01789	-2.846000	0.00333	-2.509000	0.00188	CGT	RP11-419C5.2	-	pfam_NPIP	ENSG00000226232		0.493	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	13	0.00	0	C			70010610	70010610	-1	no_errors	ENST00000532298	ensembl	human	novel	69_37n	missense	10	33.33	5	SNP	0.000	T
EPHA7	2045	genome.wustl.edu	37	6	94120423	94120423	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr6:94120423C>A	ENST00000369303.4	-	3	812	c.628G>T	c.(628-630)Gag>Tag	p.E210*	EPHA7_ENST00000369297.1_Nonsense_Mutation_p.E210*	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	210	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		GCTAAGTTCTCAATAATGGAC	0.438																																						dbGAP											0													74.0	79.0	77.0					6																	94120423		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.628G>T	6.37:g.94120423C>A	ENSP00000358309:p.Glu210*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Nonsense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.E210*	ENST00000369303.4	37	c.628	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.357537	0.97502	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	20.1041	0.97884	0.0:1.0:0.0:0.0	.	.	.	.	X	210	.	ENSP00000358303:E210X	E	-	1	0	EPHA7	94177144	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.938000	0.56583	2.826000	0.97356	0.655000	0.94253	GAG	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000135333		0.438	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	149	0.67	1	C			94120423	94120423	-1	no_errors	ENST00000369303	ensembl	human	known	69_37n	nonsense	219	14.12	36	SNP	1.000	A
EZH2	2146	genome.wustl.edu	37	7	148506190	148506190	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr7:148506190G>A	ENST00000460911.1	-	19	2241	c.2153C>T	c.(2152-2154)aCt>aTt	p.T718I	EZH2_ENST00000541220.1_Missense_Mutation_p.T667I|EZH2_ENST00000350995.2_Missense_Mutation_p.T679I|EZH2_ENST00000483967.1_Missense_Mutation_p.T709I|EZH2_ENST00000478654.1_Missense_Mutation_p.T667I|EZH2_ENST00000320356.2_Missense_Mutation_p.T723I|EZH2_ENST00000476773.1_Missense_Mutation_p.T667I			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	718	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CTCTTCGCCAGTCTGGATGGC	0.448			Mis		DLBCL																																	dbGAP		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	0													128.0	117.0	121.0					7																	148506190		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.2153C>T	7.37:g.148506190G>A	ENSP00000419711:p.Thr718Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	pfam_SET_dom,pfam_EZH2_WD-Binding,superfamily_Homeodomain-like,smart_SANT/Myb,smart_SET_dom,pfscan_SET_dom	p.T723I	ENST00000460911.1	37	c.2168	CCDS56516.1	7	.	.	.	.	.	.	.	.	.	.	g	25.5	4.646992	0.87958	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	5.23	5.23	0.72850	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.83027	0.5165	N	0.16862	0.45	0.80722	D	1	P;P;D;P;D	0.89917	0.868;0.868;0.985;0.868;1.0	B;B;P;B;D	0.85130	0.32;0.32;0.875;0.32;0.997	D	0.85031	0.0917	10	0.49607	T	0.09	.	18.8215	0.92099	0.0:0.0:1.0:0.0	.	709;667;718;679;723	Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;EZH2_HUMAN;.;.	I	667;723;718;679;667;667;709	ENSP00000417062:T667I;ENSP00000320147:T723I;ENSP00000419711:T718I;ENSP00000223193:T679I;ENSP00000443219:T667I;ENSP00000419050:T667I;ENSP00000419856:T709I	ENSP00000320147:T723I	T	-	2	0	EZH2	148137123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.260000	0.72502	2.439000	0.82584	0.579000	0.79373	ACT	EZH2	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000106462		0.448	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	EZH2	HGNC	protein_coding	OTTHUMT00000352744.1	164	0.00	0	G	NM_004456		148506190	148506190	-1	no_errors	ENST00000320356	ensembl	human	known	69_37n	missense	160	48.55	151	SNP	1.000	A
FAM66C	440078	genome.wustl.edu	37	12	8352642	8352642	+	RNA	SNP	T	T	C	rs11831572		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr12:8352642T>C	ENST00000544214.1	+	0	1669				RP11-266K4.1_ENST00000542600.1_RNA|FAM66C_ENST00000454799.2_RNA|FAM66C_ENST00000535567.1_RNA|FAM66C_ENST00000541558.1_RNA|FAM66C_ENST00000372173.5_RNA|FAM66C_ENST00000456135.2_RNA					family with sequence similarity 66, member C																		ATGGTACATCTTCATCTTTTT	0.468													T|||	1891	0.377596	0.3321	0.3977	5008	,	,		-128	0.3998		0.4513	False		,,,				2504	0.3262					dbGAP											0																																										-	-	-			0					12p13.31	2013-07-05			ENSG00000226711	ENSG00000226711		"""Long non-coding RNAs"""	21644	non-coding RNA	RNA, long non-coding							Standard	NR_026788		Approved		uc001que.4		OTTHUMG00000168638		12.37:g.8352642T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000544214.1	37	NULL		12																																																																																			FAM66C	-	-	ENSG00000226711		0.468	FAM66C-003	KNOWN	basic	antisense	FAM66C	HGNC	antisense	OTTHUMT00000400454.1	8	0.00	0	T	NR_026788		8352642	8352642	+1	no_errors	ENST00000544214	ensembl	human	known	69_37n	rna	13	38.10	8	SNP	0.000	C
GOLIM4	27333	genome.wustl.edu	37	3	167747569	167747569	+	Splice_Site	SNP	G	G	A	rs528758552		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr3:167747569G>A	ENST00000470487.1	-	10	2121	c.1432C>T	c.(1432-1434)Cgg>Tgg	p.R478W	GOLIM4_ENST00000309027.4_Splice_Site_p.R450W	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	478	Gln-rich.|Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GAAGGCTACCGGAGCTGCTCC	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		14001	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													35.0	39.0	37.0					3																	167747569		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.1433+1C>T	3.37:g.167747569G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R478W	ENST00000470487.1	37	c.1432	CCDS3204.1	3	.	.	.	.	.	.	.	.	.	.	G	12.73	2.024532	0.35701	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	5.38	0.764	0.18465	.	0.442734	0.26000	N	0.026956	T	0.31358	0.0794	L	0.45137	1.4	0.25449	N	0.988026	B;B	0.26935	0.164;0.164	B;B	0.19148	0.024;0.024	T	0.25882	-1.0119	9	0.72032	D	0.01	-4.4477	10.1582	0.42836	0.0:0.1108:0.2413:0.6479	.	450;478	F8W785;O00461	.;GOLI4_HUMAN	W	478;450	.	ENSP00000309893:R450W	R	-	1	2	GOLIM4	169230263	0.321000	0.24625	0.225000	0.23894	0.036000	0.12997	0.344000	0.19962	0.117000	0.18138	-0.315000	0.08773	CGG	GOLIM4	-	NULL	ENSG00000173905		0.542	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLIM4	HGNC	protein_coding	OTTHUMT00000351278.2	60	0.00	0	G		Missense_Mutation	167747569	167747569	-1	no_errors	ENST00000470487	ensembl	human	known	69_37n	missense	40	43.84	32	SNP	0.218	A
HAUS7	55559	genome.wustl.edu	37	X	152720739	152720739	+	Intron	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chrX:152720739G>A	ENST00000370211.4	-	8	1004				HAUS7_ENST00000421080.2_Intron|TREX2_ENST00000370232.1_Intron|TREX2_ENST00000334497.2_Intron|TREX2_ENST00000330912.2_Intron|HAUS7_ENST00000370212.3_Intron|HAUS7_ENST00000484394.1_5'UTR|TREX2_ENST00000338525.2_Intron	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						CCCCACACCGGATCTGGGCCT	0.612																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.960+260C>T	X.37:g.152720739G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	RNA	SNP	-	NULL	ENST00000370211.4	37	NULL	CCDS35438.1	X																																																																																			HAUS7	-	-	ENSG00000213397		0.612	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HAUS7	HGNC	protein_coding	OTTHUMT00000060963.2	11	0.00	0	G	NM_017518		152720739	152720739	-1	no_errors	ENST00000484394	ensembl	human	known	69_37n	rna	7	41.67	5	SNP	0.000	A
