#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCF2	10061	genome.wustl.edu	37	7	150916218	150916219	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr7:150916218_150916219insC	ENST00000287844.2	-	8	1057_1058	c.948_949insG	c.(946-951)acgcggfs	p.R317fs	ABCF2_ENST00000222388.2_Frame_Shift_Ins_p.R317fs|ABCF2_ENST00000473874.1_5'UTR	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	317	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)	p.R317W(1)|p.R317fs*63(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCTCTAGCCGCGTCTTCACGT	0.495																																						dbGAP											2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.949dupG	7.37:g.150916219_150916219dupC	ENSP00000287844:p.Arg317fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60864|Q75MJ0|Q75MJ1|Q96TE8	Frame_Shift_Ins	INS	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R316fs	ENST00000287844.2	37	c.949_948	CCDS5923.1	7																																																																																			ABCF2	-	pfscan_ABC_transporter-like	ENSG00000033050		0.495	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	43	0.00	0	-	NM_005692		150916218	150916219	-1	no_errors	ENST00000222388	ensembl	human	known	69_37n	frame_shift_ins	144	12.73	21	INS	0.995:0.690	C
ADAMTS5	11096	genome.wustl.edu	37	21	28302261	28302261	+	Silent	SNP	T	T	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr21:28302261T>C	ENST00000284987.5	-	7	2290	c.2169A>G	c.(2167-2169)gtA>gtG	p.V723V	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	723	Cys-rich.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V723V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CTCCTCCACATACTCCGCACT	0.443																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	dbGAP											1	Substitution - coding silent(1)	breast(1)											203.0	181.0	189.0					21																	28302261		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2169A>G	21.37:g.28302261T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LV4|Q9UKP2	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS5,prints_Peptidase_M12B_ADAM-TS	p.V723	ENST00000284987.5	37	c.2169	CCDS13579.1	21																																																																																			ADAMTS5	-	prints_Peptidase_M12B_ADAM-TS	ENSG00000154736		0.443	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS5	HGNC	protein_coding	OTTHUMT00000171648.1	53	0.00	0	T			28302261	28302261	-1	no_errors	ENST00000284987	ensembl	human	known	69_37n	silent	139	12.58	20	SNP	0.009	C
APCDD1	147495	genome.wustl.edu	37	18	10471922	10471922	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr18:10471922G>A	ENST00000355285.5	+	3	992	c.638G>A	c.(637-639)cGg>cAg	p.R213Q	APCDD1_ENST00000578882.1_Intron	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1									p.R213Q(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		CAGCTCATCCGGGTGGAGAAG	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	125.0	129.0					18																	10471922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.638G>A	18.37:g.10471922G>A	ENSP00000347433:p.Arg213Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R213Q	ENST00000355285.5	37	c.638	CCDS11849.1	18	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496936	0.85069	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.23950	1.88	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.54838	0.1883	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.59726	-0.7400	10	0.87932	D	0	-42.7887	18.945	0.92618	0.0:0.0:1.0:0.0	.	213	Q8J025	APCD1_HUMAN	Q	213;264	ENSP00000347433:R213Q	ENSP00000347433:R213Q	R	+	2	0	APCDD1	10461922	1.000000	0.71417	0.983000	0.44433	0.616000	0.37450	9.403000	0.97302	2.477000	0.83638	0.655000	0.94253	CGG	APCDD1	-	NULL	ENSG00000154856		0.577	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APCDD1	HGNC	protein_coding	OTTHUMT00000254529.2	9	0.00	0	G	NM_153000		10471922	10471922	+1	no_errors	ENST00000355285	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	1.000	A
ARHGEF10L	55160	genome.wustl.edu	37	1	17958870	17958870	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr1:17958870G>T	ENST00000361221.3	+	16	1798	c.1639G>T	c.(1639-1641)Gtg>Ttg	p.V547L	ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.V508L|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.V508L|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.V305L|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.V255L|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.V547L|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.V325L	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	547						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V547L(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GACGGAGACCGTGTACGGTGA	0.602																																						dbGAP											2	Substitution - Missense(2)	breast(2)											108.0	107.0	107.0					1																	17958870		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1639G>T	1.37:g.17958870G>T	ENSP00000355060:p.Val547Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.V547L	ENST00000361221.3	37	c.1639	CCDS182.1	1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447244	0.43429	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29;2.29	5.44	5.44	0.79542	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	M	0.77486	2.375	0.58432	D	0.999992	D;B;D;D;D;D;P;D	0.59767	0.976;0.084;0.986;0.966;0.976;0.976;0.94;0.957	P;B;P;P;P;P;P;P	0.62740	0.77;0.062;0.906;0.792;0.77;0.837;0.792;0.687	T	0.17137	-1.0379	10	0.39692	T	0.17	-14.2909	17.8089	0.88609	0.0:0.0:1.0:0.0	.	325;305;547;255;313;508;508;547	Q5VXI4;B4DTE2;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;.;ARGAL_HUMAN	L	547;508;547;508;305;325;325;255	ENSP00000355060:V547L;ENSP00000399401:V508L;ENSP00000394621:V547L;ENSP00000364564:V508L;ENSP00000364569:V305L;ENSP00000364557:V325L;ENSP00000167825:V255L	ENSP00000167825:V255L	V	+	1	0	ARHGEF10L	17831457	1.000000	0.71417	0.992000	0.48379	0.075000	0.17131	9.357000	0.97099	2.545000	0.85829	0.561000	0.74099	GTG	ARHGEF10L	-	NULL	ENSG00000074964		0.602	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	ARHGEF10L	HGNC	protein_coding	OTTHUMT00000007147.1	8	0.00	0	G	NM_018125		17958870	17958870	+1	no_errors	ENST00000361221	ensembl	human	known	69_37n	missense	37	24.00	12	SNP	1.000	T
ARHGEF15	22899	genome.wustl.edu	37	17	8219162	8219162	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr17:8219162T>A	ENST00000361926.3	+	8	1621	c.1511T>A	c.(1510-1512)tTc>tAc	p.F504Y	AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Missense_Mutation_p.F504Y	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	504	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.F504Y(1)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GTGGGGCCTTTCTCGGTGTAT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	76.0	77.0					17																	8219162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1511T>A	17.37:g.8219162T>A	ENSP00000355026:p.Phe504Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.F504Y	ENST00000361926.3	37	c.1511	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	t	22.0	4.228176	0.79576	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.36157	1.27;1.27	4.94	4.94	0.65067	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.64627	0.2615	M	0.89214	3.015	0.48632	D	0.999684	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.71467	-0.4584	10	0.66056	D	0.02	-29.4706	12.5944	0.56461	0.0:0.0:0.0:1.0	.	504;504	D3DTR7;O94989	.;ARHGF_HUMAN	Y	504;294;504	ENSP00000355026:F504Y;ENSP00000412505:F504Y	ENSP00000355026:F504Y	F	+	2	0	ARHGEF15	8159887	1.000000	0.71417	0.994000	0.49952	0.794000	0.44872	4.561000	0.60809	2.086000	0.62901	0.459000	0.35465	TTC	ARHGEF15	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000198844		0.582	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	37	0.00	0	T	NM_173728		8219162	8219162	+1	no_errors	ENST00000361926	ensembl	human	known	69_37n	missense	146	12.05	20	SNP	1.000	A
CCDC141	285025	genome.wustl.edu	37	2	179702153	179702153	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr2:179702153C>G	ENST00000420890.2	-	23	3910	c.3793G>C	c.(3793-3795)Gtt>Ctt	p.V1265L	CCDC141_ENST00000295723.5_Missense_Mutation_p.V690L|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1265								p.V690L(1)|p.V1265L(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GGTGGAAGAACAGATTCCTGG	0.532																																						dbGAP											2	Substitution - Missense(2)	breast(2)											72.0	74.0	74.0					2																	179702153		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3793G>C	2.37:g.179702153C>G	ENSP00000395995:p.Val1265Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V1265L	ENST00000420890.2	37	c.3793		2	.	.	.	.	.	.	.	.	.	.	C	11.73	1.724636	0.30593	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.44083	0.93;1.54;1.54	5.71	3.54	0.40534	.	0.984609	0.08280	N	0.970050	T	0.27241	0.0668	N	0.14661	0.345	0.09310	N	1	B;B	0.29301	0.241;0.11	B;B	0.25140	0.058;0.04	T	0.19257	-1.0311	10	0.51188	T	0.08	1.1363	8.9373	0.35708	0.0:0.7617:0.1411:0.0972	.	690;690	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	L	1265;709;690	ENSP00000395995:V1265L;ENSP00000344627:V709L;ENSP00000295723:V690L	ENSP00000295723:V690L	V	-	1	0	CCDC141	179410398	0.872000	0.30054	0.327000	0.25402	0.985000	0.73830	1.872000	0.39549	1.150000	0.42419	0.650000	0.86243	GTT	CCDC141	-	NULL	ENSG00000163492		0.532	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		24	0.00	0	C	NM_173648		179702153	179702153	-1	no_errors	ENST00000420890	ensembl	human	known	69_37n	missense	79	16.84	16	SNP	0.179	G
CCR2	729230	genome.wustl.edu	37	3	46399864	46399864	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr3:46399864A>T	ENST00000400888.2	+	1	885	c.846A>T	c.(844-846)caA>caT	p.Q282H	CCR2_ENST00000292301.4_Missense_Mutation_p.Q282H|CCR2_ENST00000465202.1_3'UTR|CCR2_ENST00000445132.2_Missense_Mutation_p.Q282H			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	282					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)	p.Q282H(2)		breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		GCACCAGTCAACTGGACCAAG	0.468																																						dbGAP											2	Substitution - Missense(2)	breast(2)											165.0	150.0	154.0					3																	46399864		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.846A>T	3.37:g.46399864A>T	ENSP00000383681:p.Gln282His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR2	p.Q282H	ENST00000400888.2	37	c.846	CCDS43078.1	3	.	.	.	.	.	.	.	.	.	.	A	5.037	0.192507	0.09599	.	.	ENSG00000121807	ENST00000445132;ENST00000292301;ENST00000400888	T;T;T	0.72051	1.32;-0.62;-0.62	4.95	-4.29	0.03721	GPCR, rhodopsin-like superfamily (1);	1.379400	0.04815	N	0.435940	T	0.51805	0.1696	L	0.31120	0.905	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.20577	0.03;0.009	T	0.21965	-1.0230	10	0.25106	T	0.35	.	2.4143	0.04432	0.3701:0.3101:0.22:0.0997	.	282;282	P41597;Q4VBL2	CCR2_HUMAN;.	H	282	ENSP00000399285:Q282H;ENSP00000292301:Q282H;ENSP00000383681:Q282H	ENSP00000292301:Q282H	Q	+	3	2	CCR2	46374868	0.000000	0.05858	0.002000	0.10522	0.028000	0.11728	-1.333000	0.02667	-0.818000	0.04329	0.477000	0.44152	CAA	CCR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000121807		0.468	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCR2	HGNC	protein_coding	OTTHUMT00000344292.1	37	0.00	0	A	NM_000647		46399864	46399864	+1	no_errors	ENST00000292301	ensembl	human	known	69_37n	missense	120	14.89	21	SNP	0.000	T
