#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB8	11194	genome.wustl.edu	37	7	150732799	150732799	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:150732799C>T	ENST00000297504.6	+	7	1014	c.948C>T	c.(946-948)ctC>ctT	p.L316L	ABCB8_ENST00000477092.1_Silent_p.L299L|ABCB8_ENST00000542328.1_Silent_p.L211L|ABCB8_ENST00000356058.4_Silent_p.L336L|ABCB8_ENST00000498578.1_Silent_p.L299L|ABCB8_ENST00000358849.4_Silent_p.L299L|ABCB8_ENST00000477719.1_Silent_p.L299L			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	316	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.L299L(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	GCTCAGGCCTCCGAAAATTGT	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											100.0	78.0	85.0					7																	150732799		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.948C>T	7.37:g.150732799C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	p.P32S	ENST00000297504.6	37	c.94		7	.	.	.	.	.	.	.	.	.	.	C	7.350	0.622610	0.14193	.	.	ENSG00000197150	ENST00000491920	.	.	.	4.79	2.91	0.33838	.	.	.	.	.	T	0.66819	0.2828	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62627	-0.6814	4	.	.	.	-1.4382	12.743	0.57264	0.0:0.5109:0.4891:0.0	.	.	.	.	S	32	.	.	P	+	1	0	ABCB8	150363732	0.998000	0.40836	0.488000	0.27440	0.774000	0.43823	0.217000	0.17603	0.400000	0.25396	0.561000	0.74099	CCG	ABCB8	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000197150		0.622	ABCB8-003	KNOWN	basic	protein_coding	ABCB8	HGNC	protein_coding	OTTHUMT00000351733.2	40	0.00	0	C	NM_007188		150732799	150732799	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000491920	ensembl	human	putative	69_37n	missense	31	13.89	5	SNP	0.999	T
ABCC10	89845	genome.wustl.edu	37	6	43403563	43403563	+	Silent	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:43403563C>G	ENST00000372530.4	+	5	1898	c.1683C>G	c.(1681-1683)ctC>ctG	p.L561L	ABCC10_ENST00000244533.3_Silent_p.L518L	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	561	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.L518L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TCAATGGTCTCCTGGAGGCCA	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											113.0	101.0	105.0					6																	43403563		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1683C>G	6.37:g.43403563C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.L561	ENST00000372530.4	37	c.1683	CCDS56430.1	6																																																																																			ABCC10	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000124574		0.562	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC10	HGNC	protein_coding	OTTHUMT00000040603.2	157	0.00	0	C	NM_033450		43403563	43403563	+1	no_errors	ENST00000372530	ensembl	human	known	69_37n	silent	102	16.39	20	SNP	0.999	G
AHNAK	79026	genome.wustl.edu	37	11	62297871	62297871	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:62297871C>G	ENST00000378024.4	-	5	4292	c.4018G>C	c.(4018-4020)Gat>Cat	p.D1340H	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1340					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.D1340H(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ACATCCACATCTCCCTTCAAT	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											212.0	208.0	209.0					11																	62297871		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.4018G>C	11.37:g.62297871C>G	ENSP00000367263:p.Asp1340His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D1340H	ENST00000378024.4	37	c.4018	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	16.76	3.212611	0.58452	.	.	ENSG00000124942	ENST00000378024	T	0.03441	3.93	4.66	4.66	0.58398	.	0.000000	0.32736	U	0.005707	T	0.26882	0.0658	H	0.96111	3.77	0.30348	N	0.785026	D	0.76494	0.999	D	0.67382	0.951	T	0.47275	-0.9130	10	0.42905	T	0.14	.	15.741	0.77894	0.0:1.0:0.0:0.0	.	1340	Q09666	AHNK_HUMAN	H	1340	ENSP00000367263:D1340H	ENSP00000367263:D1340H	D	-	1	0	AHNAK	62054447	0.976000	0.34144	0.096000	0.21009	0.019000	0.09904	3.247000	0.51422	2.309000	0.77851	0.645000	0.84053	GAT	AHNAK	-	NULL	ENSG00000124942		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	364	0.00	0	C	NM_024060		62297871	62297871	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	243	15.33	44	SNP	0.950	G
AHNAK	79026	genome.wustl.edu	37	11	62297991	62297991	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:62297991C>T	ENST00000378024.4	-	5	4172	c.3898G>A	c.(3898-3900)Gag>Aag	p.E1300K	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1300					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.E1300K(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCCGGGCCCTCAAGGCTCACA	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	148.0	145.0					11																	62297991		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3898G>A	11.37:g.62297991C>T	ENSP00000367263:p.Glu1300Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E1300K	ENST00000378024.4	37	c.3898	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	11.63	1.695170	0.30052	.	.	ENSG00000124942	ENST00000378024	T	0.01647	4.71	4.66	4.66	0.58398	.	0.000000	0.31976	U	0.006774	T	0.05090	0.0136	M	0.85777	2.775	0.39752	D	0.971907	B	0.22146	0.065	B	0.23150	0.044	T	0.24297	-1.0164	10	0.32370	T	0.25	.	17.5636	0.87913	0.0:1.0:0.0:0.0	.	1300	Q09666	AHNK_HUMAN	K	1300	ENSP00000367263:E1300K	ENSP00000367263:E1300K	E	-	1	0	AHNAK	62054567	0.002000	0.14202	0.314000	0.25224	0.016000	0.09150	-0.406000	0.07187	2.309000	0.77851	0.645000	0.84053	GAG	AHNAK	-	NULL	ENSG00000124942		0.532	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	256	0.00	0	C	NM_024060		62297991	62297991	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	170	13.27	26	SNP	0.998	T