HCP5	10866	genome.wustl.edu	37	6	31431422	31431422	+	RNA	SNP	G	G	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr6:31431422G>T	ENST00000414046.2	+	0	494					NR_040662.1		Q6MZN7	HCP5_HUMAN	HLA complex P5 (non-protein coding)						defense response (GO:0006952)					urinary_tract(1)	1						ggaacagcctgagagaagtag	0.547																																						dbGAP											0													54.0	54.0	54.0					6																	31431422		2203	4300	6503	-	-	-			0			D88650		6p21.3	2012-10-16	2011-08-02		ENSG00000206337	ENSG00000206337		"""Long non-coding RNAs"""	21659	non-coding RNA	RNA, long non-coding		604676	"""HLA complex P5"""			8462994, 10199916	Standard	NR_040662		Approved	D6S2650E, P5-1	uc003ntl.3	Q6MZN7	OTTHUMG00000031282		6.37:g.31431422G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q04490	RNA	SNP	-	NULL	ENST00000414046.2	37	NULL		6																																																																																			HCP5	-	-	ENSG00000206337		0.547	HCP5-001	KNOWN	basic	sense_overlapping	HCP5	HGNC	sense_overlapping	OTTHUMT00000076614.4	96	0.00	0	G	NR_040662		31431422	31431422	+1	no_errors	ENST00000414046	ensembl	human	known	69_37n	rna	119	43.60	92	SNP	0.002	T
IGDCC4	57722	genome.wustl.edu	37	15	65693239	65693239	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr15:65693239G>C	ENST00000352385.2	-	5	955	c.746C>G	c.(745-747)gCc>gGc	p.A249G		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	249	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GTTCTCTGGGGCTGCCACAAT	0.602											OREG0023196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													114.0	99.0	104.0					15																	65693239		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.746C>G	15.37:g.65693239G>C	ENSP00000319623:p.Ala249Gly	Somatic	1086	WXS	Illumina GAIIx	Phase_IV	Q9HCE4	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A249G	ENST00000352385.2	37	c.746	CCDS10206.1	15	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306130	0.23736	.	.	ENSG00000103742	ENST00000352385	T	0.26810	1.71	5.15	5.15	0.70609	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.127561	0.53938	D	0.000056	T	0.16642	0.0400	N	0.10837	0.055	0.39703	D	0.971217	B	0.25390	0.125	B	0.31245	0.126	T	0.08310	-1.0728	10	0.08837	T	0.75	-24.8208	18.6484	0.91419	0.0:0.0:1.0:0.0	.	249	Q8TDY8	IGDC4_HUMAN	G	249	ENSP00000319623:A249G	ENSP00000319623:A249G	A	-	2	0	IGDCC4	63480292	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.375000	0.66173	2.409000	0.81822	0.561000	0.74099	GCC	IGDCC4	-	pfam_Ig_I-set,pfscan_Ig-like	ENSG00000103742		0.602	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	79	0.00	0	G	NM_020962		65693239	65693239	-1	no_errors	ENST00000352385	ensembl	human	novel	69_37n	missense	54	25.00	18	SNP	1.000	C
IL11RA	3590	genome.wustl.edu	37	9	34661484	34661484	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr9:34661484C>A	ENST00000555003.1	+	13	2614	c.1258C>A	c.(1258-1260)Cca>Aca	p.P420T	RP11-195F19.30_ENST00000564224.1_RNA|CCL27_ENST00000557161.1_5'Flank|IL11RA_ENST00000318041.9_Missense_Mutation_p.P420T|IL11RA_ENST00000441545.2_Missense_Mutation_p.P420T			Q14626	I11RA_HUMAN	interleukin 11 receptor, alpha	420					developmental process (GO:0032502)|embryo implantation (GO:0007566)|head development (GO:0060322)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)	TCTAGGAGCTCCAAACCTGTA	0.512																																						dbGAP											0													102.0	99.0	100.0					9																	34661484		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z38102	CCDS6567.1	9p13	2014-05-22			ENSG00000137070	ENSG00000137070		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5967	protein-coding gene	gene with protein product		600939				7670098	Standard	NM_001142784		Approved		uc011loq.3	Q14626	OTTHUMG00000019837	ENST00000555003.1:c.1258C>A	9.37:g.34661484C>A	ENSP00000450565:p.Pro420Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16542|Q5VZ80|Q7KYJ7	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P420T	ENST00000555003.1	37	c.1258	CCDS6567.1	9	.	.	.	.	.	.	.	.	.	.	C	9.144	1.014477	0.19277	.	.	ENSG00000137070	ENST00000555003;ENST00000441545;ENST00000318041	T;T;T	0.36520	1.25;1.25;1.25	4.3	2.47	0.30058	.	0.391600	0.25124	N	0.032947	T	0.26048	0.0635	L	0.27053	0.805	0.31780	N	0.631051	P;P	0.40180	0.705;0.705	B;B	0.44044	0.346;0.439	T	0.19095	-1.0316	10	0.29301	T	0.29	-0.5733	6.528	0.22312	0.0:0.7867:0.0:0.2133	.	420;420	Q5VZ79;Q14626	.;I11RA_HUMAN	T	420	ENSP00000450565:P420T;ENSP00000394391:P420T;ENSP00000326500:P420T	ENSP00000326500:P420T	P	+	1	0	IL11RA	34651484	0.517000	0.26226	0.994000	0.49952	0.300000	0.27592	0.549000	0.23329	0.772000	0.33382	-0.136000	0.14681	CCA	IL11RA	-	NULL	ENSG00000137070		0.512	IL11RA-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL11RA	HGNC	protein_coding	OTTHUMT00000410625.1	186	0.00	0	C	NM_001142784		34661484	34661484	+1	no_errors	ENST00000318041	ensembl	human	known	69_37n	missense	81	60.00	123	SNP	0.995	A
KIF26A	26153	genome.wustl.edu	37	14	104639413	104639414	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr14:104639413_104639414GG>AA	ENST00000423312.2	+	8	1520_1521	c.1520_1521GG>AA	c.(1519-1521)aGG>aAA	p.R507K	KIF26A_ENST00000315264.7_Missense_Mutation_p.R368K	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	507	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GAGGAGCGCAGGGAGAGGACGG	0.688																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	Exception_encountered	14.37:g.104639413_104639414delinsAA	ENSP00000388241:p.Arg507Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation|Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R507K|p.R507	ENST00000423312.2	37	c.1520|c.1521	CCDS45171.1	14																																																																																			KIF26A	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000066735		0.688	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	28	0.00	0	G			104639413|104639414	104639413|104639414	+1	no_errors	ENST00000423312	ensembl	human	known	69_37n	missense|silent	19|18	38.71|41.94	12|13	SNP	0.013|0.025	A
JAG2	3714	genome.wustl.edu	37	14	105617992	105617992	+	Missense_Mutation	SNP	G	G	A	rs200420004		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr14:105617992G>A	ENST00000331782.3	-	8	1527	c.1124C>T	c.(1123-1125)tCg>tTg	p.S375L	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Missense_Mutation_p.S375L	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	375	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GCTCCAGCCCGATGGGCAGTG	0.657													g|||	1	0.000199681	0.0008	0.0	5008	,	,		17633	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													26.0	25.0	25.0					14																	105617992		2197	4298	6495	-	-	-	SO:0001583	missense	0			AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.1124C>T	14.37:g.105617992G>A	ENSP00000328169:p.Ser375Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,smart_DSL,smart_EGF-like,smart_EGF-like_Ca-bd,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom,pfscan_VWF_C	p.S375L	ENST00000331782.3	37	c.1124	CCDS9998.1	14	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	14.57	2.575714	0.45902	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.91686	-2.89;-2.52	3.17	3.17	0.36434	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.310658	0.31450	U	0.007625	D	0.87144	0.6104	L	0.43757	1.38	0.42825	D	0.994007	B;B	0.29646	0.129;0.253	B;B	0.23275	0.022;0.045	D	0.86013	0.1502	10	0.59425	D	0.04	.	11.7858	0.52041	0.0:0.0:1.0:0.0	.	375;375	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	L	375	ENSP00000328169:S375L;ENSP00000328566:S375L	ENSP00000328169:S375L	S	-	2	0	JAG2	104689037	0.030000	0.19436	0.908000	0.35775	0.427000	0.31564	1.882000	0.39648	1.292000	0.44672	0.176000	0.17051	TCG	JAG2	-	pfam_EGF-like_dom,pfam_EGF_extracell,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000184916		0.657	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG2	HGNC	protein_coding	OTTHUMT00000276506.2	23	0.00	0	G			105617992	105617992	-1	no_errors	ENST00000331782	ensembl	human	known	69_37n	missense	17	33.33	9	SNP	0.991	A