CELSR2	1952	genome.wustl.edu	37	1	109794101	109794101	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr1:109794101C>T	ENST00000271332.3	+	1	1461	c.1400C>T	c.(1399-1401)aCc>aTc	p.T467I		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	467	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.T467I(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TATGAGACGACCAAGGAGTAC	0.547																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											1	Substitution - Missense(1)	breast(1)											171.0	167.0	168.0					1																	109794101		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1400C>T	1.37:g.109794101C>T	ENSP00000271332:p.Thr467Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.T467I	ENST00000271332.3	37	c.1400	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	N	4.021	0.001380	0.07819	.	.	ENSG00000143126	ENST00000271332	T	0.01767	4.65	4.82	3.89	0.44902	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00580	0.0019	N	0.25380	0.74	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.48364	-0.9042	9	0.36615	T	0.2	.	7.5076	0.27553	0.384:0.5378:0.0:0.0782	.	467	Q9HCU4	CELR2_HUMAN	I	467	ENSP00000271332:T467I	ENSP00000271332:T467I	T	+	2	0	CELSR2	109595624	0.077000	0.21312	0.978000	0.43139	0.907000	0.53573	0.199000	0.17237	1.251000	0.43983	0.555000	0.69702	ACC	CELSR2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000143126		0.547	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	12	0.00	0	C	NM_001408		109794101	109794101	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.126	T
CLEC17A	388512	genome.wustl.edu	37	19	14705309	14705309	+	Intron	SNP	C	C	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr19:14705309C>T	ENST00000417570.1	+	5	315				CLEC17A_ENST00000397439.2_Silent_p.T69T|CLEC17A_ENST00000547437.1_Intron	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A							cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										CAGCCCTCACCCTGAGCTTCT	0.572																																						dbGAP											0													46.0	46.0	46.0					19																	14705309		1979	4146	6125	-	-	-	SO:0001627	intron_variant	0			AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.278-20C>T	19.37:g.14705309C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX68|B2RTX0|B7ZMM4	Silent	SNP	superfamily_C-type_lectin_fold	p.T69	ENST00000417570.1	37	c.207	CCDS56087.1	19																																																																																			CLEC17A	-	NULL	ENSG00000187912		0.572	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC17A	HGNC	protein_coding	OTTHUMT00000403400.1	55	0.00	0	C	NM_207390		14705309	14705309	+1	no_errors	ENST00000397439	ensembl	human	known	69_37n	silent	117	17.02	24	SNP	0.000	T
COL6A6	131873	genome.wustl.edu	37	3	130327755	130327755	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr3:130327755G>C	ENST00000358511.6	+	21	4730	c.4699G>C	c.(4699-4701)Ggc>Cgc	p.G1567R	COL6A6_ENST00000453409.2_Missense_Mutation_p.G1567R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1567	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G1567R(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGGAACAGCAGGCATCCCAGG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	62.0	61.0					3																	130327755		2028	4198	6226	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4699G>C	3.37:g.130327755G>C	ENSP00000351310:p.Gly1567Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G1567R	ENST00000358511.6	37	c.4699	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395147	0.62066	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.99637	-6.29;-6.29	5.12	5.12	0.69794	.	.	.	.	.	D	0.99806	0.9916	H	0.98646	4.29	0.31235	N	0.695886	D	0.89917	1.0	D	0.91635	0.999	D	0.96901	0.9660	9	0.87932	D	0	.	14.403	0.67063	0.0:0.0:1.0:0.0	.	1567	A6NMZ7	CO6A6_HUMAN	R	1567	ENSP00000351310:G1567R;ENSP00000399236:G1567R	ENSP00000351310:G1567R	G	+	1	0	COL6A6	131810445	0.988000	0.35896	0.323000	0.25347	0.027000	0.11550	4.342000	0.59341	2.522000	0.85027	0.650000	0.86243	GGC	COL6A6	-	NULL	ENSG00000206384		0.443	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	39	0.00	0	G	NM_001102608		130327755	130327755	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	74	13.95	12	SNP	0.545	C
DDX11	1663	genome.wustl.edu	37	12	31242861	31242861	+	Silent	SNP	A	A	C	rs200751040|rs531309221	byFrequency	TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr12:31242861A>C	ENST00000407793.2	+	9	1173	c.922A>C	c.(922-924)Agg>Cgg	p.R308R	DDX11_ENST00000350437.4_Silent_p.R308R|DDX11_ENST00000542838.1_Silent_p.R308R|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_Silent_p.R282R|DDX11_ENST00000545668.1_Silent_p.R308R	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	308	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R308R(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AAAGAGGAGGAGGCAGGAGAA	0.587										Multiple Myeloma(12;0.14)				29	0.00579073	0.0038	0.0043	5008	,	,		20906	0.0099		0.007	False		,,,				2504	0.0041					dbGAP											2	Substitution - coding silent(2)	kidney(2)											5.0	7.0	6.0					12																	31242861		2036	4038	6074	-	-	-	SO:0001819	synonymous_variant	0			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.922A>C	12.37:g.31242861A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.R308	ENST00000407793.2	37	c.922	CCDS44856.1	12																																																																																			DDX11	-	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000013573		0.587	DDX11-202	KNOWN	basic|CCDS	protein_coding	DDX11	HGNC	protein_coding	OTTHUMT00000399728.1	38	0.00	0	A	NM_030653		31242861	31242861	+1	no_errors	ENST00000407793	ensembl	human	known	69_37n	silent	109	19.26	26	SNP	0.001	C
DLGAP4	22839	genome.wustl.edu	37	20	35128703	35128703	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr20:35128703C>T	ENST00000373907.2	+	9	2400	c.2201C>T	c.(2200-2202)cCg>cTg	p.P734L	DLGAP4_ENST00000339266.5_Missense_Mutation_p.P734L|DLGAP4_ENST00000373913.3_Missense_Mutation_p.P731L|DLGAP4_ENST00000340491.4_Missense_Mutation_p.P195L|DLGAP4_ENST00000475894.1_3'UTR|DLGAP4_ENST00000401952.2_Missense_Mutation_p.P731L			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	734					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)		p.P731L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				AGGAGCCTCCCGGACTGTACC	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	83.0	86.0					20																	35128703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.2201C>T	20.37:g.35128703C>T	ENSP00000363014:p.Pro734Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	pfam_GKAP	p.P734L	ENST00000373907.2	37	c.2201		20	.	.	.	.	.	.	.	.	.	.	C	10.78	1.446953	0.25987	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266;ENST00000340491	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.24	5.24	0.73138	.	0.486738	0.22832	N	0.055087	T	0.27798	0.0684	N	0.22421	0.69	0.53688	D	0.999972	P;B;D;P	0.53151	0.876;0.446;0.958;0.839	B;B;B;B	0.35655	0.187;0.065;0.207;0.172	T	0.07654	-1.0761	10	0.26408	T	0.33	.	17.8287	0.88674	0.0:1.0:0.0:0.0	.	40;195;734;731	F8WF49;Q9Y2H0-3;Q9Y2H0;Q9Y2H0-1	.;.;DLGP4_HUMAN;.	L	731;731;734;734;195	ENSP00000363023:P731L;ENSP00000384954:P731L;ENSP00000363014:P734L;ENSP00000341633:P734L;ENSP00000345700:P195L	ENSP00000341633:P734L	P	+	2	0	DLGAP4	34562117	0.999000	0.42202	0.962000	0.40283	0.959000	0.62525	4.435000	0.59941	2.448000	0.82819	0.650000	0.86243	CCG	DLGAP4	-	pfam_GKAP	ENSG00000080845		0.592	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	23	0.00	0	C	NM_014902		35128703	35128703	+1	no_errors	ENST00000339266	ensembl	human	known	69_37n	missense	94	16.81	19	SNP	0.992	T
DNAH14	127602	genome.wustl.edu	37	1	225266935	225266935	+	Silent	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr1:225266935G>A	ENST00000445597.2	+	14	2253	c.2253G>A	c.(2251-2253)ctG>ctA	p.L751L	DNAH14_ENST00000430092.1_Silent_p.L817L|DNAH14_ENST00000439375.2_Silent_p.L817L			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	751					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.L817L(1)|p.L751L(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TGCAGCAGCTGGAATGTGATC	0.289																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											43.0	39.0	40.0					1																	225266935		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.2253G>A	1.37:g.225266935G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.L817	ENST00000445597.2	37	c.2451		1																																																																																			DNAH14	-	NULL	ENSG00000185842		0.289	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	40	0.00	0	G	XM_059166		225266935	225266935	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	silent	38	57.30	51	SNP	0.092	A
DSCAML1	57453	genome.wustl.edu	37	11	117376409	117376409	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr11:117376409A>G	ENST00000321322.6	-	9	2003	c.2002T>C	c.(2002-2004)Tcc>Ccc	p.S668P	DSCAML1_ENST00000527706.1_Missense_Mutation_p.S398P	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	608	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.S668P(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGCCGATGGAGGCGGGTGGG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	61.0	65.0					11																	117376409		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2002T>C	11.37:g.117376409A>G	ENSP00000315465:p.Ser668Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S668P	ENST00000321322.6	37	c.2002	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128661	0.77549	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.69435	-0.4;-0.4	5.06	5.06	0.68205	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	.	.	.	.	T	0.68210	0.2976	N	0.13198	0.31	0.58432	D	0.999999	D	0.61080	0.989	D	0.71656	0.974	T	0.72893	-0.4154	9	0.52906	T	0.07	.	14.9676	0.71208	1.0:0.0:0.0:0.0	.	608	Q8TD84	DSCL1_HUMAN	P	398;668;375	ENSP00000434335:S398P;ENSP00000315465:S668P	ENSP00000315465:S668P	S	-	1	0	DSCAML1	116881619	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.136000	0.77285	2.118000	0.64928	0.402000	0.26972	TCC	DSCAML1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000177103		0.632	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	19	0.00	0	A	NM_020693		117376409	117376409	-1	no_errors	ENST00000321322	ensembl	human	known	69_37n	missense	73	22.11	21	SNP	1.000	G
DYNC1H1	1778	genome.wustl.edu	37	14	102514950	102514950	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr14:102514950A>G	ENST00000360184.4	+	74	13480	c.13316A>G	c.(13315-13317)gAa>gGa	p.E4439G	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4439					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.E4439G(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CAGGTGTGCGAAGGAAAGAAG	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	83.0	90.0					14																	102514950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.13316A>G	14.37:g.102514950A>G	ENSP00000348965:p.Glu4439Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.E4439G	ENST00000360184.4	37	c.13316	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	A	16.42	3.117012	0.56505	.	.	ENSG00000197102	ENST00000360184	T	0.09163	3.01	5.52	5.52	0.82312	Dynein heavy chain (1);	0.165036	0.52532	D	0.000080	T	0.15392	0.0371	L	0.40543	1.245	0.53005	D	0.999964	B	0.26147	0.143	B	0.37198	0.243	T	0.04294	-1.0962	10	0.62326	D	0.03	.	15.632	0.76917	1.0:0.0:0.0:0.0	.	4439	Q14204	DYHC1_HUMAN	G	4439	ENSP00000348965:E4439G	ENSP00000348965:E4439G	E	+	2	0	DYNC1H1	101584703	1.000000	0.71417	0.990000	0.47175	0.838000	0.47535	7.365000	0.79537	2.085000	0.62840	0.460000	0.39030	GAA	DYNC1H1	-	pfam_Dynein_heavy	ENSG00000197102		0.552	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	18	0.00	0	A	NM_001376		102514950	102514950	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	missense	69	14.81	12	SNP	1.000	G