AKR1C2	1646	genome.wustl.edu	37	10	5038048	5038048	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:5038048G>C	ENST00000380753.4	-	6	767	c.580C>G	c.(580-582)Cat>Gat	p.H194D	AKR1C2_ENST00000407674.1_Missense_Mutation_p.H194D|RP11-499O7.7_ENST00000440414.1_RNA|AKR1C2_ENST00000421196.3_Missense_Mutation_p.H168D|RP11-499O7.7_ENST00000451575.2_RNA	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	194					cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.H194D(1)		breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	AAGTAAGGATGACATTCCACC	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											54.0	47.0	49.0					10																	5038048		2203	4294	6497	-	-	-	SO:0001583	missense	0			L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.580C>G	10.37:g.5038048G>C	ENSP00000370129:p.His194Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.H194D	ENST00000380753.4	37	c.580	CCDS7062.1	10	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366740	0.61513	.	.	ENSG00000151632	ENST00000380753;ENST00000421196;ENST00000407674	T;T;T	0.54279	0.58;0.58;0.58	3.0	3.0	0.34707	NADP-dependent oxidoreductase domain (3);	0.000000	0.64402	D	0.000004	T	0.74596	0.3737	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	0.989;1.0	D;D	0.81914	0.953;0.995	T	0.80362	-0.1414	10	0.87932	D	0	.	11.7899	0.52063	0.0:0.0:1.0:0.0	.	168;194	B4DK69;P52895	.;AK1C2_HUMAN	D	194;168;194	ENSP00000370129:H194D;ENSP00000392694:H168D;ENSP00000385221:H194D	ENSP00000370129:H194D	H	-	1	0	AKR1C2	5028048	1.000000	0.71417	0.990000	0.47175	0.938000	0.57974	7.785000	0.85724	1.657000	0.50732	0.514000	0.50259	CAT	AKR1C2	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000151632		0.388	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C2	HGNC	protein_coding	OTTHUMT00000046531.1	127	0.00	0	G	NM_001354		5038048	5038048	-1	no_errors	ENST00000380753	ensembl	human	known	69_37n	missense	94	14.55	16	SNP	1.000	C
AIFM2	84883	genome.wustl.edu	37	10	71874694	71874694	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:71874694G>C	ENST00000307864.1	-	8	1165	c.952C>G	c.(952-954)Ctc>Gtc	p.L318V	AIFM2_ENST00000482166.1_5'UTR|AIFM2_ENST00000373248.1_Missense_Mutation_p.L318V	NM_001198696.1|NM_032797.5	NP_001185625.1|NP_116186.1	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 2	318					apoptotic mitochondrial changes (GO:0008637)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.L318V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|urinary_tract(2)	16						TAGGCCTGGAGAGGCCGCTGC	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	36.0	37.0					10																	71874694		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027403	CCDS7297.1	10q22.2	2006-11-16	2006-11-16	2006-11-16	ENSG00000042286	ENSG00000042286			21411	protein-coding gene	gene with protein product		605159	"""apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death"""	AMID		12135761, 11980907, 15958387	Standard	NM_001198696		Approved	FLJ14497, PRG3	uc001jqp.2	Q9BRQ8	OTTHUMG00000018398	ENST00000307864.1:c.952C>G	10.37:g.71874694G>C	ENSP00000312370:p.Leu318Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXI0|Q63Z39	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Pyridine_nuc-diS_OxRdtase_2,prints_Rng_hydrolase-like	p.L318V	ENST00000307864.1	37	c.952	CCDS7297.1	10	.	.	.	.	.	.	.	.	.	.	G	9.462	1.093470	0.20471	.	.	ENSG00000042286	ENST00000373248;ENST00000307864;ENST00000395039	T;T	0.30714	1.52;1.52	5.8	4.9	0.64082	.	0.062472	0.64402	D	0.000003	T	0.34832	0.0911	M	0.69358	2.11	0.53005	D	0.999961	B	0.21225	0.053	B	0.25405	0.06	T	0.15694	-1.0428	10	0.52906	T	0.07	-25.0021	12.8702	0.57960	0.0757:0.0:0.9243:0.0	.	318	Q9BRQ8	AIFM2_HUMAN	V	318;318;281	ENSP00000362345:L318V;ENSP00000312370:L318V	ENSP00000312370:L318V	L	-	1	0	AIFM2	71544700	1.000000	0.71417	1.000000	0.80357	0.088000	0.18126	5.630000	0.67805	1.470000	0.48102	0.563000	0.77884	CTC	AIFM2	-	NULL	ENSG00000042286		0.562	AIFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM2	HGNC	protein_coding	OTTHUMT00000048487.1	69	0.00	0	G	NM_032797		71874694	71874694	-1	no_errors	ENST00000307864	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	1.000	C
ANKRD11	29123	genome.wustl.edu	37	16	89351969	89351969	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr16:89351969G>A	ENST00000301030.4	-	9	1441	c.981C>T	c.(979-981)ctC>ctT	p.L327L	ANKRD11_ENST00000378330.2_Silent_p.L327L	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	327					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L327L(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCTTGTGCTTGAGGCCTTTTT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											147.0	132.0	137.0					16																	89351969		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.981C>T	16.37:g.89351969G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NTG1|Q6QMF8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L327	ENST00000301030.4	37	c.981	CCDS32513.1	16																																																																																			ANKRD11	-	NULL	ENSG00000167522		0.572	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	228	0.43	1	G	NM_013275		89351969	89351969	-1	no_errors	ENST00000301030	ensembl	human	known	69_37n	silent	149	14.86	26	SNP	0.632	A
ANKRD26	22852	genome.wustl.edu	37	10	27342293	27342293	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:27342293C>G	ENST00000376087.4	-	16	1756	c.1591G>C	c.(1591-1593)Gaa>Caa	p.E531Q	ANKRD26_ENST00000376070.3_5'Flank|ANKRD26_ENST00000436985.2_Missense_Mutation_p.E547Q	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	531					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)		p.E531Q(1)		breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TGCTCTTCTTCTGATGCTACT	0.294																																						dbGAP											1	Substitution - Missense(1)	breast(1)											174.0	168.0	170.0					10																	27342293		1798	4062	5860	-	-	-	SO:0001583	missense	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1591G>C	10.37:g.27342293C>G	ENSP00000365255:p.Glu531Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E547Q	ENST00000376087.4	37	c.1639	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	C	7.838	0.721265	0.15372	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.42131	4.36;0.98	3.39	-0.741	0.11112	.	1.040570	0.07700	U	0.940166	T	0.34164	0.0888	L	0.55213	1.73	0.09310	N	1	P;P;B	0.42518	0.782;0.675;0.004	B;B;B	0.37304	0.246;0.124;0.004	T	0.27606	-1.0069	10	0.52906	T	0.07	.	6.1144	0.20117	0.0:0.4039:0.0:0.5961	.	531;531;547	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	Q	531;547	ENSP00000365255:E531Q;ENSP00000405112:E547Q	ENSP00000365255:E531Q	E	-	1	0	ANKRD26	27382299	0.000000	0.05858	0.001000	0.08648	0.054000	0.15201	-0.301000	0.08232	-0.140000	0.11394	0.484000	0.47621	GAA	ANKRD26	-	NULL	ENSG00000107890		0.294	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	308	0.00	0	C			27342293	27342293	-1	no_errors	ENST00000436985	ensembl	human	known	69_37n	missense	270	12.05	37	SNP	0.011	G