MAPK6	5597	genome.wustl.edu	37	15	52356350	52356350	+	Missense_Mutation	SNP	G	G	T	rs200909174		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr15:52356350G>T	ENST00000261845.5	+	6	2126	c.1319G>T	c.(1318-1320)tGt>tTt	p.C440F	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	440					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		GATCTGGAGTGTAGCCATACT	0.363																																						dbGAP											0													36.0	34.0	35.0					15																	52356350		2195	4292	6487	-	-	-	SO:0001583	missense	0			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1319G>T	15.37:g.52356350G>T	ENSP00000261845:p.Cys440Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.C440F	ENST00000261845.5	37	c.1319	CCDS10147.1	15	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305316	0.81247	.	.	ENSG00000069956	ENST00000261845	T	0.42513	0.97	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	L	0.38531	1.155	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.55121	-0.8190	10	0.45353	T	0.12	-11.1671	18.9107	0.92483	0.0:0.0:1.0:0.0	.	440	Q16659	MK06_HUMAN	F	440	ENSP00000261845:C440F	ENSP00000261845:C440F	C	+	2	0	MAPK6	50143642	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.601000	0.98297	2.496000	0.84212	0.638000	0.83543	TGT	MAPK6	-	NULL	ENSG00000069956		0.363	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	113	0.88	1	G	NM_002748		52356350	52356350	+1	no_errors	ENST00000261845	ensembl	human	known	69_37n	missense	96	23.81	30	SNP	1.000	T
MDGA2	161357	genome.wustl.edu	37	14	47504278	47504278	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr14:47504278C>G	ENST00000399232.2	-	8	1912	c.1548G>C	c.(1546-1548)caG>caC	p.Q516H	MDGA2_ENST00000439988.3_Missense_Mutation_p.Q585H|MDGA2_ENST00000426342.1_Missense_Mutation_p.Q287H|MDGA2_ENST00000357362.3_Missense_Mutation_p.Q287H	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	516	Ig-like 5.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.Q287H(2)|p.Q585H(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						ATTGGCTGGTCTGACATCTGT	0.418																																						dbGAP											3	Substitution - Missense(3)	lung(3)											128.0	129.0	129.0					14																	47504278		1970	4162	6132	-	-	-	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1548G>C	14.37:g.47504278C>G	ENSP00000382178:p.Gln516His	Somatic		WXS	Illumina GAIIx	Phase_IV	F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like	p.Q585H	ENST00000399232.2	37	c.1755		14	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669065	0.67814	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.52	4.64	0.57946	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.49305	U	0.000152	T	0.72645	0.3486	L	0.46614	1.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68633	-0.5357	10	0.23302	T	0.38	.	9.5701	0.39422	0.0:0.8391:0.0:0.1609	.	287;516	F6W3S7;Q7Z553	.;MDGA2_HUMAN	H	516;287;585;287	ENSP00000400011:Q516H;ENSP00000405456:Q287H;ENSP00000382178:Q585H;ENSP00000349925:Q287H	ENSP00000349925:Q287H	Q	-	3	2	MDGA2	46574028	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.692000	0.37731	1.343000	0.45638	0.491000	0.48974	CAG	MDGA2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000139915		0.418	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	135	0.00	0	C	NM_182830		47504278	47504278	-1	no_errors	ENST00000399232	ensembl	human	known	69_37n	missense	90	35.46	50	SNP	1.000	G
NANOGNB	360030	genome.wustl.edu	37	12	7922700	7922700	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr12:7922700G>C	ENST00000382119.1	+	2	294	c.224G>C	c.(223-225)cGa>cCa	p.R75P		NM_001145465.1	NP_001138937.1	Q7Z5D8	NANGN_HUMAN	NANOG neighbor homeobox	75						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)	1						aagagagaacgagaaaaagaa	0.373																																						dbGAP											0													119.0	117.0	118.0					12																	7922700		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44826.1	12p13.31	2011-06-02	2010-07-08		ENSG00000205857	ENSG00000205857			24958	protein-coding gene	gene with protein product	"""homeobox C14"""					12477932	Standard	NM_001145465		Approved		uc009zfx.2	Q7Z5D8	OTTHUMG00000165107	ENST00000382119.1:c.224G>C	12.37:g.7922700G>C	ENSP00000371553:p.Arg75Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,pfscan_Homeodomain	p.R75P	ENST00000382119.1	37	c.224	CCDS44826.1	12	.	.	.	.	.	.	.	.	.	.	G	7.581	0.668661	0.14776	.	.	ENSG00000205857	ENST00000382119	T	0.33654	1.4	3.07	-2.68	0.06041	.	.	.	.	.	T	0.13243	0.0321	N	0.14661	0.345	0.09310	N	1	P	0.43788	0.817	B	0.28232	0.087	T	0.14282	-1.0478	9	0.54805	T	0.06	0.6762	4.0501	0.09791	0.4438:0.1867:0.3695:0.0	.	75	Q7Z5D8	NANGN_HUMAN	P	75	ENSP00000371553:R75P	ENSP00000371553:R75P	R	+	2	0	NANOGNB	7813967	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.514000	0.02254	-0.557000	0.06126	-0.137000	0.14449	CGA	NANOGNB	-	NULL	ENSG00000205857		0.373	NANOGNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NANOGNB	HGNC	protein_coding	OTTHUMT00000381846.1	82	0.00	0	G			7922700	7922700	+1	no_errors	ENST00000382119	ensembl	human	known	69_37n	missense	267	19.09	63	SNP	0.000	C
MYF6	4618	genome.wustl.edu	37	12	81102680	81102680	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr12:81102680G>T	ENST00000228641.3	+	3	892	c.670G>T	c.(670-672)Gac>Tac	p.D224Y		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	224					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D224Y(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						TTCCATCGTGGACAGTATTTC	0.512																																						dbGAP											1	Substitution - Missense(1)	lung(1)											153.0	132.0	139.0					12																	81102680		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.670G>T	12.37:g.81102680G>T	ENSP00000228641:p.Asp224Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	pfam_Basic,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_Basic,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D224Y	ENST00000228641.3	37	c.670	CCDS9019.1	12	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560447	0.65538	.	.	ENSG00000111046	ENST00000228641	D	0.97598	-4.45	5.6	5.6	0.85130	.	0.135819	0.64402	D	0.000003	D	0.98277	0.9429	M	0.73962	2.25	0.58432	D	0.99999	D	0.89917	1.0	D	0.83275	0.996	D	0.99239	1.0884	10	0.87932	D	0	-38.2672	17.3929	0.87437	0.0:0.0:1.0:0.0	.	224	P23409	MYF6_HUMAN	Y	224	ENSP00000228641:D224Y	ENSP00000228641:D224Y	D	+	1	0	MYF6	79626811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.483000	0.66838	2.638000	0.89438	0.591000	0.81541	GAC	MYF6	-	NULL	ENSG00000111046		0.512	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	HGNC	protein_coding	OTTHUMT00000407756.1	154	0.00	0	G	NM_002469		81102680	81102680	+1	no_errors	ENST00000228641	ensembl	human	known	69_37n	missense	134	39.19	87	SNP	1.000	T