EIF4ENIF1	56478	genome.wustl.edu	37	22	31836773	31836773	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr22:31836773G>C	ENST00000397525.1	-	18	2856	c.2633C>G	c.(2632-2634)cCt>cGt	p.P878R	EIF4ENIF1_ENST00000441289.1_5'Flank|EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.P704R|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.P878R|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.P854R|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.P533R	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	878						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.P878R(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						ACTAGCAGCAGGTAAAGGGTA	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	118.0	122.0					22																	31836773		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2633C>G	22.37:g.31836773G>C	ENSP00000380659:p.Pro878Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	pfam_eIF4E_transporter	p.P878R	ENST00000397525.1	37	c.2633	CCDS13898.1	22	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795135	0.50208	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180	.	.	.	5.89	5.89	0.94794	.	0.252210	0.46442	D	0.000293	T	0.49372	0.1553	L	0.44542	1.39	0.33426	D	0.58051	P;P;B;B	0.38250	0.624;0.624;0.178;0.232	B;B;B;B	0.35607	0.206;0.206;0.206;0.147	T	0.64071	-0.6493	9	0.72032	D	0.01	-10.1375	19.2356	0.93858	0.0:0.0:1.0:0.0	.	704;878;703;854	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	R	704;878;878;854;533	.	ENSP00000328103:P878R	P	-	2	0	EIF4ENIF1	30166773	1.000000	0.71417	0.721000	0.30653	0.998000	0.95712	5.346000	0.65992	2.763000	0.94921	0.655000	0.94253	CCT	EIF4ENIF1	-	NULL	ENSG00000184708		0.522	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	HGNC	protein_coding	OTTHUMT00000127926.1	57	0.00	0	G	NM_019843		31836773	31836773	-1	no_errors	ENST00000330125	ensembl	human	known	69_37n	missense	93	50.79	96	SNP	0.774	C
ERV3-1	2086	genome.wustl.edu	37	7	64452362	64452362	+	Missense_Mutation	SNP	C	C	G	rs140714007	byFrequency	TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr7:64452362C>G	ENST00000394323.2	-	2	1543	c.1043G>C	c.(1042-1044)cGc>cCc	p.R348P	ZNF117_ENST00000282869.6_5'Flank	NM_001007253.3	NP_001007254.2	Q14264	ENR1_HUMAN	endogenous retrovirus group 3, member 1	348						extracellular vesicular exosome (GO:0070062)|viral envelope (GO:0019031)		p.R348P(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)	16						ctttccccagcgagcaataca	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	79.0	81.0					7																	64452362		1865	4094	5959	-	-	-	SO:0001583	missense	0			AK295189	CCDS47595.1	7p12-q11	2014-05-02	2011-05-05	2011-05-05	ENSG00000213462	ENSG00000213462			3454	other	endogenous retrovirus		131170	"""endogenous retroviral sequence 3 (includes zinc finger protein H-plk/HPF9)"", ""endogenous retroviral sequence 3"""	ERV3		2115127, 6495650, 21542922	Standard	NM_001007253		Approved	H-PLK, HERV-R, ERV-R, envR	uc011kdr.2	Q14264	OTTHUMG00000165023	ENST00000394323.2:c.1043G>C	7.37:g.64452362C>G	ENSP00000391594:p.Arg348Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R348P	ENST00000394323.2	37	c.1043	CCDS47595.1	7	.	.	.	.	.	.	.	.	.	.	.	16.55	3.155081	0.57259	.	.	ENSG00000213462	ENST00000394323	T	0.24538	1.85	0.109	0.109	0.14578	.	.	.	.	.	T	0.14960	0.0361	N	0.08118	0	0.22171	N	0.999311	D	0.63880	0.993	P	0.49387	0.609	T	0.18461	-1.0336	8	0.27785	T	0.31	.	.	.	.	.	348	Q14264	ENR1_HUMAN	P	348	ENSP00000391594:R348P	ENSP00000391594:R348P	R	-	2	0	ERV3-1	64089797	0.955000	0.32602	0.878000	0.34440	0.879000	0.50718	0.195000	0.17155	0.181000	0.19994	0.184000	0.17185	CGC	ERV3-1	-	NULL	ENSG00000213462		0.443	ERV3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERV3-1	HGNC	protein_coding	OTTHUMT00000381468.1	82	0.00	0	C	NM_001007253		64452362	64452362	-1	no_errors	ENST00000394323	ensembl	human	known	69_37n	missense	238	29.59	100	SNP	0.901	G
FAM155A	728215	genome.wustl.edu	37	13	108518036	108518036	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr13:108518036G>T	ENST00000375915.2	-	1	1047	c.909C>A	c.(907-909)gaC>gaA	p.D303E		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	303						integral component of membrane (GO:0016021)		p.D303E(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CTACCTTACAGTCTTCAGGAC	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	93.0	91.0					13																	108518036		2203	4300	6503	-	-	-	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.909C>A	13.37:g.108518036G>T	ENSP00000365080:p.Asp303Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.D303E	ENST00000375915.2	37	c.909	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	G	0.780	-0.762818	0.02996	.	.	ENSG00000204442	ENST00000375915	T	0.11604	2.76	5.68	4.83	0.62350	.	0.183764	0.45606	D	0.000349	T	0.04452	0.0122	N	0.08118	0	0.28364	N	0.92031	B	0.26975	0.165	B	0.26416	0.069	T	0.38265	-0.9669	10	0.12430	T	0.62	.	6.0102	0.19571	0.1461:0.0:0.6925:0.1614	.	303	B1AL88	F155A_HUMAN	E	303	ENSP00000365080:D303E	ENSP00000365080:D303E	D	-	3	2	FAM155A	107316037	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	0.657000	0.24963	2.668000	0.90789	0.563000	0.77884	GAC	FAM155A	-	NULL	ENSG00000204442		0.448	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	30	0.00	0	G	NM_001080396		108518036	108518036	-1	no_errors	ENST00000375915	ensembl	human	known	69_37n	missense	85	13.27	13	SNP	1.000	T
FAM184A	79632	genome.wustl.edu	37	6	119301436	119301436	+	Missense_Mutation	SNP	G	G	C	rs372303662		TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr6:119301436G>C	ENST00000338891.7	-	10	2611	c.2168C>G	c.(2167-2169)aCg>aGg	p.T723R	FAM184A_ENST00000352896.5_Missense_Mutation_p.T603R|FAM184A_ENST00000368475.4_Missense_Mutation_p.T603R|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000521531.1_Missense_Mutation_p.T723R	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	723						extracellular space (GO:0005615)		p.T723R(1)|p.T723M(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TCGTTCTTGCGTAAACTGGGC	0.438																																						dbGAP											2	Substitution - Missense(2)	ovary(1)|breast(1)											102.0	97.0	99.0					6																	119301436		1902	4122	6024	-	-	-	SO:0001583	missense	0			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2168C>G	6.37:g.119301436G>C	ENSP00000342604:p.Thr723Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	superfamily_Prefoldin	p.T723R	ENST00000338891.7	37	c.2168	CCDS43499.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242852	0.79912	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	6.17	6.17	0.99709	.	0.094566	0.64402	D	0.000001	T	0.26340	0.0643	L	0.29908	0.895	0.80722	D	1	D;P;D	0.60160	0.984;0.939;0.987	P;P;P	0.57720	0.757;0.645;0.826	T	0.01062	-1.1464	10	0.23302	T	0.38	-15.6808	15.125	0.72475	0.0:0.2445:0.7555:0.0	.	723;603;723	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	R	723;603;603;723	ENSP00000342604:T723R;ENSP00000326608:T603R;ENSP00000357460:T603R;ENSP00000430442:T723R	ENSP00000342604:T723R	T	-	2	0	FAM184A	119343135	1.000000	0.71417	0.999000	0.59377	0.874000	0.50279	3.441000	0.52893	2.941000	0.99782	0.655000	0.94253	ACG	FAM184A	-	NULL	ENSG00000111879		0.438	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	HGNC	protein_coding	OTTHUMT00000042009.3	55	0.00	0	G	NM_024581		119301436	119301436	-1	no_errors	ENST00000338891	ensembl	human	known	69_37n	missense	216	16.92	44	SNP	1.000	C
FAM69C	125704	genome.wustl.edu	37	18	72109212	72109212	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr18:72109212G>A	ENST00000343998.6	-	3	1024	c.1016C>T	c.(1015-1017)gCg>gTg	p.A339V	FAM69C_ENST00000400291.2_Missense_Mutation_p.A40V	NM_001044369.2	NP_001037834.2	Q0P6D2	FA69C_HUMAN	family with sequence similarity 69, member C	339						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.A339V(1)|p.A40V(1)		breast(1)|large_intestine(2)|ovary(2)	5						TACGCGCTGCGCTCCGCATTT	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											113.0	120.0	118.0					18																	72109212		1977	4140	6117	-	-	-	SO:0001583	missense	0			BC019628	CCDS42445.2	18q22.3	2012-08-03	2009-07-23	2009-07-23	ENSG00000187773	ENSG00000187773			31729	protein-coding gene	gene with protein product		614544	"""chromosome 18 open reading frame 51"""	C18orf51		21334309	Standard	NM_001044369		Approved		uc002llk.3	Q0P6D2	OTTHUMG00000156984	ENST00000343998.6:c.1016C>T	18.37:g.72109212G>A	ENSP00000344331:p.Ala339Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Uncharacterised_FAM69,superfamily_Kinase-like_dom	p.A339V	ENST00000343998.6	37	c.1016	CCDS42445.2	18	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527599	0.64860	.	.	ENSG00000187773	ENST00000400291;ENST00000343998	.	.	.	5.1	5.1	0.69264	.	0.196582	0.45606	D	0.000350	T	0.76644	0.4016	M	0.67953	2.075	0.50039	D	0.99984	D	0.76494	0.999	D	0.63703	0.917	T	0.76680	-0.2870	9	0.45353	T	0.12	-11.6771	18.8794	0.92351	0.0:0.0:1.0:0.0	.	339	Q0P6D2	FA69C_HUMAN	V	40;339	.	ENSP00000344331:A339V	A	-	2	0	FAM69C	70260192	1.000000	0.71417	0.599000	0.28851	0.013000	0.08279	7.524000	0.81866	2.520000	0.84964	0.650000	0.86243	GCG	FAM69C	-	pfam_Uncharacterised_FAM69	ENSG00000187773		0.493	FAM69C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69C	HGNC	protein_coding	OTTHUMT00000346971.2	42	0.00	0	G	XM_058931		72109212	72109212	-1	no_errors	ENST00000343998	ensembl	human	known	69_37n	missense	153	24.63	50	SNP	0.984	A
FBN3	84467	genome.wustl.edu	37	19	8174244	8174244	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr19:8174244C>G	ENST00000600128.1	-	36	4899	c.4485G>C	c.(4483-4485)gaG>gaC	p.E1495D	FBN3_ENST00000601739.1_Missense_Mutation_p.E1495D|FBN3_ENST00000270509.2_Missense_Mutation_p.E1495D			Q75N90	FBN3_HUMAN	fibrillin 3	1495	TB 6.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.E1495D(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGTCATGCGTCTCCAGGAAAC	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	88.0	93.0					19																	8174244		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.4485G>C	19.37:g.8174244C>G	ENSP00000470498:p.Glu1495Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.E1495D	ENST00000600128.1	37	c.4485	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.836779	0.00579	.	.	ENSG00000142449	ENST00000270509	D	0.93247	-3.19	4.29	-1.38	0.09027	Matrix fibril-associated (2);TGF-beta binding (1);	0.182108	0.45867	N	0.000322	T	0.74084	0.3670	N	0.01250	-0.93	0.21064	N	0.999795	B	0.06786	0.001	B	0.06405	0.002	T	0.67173	-0.5737	10	0.02654	T	1	.	10.276	0.43510	0.0:0.4784:0.2901:0.2315	.	1495	Q75N90	FBN3_HUMAN	D	1495	ENSP00000270509:E1495D	ENSP00000270509:E1495D	E	-	3	2	FBN3	8080244	0.022000	0.18835	0.148000	0.22405	0.347000	0.29111	-0.111000	0.10807	-0.304000	0.08843	-0.479000	0.04858	GAG	FBN3	-	superfamily_TB_dom,pirsf_Fibrillin	ENSG00000142449		0.592	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	16	0.00	0	C	NM_032447		8174244	8174244	-1	no_errors	ENST00000270509	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	0.256	G
GPR110	266977	genome.wustl.edu	37	6	46977783	46977783	+	Missense_Mutation	SNP	C	C	A	rs45598235	byFrequency	TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr6:46977783C>A	ENST00000371253.2	-	11	1603	c.1388G>T	c.(1387-1389)cGt>cTt	p.R463L	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Missense_Mutation_p.R266L	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	463					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						AATTAACACACGGCCTCTGAT	0.438																																						dbGAP											0													97.0	92.0	94.0					6																	46977783		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.1388G>T	6.37:g.46977783C>A	ENSP00000360299:p.Arg463Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.R463L	ENST00000371253.2	37	c.1388	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	C	9.097	1.003224	0.19121	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	T;T	0.34072	1.39;1.38	5.2	-3.63	0.04529	.	1.386990	0.04430	N	0.369085	T	0.09512	0.0234	L	0.38175	1.15	0.09310	N	1	B	0.21520	0.057	B	0.17433	0.018	T	0.25916	-1.0118	10	0.23302	T	0.38	-0.5469	6.9695	0.24640	0.0:0.2802:0.2071:0.5127	.	463	Q5T601	GP110_HUMAN	L	463;463;266	ENSP00000360299:R463L;ENSP00000283297:R266L	ENSP00000283297:R266L	R	-	2	0	GPR110	47085742	0.000000	0.05858	0.022000	0.16811	0.063000	0.16089	-0.885000	0.04161	-0.181000	0.10619	-1.467000	0.01014	CGT	GPR110	-	NULL	ENSG00000153292		0.438	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2	45	0.00	0	C	NM_153840		46977783	46977783	-1	no_errors	ENST00000371253	ensembl	human	known	69_37n	missense	135	16.15	26	SNP	0.000	A