AP2B1	163	genome.wustl.edu	37	17	33984663	33984663	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr17:33984663C>T	ENST00000262325.7	+	14	2395	c.1842C>T	c.(1840-1842)aaC>aaT	p.N614N	AP2B1_ENST00000537622.2_Silent_p.N614N|AP2B1_ENST00000312678.8_Silent_p.N614N|AP2B1_ENST00000592545.1_Silent_p.N576N|AP2B1_ENST00000538556.1_Silent_p.N557N|AP2B1_ENST00000589344.1_Silent_p.N614N|AP2B1_ENST00000545922.2_3'UTR	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	614	Pro-rich (stalk region).				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)	p.N614N(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CTGCAACGAACCTGGAACAGC	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											111.0	96.0	101.0					17																	33984663		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.1842C>T	17.37:g.33984663C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJP3|P21851|Q7Z451|Q96J19	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu	p.N614	ENST00000262325.7	37	c.1842	CCDS32622.1	17																																																																																			AP2B1	-	pirsf_AP_complex_bsu	ENSG00000006125		0.488	AP2B1-001	KNOWN	basic|CCDS	protein_coding	AP2B1	HGNC	protein_coding	OTTHUMT00000448969.1	137	0.00	0	C			33984663	33984663	+1	no_errors	ENST00000312678	ensembl	human	known	69_37n	silent	118	11.28	15	SNP	1.000	T
AP3B1	8546	genome.wustl.edu	37	5	77590302	77590302	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:77590302G>A	ENST00000255194.6	-	1	277	c.102C>T	c.(100-102)ttC>ttT	p.F34F	AP3B1_ENST00000519295.1_5'UTR	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	34					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)	p.F34F(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TAAAGAGGCCGAAGGCCCCCG	0.612									Hermansky-Pudlak syndrome																													dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	62.0	59.0					5																	77590302		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.102C>T	5.37:g.77590302G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E5RJ68|O00580|Q7Z393|Q9HD66	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	p.F34	ENST00000255194.6	37	c.102	CCDS4041.1	5																																																																																			AP3B1	-	pirsf_AP3_complex_bsu	ENSG00000132842		0.612	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	109	0.00	0	G			77590302	77590302	-1	no_errors	ENST00000255194	ensembl	human	known	69_37n	silent	73	15.12	13	SNP	0.998	A
ARHGAP29	9411	genome.wustl.edu	37	1	94650459	94650459	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:94650459G>C	ENST00000260526.6	-	18	2260	c.2078C>G	c.(2077-2079)tCa>tGa	p.S693*	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	693	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)	p.S693*(2)		NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTCAATCTCTGAGGCACATAT	0.333																																						dbGAP											2	Substitution - Nonsense(2)	urinary_tract(1)|breast(1)											73.0	75.0	74.0					1																	94650459		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2078C>G	1.37:g.94650459G>C	ENSP00000260526:p.Ser693*	Somatic		WXS	Illumina GAIIx	Phase_IV	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.S693*	ENST00000260526.6	37	c.2078	CCDS748.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.744507	0.98465	.	.	ENSG00000137962	ENST00000260526	.	.	.	5.3	5.3	0.74995	.	0.301444	0.18352	N	0.143849	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-6.0973	18.9478	0.92628	0.0:0.0:1.0:0.0	.	.	.	.	X	693	.	ENSP00000260526:S693X	S	-	2	0	ARHGAP29	94423047	0.988000	0.35896	1.000000	0.80357	0.977000	0.68977	5.818000	0.69236	2.455000	0.83008	0.557000	0.71058	TCA	ARHGAP29	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000137962		0.333	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	167	0.00	0	G	NM_004815		94650459	94650459	-1	no_errors	ENST00000260526	ensembl	human	known	69_37n	nonsense	91	14.95	16	SNP	1.000	C
ARHGAP31	57514	genome.wustl.edu	37	3	119101244	119101244	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:119101244C>T	ENST00000264245.4	+	5	1069	c.537C>T	c.(535-537)ctC>ctT	p.L179L		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	179	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.L179L(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CAAACCTCCTCAGGTAACCAC	0.557																																					Pancreas(7;176 297 5394 51128 51241)	dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	62.0	59.0					3																	119101244		1931	4126	6057	-	-	-	SO:0001819	synonymous_variant	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.537C>T	3.37:g.119101244C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULL6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L179	ENST00000264245.4	37	c.537	CCDS43135.1	3																																																																																			ARHGAP31	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000031081		0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	113	0.00	0	C			119101244	119101244	+1	no_errors	ENST00000264245	ensembl	human	known	69_37n	silent	64	15.79	12	SNP	1.000	T
ARHGEF7	8874	genome.wustl.edu	37	13	111930018	111930018	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr13:111930018C>T	ENST00000375741.2	+	14	1817	c.1567C>T	c.(1567-1569)Cag>Tag	p.Q523*	ARHGEF7_ENST00000544132.1_Nonsense_Mutation_p.Q179*|ARHGEF7_ENST00000317133.5_Nonsense_Mutation_p.Q502*|ARHGEF7_ENST00000426073.2_Nonsense_Mutation_p.Q345*|ARHGEF7_ENST00000370623.3_Nonsense_Mutation_p.Q430*|ARHGEF7_ENST00000478679.1_Nonsense_Mutation_p.Q267*|ARHGEF7_ENST00000375737.5_Nonsense_Mutation_p.Q420*|ARHGEF7_ENST00000375723.1_Nonsense_Mutation_p.Q345*|ARHGEF7_ENST00000375736.4_Nonsense_Mutation_p.Q345*|ARHGEF7_ENST00000375739.2_Nonsense_Mutation_p.Q473*|ARHGEF7_ENST00000218789.5_Nonsense_Mutation_p.Q345*	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	523	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q345*(1)|p.Q502*(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CTTTATCTATCAGGTAAAACA	0.303																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											98.0	97.0	97.0					13																	111930018		2201	4300	6501	-	-	-	SO:0001587	stop_gained	0			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1567C>T	13.37:g.111930018C>T	ENSP00000364893:p.Gln523*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_CH-domain,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,prints_SH3_domain,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.Q523*	ENST00000375741.2	37	c.1567	CCDS45068.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.187263	0.98696	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000466143;ENST00000544132;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.5704	0.91133	0.0:1.0:0.0:0.0	.	.	.	.	X	502;523;473;430;500;345;179;345;345;345;420;345;267	.	ENSP00000218789:Q345X	Q	+	1	0	ARHGEF7	110728019	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.382000	0.79729	2.378000	0.81104	0.655000	0.94253	CAG	ARHGEF7	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000102606		0.303	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	ARHGEF7	HGNC	protein_coding		344	0.00	0	C	NM_001113511		111930018	111930018	+1	no_errors	ENST00000375741	ensembl	human	known	69_37n	nonsense	222	12.25	31	SNP	1.000	T