NOP14	8602	genome.wustl.edu	37	4	2949062	2949062	+	Intron	SNP	A	A	G			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr4:2949062A>G	ENST00000314262.6	-	10	1548				NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000502735.1_Intron|NOP14_ENST00000416614.2_Intron|NOP14_ENST00000398071.4_Intron|NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000507702.1_RNA|NOP14-AS1_ENST00000515194.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						CAGTGGCTGGAGCGGCACGTG	0.532																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1499+190T>C	4.37:g.2949062A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	RNA	SNP	-	NULL	ENST00000314262.6	37	NULL	CCDS33945.1	4																																																																																			NOP14-AS1	-	-	ENSG00000249673		0.532	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14-AS1	HGNC	protein_coding	OTTHUMT00000358135.2	20	0.00	0	A	NM_003703		2949062	2949062	+1	no_errors	ENST00000505731	ensembl	human	known	69_37n	rna	15	57.14	20	SNP	0.001	G
NPC2	10577	genome.wustl.edu	37	14	74946861	74946861	+	3'UTR	SNP	C	C	T	rs550747017		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr14:74946861C>T	ENST00000555619.1	-	0	809				NPC2_ENST00000434013.2_Intron|NPC2_ENST00000541064.1_3'UTR|MIR4709_ENST00000577272.1_RNA|NPC2_ENST00000238633.2_3'UTR	NM_006432.3	NP_006423.1	P61916	NPC2_HUMAN	Niemann-Pick disease, type C2						cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|glycolipid transport (GO:0046836)|intracellular cholesterol transport (GO:0032367)|intracellular sterol transport (GO:0032366)|phospholipid transport (GO:0015914)|regulation of isoprenoid metabolic process (GO:0019747)|response to virus (GO:0009615)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.00149)		TCCTCTTCAACGAATCACTGG	0.493													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19026	0.0		0.0	False		,,,				2504	0.0				Pancreas(93;260 1497 8575 30964 48133)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X67698	CCDS32121.1	14q24.3	2009-09-12				ENSG00000119655			14537	protein-coding gene	gene with protein product	"""epididymal protein 1"""	601015				8418812, 11125141	Standard	NM_006432		Approved	HE1, NP-C2, EDDM1	uc001xpy.3	P61916		ENST00000555619.1:c.*116G>A	14.37:g.74946861C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQV7|Q15668|Q29413	Silent	SNP	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	p.S196	ENST00000555619.1	37	c.588	CCDS32121.1	14																																																																																			NPC2	-	NULL	ENSG00000119655		0.493	NPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPC2	HGNC	protein_coding	OTTHUMT00000412346.1	41	0.00	0	C	NM_006432		74946861	74946861	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000553490	ensembl	human	novel	69_37n	silent	65	19.75	16	SNP	0.000	T
PLAC8	51316	genome.wustl.edu	37	4	84026091	84026091	+	Silent	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr4:84026091G>A	ENST00000509973.1	-	2	153	c.30C>T	c.(28-30)agC>agT	p.S10S	PLAC8_ENST00000411416.2_Silent_p.S67S|PLAC8_ENST00000515389.1_Intron|PLAC8_ENST00000311507.4_Silent_p.S67S|PLAC8_ENST00000505406.1_Silent_p.S67S|PLAC8_ENST00000426923.2_Silent_p.S67S			Q9UHV8	PP13_HUMAN	placenta-specific 8	0	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)			large_intestine(2)|lung(3)|ovary(1)	6		Hepatocellular(203;0.114)				TCATTGCGACGCTTGTTCCAC	0.453																																						dbGAP											0													119.0	108.0	112.0					4																	84026091		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF208846	CCDS3601.1	4q21.22	2006-05-20			ENSG00000145287	ENSG00000145287			19254	protein-coding gene	gene with protein product		607515				12758124, 12384430	Standard	NM_016619		Approved	onzin, C15	uc003hoe.3	Q9NZF1	OTTHUMG00000130294	ENST00000509973.1:c.30C>T	4.37:g.84026091G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C5HZ15	Silent	SNP	pfam_Uncharacterised_Cys-rich,tigrfam_Uncharacterised_Cys-rich	p.S67	ENST00000509973.1	37	c.201		4																																																																																			PLAC8	-	pfam_Uncharacterised_Cys-rich,tigrfam_Uncharacterised_Cys-rich	ENSG00000145287		0.453	PLAC8-003	PUTATIVE	basic|exp_conf	protein_coding	PLAC8	HGNC	protein_coding	OTTHUMT00000363078.1	138	0.00	0	G	NM_016619		84026091	84026091	-1	no_errors	ENST00000311507	ensembl	human	known	69_37n	silent	61	64.37	112	SNP	0.021	A
PLEKHA2	59339	genome.wustl.edu	37	8	38827055	38827055	+	Silent	SNP	C	C	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr8:38827055C>T	ENST00000420274.1	+	12	1266	c.1032C>T	c.(1030-1032)ctC>ctT	p.L344L	PLEKHA2_ENST00000388745.4_3'UTR|CTD-2544N14.3_ENST00000520863.1_RNA|PLEKHA2_ENST00000521746.1_Intron	NM_021623.1	NP_067636.1	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	344					positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			AGAAAGCCCTCTGCAAAGCCC	0.602																																						dbGAP											0													25.0	29.0	28.0					8																	38827055		1843	4077	5920	-	-	-	SO:0001819	synonymous_variant	0			AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000420274.1:c.1032C>T	8.37:g.38827055C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L344	ENST00000420274.1	37	c.1032		8																																																																																			PLEKHA2	-	NULL	ENSG00000169499		0.602	PLEKHA2-201	KNOWN	basic|appris_principal	protein_coding	PLEKHA2	HGNC	protein_coding		53	0.00	0	C	NM_021623		38827055	38827055	+1	no_errors	ENST00000420274	ensembl	human	known	69_37n	silent	56	25.33	19	SNP	0.846	T
PLEC	5339	genome.wustl.edu	37	8	145006674	145006674	+	Missense_Mutation	SNP	G	G	C	rs201447140		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr8:145006674G>C	ENST00000322810.4	-	16	2451	c.2282C>G	c.(2281-2283)gCc>gGc	p.A761G	PLEC_ENST00000356346.3_Missense_Mutation_p.A610G|PLEC_ENST00000345136.3_Missense_Mutation_p.A624G|PLEC_ENST00000354958.2_Missense_Mutation_p.A602G|PLEC_ENST00000436759.2_Missense_Mutation_p.A651G|PLEC_ENST00000398774.2_Missense_Mutation_p.A592G|PLEC_ENST00000354589.3_Missense_Mutation_p.A624G|PLEC_ENST00000357649.2_Missense_Mutation_p.A628G|PLEC_ENST00000527096.1_Missense_Mutation_p.A647G	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	761	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTTAGTGGCGGCTGCCACAAA	0.627																																						dbGAP											0													46.0	57.0	53.0					8																	145006674		1980	4119	6099	-	-	-	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.2282C>G	8.37:g.145006674G>C	ENSP00000323856:p.Ala761Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.A761G	ENST00000322810.4	37	c.2282	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	G	7.382	0.629062	0.14257	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096;ENST00000528025	D;D;D;D;D;D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09	4.08	3.17	0.36434	.	0.000000	0.64402	U	0.000011	D	0.90041	0.6890	M	0.68952	2.095	0.43994	D	0.99669	B;B;B;B;B;B;B;B	0.10296	0.003;0.003;0.003;0.001;0.003;0.003;0.003;0.003	B;B;B;B;B;B;B;B	0.08055	0.003;0.003;0.003;0.001;0.003;0.003;0.003;0.003	D	0.87206	0.2244	10	0.52906	T	0.07	.	12.7916	0.57537	0.0:0.1668:0.8332:0.0	.	651;610;602;761;592;624;628;624	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	G	624;628;624;592;761;602;610;651;647;668	ENSP00000344848:A624G;ENSP00000350277:A628G;ENSP00000346602:A624G;ENSP00000381756:A592G;ENSP00000323856:A761G;ENSP00000347044:A602G;ENSP00000348702:A610G;ENSP00000388180:A651G;ENSP00000434583:A647G;ENSP00000437303:A668G	ENSP00000323856:A761G	A	-	2	0	PLEC	145078662	1.000000	0.71417	0.248000	0.24265	0.119000	0.20118	4.411000	0.59781	1.020000	0.39573	0.453000	0.30009	GCC	PLEC	-	smart_Spectrin/alpha-actinin	ENSG00000178209		0.627	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	56	0.00	0	G	NM_000445		145006674	145006674	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	missense	35	40.68	24	SNP	0.805	C