HEATR5A	25938	genome.wustl.edu	37	14	31763097	31763097	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr14:31763097G>A	ENST00000389961.3	-	34	5814	c.5815C>T	c.(5815-5817)Cgc>Tgc	p.R1939C	HEATR5A_ENST00000439727.1_Splice_Site_p.R1652C|HEATR5A_ENST00000543095.2_Splice_Site_p.R1945C|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439348.1_Splice_Site_p.R1864C			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1939								p.R1939C(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TGACACTTACGATGGTGTTCT	0.343																																						dbGAP											2	Substitution - Missense(2)	breast(2)											92.0	77.0	82.0					14																	31763097		1874	4116	5990	-	-	-	SO:0001630	splice_region_variant	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5815+1C>T	14.37:g.31763097G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R1939C	ENST00000389961.3	37	c.5815		14	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688716	0.88639	.	.	ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	T;T;T;T	0.68181	-0.16;-0.31;-0.16;-0.16	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.83059	0.5172	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84135	0.0414	9	.	.	.	-12.3419	18.747	0.91797	0.0:0.0:1.0:0.0	.	1864	Q86XA9-2	.	C	1939;1864;1652;1945	ENSP00000374611:R1939C;ENSP00000405407:R1864C;ENSP00000408681:R1652C;ENSP00000437968:R1945C	.	R	-	1	0	HEATR5A	30832848	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	3.565000	0.53798	2.421000	0.82119	0.555000	0.69702	CGC	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.343	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		78	0.00	0	G	NM_015473	Missense_Mutation	31763097	31763097	-1	no_errors	ENST00000389961	ensembl	human	known	69_37n	missense	129	18.87	30	SNP	1.000	A
HIST1H2AD	3013	genome.wustl.edu	37	6	26199312	26199312	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr6:26199312C>A	ENST00000341023.1	-	1	159	c.160G>T	c.(160-162)Gcg>Tcg	p.A54S	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	54						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A54S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				TCCAACACCGCCGCCAGATAC	0.692																																						dbGAP											1	Substitution - Missense(1)	breast(1)											33.0	39.0	37.0					6																	26199312		2203	4298	6501	-	-	-	SO:0001583	missense	0			Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.160G>T	6.37:g.26199312C>A	ENSP00000341094:p.Ala54Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK91|P57754|Q6FGY6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.A54S	ENST00000341023.1	37	c.160	CCDS4591.1	6	.	.	.	.	.	.	.	.	.	.	.	15.65	2.895622	0.52121	.	.	ENSG00000196866	ENST00000341023	T	0.67523	-0.27	4.82	4.82	0.62117	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.42821	U	0.000643	T	0.81814	0.4902	M	0.90309	3.105	0.38428	D	0.94636	P	0.43412	0.806	P	0.60949	0.881	D	0.85542	0.1216	10	0.72032	D	0.01	.	17.2301	0.86982	0.0:1.0:0.0:0.0	.	54	P20671	H2A1D_HUMAN	S	54	ENSP00000341094:A54S	ENSP00000341094:A54S	A	-	1	0	HIST1H2AD	26307291	1.000000	0.71417	0.794000	0.32065	0.008000	0.06430	7.592000	0.82676	2.373000	0.80994	0.655000	0.94253	GCG	HIST1H2AD	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000196866		0.692	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AD	HGNC	protein_coding	OTTHUMT00000040100.1	20	0.00	0	C	NM_021065		26199312	26199312	-1	no_errors	ENST00000341023	ensembl	human	known	69_37n	missense	91	13.08	14	SNP	0.999	A
HSPA2	3306	genome.wustl.edu	37	14	65007620	65007620	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr14:65007620G>A	ENST00000394709.1	+	2	129	c.53G>A	c.(52-54)tGc>tAc	p.C18Y	HSPA2_ENST00000247207.6_Missense_Mutation_p.C18Y|RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000554883.1_3'UTR			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	18					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)	p.C18Y(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		ACCTATTCGTGCGTCGGGGTC	0.622											OREG0022731	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(136;1211 1835 24894 31984 38227)	dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	82.0	88.0					14																	65007620		2203	4300	6503	-	-	-	SO:0001583	missense	0			L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.53G>A	14.37:g.65007620G>A	ENSP00000378199:p.Cys18Tyr	Somatic	1080	WXS	Illumina GAIIx	Phase_IV	Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.C18Y	ENST00000394709.1	37	c.53	CCDS9766.1	14	.	.	.	.	.	.	.	.	.	.	G	19.41	3.823192	0.71143	.	.	ENSG00000126803	ENST00000394709;ENST00000247207;ENST00000545222	T;T	0.01068	5.38;5.38	5.38	5.38	0.77491	.	0.000000	0.64402	U	0.000010	T	0.20333	0.0489	H	0.99890	4.9	0.80722	D	1	D	0.62365	0.991	D	0.76071	0.987	T	0.56486	-0.7971	10	0.87932	D	0	-3.1362	19.1255	0.93382	0.0:0.0:1.0:0.0	.	18	P54652	HSP72_HUMAN	Y	18	ENSP00000378199:C18Y;ENSP00000247207:C18Y	ENSP00000247207:C18Y	C	+	2	0	HSPA2	64077373	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	9.828000	0.99408	2.513000	0.84729	0.557000	0.71058	TGC	HSPA2	-	pfam_Hsp_70_fam,prints_Hsp_70_fam	ENSG00000126803		0.622	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA2	HGNC	protein_coding	OTTHUMT00000280651.1	13	0.00	0	G			65007620	65007620	+1	no_errors	ENST00000247207	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	A
HYAL2	8692	genome.wustl.edu	37	3	50357070	50357070	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr3:50357070G>C	ENST00000447092.1	-	1	3143	c.851C>G	c.(850-852)gCc>gGc	p.A284G	HYAL2_ENST00000395139.3_Missense_Mutation_p.A284G|HYAL2_ENST00000357750.4_Missense_Mutation_p.A284G|TUSC2_ENST00000462137.1_5'Flank|HYAL2_ENST00000442581.1_Missense_Mutation_p.A284G			Q12891	HYAL2_HUMAN	hyaluronoglucosaminidase 2	284					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|defense response to virus (GO:0051607)|fusion of virus membrane with host plasma membrane (GO:0019064)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|kidney development (GO:0001822)|monocyte activation (GO:0042117)|multicellular organismal aging (GO:0010259)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|transformation of host cell by virus (GO:0019087)|viral entry into host cell (GO:0046718)	anchored component of external side of plasma membrane (GO:0031362)|anchored component of plasma membrane (GO:0046658)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|lysosome (GO:0005764)|membrane raft (GO:0045121)|microvillus (GO:0005902)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|hyaluronic acid binding (GO:0005540)|hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)|receptor signaling protein tyrosine kinase inhibitor activity (GO:0030294)|receptor tyrosine kinase binding (GO:0030971)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)	p.A284G(1)		breast(1)|endometrium(2)|kidney(1)|ovary(1)|prostate(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		TGCATGGTTGGCATGGTGGGT	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	58.0	57.0					3																	50357070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000099	CCDS2818.1	3p21.3	2008-07-18			ENSG00000068001	ENSG00000068001			5321	protein-coding gene	gene with protein product	"""lysosomal hyaluronidase"", ""PH-20 homolog"", ""hyaluronidase 2"""	603551				9712871, 9790770	Standard	NM_003773		Approved	LuCa-2, LUCA2	uc003czv.3	Q12891	OTTHUMG00000156876	ENST00000447092.1:c.851C>G	3.37:g.50357070G>C	ENSP00000401853:p.Ala284Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRZ2|O15177|Q9BW29	Missense_Mutation	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	p.A284G	ENST00000447092.1	37	c.851	CCDS2818.1	3	.	.	.	.	.	.	.	.	.	.	G	3.842	-0.033645	0.07543	.	.	ENSG00000068001	ENST00000447092;ENST00000357750;ENST00000395139;ENST00000442581	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.75	5.75	0.90469	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.442925	0.26601	N	0.023476	T	0.17365	0.0417	N	0.21373	0.66	0.20873	N	0.999837	B;B	0.10296	0.003;0.001	B;B	0.14023	0.01;0.008	T	0.14783	-1.0460	10	0.19590	T	0.45	-20.2044	12.4369	0.55604	0.0:0.0:0.8327:0.1673	.	284;284	B3KRZ2;Q12891	.;HYAL2_HUMAN	G	284	ENSP00000401853:A284G;ENSP00000350387:A284G;ENSP00000378571:A284G;ENSP00000406657:A284G	ENSP00000350387:A284G	A	-	2	0	HYAL2	50332074	0.001000	0.12720	0.980000	0.43619	0.018000	0.09664	1.074000	0.30703	2.709000	0.92574	0.557000	0.71058	GCC	HYAL2	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase	ENSG00000068001		0.592	HYAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYAL2	HGNC	protein_coding	OTTHUMT00000346391.1	20	0.00	0	G	NM_003773		50357070	50357070	-1	no_errors	ENST00000357750	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	0.490	C
KRTAP10-1	386677	genome.wustl.edu	37	21	45959988	45959988	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr21:45959988A>T	ENST00000400375.1	-	1	90	c.46T>A	c.(46-48)Tcc>Acc	p.S16T	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	16						keratin filament (GO:0045095)		p.S16T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						ACCTGCCAGGAGTCGGAGCAA	0.692																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	87.0	85.0					21																	45959988		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.46T>A	21.37:g.45959988A>T	ENSP00000383226:p.Ser16Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAR0|Q0VAR1	Missense_Mutation	SNP	NULL	p.S16T	ENST00000400375.1	37	c.46	CCDS42954.1	21	.	.	.	.	.	.	.	.	.	.	a	1.486	-0.556039	0.03967	.	.	ENSG00000215455	ENST00000400375;ENST00000545982	T	0.16196	2.36	3.3	0.846	0.18955	.	.	.	.	.	T	0.20618	0.0496	M	0.77712	2.385	0.09310	N	1	P	0.51791	0.948	B	0.43783	0.431	T	0.13469	-1.0508	9	0.48119	T	0.1	.	4.9522	0.14021	0.7244:0.0:0.2756:0.0	.	16	P60331	KR101_HUMAN	T	16	ENSP00000383226:S16T	ENSP00000383226:S16T	S	-	1	0	KRTAP10-1	44784416	1.000000	0.71417	0.061000	0.19648	0.102000	0.19082	1.398000	0.34554	0.068000	0.16574	0.260000	0.18958	TCC	KRTAP10-1	-	NULL	ENSG00000215455		0.692	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-1	HGNC	protein_coding	OTTHUMT00000128030.1	56	0.00	0	A			45959988	45959988	-1	no_errors	ENST00000400375	ensembl	human	known	69_37n	missense	252	12.03	35	SNP	0.109	T
LRRK2	120892	genome.wustl.edu	37	12	40745469	40745469	+	Silent	SNP	C	C	T	rs34869625	byFrequency	TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr12:40745469C>T	ENST00000298910.7	+	44	6568	c.6510C>T	c.(6508-6510)ggC>ggT	p.G2170G		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2170					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.G2170G(1)|p.G2177G(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTGGCTGGGCTGTGGGCACA	0.403																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											84.0	87.0	86.0					12																	40745469		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6510C>T	12.37:g.40745469C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.G2170	ENST00000298910.7	37	c.6510	CCDS31774.1	12																																																																																			LRRK2	-	NULL	ENSG00000188906		0.403	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	31	0.00	0	C	XM_058513		40745469	40745469	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	silent	83	18.63	19	SNP	0.996	T