ARPC1A	10552	genome.wustl.edu	37	7	98951679	98951679	+	Silent	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:98951679G>C	ENST00000262942.5	+	6	772	c.648G>C	c.(646-648)ggG>ggC	p.G216G	ARPC1A_ENST00000471960.1_3'UTR|ARPC1A_ENST00000432884.2_Silent_p.G169G	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	216					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			CTGCCAGTGGGAGCCGCCTGG	0.587																																						dbGAP											0													58.0	60.0	59.0					7																	98951679		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.648G>C	7.37:g.98951679G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G216	ENST00000262942.5	37	c.648	CCDS5660.1	7																																																																																			ARPC1A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1	ENSG00000241685		0.587	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC1A	HGNC	protein_coding	OTTHUMT00000335908.1	109	0.90	1	G	NM_006409		98951679	98951679	+1	no_errors	ENST00000262942	ensembl	human	known	69_37n	silent	80	13.98	13	SNP	0.977	C
ARMC10	83787	genome.wustl.edu	37	7	102738803	102738803	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:102738803C>T	ENST00000323716.3	+	7	1227	c.835C>T	c.(835-837)Cga>Tga	p.R279*	ARMC10_ENST00000454559.1_Nonsense_Mutation_p.R185*|ARMC10_ENST00000425331.1_Nonsense_Mutation_p.R220*|ARMC10_ENST00000428183.2_Nonsense_Mutation_p.R220*|ARMC10_ENST00000441711.2_Nonsense_Mutation_p.R244*|ARMC10_ENST00000541300.1_Nonsense_Mutation_p.R161*	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	279					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R279*(2)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						GATTCTTCTTCGAGTACTTAC	0.343																																						dbGAP											2	Substitution - Nonsense(2)	NS(1)|breast(1)											73.0	65.0	67.0					7																	102738803		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.835C>T	7.37:g.102738803C>T	ENSP00000319412:p.Arg279*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Nonsense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.R279*	ENST00000323716.3	37	c.835	CCDS5728.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.008041	0.97998	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000434153;ENST00000431642	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7948	11.9574	0.52988	0.2764:0.7236:0.0:0.0	.	.	.	.	X	279;220;244;185;220;161;207;121	.	ENSP00000319412:R279X	R	+	1	2	ARMC10	102526039	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.632000	0.24583	2.709000	0.92574	0.591000	0.81541	CGA	ARMC10	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000170632		0.343	ARMC10-001	KNOWN	basic|CCDS	protein_coding	ARMC10	HGNC	protein_coding	OTTHUMT00000347882.1	142	0.00	0	C	NM_031905		102738803	102738803	+1	no_errors	ENST00000323716	ensembl	human	known	69_37n	nonsense	88	10.20	10	SNP	1.000	T
ASAP3	55616	genome.wustl.edu	37	1	23768756	23768756	+	Silent	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:23768756G>C	ENST00000336689.3	-	7	638	c.594C>G	c.(592-594)ctC>ctG	p.L198L	ASAP3_ENST00000437606.2_Silent_p.L189L	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	198					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.L198L(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CCCCGGCTTTGAGCAGATACT	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											91.0	75.0	80.0					1																	23768756		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.594C>G	1.37:g.23768756G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,prints_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP	p.L198	ENST00000336689.3	37	c.594	CCDS235.1	1																																																																																			ASAP3	-	NULL	ENSG00000088280		0.567	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP3	HGNC	protein_coding	OTTHUMT00000008916.2	226	0.00	0	G	NM_017707		23768756	23768756	-1	no_errors	ENST00000336689	ensembl	human	known	69_37n	silent	160	11.11	20	SNP	0.972	C
ASXL3	80816	genome.wustl.edu	37	18	31226305	31226305	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr18:31226305G>A	ENST00000269197.5	+	4	343	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E115K(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGCCCATGGAGAAGAAAATGG	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	129.0	130.0					18																	31226305		1902	4131	6033	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.343G>A	18.37:g.31226305G>A	ENSP00000269197:p.Glu115Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.E115K	ENST00000269197.5	37	c.343	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	15.13	2.743327	0.49151	.	.	ENSG00000141431	ENST00000269197	T	0.15603	2.41	5.06	5.06	0.68205	.	.	.	.	.	T	0.29423	0.0733	L	0.29908	0.895	0.41257	D	0.986753	D	0.63880	0.993	D	0.72625	0.978	T	0.03344	-1.1046	9	0.16420	T	0.52	.	18.8121	0.92061	0.0:0.0:1.0:0.0	.	115	Q9C0F0	ASXL3_HUMAN	K	115	ENSP00000269197:E115K	ENSP00000269197:E115K	E	+	1	0	ASXL3	29480303	1.000000	0.71417	0.944000	0.38274	0.396000	0.30629	7.103000	0.77014	2.509000	0.84616	0.650000	0.86243	GAA	ASXL3	-	NULL	ENSG00000141431		0.398	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	220	0.00	0	G			31226305	31226305	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	128	15.23	23	SNP	1.000	A