PMEL	6490	genome.wustl.edu	37	12	56355434	56355434	+	Silent	SNP	T	T	C			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr12:56355434T>C	ENST00000548747.1	-	2	821	c.159A>G	c.(157-159)acA>acG	p.T53T	PMEL_ENST00000449260.2_Silent_p.T53T|PMEL_ENST00000539511.1_Intron|PMEL_ENST00000536427.1_Silent_p.T53T|PMEL_ENST00000550464.1_Intron|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000552882.1_Silent_p.T53T|PMEL_ENST00000548493.1_Silent_p.T53T|PMEL_ENST00000360714.4_Silent_p.T53T|PMEL_ENST00000550447.1_Intron			P40967	PMEL_HUMAN	premelanosome protein	53					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TCTGGGCTTCTGTCCACTCTG	0.522																																						dbGAP											0													127.0	125.0	126.0					12																	56355434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.159A>G	12.37:g.56355434T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.T53	ENST00000548747.1	37	c.159	CCDS8897.1	12																																																																																			PMEL	-	NULL	ENSG00000185664		0.522	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	HGNC	protein_coding	OTTHUMT00000409626.1	147	0.00	0	T	NM_006928		56355434	56355434	-1	no_errors	ENST00000360714	ensembl	human	known	69_37n	silent	96	41.82	69	SNP	0.995	C
RB1	5925	genome.wustl.edu	37	13	48934162	48934162	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr13:48934162T>G	ENST00000267163.4	+	7	755	c.617T>G	c.(616-618)tTa>tGa	p.L206*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	206					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(6)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGGGAAGTATTACAAATGGAA	0.318		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	21	Whole gene deletion(15)|Unknown(6)	bone(11)|breast(5)|eye(1)|soft_tissue(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)											89.0	88.0	88.0					13																	48934162		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.617T>G	13.37:g.48934162T>G	ENSP00000267163:p.Leu206*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.L206*	ENST00000267163.4	37	c.617	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	T	34	5.323639	0.95708	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.59	5.59	0.84812	.	0.081893	0.51477	D	0.000097	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.744	0.69477	0.0:0.0:0.0:1.0	.	.	.	.	X	185;206	.	ENSP00000267163:L206X	L	+	2	0	RB1	47832163	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.416000	0.66417	2.126000	0.65437	0.528000	0.53228	TTA	RB1	-	pfam_DUF3452_retinoblatoma-assoc	ENSG00000139687		0.318	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	110	0.00	0	T			48934162	48934162	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	nonsense	77	68.57	168	SNP	1.000	G
RBM17	84991	genome.wustl.edu	37	10	6150611	6150611	+	Intron	SNP	G	G	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr10:6150611G>T	ENST00000446108.1	+	6	1149				RBM17_ENST00000379888.4_Intron	NM_001145547.1	NP_001139019.1	Q96I25	SPF45_HUMAN	RNA binding motif protein 17						alternative mRNA splicing, via spliceosome (GO:0000380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	19						GTCTGGCATCGGAAACCTCCT	0.473																																						dbGAP											0													139.0	134.0	135.0					10																	6150611		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF083384	CCDS7077.1	10p15.1	2013-01-28			ENSG00000134453	ENSG00000134453		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	16944	protein-coding gene	gene with protein product	"""splicing factor 45kDa"""	606935				9731529	Standard	NM_032905		Approved	SPF45, MGC14439	uc001ijb.3	Q96I25	OTTHUMG00000017618	ENST00000446108.1:c.506-38G>T	10.37:g.6150611G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GY6	RNA	SNP	-	NULL	ENST00000446108.1	37	NULL	CCDS7077.1	10																																																																																			RBM17	-	-	ENSG00000134453		0.473	RBM17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM17	HGNC	protein_coding	OTTHUMT00000046635.1	179	0.00	0	G	NM_032905		6150611	6150611	+1	no_errors	ENST00000481147	ensembl	human	known	69_37n	rna	156	42.65	116	SNP	0.000	T
REPIN1	29803	genome.wustl.edu	37	7	150066656	150066656	+	Intron	SNP	C	C	G			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr7:150066656C>G	ENST00000397281.2	+	2	152				REPIN1_ENST00000482680.1_Intron|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000479668.1_Intron|REPIN1_ENST00000518514.1_Intron|REPIN1_ENST00000518462.1_3'UTR|REPIN1_ENST00000444957.1_Intron|REPIN1_ENST00000540729.1_Intron|REPIN1_ENST00000489432.2_Intron|REPIN1_ENST00000466559.1_Intron|REPIN1_ENST00000425389.2_5'Flank	NM_013400.3	NP_037532.2	Q9BWE0	REPI1_HUMAN	replication initiator 1						DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			ATGGCTGGTGCGTGTGGCTTT	0.537																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000397281.2:c.-337-104C>G	7.37:g.150066656C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	RNA	SNP	-	NULL	ENST00000397281.2	37	NULL	CCDS43677.1	7																																																																																			REPIN1	-	-	ENSG00000214022		0.537	REPIN1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	HGNC	protein_coding		23	0.00	0	C	NM_014374		150066656	150066656	+1	no_errors	ENST00000518462	ensembl	human	putative	69_37n	rna	7	68.18	15	SNP	0.000	G
RNF40	9810	genome.wustl.edu	37	16	30780540	30780540	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr16:30780540A>G	ENST00000324685.6	+	16	2716	c.2281A>G	c.(2281-2283)Aca>Gca	p.T761A	RNF40_ENST00000402121.3_Missense_Mutation_p.T453A|RNF40_ENST00000357890.5_Missense_Mutation_p.T661A|RNF40_ENST00000563683.1_Missense_Mutation_p.T721A	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	761					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GATGGATGTGACAGGTCAGGC	0.547																																						dbGAP											0													122.0	124.0	124.0					16																	30780540		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.2281A>G	16.37:g.30780540A>G	ENSP00000325677:p.Thr761Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.T761A	ENST00000324685.6	37	c.2281	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	A	22.1	4.237936	0.79800	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121;ENST00000538323	T;T;T	0.34072	1.38;1.4;1.42	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.76494	0.992;0.997;0.999;0.999;0.999	D;D;D;D;D	0.80764	0.917;0.968;0.994;0.991;0.991	T	0.64761	-0.6331	10	0.72032	D	0.01	-13.5854	14.8515	0.70300	1.0:0.0:0.0:0.0	.	93;453;661;761;761	F6SYU7;F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;.;BRE1B_HUMAN	A	761;661;453;93	ENSP00000325677:T761A;ENSP00000350563:T661A;ENSP00000384942:T453A	ENSP00000325677:T761A	T	+	1	0	RNF40	30688041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.150000	0.67090	0.533000	0.62120	ACA	RNF40	-	NULL	ENSG00000103549		0.547	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	223	0.00	0	A	NM_014771		30780540	30780540	+1	no_errors	ENST00000324685	ensembl	human	known	69_37n	missense	350	30.84	157	SNP	1.000	G