MAGI2	9863	genome.wustl.edu	37	7	77762343	77762343	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr7:77762343C>G	ENST00000354212.4	-	18	3319	c.3066G>C	c.(3064-3066)gaG>gaC	p.E1022D	MAGI2_ENST00000522391.1_Missense_Mutation_p.E1022D|MAGI2_ENST00000419488.1_Missense_Mutation_p.E1008D	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1022	Pro-rich.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.E1022D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GACTCTGCTTCTCTGAGCTGG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	119.0	116.0					7																	77762343		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3066G>C	7.37:g.77762343C>G	ENSP00000346151:p.Glu1022Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.E1022D	ENST00000354212.4	37	c.3066	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182944	0.57800	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.12255	2.8;2.78;2.7	5.76	5.76	0.90799	.	0.000000	0.36854	U	0.002372	T	0.20373	0.0490	N	0.14661	0.345	0.80722	D	1	B;B;D	0.64830	0.06;0.085;0.994	B;B;D	0.70716	0.018;0.091;0.97	T	0.02610	-1.1134	10	0.56958	D	0.05	.	12.8594	0.57906	0.0:0.925:0.0:0.075	.	1022;1008;1022	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	D	1008;1022;1022;1022	ENSP00000405766:E1008D;ENSP00000346151:E1022D;ENSP00000428389:E1022D	ENSP00000346151:E1022D	E	-	3	2	MAGI2	77600279	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.764000	0.47613	2.726000	0.93360	0.655000	0.94253	GAG	MAGI2	-	NULL	ENSG00000187391		0.617	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	51	0.00	0	C	NM_012301		77762343	77762343	-1	no_errors	ENST00000354212	ensembl	human	known	69_37n	missense	186	10.58	22	SNP	1.000	G
MECOM	2122	genome.wustl.edu	37	3	168833597	168833597	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr3:168833597G>T	ENST00000464456.1	-	7	2699	c.1499C>A	c.(1498-1500)gCt>gAt	p.A500D	MECOM_ENST00000494292.1_Missense_Mutation_p.A688D|MECOM_ENST00000460814.1_Missense_Mutation_p.A500D|MECOM_ENST00000468789.1_Missense_Mutation_p.A500D|MECOM_ENST00000264674.3_Missense_Mutation_p.A565D|MECOM_ENST00000433243.2_Missense_Mutation_p.A501D|MECOM_ENST00000392736.3_Missense_Mutation_p.A500D|MECOM_ENST00000472280.1_Missense_Mutation_p.A501D	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A500D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GTAAGGTAAAGCTCCAACTTT	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											394.0	342.0	360.0					3																	168833597		2203	4300	6503	-	-	-	SO:0001583	missense	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.1499C>A	3.37:g.168833597G>T	ENSP00000419770:p.Ala500Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13466|Q6FH90	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.A688D	ENST00000464456.1	37	c.2063	CCDS54669.1	3	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198303	0.38806	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.06218	3.38;3.38;3.34;3.48;3.33;3.38;3.33;3.48	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000002	T	0.09774	0.0240	L	0.40543	1.245	0.49915	D	0.999834	P;P;P;P;P	0.47910	0.902;0.763;0.842;0.763;0.651	B;B;B;B;B	0.43301	0.415;0.229;0.236;0.229;0.115	T	0.06899	-1.0801	10	0.38643	T	0.18	-10.8711	20.1162	0.97934	0.0:0.0:1.0:0.0	.	688;501;688;565;500	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	D	565;500;500;501;688;500;500;501	ENSP00000264674:A565D;ENSP00000376493:A500D;ENSP00000419770:A500D;ENSP00000420048:A501D;ENSP00000417899:A688D;ENSP00000419995:A500D;ENSP00000420466:A500D;ENSP00000394302:A501D	ENSP00000264674:A565D	A	-	2	0	MECOM	170316291	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.526000	0.81920	2.756000	0.94617	0.655000	0.94253	GCT	MECOM	-	NULL	ENSG00000085276		0.408	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351519.1	240	0.00	0	G	NM_005241, NM_004991		168833597	168833597	-1	no_errors	ENST00000494292	ensembl	human	known	69_37n	missense	490	16.10	94	SNP	1.000	T
NARS2	79731	genome.wustl.edu	37	11	78154716	78154716	+	Missense_Mutation	SNP	C	C	T	rs535877562		TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr11:78154716C>T	ENST00000281038.5	-	12	1628	c.1253G>A	c.(1252-1254)cGc>cAc	p.R418H	NARS2_ENST00000528850.1_Missense_Mutation_p.R191H|RP11-452H21.1_ENST00000534168.1_RNA	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	418					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)	p.R418H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	CCTGGCTAAGCGCTCCTCTAA	0.458													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16837	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	89.0	91.0					11																	78154716		2200	4292	6492	-	-	-	SO:0001583	missense	0			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1253G>A	11.37:g.78154716C>T	ENSP00000281038:p.Arg418His	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V178	Missense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asn-tRNA-synth_IIb	p.R418H	ENST00000281038.5	37	c.1253	CCDS8261.1	11	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656423	0.47467	.	.	ENSG00000137513	ENST00000281038;ENST00000528850	D;D	0.86497	-2.13;-2.13	4.96	-1.45	0.08828	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.234964	0.42420	D	0.000706	D	0.91560	0.7334	M	0.90082	3.085	0.42155	D	0.991577	D	0.61697	0.99	P	0.59115	0.852	D	0.89992	0.4108	10	0.87932	D	0	-0.0791	9.2527	0.37564	0.0:0.5407:0.0:0.4593	.	418	Q96I59	SYNM_HUMAN	H	418;191	ENSP00000281038:R418H;ENSP00000432635:R191H	ENSP00000281038:R418H	R	-	2	0	NARS2	77832364	0.314000	0.24563	0.239000	0.24122	0.982000	0.71751	0.577000	0.23758	-0.343000	0.08351	0.591000	0.81541	CGC	NARS2	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,tigrfam_Asn-tRNA-synth_IIb	ENSG00000137513		0.458	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARS2	HGNC	protein_coding	OTTHUMT00000391138.2	44	0.00	0	C	NM_024678		78154716	78154716	-1	no_errors	ENST00000281038	ensembl	human	known	69_37n	missense	147	12.50	21	SNP	0.423	T
KMT2A	4297	genome.wustl.edu	37	11	118375750	118375750	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr11:118375750A>C	ENST00000389506.5	+	27	9134	c.9134A>C	c.(9133-9135)aAg>aCg	p.K3045T	KMT2A_ENST00000534358.1_Missense_Mutation_p.K3048T|KMT2A_ENST00000354520.4_Missense_Mutation_p.K3007T			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3045					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.K3048T(1)|p.K3045T(1)									CAGAACCAGAAGTATGTGCCC	0.517																																						dbGAP											2	Substitution - Missense(2)	breast(2)											130.0	114.0	120.0					11																	118375750		2200	4295	6495	-	-	-	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.9134A>C	11.37:g.118375750A>C	ENSP00000374157:p.Lys3045Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.K3045T	ENST00000389506.5	37	c.9134	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	A	13.82	2.350580	0.41599	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.88124	-2.34;-2.34;-2.29	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.91106	0.7200	L	0.48642	1.525	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.90860	0.4738	10	0.45353	T	0.12	.	16.2233	0.82274	1.0:0.0:0.0:0.0	.	3048;3045	E9PQG7;Q03164	.;MLL1_HUMAN	T	3048;3045;3007;1955	ENSP00000436786:K3048T;ENSP00000374157:K3045T;ENSP00000346516:K3007T	ENSP00000346516:K3007T	K	+	2	0	MLL	117880960	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.013000	0.76373	2.243000	0.73865	0.482000	0.46254	AAG	MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.517	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	31	0.00	0	A	NM_005933		118375750	118375750	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	missense	78	13.33	12	SNP	1.000	C
NDUFS2	4720	genome.wustl.edu	37	1	161183954	161183954	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr1:161183954G>A	ENST00000367993.3	+	15	1811	c.1363G>A	c.(1363-1365)Gat>Aat	p.D455N	NDUFS2_ENST00000392179.4_3'UTR|FCER1G_ENST00000289902.1_5'Flank|FCER1G_ENST00000367992.3_5'Flank|NDUFS2_ENST00000465923.1_3'UTR	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	455					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)	p.D455N(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	AGGTACCCAAGATATTGTATT	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	96.0	102.0					1																	161183954		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.1363G>A	1.37:g.161183954G>A	ENSP00000356972:p.Asp455Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Missense_Mutation	SNP	pfam_NADH_Q_OxRdtase_suD,tigrfam_NADH_DH_1_suD	p.D455N	ENST00000367993.3	37	c.1363	CCDS1224.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.090650	0.94149	.	.	ENSG00000158864	ENST00000367993	D	0.94457	-3.43	5.25	5.25	0.73442	NADH-quinone oxidoreductase, subunit D (1);	0.000000	0.85682	D	0.000000	D	0.97065	0.9041	M	0.80746	2.51	0.54753	D	0.999982	D	0.76494	0.999	D	0.76071	0.987	D	0.97368	0.9974	9	0.87932	D	0	.	17.7676	0.88483	0.0:0.0:1.0:0.0	.	455	O75306	NDUS2_HUMAN	N	455	ENSP00000356972:D455N	ENSP00000356972:D455N	D	+	1	0	NDUFS2	159450578	1.000000	0.71417	0.993000	0.49108	0.931000	0.56810	6.859000	0.75467	2.721000	0.93114	0.655000	0.94253	GAT	NDUFS2	-	pfam_NADH_Q_OxRdtase_suD,tigrfam_NADH_DH_1_suD	ENSG00000158864		0.458	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NDUFS2	HGNC	protein_coding	OTTHUMT00000083015.1	46	0.00	0	G	NM_004550		161183954	161183954	+1	no_errors	ENST00000367993	ensembl	human	known	69_37n	missense	184	13.21	28	SNP	1.000	A
NLRP5	126206	genome.wustl.edu	37	19	56569642	56569642	+	Silent	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr19:56569642G>A	ENST00000390649.3	+	14	3336	c.3336G>A	c.(3334-3336)gaG>gaA	p.E1112E		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1112					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.E1112E(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		ATTGCTGTGAGGCACTCTCCT	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											186.0	179.0	181.0					19																	56569642		2048	4205	6253	-	-	-	SO:0001819	synonymous_variant	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3336G>A	19.37:g.56569642G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTY4|Q86W29	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E1112	ENST00000390649.3	37	c.3336	CCDS12938.1	19																																																																																			NLRP5	-	NULL	ENSG00000171487		0.512	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	71	0.00	0	G	NM_153447		56569642	56569642	+1	no_errors	ENST00000390649	ensembl	human	known	69_37n	silent	145	21.62	40	SNP	0.009	A
OR52N2	390077	genome.wustl.edu	37	11	5842404	5842404	+	Missense_Mutation	SNP	C	C	G	rs369539095		TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr11:5842404C>G	ENST00000317037.2	+	1	861	c.839C>G	c.(838-840)gCc>gGc	p.A280G	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A280G(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCATCGTGGCCAACCTTTAT	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											170.0	144.0	153.0					11																	5842404		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.839C>G	11.37:g.5842404C>G	ENSP00000322801:p.Ala280Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFF9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A280G	ENST00000317037.2	37	c.839	CCDS31399.1	11	.	.	.	.	.	.	.	.	.	.	C	11.93	1.785237	0.31593	.	.	ENSG00000180988	ENST00000317037	T	0.00207	8.55	6.09	6.09	0.99107	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000057	T	0.00637	0.0021	M	0.76727	2.345	0.22701	N	0.998834	D	0.89917	1.0	D	0.97110	1.0	T	0.57046	-0.7878	10	0.72032	D	0.01	.	19.2573	0.93951	0.0:1.0:0.0:0.0	.	280	Q8NGI0	O52N2_HUMAN	G	280	ENSP00000322801:A280G	ENSP00000322801:A280G	A	+	2	0	OR52N2	5798980	0.000000	0.05858	0.307000	0.25127	0.026000	0.11368	0.138000	0.16016	2.897000	0.99335	0.643000	0.83706	GCC	OR52N2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180988		0.398	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N2	HGNC	protein_coding	OTTHUMT00000401143.1	68	0.00	0	C	NM_001005174		5842404	5842404	+1	no_errors	ENST00000317037	ensembl	human	known	69_37n	missense	123	19.61	30	SNP	0.755	G