ATM	472	genome.wustl.edu	37	11	108200998	108200998	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:108200998G>A	ENST00000452508.2	+	51	7554	c.7365G>A	c.(7363-7365)ctG>ctA	p.L2455L	ATM_ENST00000278616.4_Silent_p.L2455L|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2455	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.L2455L(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TGCGTGCACTGAAAGAGGATC	0.378			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	2	Substitution - coding silent(2)	breast(2)											120.0	123.0	122.0					11																	108200998		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7365G>A	11.37:g.108200998G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L2455	ENST00000452508.2	37	c.7365	CCDS31669.1	11																																																																																			ATM	-	pfam_PIK-rel_kinase_FAT,superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000149311		0.378	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	187	0.53	1	G	NM_000051		108200998	108200998	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	silent	125	16.11	24	SNP	1.000	A
ATM	472	genome.wustl.edu	37	11	108206578	108206578	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:108206578G>A	ENST00000452508.2	+	57	8347	c.8158G>A	c.(8158-8160)Gat>Aat	p.D2720N	ATM_ENST00000278616.4_Missense_Mutation_p.D2720N|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2720	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.D2720N(2)|p.D2720H(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GAAGGGCCGTGATGACCTGAG	0.373			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	4	Substitution - Missense(4)	lung(2)|breast(2)											98.0	90.0	93.0					11																	108206578		2201	4298	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8158G>A	11.37:g.108206578G>A	ENSP00000388058:p.Asp2720Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.D2720N	ENST00000452508.2	37	c.8158	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.538813	0.96474	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.90955	-2.76;-2.76	5.47	5.47	0.80525	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.97349	0.9133	H	0.97315	3.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98548	1.0635	10	0.87932	D	0	.	19.3096	0.94182	0.0:0.0:1.0:0.0	.	2720	Q13315	ATM_HUMAN	N	2720	ENSP00000278616:D2720N;ENSP00000388058:D2720N	ENSP00000278616:D2720N	D	+	1	0	ATM	107711788	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.304000	0.96190	2.583000	0.87209	0.591000	0.81541	GAT	ATM	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000149311		0.373	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	146	0.67	1	G	NM_000051		108206578	108206578	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	80	13.98	13	SNP	1.000	A
ATRN	8455	genome.wustl.edu	37	20	3540081	3540081	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr20:3540081C>T	ENST00000262919.5	+	7	1222	c.1154C>T	c.(1153-1155)tCt>tTt	p.S385F	ATRN_ENST00000446916.2_Missense_Mutation_p.S385F	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	385					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.S385F(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						CTAAACCGTTCTGTGAACAAT	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											268.0	221.0	237.0					20																	3540081		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.1154C>T	20.37:g.3540081C>T	ENSP00000262919:p.Ser385Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Plexin_repeat,pfam_CUB,superfamily_C-type_lectin_fold,superfamily_CUB,superfamily_Plexin-like_fold,smart_EGF-like,smart_CUB,smart_Plexin-like,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.S385F	ENST00000262919.5	37	c.1154	CCDS13053.1	20	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281206	0.59758	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.65916	3.17;-0.18	5.02	5.02	0.67125	Kelch-type beta propeller (1);	0.201124	0.46145	D	0.000313	T	0.69540	0.3122	L	0.58101	1.795	0.49687	D	0.999817	B;P	0.50617	0.452;0.937	B;P	0.53809	0.243;0.735	T	0.72243	-0.4350	10	0.62326	D	0.03	-17.0179	14.625	0.68614	0.0:0.8536:0.1464:0.0	.	385;385	O75882;O75882-2	ATRN_HUMAN;.	F	385;385;311	ENSP00000262919:S385F;ENSP00000416587:S385F	ENSP00000262919:S385F	S	+	2	0	ATRN	3488081	0.998000	0.40836	0.997000	0.53966	0.985000	0.73830	4.772000	0.62324	2.612000	0.88384	0.591000	0.81541	TCT	ATRN	-	NULL	ENSG00000088812		0.378	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRN	HGNC	protein_coding	OTTHUMT00000077740.2	339	0.00	0	C	NM_139321		3540081	3540081	+1	no_errors	ENST00000262919	ensembl	human	known	69_37n	missense	267	11.00	33	SNP	0.998	T
BMI1	648	genome.wustl.edu	37	10	22616543	22616543	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:22616543G>C	ENST00000376663.3	+	4	734	c.229G>C	c.(229-231)Gat>Cat	p.D77H	COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.D220H	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	77					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)	p.D77H(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						AACTCTCCAAGATATTGTATA	0.274																																						dbGAP											1	Substitution - Missense(1)	breast(1)											47.0	56.0	53.0					10																	22616543		2185	4285	6470	-	-	-	SO:0001583	missense	0			BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.229G>C	10.37:g.22616543G>C	ENSP00000365851:p.Asp77His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16030|Q5T8Z3|Q96F37	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D77H	ENST00000376663.3	37	c.229	CCDS7138.1	10	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640421	0.47153	.	.	ENSG00000168283	ENST00000417470;ENST00000376663;ENST00000442508;ENST00000456675;ENST00000416820	T;T;T	0.37411	1.2;1.66;2.1	5.78	5.78	0.91487	Zinc finger, RING/FYVE/PHD-type (1);	0.043232	0.85682	D	0.000000	T	0.69296	0.3095	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.984	T	0.75124	-0.3428	10	0.87932	D	0	-8.7327	19.6126	0.95616	0.0:0.0:1.0:0.0	.	77;77	Q5U0M5;P35226	.;BMI1_HUMAN	H	77	ENSP00000365851:D77H;ENSP00000397912:D77H;ENSP00000399220:D77H	ENSP00000365851:D77H	D	+	1	0	BMI1	22656549	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	7.268000	0.78473	2.738000	0.93877	0.655000	0.94253	GAT	BMI1	-	NULL	ENSG00000168283		0.274	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMI1	HGNC	protein_coding	OTTHUMT00000047176.1	87	0.00	0	G	NM_005180		22616543	22616543	+1	no_errors	ENST00000376663	ensembl	human	known	69_37n	missense	75	11.76	10	SNP	1.000	C