RSPH10B	222967	genome.wustl.edu	37	7	5978378	5978378	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr7:5978378C>G	ENST00000405415.1	-	15	2227	c.1841G>C	c.(1840-1842)gGa>gCa	p.G614A	RSPH10B_ENST00000535104.1_5'UTR|RSPH10B_ENST00000441023.2_Missense_Mutation_p.G614A|RSPH10B_ENST00000337579.3_Missense_Mutation_p.G614A|RSPH10B_ENST00000539903.1_3'UTR|RSPH10B_ENST00000404406.1_Missense_Mutation_p.G614A			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	614										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		GCTGTCAATTCCATCATATAT	0.363																																						dbGAP											0													3.0	4.0	3.0					7																	5978378		451	880	1331	-	-	-	SO:0001583	missense	0				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.1841G>C	7.37:g.5978378C>G	ENSP00000385443:p.Gly614Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.G614A	ENST00000405415.1	37	c.1841	CCDS34598.1	7	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868333	0.51588	.	.	ENSG00000155026	ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	4.49	3.58	0.41010	.	0.406772	0.18585	U	0.136888	T	0.65069	0.2656	M	0.73598	2.24	0.80722	D	1	D;D;P	0.62365	0.991;0.982;0.775	P;P;B	0.51355	0.667;0.591;0.266	T	0.66488	-0.5911	10	0.49607	T	0.09	.	11.0489	0.47876	0.1864:0.8136:0.0:0.0	.	315;614;473	B7Z298;P0C881;F5GXE3	.;R10B1_HUMAN;.	A	614;614;614;473;614	ENSP00000385443:G614A;ENSP00000384097:G614A;ENSP00000338556:G614A;ENSP00000400988:G614A	ENSP00000338556:G614A	G	-	2	0	RSPH10B	5944904	0.133000	0.22466	0.176000	0.23000	0.904000	0.53231	2.616000	0.46376	0.986000	0.38683	0.448000	0.29417	GGA	RSPH10B	-	NULL	ENSG00000155026		0.363	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B	HGNC	protein_coding	OTTHUMT00000325465.2	17	0.00	0	C	NM_173565		5978378	5978378	-1	no_errors	ENST00000337579	ensembl	human	known	69_37n	missense	14	79.41	54	SNP	0.896	G
RYR1	6261	genome.wustl.edu	37	19	39018370	39018370	+	Silent	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr19:39018370G>A	ENST00000359596.3	+	73	10770	c.10770G>A	c.(10768-10770)gaG>gaA	p.E3590E	AC067969.1_ENST00000597015.1_RNA|RYR1_ENST00000360985.3_Silent_p.E3590E|RYR1_ENST00000355481.4_Silent_p.E3585E			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3590					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ATGACCCCGAGAAAATCGTGC	0.652																																						dbGAP											0													45.0	48.0	47.0					19																	39018370		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10770G>A	19.37:g.39018370G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E3590	ENST00000359596.3	37	c.10770	CCDS33011.1	19																																																																																			RYR1	-	NULL	ENSG00000196218		0.652	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	66	0.00	0	G			39018370	39018370	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	silent	66	10.81	8	SNP	1.000	A
SHROOM3	57619	genome.wustl.edu	37	4	77675780	77675780	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr4:77675780A>C	ENST00000296043.6	+	7	5097	c.4144A>C	c.(4144-4146)Acc>Ccc	p.T1382P	RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1382					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCCGCCCTACACCCCTGCCAT	0.632																																						dbGAP											0													46.0	44.0	44.0					4																	77675780		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.4144A>C	4.37:g.77675780A>C	ENSP00000296043:p.Thr1382Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T1382P	ENST00000296043.6	37	c.4144	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	A	13.89	2.372618	0.42003	.	.	ENSG00000138771	ENST00000296043	T	0.22743	1.94	4.96	-0.529	0.11901	.	2.684760	0.00960	N	0.003098	T	0.19927	0.0479	N	0.24115	0.695	0.09310	N	1	P	0.48911	0.917	P	0.49226	0.603	T	0.09443	-1.0674	10	0.39692	T	0.17	-8.7148	4.494	0.11828	0.6583:0.0:0.2076:0.1341	.	1382	Q8TF72	SHRM3_HUMAN	P	1382	ENSP00000296043:T1382P	ENSP00000296043:T1382P	T	+	1	0	SHROOM3	77894804	0.000000	0.05858	0.013000	0.15412	0.041000	0.13682	-0.067000	0.11579	-0.118000	0.11851	-0.480000	0.04831	ACC	SHROOM3	-	NULL	ENSG00000138771		0.632	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	56	0.00	0	A	NM_020859		77675780	77675780	+1	no_errors	ENST00000296043	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.018	C
SLC15A5	729025	genome.wustl.edu	37	12	16430303	16430303	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr12:16430303C>A	ENST00000344941.3	-	1	316	c.317G>T	c.(316-318)gGa>gTa	p.G106V		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	106					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						TTTGTTTCTTCCTAAATAGAC	0.373																																						dbGAP											0													68.0	61.0	63.0					12																	16430303		692	1590	2282	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.317G>T	12.37:g.16430303C>A	ENSP00000340402:p.Gly106Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.G106V	ENST00000344941.3	37	c.317		12	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370149	0.24771	.	.	ENSG00000188991	ENST00000344941	D	0.87491	-2.26	5.03	3.0	0.34707	.	.	.	.	.	D	0.91499	0.7316	M	0.82923	2.615	0.53005	D	0.999964	.	.	.	.	.	.	D	0.92017	0.5623	7	0.87932	D	0	.	10.9442	0.47292	0.0:0.7837:0.1353:0.081	.	.	.	.	V	106	ENSP00000340402:G106V	ENSP00000340402:G106V	G	-	2	0	SLC15A5	16321570	0.975000	0.34042	0.850000	0.33497	0.032000	0.12392	3.727000	0.54984	1.300000	0.44818	0.655000	0.94253	GGA	SLC15A5	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000188991		0.373	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	67	0.00	0	C	XM_001129090		16430303	16430303	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	116	41.12	81	SNP	0.978	A
SLC9B2	133308	genome.wustl.edu	37	4	103966075	103966075	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr4:103966075delA	ENST00000394785.3	-	8	1599	c.968delT	c.(967-969)ttcfs	p.F323fs	SLC9B2_ENST00000362026.3_Frame_Shift_Del_p.F323fs|SLC9B2_ENST00000503103.1_Frame_Shift_Del_p.F266fs|SLC9B2_ENST00000503230.1_Frame_Shift_Del_p.F266fs|SLC9B2_ENST00000339611.4_Frame_Shift_Del_p.F323fs	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2	323					ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)										GTACTGAATGAAAAATCCAAG	0.378																																						dbGAP											0													148.0	160.0	156.0					4																	103966075		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.968delT	4.37:g.103966075delA	ENSP00000378265:p.Phe323fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME52|Q6ZMD8|Q96D95	Frame_Shift_Del	DEL	pfam_Cation/H_exchanger	p.F323fs	ENST00000394785.3	37	c.968	CCDS3662.1	4																																																																																			SLC9B2	-	pfam_Cation/H_exchanger	ENSG00000164038		0.378	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9B2	HGNC	protein_coding	OTTHUMT00000253805.1	176	0.00	0	A	NM_178833		103966075	103966075	-1	no_errors	ENST00000362026	ensembl	human	known	69_37n	frame_shift_del	120	65.03	238	DEL	1.000	-
STAC2	342667	genome.wustl.edu	37	17	37371458	37371458	+	Silent	SNP	G	G	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr17:37371458G>T	ENST00000333461.5	-	5	981	c.612C>A	c.(610-612)gtC>gtA	p.V204V		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	204					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						GGGTCTCGTAGACAGGGTCCA	0.607																																						dbGAP											0													129.0	113.0	119.0					17																	37371458		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.612C>A	17.37:g.37371458G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA3	Missense_Mutation	SNP	NULL	p.S137Y	ENST00000333461.5	37	c.410	CCDS11335.1	17																																																																																			STAC2	-	NULL	ENSG00000141750		0.607	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC2	HGNC	protein_coding	OTTHUMT00000444533.2	171	0.58	1	G	NM_198993		37371458	37371458	-1	no_errors	ENST00000584501	ensembl	human	known	69_37n	missense	204	29.17	84	SNP	0.982	T