PARP8	79668	genome.wustl.edu	37	5	50091197	50091197	+	Silent	SNP	C	C	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr5:50091197C>A	ENST00000281631.5	+	12	1532	c.1374C>A	c.(1372-1374)acC>acA	p.T458T	PARP8_ENST00000505697.2_Silent_p.T458T|PARP8_ENST00000503750.2_Silent_p.T458T|PARP8_ENST00000514342.2_Silent_p.T211T|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000505554.1_Silent_p.T437T|PARP8_ENST00000514067.2_Silent_p.T458T	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	458						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.T458T(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TCTCTCTTACCTCAGGGCTTA	0.443																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											73.0	76.0	75.0					5																	50091197		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1374C>A	5.37:g.50091197C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KRB7|Q6DHZ1|Q9H754	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.T458	ENST00000281631.5	37	c.1374	CCDS3954.1	5																																																																																			PARP8	-	NULL	ENSG00000151883		0.443	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	32	0.00	0	C	NM_024615		50091197	50091197	+1	no_errors	ENST00000281631	ensembl	human	known	69_37n	silent	22	37.14	13	SNP	1.000	A
PPP1R9A	55607	genome.wustl.edu	37	7	94750069	94750069	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr7:94750069C>T	ENST00000433881.1	+	4	2106	c.1574C>T	c.(1573-1575)gCa>gTa	p.A525V	PPP1R9A_ENST00000456331.2_Missense_Mutation_p.A525V|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.A525V|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.A525V|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.A525V|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.A525V			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	525	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.A525V(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			GGTGTTGGAGCAGATGCTGGA	0.398										HNSCC(28;0.073)																												dbGAP											2	Substitution - Missense(2)	breast(2)											163.0	158.0	160.0					7																	94750069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1574C>T	7.37:g.94750069C>T	ENSP00000398870:p.Ala525Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,superfamily_Smac_DIABLO-like,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.A525V	ENST00000433881.1	37	c.1574	CCDS34683.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.265300	0.95399	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71;1.71	4.46	4.46	0.54185	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.46908	0.1417	L	0.51853	1.615	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;0.999;1.0;0.981	D;D;D;D;D	0.80764	0.977;0.941;0.973;0.994;0.947	T	0.45920	-0.9228	10	0.87932	D	0	.	18.4373	0.90650	0.0:1.0:0.0:0.0	.	525;525;525;525;525	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	V	525	ENSP00000405514:A525V;ENSP00000344524:A525V;ENSP00000411342:A525V;ENSP00000398870:A525V;ENSP00000289495:A525V;ENSP00000402893:A525V	ENSP00000289495:A525V	A	+	2	0	PPP1R9A	94588005	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.598000	0.82745	2.773000	0.95371	0.655000	0.94253	GCA	PPP1R9A	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000158528		0.398	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	72	0.00	0	C	NM_001166160		94750069	94750069	+1	no_errors	ENST00000289495	ensembl	human	known	69_37n	missense	234	11.36	30	SNP	1.000	T
PTCHD3	374308	genome.wustl.edu	37	10	27687828	27687828	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr10:27687828A>C	ENST00000438700.3	-	4	1816	c.1699T>G	c.(1699-1701)Tgt>Ggt	p.C567G		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	567					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.C567G(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						AATGGGAAACAGCAGAACTTT	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	93.0	94.0					10																	27687828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1699T>G	10.37:g.27687828A>C	ENSP00000417658:p.Cys567Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	I3L499|Q6ZU28	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.C567G	ENST00000438700.3	37	c.1699	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	A	9.892	1.204454	0.22205	.	.	ENSG00000182077	ENST00000438700	D	0.85411	-1.98	3.7	2.53	0.30540	.	0.371973	0.33419	N	0.004921	D	0.89392	0.6702	M	0.68952	2.095	0.36731	D	0.88172	D	0.76494	0.999	D	0.79108	0.992	D	0.88832	0.3306	10	0.39692	T	0.17	-12.3671	9.9762	0.41786	0.8286:0.1714:0.0:0.0	.	567	Q3KNS1	PTHD3_HUMAN	G	567	ENSP00000417658:C567G	ENSP00000417658:C567G	C	-	1	0	PTCHD3	27727834	1.000000	0.71417	0.148000	0.22405	0.133000	0.20885	3.948000	0.56660	0.588000	0.29660	0.254000	0.18369	TGT	PTCHD3	-	pfam_Patched	ENSG00000182077		0.408	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3	55	0.00	0	A	XM_370541		27687828	27687828	-1	no_errors	ENST00000438700	ensembl	human	known	69_37n	missense	198	10.81	24	SNP	0.998	C
RAE1	8480	genome.wustl.edu	37	20	55949798	55949798	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr20:55949798T>A	ENST00000395841.2	+	11	1381	c.961T>A	c.(961-963)Tgc>Agc	p.C321S	RAE1_ENST00000527947.1_Missense_Mutation_p.C321S|RAE1_ENST00000395840.2_Missense_Mutation_p.C321S|RAE1_ENST00000371242.2_Missense_Mutation_p.C321S	NM_003610.3	NP_003601.1	P78406	RAE1L_HUMAN	ribonucleic acid export 1	321					carbohydrate metabolic process (GO:0005975)|cellular response to organic cyclic compound (GO:0071407)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|RNA binding (GO:0003723)	p.C321S(1)		breast(1)|endometrium(5)|large_intestine(4)|lung(6)|prostate(3)|skin(2)	21	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			CATCTCAGCTTGCTGTTTCAA	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	122.0	128.0					20																	55949798		2203	4300	6503	-	-	-	SO:0001583	missense	0			U84720	CCDS13458.1	20q13.31	2013-08-28	2013-08-28		ENSG00000101146	ENSG00000101146		"""WD repeat domain containing"""	9828	protein-coding gene	gene with protein product		603343	"""RAE1 (RNA export 1, S.pombe) homolog"", ""RAE1 RNA export 1 homolog (S. pombe)"""			9370289, 9256445	Standard	XM_005260582		Approved	Mnrp41	uc002xyi.3	P78406	OTTHUMG00000032819	ENST00000395841.2:c.961T>A	20.37:g.55949798T>A	ENSP00000379182:p.Cys321Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K882|O15306|Q3SYL7|Q5TCH8|Q6V708|Q9H100|Q9NQM6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.C321S	ENST00000395841.2	37	c.961	CCDS13458.1	20	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473085	0.63737	.	.	ENSG00000101146	ENST00000395841;ENST00000371242;ENST00000527947;ENST00000395840	T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80924	0.4717	L	0.59912	1.85	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.994	D;P;P	0.79108	0.992;0.769;0.769	T	0.77593	-0.2530	10	0.24483	T	0.36	-13.9525	16.3483	0.83171	0.0:0.0:0.0:1.0	.	321;321;321	E9PQ57;A8K882;P78406	.;.;RAE1L_HUMAN	S	321	ENSP00000379182:C321S;ENSP00000360286:C321S;ENSP00000432609:C321S;ENSP00000379181:C321S	ENSP00000360286:C321S	C	+	1	0	RAE1	55383205	1.000000	0.71417	0.934000	0.37439	0.362000	0.29581	7.710000	0.84655	2.254000	0.74563	0.533000	0.62120	TGC	RAE1	-	superfamily_WD40_repeat_dom	ENSG00000101146		0.483	RAE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAE1	HGNC	protein_coding	OTTHUMT00000079842.2	28	0.00	0	T			55949798	55949798	+1	no_errors	ENST00000371242	ensembl	human	known	69_37n	missense	123	12.14	17	SNP	1.000	A
RBM33	155435	genome.wustl.edu	37	7	155537935	155537935	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr7:155537935G>T	ENST00000401878.3	+	14	2816	c.2618G>T	c.(2617-2619)aGa>aTa	p.R873I	RBM33_ENST00000341148.3_5'Flank	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	873							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R873I(2)		breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		GTGAAGAACAGACTTCTTGTT	0.473																																						dbGAP											2	Substitution - Missense(2)	breast(2)											57.0	48.0	51.0					7																	155537935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.2618G>T	7.37:g.155537935G>T	ENSP00000384160:p.Arg873Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	smart_RRM_dom	p.R873I	ENST00000401878.3	37	c.2618	CCDS5941.2	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.340616|4.340616	0.81911|0.81911	.|.	.|.	ENSG00000184863|ENSG00000184863	ENST00000392761|ENST00000401878	.|T	.|0.54279	.|0.58	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.72906|0.72906	0.3519|0.3519	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.998;1.0	.|D;D	.|0.85130	.|0.934;0.997	T|T	0.74047|0.74047	-0.3790|-0.3790	5|10	.|0.66056	.|D	.|0.02	.|.	19.7096|19.7096	0.96089|0.96089	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|590;873	.|B4DVQ2;Q96EV2	.|.;RBM33_HUMAN	Y|I	645|873	.|ENSP00000384160:R873I	.|ENSP00000384160:R873I	D|R	+|+	1|2	0|0	RBM33|RBM33	155230696|155230696	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	4.740000|4.740000	0.62087|0.62087	2.652000|2.652000	0.90054|0.90054	0.655000|0.655000	0.94253|0.94253	GAC|AGA	RBM33	-	NULL	ENSG00000184863		0.473	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3	24	0.00	0	G	NM_001008408		155537935	155537935	+1	no_errors	ENST00000401878	ensembl	human	known	69_37n	missense	61	16.44	12	SNP	1.000	T
RDH14	57665	genome.wustl.edu	37	2	18736890	18736890	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr2:18736890T>C	ENST00000381249.3	-	2	685	c.578A>G	c.(577-579)aAa>aGa	p.K193R	NT5C1B-RDH14_ENST00000532967.1_3'UTR|RDH14_ENST00000468071.1_5'UTR	NM_020905.3	NP_065956.1	Q9HBH5	RDH14_HUMAN	retinol dehydrogenase 14 (all-trans/9-cis/11-cis)	193					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.K193R(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)				Vitamin A(DB00162)	TTTATAAAGTTTGGAAGAAAC	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	58.0	57.0					2																	18736890		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF237952	CCDS1693.1	2p24.2	2011-09-14	2006-05-09		ENSG00000240857	ENSG00000240857	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19979	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 4"""		"""retinol dehydrogenase 14 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_020905		Approved	PAN2, SDR7C4		Q9HBH5	OTTHUMG00000090705	ENST00000381249.3:c.578A>G	2.37:g.18736890T>C	ENSP00000370648:p.Lys193Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.K193R	ENST00000381249.3	37	c.578	CCDS1693.1	2	.	.	.	.	.	.	.	.	.	.	T	21.6	4.179086	0.78564	.	.	ENSG00000240857;ENSG00000250741	ENST00000381249;ENST00000444297	D;T	0.87412	-2.25;2.01	5.67	4.51	0.55191	NAD(P)-binding domain (1);	.	.	.	.	T	0.70098	0.3185	N	0.05199	-0.095	0.80722	D	1	B;P	0.43938	0.235;0.822	B;B	0.37346	0.19;0.247	T	0.67681	-0.5608	9	0.14252	T	0.57	.	11.5461	0.50694	0.0:0.0699:0.0:0.9301	.	507;193	C9J2C7;Q9HBH5	.;RDH14_HUMAN	R	193;507	ENSP00000370648:K193R;ENSP00000412639:K507R	ENSP00000412639:K507R	K	-	2	0	NT5C1B-RDH14;RDH14	18600371	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.071000	0.64382	0.988000	0.38734	0.533000	0.62120	AAA	RDH14	-	pfam_DH_sc/Rdtase_SDR,pfam_Epimerase_deHydtase	ENSG00000240857		0.408	RDH14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH14	HGNC	protein_coding	OTTHUMT00000207394.1	50	0.00	0	T			18736890	18736890	-1	no_errors	ENST00000381249	ensembl	human	known	69_37n	missense	94	12.15	13	SNP	1.000	C