C11orf30	56946	genome.wustl.edu	37	11	76255449	76255449	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:76255449G>C	ENST00000529032.1	+	18	2856	c.2856G>C	c.(2854-2856)caG>caC	p.Q952H	C11orf30_ENST00000343878.3_Missense_Mutation_p.Q952H|C11orf30_ENST00000524767.1_Missense_Mutation_p.Q967H|C11orf30_ENST00000334736.3_Missense_Mutation_p.Q952H|C11orf30_ENST00000525038.1_Missense_Mutation_p.Q953H|C11orf30_ENST00000525919.1_Missense_Mutation_p.Q953H|C11orf30_ENST00000524490.1_Missense_Mutation_p.Q854H|C11orf30_ENST00000533248.1_Missense_Mutation_p.Q861H			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	952	Gln-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q952H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						CTAAACAGCAGAAACTTAGCC	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	84.0	86.0					11																	76255449		2200	4292	6492	-	-	-	SO:0001583	missense	0			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.2856G>C	11.37:g.76255449G>C	ENSP00000432327:p.Gln952His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	pfam_ENT_N,pfscan_ENT_N	p.Q952H	ENST00000529032.1	37	c.2856	CCDS8244.1	11	.	.	.	.	.	.	.	.	.	.	G	12.35	1.910492	0.33721	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032;ENST00000532719	.	.	.	5.39	2.51	0.30379	.	0.200175	0.44688	D	0.000427	T	0.48642	0.1511	N	0.19112	0.55	0.33585	D	0.600408	D;D;D;D;D;D;D	0.61697	0.99;0.98;0.98;0.988;0.981;0.98;0.981	D;D;D;D;P;D;P	0.72982	0.979;0.948;0.948;0.977;0.592;0.948;0.592	T	0.57728	-0.7761	9	0.41790	T	0.15	-3.88	9.8403	0.40996	0.3003:0.0:0.6997:0.0	.	861;953;967;306;953;854;952	B7ZKT8;B7ZKU2;B7ZKU0;B3KWW8;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;.;EMSY_HUMAN	H	854;952;952;634;967;861;953;953;952;92	.	ENSP00000334130:Q952H	Q	+	3	2	C11orf30	75933097	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.140000	0.31516	0.395000	0.25257	-0.140000	0.14226	CAG	C11orf30	-	NULL	ENSG00000158636		0.527	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf30	HGNC	protein_coding	OTTHUMT00000383288.2	51	0.00	0	G	NM_020193		76255449	76255449	+1	no_errors	ENST00000334736	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	C
CFAP54	144535	genome.wustl.edu	37	12	97093812	97093812	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:97093812T>C	ENST00000524981.4	+	46	6438	c.6415T>C	c.(6415-6417)Tat>Cat	p.Y2139H				Q96N23	CL055_HUMAN		0								p.Y564H(1)									CCAAATTTTCTATGGAAAAAA	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	83.0	80.0					12																	97093812		2203	4299	6502	-	-	-	SO:0001583	missense	0																														ENST00000524981.4:c.6415T>C	12.37:g.97093812T>C	ENSP00000431759:p.Tyr2139His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Y564H	ENST00000524981.4	37	c.1690		12	.	.	.	.	.	.	.	.	.	.	T	7.337	0.620201	0.14193	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.96	-4.83	0.03161	.	1.542560	0.03471	N	0.213664	T	0.14874	0.0359	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20907	-1.0261	8	0.08837	T	0.75	-1.2571	5.618	0.17442	0.2848:0.4099:0.0:0.3053	.	564	Q6ZTY8	CL063_HUMAN	H	2139;564	.	ENSP00000345466:Y564H	Y	+	1	0	C12orf63	95617943	0.062000	0.20869	0.071000	0.20095	0.105000	0.19272	-0.348000	0.07740	-0.276000	0.09206	0.528000	0.53228	TAT	C12orf55	-	NULL	ENSG00000188596		0.328	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	132	0.00	0	T			97093812	97093812	+1	no_errors	ENST00000342887	ensembl	human	known	69_37n	missense	93	10.58	11	SNP	0.002	C
C14orf37	145407	genome.wustl.edu	37	14	58604848	58604848	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:58604848G>A	ENST00000267485.7	-	2	1423	c.1229C>T	c.(1228-1230)tCc>tTc	p.S410F	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	410						integral component of membrane (GO:0016021)		p.S410F(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						GTTCACAATGGAAACTTTCAT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	86.0	87.0					14																	58604848		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1229C>T	14.37:g.58604848G>A	ENSP00000267485:p.Ser410Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	NULL	p.S410F	ENST00000267485.7	37	c.1229	CCDS32089.1	14	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361173	0.61403	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.21191	2.02	5.86	4.05	0.47172	.	0.396968	0.24409	N	0.038772	T	0.20861	0.0502	M	0.62723	1.935	0.09310	N	1	B;P;B;B	0.41102	0.246;0.738;0.246;0.246	B;B;B;B	0.38562	0.086;0.276;0.086;0.086	T	0.21245	-1.0251	10	0.72032	D	0.01	-5.9321	6.4594	0.21948	0.1601:0.149:0.6909:0.0	.	448;410;410;410	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	F	410;448	ENSP00000267485:S410F	ENSP00000267485:S410F	S	-	2	0	C14orf37	57674601	0.032000	0.19561	0.019000	0.16419	0.317000	0.28152	2.076000	0.41548	0.837000	0.34925	0.655000	0.94253	TCC	C14orf37	-	NULL	ENSG00000139971		0.453	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	HGNC	protein_coding	OTTHUMT00000412059.1	99	0.00	0	G	NM_001001872		58604848	58604848	-1	no_errors	ENST00000267485	ensembl	human	known	69_37n	missense	77	13.48	12	SNP	0.002	A
C17orf77	146723	genome.wustl.edu	37	17	72588661	72588661	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr17:72588661G>A	ENST00000392620.1	+	3	838	c.476G>A	c.(475-477)gGa>gAa	p.G159E	C17orf77_ENST00000328023.2_Missense_Mutation_p.G159E|CD300LD_ENST00000375352.1_5'Flank	NM_152460.2	NP_689673.2	Q96MU5	CQ077_HUMAN	chromosome 17 open reading frame 77	159						extracellular region (GO:0005576)		p.G159E(1)		breast(2)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11						GAGCCAGGAGGAACCCAAGCA	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	86.0	93.0					17																	72588661		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32721.1	17q25.1	2006-01-16			ENSG00000182352	ENSG00000182352			26480	protein-coding gene	gene with protein product							Standard	NM_152460		Approved	FLJ31882	uc002jla.1	Q96MU5	OTTHUMG00000067611	ENST00000392620.1:c.476G>A	17.37:g.72588661G>A	ENSP00000376396:p.Gly159Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G159E	ENST00000392620.1	37	c.476	CCDS32721.1	17	.	.	.	.	.	.	.	.	.	.	G	4.818	0.152057	0.09185	.	.	ENSG00000182352	ENST00000392620;ENST00000328023	T;T	0.58652	0.32;0.32	1.53	1.53	0.23141	.	.	.	.	.	T	0.47820	0.1466	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	P	0.61722	0.893	T	0.31806	-0.9930	8	.	.	.	.	6.4737	0.22024	0.0:0.0:1.0:0.0	.	159	Q96MU5	CQ077_HUMAN	E	159	ENSP00000376396:G159E;ENSP00000329353:G159E	.	G	+	2	0	C17orf77	70100256	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	-0.795000	0.04580	1.149000	0.42402	0.609000	0.83330	GGA	C17orf77	-	NULL	ENSG00000182352		0.572	C17orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf77	HGNC	protein_coding	OTTHUMT00000145090.2	145	0.00	0	G	NM_152460		72588661	72588661	+1	no_errors	ENST00000328023	ensembl	human	known	69_37n	missense	76	14.61	13	SNP	0.005	A