SMG8	55181	genome.wustl.edu	37	17	57287421	57287421	+	Silent	SNP	T	T	G	rs202093325		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr17:57287421T>G	ENST00000543872.2	+	2	273	c.9T>G	c.(7-9)ggT>ggG	p.G3G	SMG8_ENST00000580498.1_3'UTR|SMG8_ENST00000578922.1_Silent_p.G3G|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000300917.5_Silent_p.G3G			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	3					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						CTATGGCTGGTCCCGTGAGCT	0.577																																						dbGAP											0													28.0	33.0	31.0					17																	57287421		2202	4296	6498	-	-	-	SO:0001819	synonymous_variant	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.9T>G	17.37:g.57287421T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	pfam_Smg8/Smg9	p.G3	ENST00000543872.2	37	c.9	CCDS11615.1	17																																																																																			SMG8	-	NULL	ENSG00000167447		0.577	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	49	0.00	0	T	NM_018149		57287421	57287421	+1	no_errors	ENST00000300917	ensembl	human	known	69_37n	silent	24	57.63	34	SNP	0.977	G
STX5	6811	genome.wustl.edu	37	11	62574965	62574965	+	Silent	SNP	G	G	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr11:62574965G>T	ENST00000294179.3	-	11	1197	c.1044C>A	c.(1042-1044)atC>atA	p.I348I	NXF1_ENST00000531131.1_5'Flank|NXF1_ENST00000439713.2_5'Flank|NXF1_ENST00000531709.2_5'Flank|STX5_ENST00000541317.1_Silent_p.I252I|NXF1_ENST00000294172.2_5'Flank|RP11-727F15.13_ENST00000596971.1_RNA|STX5_ENST00000394690.1_Silent_p.I294I|STX5_ENST00000377897.4_3'UTR|NXF1_ENST00000532297.1_5'Flank	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	348					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)			breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						CCACAAAGATGATGAAGAAGA	0.527																																						dbGAP											0													188.0	158.0	168.0					11																	62574965		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.1044C>A	11.37:g.62574965G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.I348	ENST00000294179.3	37	c.1044	CCDS8038.2	11																																																																																			STX5	-	NULL	ENSG00000162236		0.527	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX5	HGNC	protein_coding	OTTHUMT00000290113.1	236	0.00	0	G	NM_003164		62574965	62574965	-1	no_errors	ENST00000294179	ensembl	human	known	69_37n	silent	479	16.26	93	SNP	1.000	T
TCF25	22980	genome.wustl.edu	37	16	89940218	89940218	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr16:89940218C>A	ENST00000263346.8	+	1	199	c.143C>A	c.(142-144)cCc>cAc	p.P48H		NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	48					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		GTCCGGCGTCCCGGGGGCGCA	0.701																																						dbGAP											0													12.0	17.0	15.0					16																	89940218		2176	4277	6453	-	-	-	SO:0001583	missense	0			AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.143C>A	16.37:g.89940218C>A	ENSP00000263346:p.Pro48His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2MK75|Q9UPV3	Missense_Mutation	SNP	pfam_TCF25	p.P48H	ENST00000263346.8	37	c.143	CCDS10987.1	16	.	.	.	.	.	.	.	.	.	.	c	12.09	1.832392	0.32421	.	.	ENSG00000141002	ENST00000263346;ENST00000310554	.	.	.	4.92	3.92	0.45320	.	0.328095	0.28262	N	0.015991	T	0.47414	0.1444	N	0.08118	0	0.48511	D	0.999661	D;B	0.65815	0.995;0.412	P;B	0.60415	0.874;0.237	T	0.51779	-0.8662	9	0.45353	T	0.12	.	13.1483	0.59474	0.0:0.839:0.161:0.0	.	48;48	B4DVF2;Q9BQ70	.;TCF25_HUMAN	H	48	.	ENSP00000263346:P48H	P	+	2	0	TCF25	88467719	0.012000	0.17670	0.978000	0.43139	0.051000	0.14879	0.270000	0.18607	2.572000	0.86782	0.457000	0.33378	CCC	TCF25	-	NULL	ENSG00000141002		0.701	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF25	HGNC	protein_coding	OTTHUMT00000272875.2	20	0.00	0	C	NM_014972		89940218	89940218	+1	no_errors	ENST00000263346	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	0.353	A
TP53	7157	genome.wustl.edu	37	17	7578445	7578445	+	Frame_Shift_Del	DEL	A	A	-	rs587780069		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr17:7578445delA	ENST00000269305.4	-	5	674	c.485delT	c.(484-486)atcfs	p.I162fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.I162fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.I162fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.I162fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.I162fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.I162fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	162	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> N (in a breast cancer with no family history; germline mutation and in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I162S(7)|p.I162N(6)|p.I162_Y163>N(3)|p.R156_I162delRVRAMAI(2)|p.V157_C176del20(1)|p.I30N(1)|p.I162_Y163delIY(1)|p.I69S(1)|p.P151_V173del23(1)|p.A161fs*7(1)|p.V157_I162delVRAMAI(1)|p.I162fs*19(1)|p.I69N(1)|p.I69_Y70>N(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.I30S(1)|p.I30_Y31>N(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCTTGTAGATGGCCATGGC	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	40	Substitution - Missense(17)|Whole gene deletion(8)|Deletion - In frame(7)|Complex - deletion inframe(5)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(8)|liver(6)|breast(6)|bone(4)|stomach(3)|lung(3)|central_nervous_system(2)|oesophagus(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|urinary_tract(1)|pancreas(1)	GRCh37	CM983887	TP53	M							53.0	54.0	54.0					17																	7578445		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.485delT	17.37:g.7578445delA	ENSP00000269305:p.Ile162fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I162fs	ENST00000269305.4	37	c.485	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	59	0.00	0	A	NM_000546		7578445	7578445	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	42	64.29	81	DEL	1.000	-
TRPC7	57113	genome.wustl.edu	37	5	135692614	135692614	+	Silent	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr5:135692614G>A	ENST00000513104.1	-	2	744	c.462C>T	c.(460-462)taC>taT	p.Y154Y	TRPC7_ENST00000355180.3_Silent_p.Y154Y|TRPC7_ENST00000426057.2_Silent_p.Y154Y	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	154					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CGTCCTCGTCGTAGGCATAGA	0.657																																						dbGAP											0													120.0	128.0	125.0					5																	135692614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.462C>T	5.37:g.135692614G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Nonsense_Mutation	SNP	pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC7_channel	p.R154*	ENST00000513104.1	37	c.460	CCDS47267.2	5	.	.	.	.	.	.	.	.	.	.	G	9.285	1.049220	0.19827	.	.	ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753	.	.	.	5.27	-4.74	0.03249	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.906	14.0496	0.64727	0.5701:0.0:0.4299:0.0	.	.	.	.	X	154	.	.	R	-	1	2	TRPC7	135720513	0.020000	0.18652	0.914000	0.36105	0.997000	0.91878	-1.019000	0.03622	-0.877000	0.04012	0.655000	0.94253	CGA	TRPC7	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000069018		0.657	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1	108	0.00	0	G	NM_020389		135692614	135692614	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000503275	ensembl	human	known	69_37n	nonsense	89	10.10	10	SNP	0.908	A