RRP12	23223	genome.wustl.edu	37	10	99133604	99133604	+	Missense_Mutation	SNP	C	C	T	rs202239906	byFrequency	TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr10:99133604C>T	ENST00000370992.4	-	16	1957	c.1846G>A	c.(1846-1848)Gac>Aac	p.D616N	RRP12_ENST00000536831.1_Missense_Mutation_p.D334N|RRP12_ENST00000315563.6_Missense_Mutation_p.D516N|RRP12_ENST00000479481.1_5'Flank|RRP12_ENST00000414986.1_Missense_Mutation_p.D555N	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	616						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.D616N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TGGAGTGTGTCGTAGATCTTA	0.607													C|||	2	0.000399361	0.0	0.0029	5008	,	,		19138	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	81.0	98.0					10																	99133604		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.1846G>A	10.37:g.99133604C>T	ENSP00000360031:p.Asp616Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	pfam_Uncharacterised_NUC173,superfamily_ARM-type_fold	p.D616N	ENST00000370992.4	37	c.1846	CCDS7457.1	10	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	17.22	3.333530	0.60853	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.01	5.01	0.66863	Armadillo-type fold (1);Uncharacterised domain NUC173 (1);	0.146165	0.64402	D	0.000008	T	0.58308	0.2113	L	0.56769	1.78	0.48452	D	0.999659	D;B;P;P	0.57571	0.98;0.334;0.653;0.843	P;B;B;B	0.47891	0.56;0.038;0.139;0.404	T	0.63883	-0.6536	10	0.34782	T	0.22	-28.3354	18.2999	0.90160	0.0:1.0:0.0:0.0	.	555;516;334;616	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	N	616;516;555;334	ENSP00000360031:D616N;ENSP00000324315:D516N;ENSP00000414863:D555N;ENSP00000446184:D334N	ENSP00000324315:D516N	D	-	1	0	RRP12	99123594	0.983000	0.35010	0.993000	0.49108	0.764000	0.43329	2.299000	0.43611	2.321000	0.78463	0.462000	0.41574	GAC	RRP12	-	pfam_Uncharacterised_NUC173,superfamily_ARM-type_fold	ENSG00000052749		0.607	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RRP12	HGNC	protein_coding	OTTHUMT00000049699.4	38	0.00	0	C	NM_015179		99133604	99133604	-1	no_errors	ENST00000370992	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	1.000	T
SFI1	9814	genome.wustl.edu	37	22	31942922	31942922	+	Silent	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr22:31942922G>A	ENST00000400288.2	+	5	519	c.414G>A	c.(412-414)gaG>gaA	p.E138E	SFI1_ENST00000432498.1_Silent_p.E138E|SFI1_ENST00000443326.1_Silent_p.E56E|SFI1_ENST00000400289.1_Silent_p.E56E|SFI1_ENST00000443011.1_Silent_p.E56E|SFI1_ENST00000414585.1_Silent_p.E56E|SFI1_ENST00000540643.1_Silent_p.E114E	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	138					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.E138E(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						TCCAGCACGAGTGGAAACTCT	0.408																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	117.0	117.0					22																	31942922		1888	4112	6000	-	-	-	SO:0001819	synonymous_variant	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.414G>A	22.37:g.31942922G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Silent	SNP	superfamily_Cyclin-like	p.E138	ENST00000400288.2	37	c.414	CCDS43004.1	22																																																																																			SFI1	-	NULL	ENSG00000198089		0.408	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	32	0.00	0	G	NM_014775		31942922	31942922	+1	no_errors	ENST00000400288	ensembl	human	known	69_37n	silent	58	23.68	18	SNP	0.998	A
SHPK	23729	genome.wustl.edu	37	17	3524661	3524661	+	Silent	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr17:3524661G>A	ENST00000225519.3	-	5	795	c.693C>T	c.(691-693)gcC>gcT	p.A231A		NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	231					carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)	p.A231A(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		TGCCAGGCTCGGCGATGTCTG	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											58.0	57.0	57.0					17																	3524661		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.693C>T	17.37:g.3524661G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R640|Q8WUH3	Silent	SNP	pfam_Carb_kinase_FGGY_N	p.A231	ENST00000225519.3	37	c.693	CCDS11030.1	17																																																																																			SHPK	-	pfam_Carb_kinase_FGGY_N	ENSG00000197417		0.552	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHPK	HGNC	protein_coding	OTTHUMT00000207378.2	13	0.00	0	G			3524661	3524661	-1	no_errors	ENST00000225519	ensembl	human	known	69_37n	silent	5	86.84	33	SNP	0.000	A
SNAP91	9892	genome.wustl.edu	37	6	84366485	84366485	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr6:84366485T>C	ENST00000439399.2	-	7	962	c.646A>G	c.(646-648)Att>Gtt	p.I216V	SNAP91_ENST00000520213.1_Missense_Mutation_p.I216V|SNAP91_ENST00000520302.1_Missense_Mutation_p.I216V|SNAP91_ENST00000195649.6_Missense_Mutation_p.I216V|SNAP91_ENST00000521743.1_Missense_Mutation_p.I216V|SNAP91_ENST00000521485.1_Missense_Mutation_p.I216V|SNAP91_ENST00000428679.2_Missense_Mutation_p.I216V|SNAP91_ENST00000437520.1_Missense_Mutation_p.I216V|SNAP91_ENST00000369694.2_Missense_Mutation_p.I216V	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	216					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)	p.I216V(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AGTAAGTTAATAACACCATCA	0.393																																						dbGAP											2	Substitution - Missense(2)	breast(2)											99.0	94.0	95.0					6																	84366485		1910	4133	6043	-	-	-	SO:0001583	missense	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.646A>G	6.37:g.84366485T>C	ENSP00000400459:p.Ile216Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.I216V	ENST00000439399.2	37	c.646	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	T	16.61	3.171083	0.57584	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931	T;T;T;T;T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39	5.11	5.11	0.69529	ANTH (1);Clathrin adaptor, phosphoinositide-binding, GAT-like (1);	0.000000	0.85682	D	0.000000	T	0.61515	0.2353	M	0.93978	3.48	0.80722	D	1	P;B;B;B	0.42785	0.79;0.182;0.364;0.182	P;P;P;P	0.59643	0.842;0.807;0.861;0.807	T	0.71523	-0.4567	10	0.87932	D	0	-14.1858	15.1975	0.73104	0.0:0.0:0.0:1.0	.	216;216;216;216	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	V	216	ENSP00000429776:I216V;ENSP00000358708:I216V;ENSP00000400459:I216V;ENSP00000195649:I216V;ENSP00000412492:I216V;ENSP00000413277:I216V;ENSP00000428511:I216V;ENSP00000428215:I216V;ENSP00000428026:I216V;ENSP00000430071:I216V	ENSP00000195649:I216V	I	-	1	0	SNAP91	84423204	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.997000	0.88414	2.056000	0.61249	0.383000	0.25322	ATT	SNAP91	-	pfam_ANTH	ENSG00000065609		0.393	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	67	0.00	0	T			84366485	84366485	-1	no_errors	ENST00000369694	ensembl	human	known	69_37n	missense	164	13.68	26	SNP	1.000	C
SNX25	83891	genome.wustl.edu	37	4	186180136	186180136	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr4:186180136G>A	ENST00000504273.1	+	3	451	c.157G>A	c.(157-159)Gtg>Atg	p.V53M	SNX25_ENST00000264694.8_Missense_Mutation_p.V53M			Q9H3E2	SNX25_HUMAN	sorting nexin 25	53	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.V53M(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		ACTGAGTCACGTGGATGTGGT	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	116.0	121.0					4																	186180136		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.157G>A	4.37:g.186180136G>A	ENSP00000426255:p.Val53Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Regulat_G_prot_signal,pfam_Phox,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal	p.V53M	ENST00000504273.1	37	c.157	CCDS34116.1	4	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085031	0.36758	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.15256	2.44;2.44	5.22	4.38	0.52667	Phox-associated domain (2);	0.147980	0.49305	N	0.000159	T	0.14098	0.0341	L	0.45137	1.4	0.43522	D	0.995796	B	0.26512	0.151	B	0.26864	0.074	T	0.06807	-1.0806	10	0.59425	D	0.04	-14.2903	6.0571	0.19816	0.3056:0.0:0.6944:0.0	.	53	Q9H3E2	SNX25_HUMAN	M	53	ENSP00000426255:V53M;ENSP00000264694:V53M	ENSP00000264694:V53M	V	+	1	0	SNX25	186417130	1.000000	0.71417	0.996000	0.52242	0.917000	0.54804	1.585000	0.36600	1.578000	0.49821	-0.253000	0.11424	GTG	SNX25	-	pfam_Phox_assoc,smart_PX_assoc_Snx13,pfscan_Phox_assoc	ENSG00000109762		0.463	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX25	HGNC	protein_coding	OTTHUMT00000360756.1	55	0.00	0	G	NM_031953		186180136	186180136	+1	no_errors	ENST00000264694	ensembl	human	known	69_37n	missense	76	20.83	20	SNP	0.998	A
SUZ12	23512	genome.wustl.edu	37	17	30267315	30267315	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr17:30267315G>C	ENST00000322652.5	+	2	514	c.285G>C	c.(283-285)caG>caC	p.Q95H	SUZ12_ENST00000580398.1_Missense_Mutation_p.Q95H	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	95					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.Q95H(1)	SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				AGCCAACACAGATCTATAGAT	0.303			T	JAZF1	endometrial stromal tumours																																	dbGAP		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	1	Substitution - Missense(1)	breast(1)											80.0	76.0	77.0					17																	30267315		2203	4294	6497	-	-	-	SO:0001583	missense	0			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.285G>C	17.37:g.30267315G>C	ENSP00000316578:p.Gln95His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BD9	Missense_Mutation	SNP	pfam_Polycomb_protein_VEFS-Box	p.Q95H	ENST00000322652.5	37	c.285	CCDS11270.1	17	.	.	.	.	.	.	.	.	.	.	.	11.80	1.746586	0.30955	.	.	ENSG00000178691	ENST00000322652	T	0.26518	1.73	4.81	4.81	0.61882	.	0.053678	0.85682	D	0.000000	T	0.38427	0.1040	L	0.39245	1.2	0.53005	D	0.99996	D;P	0.65815	0.995;0.917	P;P	0.57371	0.819;0.671	T	0.23726	-1.0180	10	0.87932	D	0	-2.1432	17.2624	0.87073	0.0:0.0:1.0:0.0	.	95;95	A8K1U9;Q15022	.;SUZ12_HUMAN	H	95	ENSP00000316578:Q95H	ENSP00000316578:Q95H	Q	+	3	2	SUZ12	27291428	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.459000	0.45023	2.383000	0.81215	0.597000	0.82753	CAG	SUZ12	-	NULL	ENSG00000178691		0.303	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	HGNC	protein_coding	OTTHUMT00000256260.2	111	0.00	0	G	NM_015355		30267315	30267315	+1	no_errors	ENST00000322652	ensembl	human	known	69_37n	missense	123	12.14	17	SNP	1.000	C
TAF1L	138474	genome.wustl.edu	37	9	32634818	32634818	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr9:32634818G>A	ENST00000242310.4	-	1	849	c.760C>T	c.(760-762)Cga>Tga	p.R254*	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	254					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.R254*(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTTCCAGGTCGAAATTCTGGA	0.483																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											126.0	118.0	120.0					9																	32634818		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.760C>T	9.37:g.32634818G>A	ENSP00000418379:p.Arg254*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VG57	Nonsense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R254*	ENST00000242310.4	37	c.760	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321376	0.81580	.	.	ENSG00000122728	ENST00000242310	.	.	.	1.04	1.04	0.20106	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.2195	0.10551	0.0:0.0:0.605:0.395	.	.	.	.	X	254	.	ENSP00000418379:R254X	R	-	1	2	TAF1L	32624818	1.000000	0.71417	0.993000	0.49108	0.637000	0.38172	2.712000	0.47186	0.507000	0.28148	0.195000	0.17529	CGA	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	70	0.00	0	G			32634818	32634818	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	nonsense	139	35.65	77	SNP	1.000	A