CFAP74	85452	genome.wustl.edu	37	1	1855219	1855219	+	IGR	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:1855219C>G								TMEM52 (4507 upstream) : C1orf222 (64343 downstream)														p.E128Q(1)									CGCACCTTTTCAAAGAGCACC	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	139.0	141.0					1																	1855219		2202	4299	6501	-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.1855219C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_PapD-like	p.E745Q		37	c.2233		1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.097913	0.37048	.	.	ENSG00000142609	ENST00000493964	T	0.65364	-0.15	3.5	1.5	0.22942	.	0.582024	0.16300	N	0.220502	T	0.64000	0.2559	M	0.68317	2.08	0.19775	N	0.999958	P	0.51933	0.949	P	0.51701	0.677	T	0.53732	-0.8397	10	0.22706	T	0.39	.	8.8348	0.35107	0.0:0.7927:0.0:0.2073	.	128	Q69YW0	CA222_HUMAN	Q	745	ENSP00000417061:E745Q	ENSP00000417061:E745Q	E	-	1	0	C1orf222	1845079	0.000000	0.05858	0.597000	0.28824	0.818000	0.46254	0.322000	0.19576	0.577000	0.29470	0.313000	0.20887	GAA	C1orf222	-	superfamily_PapD-like	ENSG00000142609	0	0.632					C1orf222	HGNC			175	0.00	0	C			1855219	1855219	-1	no_start_codon	ENST00000493964	ensembl	human	putative	69_37n	missense	137	16.87	28	SNP	0.201	G
C1orf177	163747	genome.wustl.edu	37	1	55277548	55277548	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:55277548C>G	ENST00000371273.3	+	5	577	c.562C>G	c.(562-564)Cat>Gat	p.H188D	C1orf177_ENST00000358193.3_Missense_Mutation_p.H188D	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	188								p.H188D(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						GAACCGGTCTCATTCCGAGGG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	72.0	74.0					1																	55277548		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.562C>G	1.37:g.55277548C>G	ENSP00000360320:p.His188Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPL2|Q8N7Y9	Missense_Mutation	SNP	NULL	p.H188D	ENST00000371273.3	37	c.562	CCDS44153.1	1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723078	0.48728	.	.	ENSG00000162398	ENST00000358193;ENST00000371273	T;T	0.24908	1.83;1.83	5.08	5.08	0.68730	.	0.273612	0.30227	N	0.010111	T	0.42630	0.1211	L	0.56769	1.78	0.33247	D	0.558003	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.38001	-0.9681	10	0.08381	T	0.77	-14.3744	14.3194	0.66476	0.0:1.0:0.0:0.0	.	188;188	Q3ZCV2;Q3ZCV2-2	CA177_HUMAN;.	D	188	ENSP00000350924:H188D;ENSP00000360320:H188D	ENSP00000350924:H188D	H	+	1	0	C1orf177	55050136	0.267000	0.24122	0.972000	0.41901	0.910000	0.53928	2.462000	0.45049	2.512000	0.84698	0.555000	0.69702	CAT	C1orf177	-	NULL	ENSG00000162398		0.617	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf177	HGNC	protein_coding	OTTHUMT00000027674.1	70	0.00	0	C	NM_152607		55277548	55277548	+1	no_errors	ENST00000371273	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	0.978	G
C3orf20	84077	genome.wustl.edu	37	3	14725873	14725873	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:14725873C>T	ENST00000253697.3	+	4	1061	c.609C>T	c.(607-609)agC>agT	p.S203S	C3orf20_ENST00000435614.1_Silent_p.S81S|C3orf20_ENST00000412910.1_Silent_p.S81S	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	203						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.S203S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GCTACAGCAGCGGACAGTTGT	0.542																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	78.0	83.0					3																	14725873		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.609C>T	3.37:g.14725873C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L0U6|Q8NCP2|Q9H0I7	Silent	SNP	NULL	p.S203	ENST00000253697.3	37	c.609	CCDS33706.1	3																																																																																			C3orf20	-	NULL	ENSG00000131379		0.542	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf20	HGNC	protein_coding	OTTHUMT00000340586.1	114	0.00	0	C	NM_032137		14725873	14725873	+1	no_errors	ENST00000253697	ensembl	human	known	69_37n	silent	96	15.04	17	SNP	0.000	T
CACNA2D2	9254	genome.wustl.edu	37	3	50413289	50413289	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:50413289C>A	ENST00000479441.1	-	20	1795	c.1796G>T	c.(1795-1797)gGc>gTc	p.G599V	CACNA2D2_ENST00000266039.3_Missense_Mutation_p.G599V|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.G530V|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.G599V|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.G599V|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.G599V|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.G599V|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.G599V			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	599					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G599V(1)		breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GCCCTTGTTGCCATCAATCAT	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	84.0	88.0					3																	50413289		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.1796G>T	3.37:g.50413289C>A	ENSP00000418081:p.Gly599Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	pfam_VWA_N,pfam_VDCC_a2/dsu,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.G599V	ENST00000479441.1	37	c.1796	CCDS54588.1	3	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625542	0.87560	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	D;D;D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	4.68	4.68	0.58851	Voltage-dependent calcium channel, alpha-2/delta subunit, conserved region (1);	0.000000	0.85682	D	0.000000	D	0.91653	0.7362	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.76071	0.987;0.964	D	0.92779	0.6239	10	0.72032	D	0.01	-19.9516	17.1725	0.86833	0.0:1.0:0.0:0.0	.	599;599	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	V	599;599;599;530;599;599;599;599	ENSP00000407393:G599V;ENSP00000404631:G599V;ENSP00000266039:G599V;ENSP00000354228:G530V;ENSP00000390526:G599V;ENSP00000378519:G599V;ENSP00000390329:G599V;ENSP00000418081:G599V	ENSP00000266039:G599V	G	-	2	0	CACNA2D2	50388293	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	3.314000	0.51943	2.126000	0.65437	0.462000	0.41574	GGC	CACNA2D2	-	pfam_VDCC_a2/dsu	ENSG00000007402		0.617	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACNA2D2	HGNC	protein_coding	OTTHUMT00000346457.1	61	0.00	0	C	NM_006030		50413289	50413289	-1	no_errors	ENST00000435965	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	1.000	A