VPRBP	9730	genome.wustl.edu	37	3	51457513	51457513	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr3:51457513T>C	ENST00000335891.5	-	7	1573	c.1564A>G	c.(1564-1566)Aaa>Gaa	p.K522E				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	971					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		ACTCTGATTTTCCTGCCATTG	0.532																																						dbGAP											0													142.0	141.0	142.0					3																	51457513		1928	4149	6077	-	-	-	SO:0001583	missense	0			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.1564A>G	3.37:g.51457513T>C	ENSP00000338857:p.Lys522Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.K522E	ENST00000335891.5	37	c.1564		3	.	.	.	.	.	.	.	.	.	.	T	10.02	1.236585	0.22711	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.55760	0.51;0.5	5.92	5.92	0.95590	.	0.042795	0.85682	D	0.000000	T	0.41511	0.1162	L	0.36672	1.1	0.58432	D	0.999996	B	0.32507	0.373	B	0.30572	0.117	T	0.30822	-0.9965	10	0.08381	T	0.77	-17.6256	16.3648	0.83312	0.0:0.0:0.0:1.0	.	971	Q9Y4B6	VPRBP_HUMAN	E	542;522	ENSP00000393183:K542E;ENSP00000338857:K522E	ENSP00000338857:K522E	K	-	1	0	VPRBP	51432553	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.362000	0.79507	2.263000	0.75096	0.533000	0.62120	AAA	VPRBP	-	superfamily_ARM-type_fold	ENSG00000145041		0.532	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding		238	0.42	1	T	NM_014703		51457513	51457513	-1	no_errors	ENST00000335891	ensembl	human	known	69_37n	missense	262	17.03	54	SNP	1.000	C
VPS28	51160	genome.wustl.edu	37	8	145649456	145649456	+	Silent	SNP	G	G	A	rs199666552		TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr8:145649456G>A	ENST00000526054.1	-	8	553	c.516C>T	c.(514-516)ccC>ccT	p.P172P	VPS28_ENST00000529182.1_Silent_p.P172P|VPS28_ENST00000292510.4_Silent_p.P172P|VPS28_ENST00000526734.1_5'Flank|VPS28_ENST00000377348.2_Silent_p.P172P			Q9UK41	VPS28_HUMAN	vacuolar protein sorting 28 homolog (S. cerevisiae)	172	VPS28 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00642}.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|negative regulation of protein ubiquitination (GO:0031397)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCTCAAAGTCGGGTGGGAGGT	0.701																																						dbGAP											0													50.0	56.0	54.0					8																	145649456		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF316887	CCDS6425.1, CCDS34967.1	8q24.3	2014-08-12	2006-04-04		ENSG00000160948	ENSG00000160948			18178	protein-coding gene	gene with protein product		611952	"""vacuolar protein sorting 28 (yeast)"""				Standard	NM_183057		Approved		uc003zct.1	Q9UK41	OTTHUMG00000165209	ENST00000526054.1:c.516C>T	8.37:g.145649456G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VK0	Silent	SNP	pfam_VPS28,pirsf_VPS28	p.P172	ENST00000526054.1	37	c.516	CCDS6425.1	8																																																																																			VPS28	-	pfam_VPS28,pirsf_VPS28	ENSG00000160948		0.701	VPS28-003	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS28	HGNC	protein_coding	OTTHUMT00000382694.1	46	0.00	0	G			145649456	145649456	-1	no_errors	ENST00000377348	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	0.091	A
VPS51	738	genome.wustl.edu	37	11	64875774	64875774	+	Silent	SNP	C	C	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr11:64875774C>T	ENST00000279281.3	+	5	923	c.831C>T	c.(829-831)cgC>cgT	p.R277R	VPS51_ENST00000527646.1_3'UTR|AP003068.9_ENST00000528887.1_RNA	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	277					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CGCACGCCCGCGGCCGGCTGG	0.706																																						dbGAP											0													9.0	11.0	10.0					11																	64875774		2177	4248	6425	-	-	-	SO:0001819	synonymous_variant	0			AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.831C>T	11.37:g.64875774C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Silent	SNP	pfam_Vps51,pfam_Dor1,pfam_Vacuolar_sorting-assoc_54,pfam_COG_su2_N,pfam_RZZ-complex_Zw10,superfamily_Cullin_repeat-like_dom	p.R277	ENST00000279281.3	37	c.831	CCDS8093.1	11																																																																																			VPS51	-	superfamily_Cullin_repeat-like_dom	ENSG00000149823		0.706	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS51	HGNC	protein_coding	OTTHUMT00000385217.1	17	0.00	0	C	NM_013265		64875774	64875774	+1	no_errors	ENST00000279281	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	0.071	T
ZFP64	55734	genome.wustl.edu	37	20	50701502	50701502	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr20:50701502C>T	ENST00000361387.2	-	9	1592	c.1532G>A	c.(1531-1533)cGc>cAc	p.R511H	ZFP64_ENST00000371523.4_Missense_Mutation_p.R292H|ZFP64_ENST00000371518.2_Intron	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GCTGTGCACGCGCAGGGCGGC	0.657																																						dbGAP											0													56.0	56.0	56.0					20																	50701502		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1532G>A	20.37:g.50701502C>T	ENSP00000355179:p.Arg511His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R511H	ENST00000361387.2	37	c.1532	CCDS13439.1	20	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155235	0.57259	.	.	ENSG00000020256	ENST00000371523;ENST00000361387	T;T	0.22539	1.95;1.95	4.5	3.55	0.40652	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34745	0.0908	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.966	T	0.09975	-1.0650	9	0.30854	T	0.27	.	4.1129	0.10067	0.0:0.6864:0.0:0.3136	.	511;292	Q9NTW7;Q9NTW7-2	ZF64B_HUMAN;.	H	292;511	ENSP00000360578:R292H;ENSP00000355179:R511H	ENSP00000355179:R511H	R	-	2	0	ZFP64	50134909	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	3.110000	0.50352	2.487000	0.83934	0.655000	0.94253	CGC	ZFP64	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000020256		0.657	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079743.2	47	0.00	0	C	NM_018197		50701502	50701502	-1	no_errors	ENST00000361387	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	0.996	T
ZNF114	163071	genome.wustl.edu	37	19	48785718	48785718	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YE-01A-11D-A10G-09	TCGA-A2-A0YE-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3a4ca2a3-9918-465b-823f-403419bd9740	55851e9c-80b4-4bde-a645-c29a84f61a20	g.chr19:48785718G>A	ENST00000595607.1	+	5	594	c.100G>A	c.(100-102)Gtg>Atg	p.V34M	ZNF114_ENST00000315849.1_Missense_Mutation_p.V34M|ZNF114_ENST00000597695.1_5'UTR|ZNF114_ENST00000600687.1_Missense_Mutation_p.V34M			Q8NC26	ZN114_HUMAN	zinc finger protein 114	34	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		CTACAGAGACGTGATGCTGGA	0.522																																						dbGAP											0													119.0	122.0	121.0					19																	48785718		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.100G>A	19.37:g.48785718G>A	ENSP00000469998:p.Val34Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B0|Q08AQ6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V34M	ENST00000595607.1	37	c.100	CCDS12713.1	19	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487423	0.44249	.	.	ENSG00000178150	ENST00000315849	T	0.04015	3.73	2.26	1.21	0.21127	Krueppel-associated box (4);	.	.	.	.	T	0.16685	0.0401	M	0.83774	2.66	0.22489	N	0.999054	D	0.76494	0.999	P	0.61800	0.894	T	0.04467	-1.0949	9	0.66056	D	0.02	.	6.9104	0.24333	0.1539:0.0:0.8461:0.0	.	34	Q8NC26	ZN114_HUMAN	M	34	ENSP00000318898:V34M	ENSP00000318898:V34M	V	+	1	0	ZNF114	53477530	0.613000	0.27009	0.242000	0.24170	0.202000	0.24057	0.693000	0.25497	0.524000	0.28502	0.205000	0.17691	GTG	ZNF114	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000178150		0.522	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF114	HGNC	protein_coding	OTTHUMT00000465601.1	87	0.00	0	G	NM_153608		48785718	48785718	+1	no_errors	ENST00000315849	ensembl	human	known	69_37n	missense	85	51.70	91	SNP	0.670	A