TCHHL1	126637	genome.wustl.edu	37	1	152058008	152058008	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr1:152058008T>A	ENST00000368806.1	-	3	2214	c.2150A>T	c.(2149-2151)cAg>cTg	p.Q717L		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	717							calcium ion binding (GO:0005509)	p.Q717L(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			CAGAGTATTCTGGGCCTCTGT	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											165.0	170.0	169.0					1																	152058008		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.2150A>T	1.37:g.152058008T>A	ENSP00000357796:p.Gln717Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.Q717L	ENST00000368806.1	37	c.2150	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	15.64	2.893997	0.52121	.	.	ENSG00000182898	ENST00000368806	T	0.32988	1.43	4.23	4.23	0.50019	.	0.530450	0.14161	N	0.337341	T	0.24547	0.0595	L	0.50333	1.59	0.09310	N	1	D	0.62365	0.991	P	0.55011	0.766	T	0.04255	-1.0965	10	0.36615	T	0.2	-0.5158	9.6341	0.39798	0.0:0.0:0.0:1.0	.	717	Q5QJ38	TCHL1_HUMAN	L	717	ENSP00000357796:Q717L	ENSP00000357796:Q717L	Q	-	2	0	TCHHL1	150324632	0.241000	0.23857	0.009000	0.14445	0.015000	0.08874	2.998000	0.49465	1.764000	0.52075	0.533000	0.62120	CAG	TCHHL1	-	NULL	ENSG00000182898		0.438	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	127	0.00	0	T	XM_060104		152058008	152058008	-1	no_errors	ENST00000368806	ensembl	human	known	69_37n	missense	378	14.06	62	SNP	0.025	A
TCTN2	79867	genome.wustl.edu	37	12	124191572	124191572	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr12:124191572G>A	ENST00000303372.5	+	17	2064	c.1936G>A	c.(1936-1938)Gag>Aag	p.E646K	RP11-338K17.8_ENST00000538837.1_lincRNA|TCTN2_ENST00000426174.2_Missense_Mutation_p.E645K	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	646					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)		p.E646K(1)		breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CAACAGAAATGAGGTGTGTTG	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	99.0	99.0					12																	124191572		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.1936G>A	12.37:g.124191572G>A	ENSP00000304941:p.Glu646Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Y8|B3KPW5|Q9H966	Missense_Mutation	SNP	pfam_DUF1619	p.E646K	ENST00000303372.5	37	c.1936	CCDS9253.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.176029	0.94846	.	.	ENSG00000168778	ENST00000426174;ENST00000303372	D;D	0.84298	-1.83;-1.83	5.67	5.67	0.87782	.	0.471896	0.22784	N	0.055688	D	0.87330	0.6150	M	0.67953	2.075	0.45066	D	0.998085	P;P	0.47762	0.9;0.9	P;P	0.46585	0.521;0.521	D	0.88223	0.2898	10	0.59425	D	0.04	-13.6546	17.6029	0.88030	0.0:0.0:1.0:0.0	.	645;646	A8K7Y8;Q96GX1	.;TECT2_HUMAN	K	645;646	ENSP00000395171:E645K;ENSP00000304941:E646K	ENSP00000304941:E646K	E	+	1	0	TCTN2	122757525	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	7.849000	0.86908	2.685000	0.91497	0.585000	0.79938	GAG	TCTN2	-	NULL	ENSG00000168778		0.338	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCTN2	HGNC	protein_coding	OTTHUMT00000400652.1	94	0.00	0	G	NM_024809		124191572	124191572	+1	no_errors	ENST00000303372	ensembl	human	known	69_37n	missense	217	12.50	31	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr17:7574003G>A	ENST00000269305.4	-	10	1213	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	TP53_ENST00000359597.4_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.R342*|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	GRCh37	CM004908	TP53	M							62.0	48.0	53.0					17																	7574003		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024C>T	17.37:g.7574003G>A	ENSP00000269305:p.Arg342*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R342*	ENST00000269305.4	37	c.1024	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.061927	0.97246	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	3.43	0.39272	.	0.217683	0.37906	N	0.001893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.3792	6.4477	0.21885	0.0845:0.0:0.5925:0.323	.	.	.	.	X	342;342;331	.	ENSP00000269305:R342X	R	-	1	2	TP53	7514728	0.820000	0.29190	0.702000	0.30337	0.859000	0.49053	2.169000	0.42434	0.657000	0.30906	0.561000	0.74099	CGA	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	10	0.00	0	G	NM_000546		7574003	7574003	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	19	62.00	31	SNP	0.307	A
UHRF1BP1L	23074	genome.wustl.edu	37	12	100451829	100451829	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr12:100451829G>C	ENST00000279907.7	-	14	3438	c.3226C>G	c.(3226-3228)Ctt>Gtt	p.L1076V	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.L726V	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1076								p.L1076V(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						TGTGATTTAAGTGTTCTAACT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											67.0	72.0	70.0					12																	100451829		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3226C>G	12.37:g.100451829G>C	ENSP00000279907:p.Leu1076Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.L1076V	ENST00000279907.7	37	c.3226	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	G	5.575	0.290999	0.10567	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.12672	2.66;2.66	6.02	4.96	0.65561	.	0.388985	0.25938	N	0.027337	T	0.11707	0.0285	N	0.24115	0.695	0.80722	D	1	P	0.42078	0.77	B	0.43575	0.424	T	0.03413	-1.1039	10	0.38643	T	0.18	-9.6178	11.5634	0.50792	0.1236:0.0:0.8764:0.0	.	1076	A0JNW5	UH1BL_HUMAN	V	1076;726	ENSP00000279907:L1076V;ENSP00000444824:L726V	ENSP00000279907:L1076V	L	-	1	0	UHRF1BP1L	98975960	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	0.945000	0.29056	2.850000	0.98022	0.650000	0.86243	CTT	UHRF1BP1L	-	NULL	ENSG00000111647		0.363	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	55	0.00	0	G	NM_001006947		100451829	100451829	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	1.000	C
UNC119	9094	genome.wustl.edu	37	17	26875691	26875691	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr17:26875691T>C	ENST00000335765.4	-	2	363	c.253A>G	c.(253-255)Aag>Gag	p.K85E	UNC119_ENST00000470125.1_5'UTR|UNC119_ENST00000484980.1_5'UTR|UNC119_ENST00000301032.4_Missense_Mutation_p.K85E	NM_005148.3	NP_005139.1	Q13432	U119A_HUMAN	unc-119 homolog (C. elegans)	85					cytokinesis, completion of separation (GO:0007109)|endocytosis (GO:0006897)|lipoprotein transport (GO:0042953)|negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of clathrin-mediated endocytosis (GO:1900186)|phototransduction (GO:0007602)|positive regulation of protein tyrosine kinase activity (GO:0061098)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	lipid binding (GO:0008289)	p.K85E(2)		breast(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	7	Lung NSC(42;0.00431)					AAGTCGATCTTGTAGATATTC	0.557											OREG0024277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											2	Substitution - Missense(2)	breast(2)											92.0	93.0	93.0					17																	26875691		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40998	CCDS11233.1, CCDS11234.1	17q11.2	2014-09-17	2001-11-28		ENSG00000109103	ENSG00000109103			12565	protein-coding gene	gene with protein product	"""POC7 centriolar protein homolog A (Chlamydomonas)"""	604011	"""unc119 (C.elegans) homolog"""			8576185, 9538874	Standard	NM_005148		Approved	HRG4, POC7, POC7A	uc002hbk.2	Q13432	OTTHUMG00000132606	ENST00000335765.4:c.253A>G	17.37:g.26875691T>C	ENSP00000337040:p.Lys85Glu	Somatic	790	WXS	Illumina GAIIx	Phase_IV	A8K8G4|F1T095|O95126	Missense_Mutation	SNP	pfam_GMP_PDE_delta,superfamily_Ig_E-set	p.K85E	ENST00000335765.4	37	c.253	CCDS11233.1	17	.	.	.	.	.	.	.	.	.	.	T	13.81	2.349019	0.41599	.	.	ENSG00000109103	ENST00000335765;ENST00000301032	T;T	0.75589	-0.93;-0.95	5.49	3.19	0.36642	Immunoglobulin E-set (1);	0.284244	0.43416	D	0.000574	T	0.57007	0.2024	N	0.25890	0.77	0.80722	D	1	B;B	0.13594	0.008;0.001	B;B	0.16722	0.016;0.005	T	0.45338	-0.9268	10	0.16420	T	0.52	-27.5149	8.767	0.34708	0.0:0.0694:0.1295:0.8011	.	85;85	F1T095;Q13432	.;U119A_HUMAN	E	85	ENSP00000337040:K85E;ENSP00000301032:K85E	ENSP00000301032:K85E	K	-	1	0	UNC119	23899818	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.216000	0.72212	0.988000	0.38734	0.455000	0.32223	AAG	UNC119	-	pfam_GMP_PDE_delta,superfamily_Ig_E-set	ENSG00000109103		0.557	UNC119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC119	HGNC	protein_coding	OTTHUMT00000255842.2	33	0.00	0	T			26875691	26875691	-1	no_errors	ENST00000335765	ensembl	human	known	69_37n	missense	29	63.29	50	SNP	1.000	C
VASH1	22846	genome.wustl.edu	37	14	77244414	77244414	+	Splice_Site	SNP	G	G	T			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr14:77244414G>T	ENST00000167106.4	+	6	1658	c.1025G>T	c.(1024-1026)cGg>cTg	p.R342L	RP11-488C13.6_ENST00000556368.1_RNA|RP11-488C13.6_ENST00000553507.1_RNA|RP11-488C13.7_ENST00000553758.1_lincRNA|VASH1_ENST00000554743.1_5'UTR	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1	342	Involved in heparin-binding and antiangiogenic activity.				angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)		p.R342L(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		AGTGAAAGACGGTGAGAGAGG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											14.0	14.0	14.0					14																	77244414		2175	4246	6421	-	-	-	SO:0001630	splice_region_variant	0			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.1025+1G>T	14.37:g.77244414G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H02|Q9UBF4|Q9Y629	Missense_Mutation	SNP	NULL	p.R342L	ENST00000167106.4	37	c.1025	CCDS9851.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.167732	0.94768	.	.	ENSG00000071246	ENST00000167106	.	.	.	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.74191	0.3684	L	0.51422	1.61	0.80722	D	1	D	0.67145	0.996	D	0.76575	0.988	T	0.73288	-0.4030	9	0.36615	T	0.2	-19.838	17.6214	0.88083	0.0:0.0:1.0:0.0	.	342	Q7L8A9	VASH1_HUMAN	L	342	.	ENSP00000167106:R342L	R	+	2	0	VASH1	76314167	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.476000	0.97823	2.166000	0.68216	0.655000	0.94253	CGG	VASH1	-	NULL	ENSG00000071246		0.582	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH1	HGNC	protein_coding	OTTHUMT00000413706.1	17	0.00	0	G	NM_014909	Missense_Mutation	77244414	77244414	+1	no_errors	ENST00000167106	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	T
ZNF430	80264	genome.wustl.edu	37	19	21240799	21240799	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0YJ-01A-11D-A10G-09	TCGA-A2-A0YJ-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3fe8e99f-dce5-4df9-983e-efe63d56bdd5	0fb6d352-b236-4ecf-9d79-39d49a387277	g.chr19:21240799C>A	ENST00000261560.5	+	5	1866	c.1685C>A	c.(1684-1686)tCa>tAa	p.S562*	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	562					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S562*(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						CAAAGTAATTCATACTGGAGA	0.383																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											30.0	34.0	33.0					19																	21240799		2167	4271	6438	-	-	-	SO:0001587	stop_gained	0			AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.1685C>A	19.37:g.21240799C>A	ENSP00000261560:p.Ser562*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V70	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S562*	ENST00000261560.5	37	c.1685	CCDS32978.1	19	.	.	.	.	.	.	.	.	.	.	.	33	5.214757	0.95104	.	.	ENSG00000118620	ENST00000261560	.	.	.	0.381	0.381	0.16228	.	.	.	.	.	.	.	.	.	.	.	0.44918	D	0.997936	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	8.2992	0.32004	0.0:1.0:0.0:0.0	.	.	.	.	X	562	.	ENSP00000261560:S562X	S	+	2	0	ZNF430	21032639	0.972000	0.33761	0.399000	0.26333	0.375000	0.29983	3.732000	0.55021	0.446000	0.26666	0.449000	0.29647	TCA	ZNF430	-	NULL	ENSG00000118620		0.383	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF430	HGNC	protein_coding	OTTHUMT00000463539.1	66	0.00	0	C	NM_025189		21240799	21240799	+1	no_errors	ENST00000261560	ensembl	human	known	69_37n	nonsense	48	23.81	15	SNP	0.969	A