CCDC125	202243	genome.wustl.edu	37	5	68581193	68581193	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:68581193G>A	ENST00000396496.2	-	11	1308	c.1201C>T	c.(1201-1203)Caa>Taa	p.Q401*	CCDC125_ENST00000383374.2_Silent_p.L305L|CCDC125_ENST00000396499.1_Nonsense_Mutation_p.Q401*|CCDC125_ENST00000511257.1_Nonsense_Mutation_p.Q276*|CCDC125_ENST00000460090.1_5'UTR			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	401						cytoplasm (GO:0005737)		p.Q401*(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		AGGACCTCTTGAGGACTGTCC	0.473																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											156.0	143.0	148.0					5																	68581193		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.1201C>T	5.37:g.68581193G>A	ENSP00000379754:p.Gln401*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86Z19	Nonsense_Mutation	SNP	NULL	p.Q401*	ENST00000396496.2	37	c.1201	CCDS4000.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.168543	0.94768	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000511257	.	.	.	5.77	3.97	0.46021	.	0.522700	0.21056	N	0.080917	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-1.0999	15.7151	0.77661	0.0:0.2582:0.7418:0.0	.	.	.	.	X	401;401;276	.	ENSP00000379754:Q401X	Q	-	1	0	CCDC125	68616949	1.000000	0.71417	0.662000	0.29724	0.200000	0.23975	2.878000	0.48515	0.749000	0.32854	0.555000	0.69702	CAA	CCDC125	-	NULL	ENSG00000183323		0.473	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC125	HGNC	protein_coding	OTTHUMT00000254027.4	143	0.00	0	G	NM_176816		68581193	68581193	-1	no_errors	ENST00000396496	ensembl	human	known	69_37n	nonsense	107	10.08	12	SNP	0.999	A
CCDC168	643677	genome.wustl.edu	37	13	103385158	103385158	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr13:103385158C>G	ENST00000322527.2	-	1	4001	c.4002G>C	c.(4000-4002)caG>caC	p.Q1334H		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1334								p.Q1334H(1)									TCCCTTCTTTCTGATTCACAG	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	80.0	87.0					13																	103385158		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4002G>C	13.37:g.103385158C>G	ENSP00000320232:p.Gln1334His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N800	Missense_Mutation	SNP	NULL	p.Q1334H	ENST00000322527.2	37	c.4002		13	.	.	.	.	.	.	.	.	.	.	C	11.51	1.661496	0.29515	.	.	ENSG00000175820	ENST00000322527	T	0.04119	3.7	1.62	-0.251	0.13003	.	.	.	.	.	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	D	0.62365	0.991	P	0.54238	0.746	T	0.40232	-0.9574	9	0.72032	D	0.01	.	4.0606	0.09837	0.0:0.5845:0.0:0.4155	.	1334	Q8NDH2	CC168_HUMAN	H	1334	ENSP00000320232:Q1334H	ENSP00000320232:Q1334H	Q	-	3	2	CCDC168	102183159	0.004000	0.15560	0.005000	0.12908	0.337000	0.28794	-0.379000	0.07437	-0.136000	0.11475	0.460000	0.39030	CAG	CCDC168	-	NULL	ENSG00000175820		0.388	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		207	0.00	0	C	NM_001146197		103385158	103385158	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	missense	130	13.91	21	SNP	0.013	G
CCDC65	85478	genome.wustl.edu	37	12	49298848	49298848	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:49298848C>T	ENST00000320516.4	+	2	440	c.252C>T	c.(250-252)ctC>ctT	p.L84L	CCDC65_ENST00000266984.5_Silent_p.L84L|RP11-302B13.5_ENST00000398092.4_Intron	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	84								p.L84L(1)		breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						TTGAGATCCTCAGCCAAACAT	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											177.0	146.0	156.0					12																	49298848		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.252C>T	12.37:g.49298848C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Silent	SNP	NULL	p.L84	ENST00000320516.4	37	c.252	CCDS8772.1	12																																																																																			CCDC65	-	NULL	ENSG00000139537		0.433	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC65	HGNC	protein_coding	OTTHUMT00000408922.1	137	0.00	0	C	NM_033124		49298848	49298848	+1	no_errors	ENST00000266984	ensembl	human	known	69_37n	silent	76	18.28	17	SNP	1.000	T
CCT8	10694	genome.wustl.edu	37	21	30434457	30434457	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr21:30434457G>C	ENST00000286788.4	-	11	1410	c.1204C>G	c.(1204-1206)Ctt>Gtt	p.L402V	CCT8_ENST00000540844.1_Missense_Mutation_p.L329V|CCT8_ENST00000542732.1_Missense_Mutation_p.L383V|CCT8_ENST00000470450.1_5'UTR|AF129075.5_ENST00000457162.2_RNA	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	402					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)	p.L402V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						ACCCTTGTAAGAACTTTGAAA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	137.0	139.0					21																	30434457		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.1204C>G	21.37:g.30434457G>C	ENSP00000286788:p.Leu402Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_theta	p.L402V	ENST00000286788.4	37	c.1204	CCDS33528.1	21	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950457	0.73787	.	.	ENSG00000156261	ENST00000389159;ENST00000286788;ENST00000542732;ENST00000540844	T;T;T	0.79033	-1.23;-1.23;-1.23	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.81800	0.4899	L	0.43598	1.365	0.80722	D	1	D;P;D;D;P	0.58970	0.966;0.642;0.965;0.984;0.931	P;P;P;P;P	0.58820	0.846;0.456;0.834;0.745;0.558	T	0.76934	-0.2775	10	0.23302	T	0.38	-7.5273	19.1735	0.93590	0.0:0.0:1.0:0.0	.	329;383;402;401;402	B4DQH4;B4DEM7;Q53HU0;G5E9B2;P50990	.;.;.;.;TCPQ_HUMAN	V	401;402;383;329	ENSP00000286788:L402V;ENSP00000444984:L383V;ENSP00000442730:L329V	ENSP00000286788:L402V	L	-	1	0	CCT8	29356328	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.180000	0.77674	2.836000	0.97738	0.655000	0.94253	CTT	CCT8	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_theta	ENSG00000156261		0.393	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8	HGNC	protein_coding	OTTHUMT00000171822.1	275	0.00	0	G			30434457	30434457	-1	no_errors	ENST00000286788	ensembl	human	known	69_37n	missense	177	11.06	22	SNP	1.000	C
CDH1	999	genome.wustl.edu	37	16	68835596	68835596	+	Nonsense_Mutation	SNP	C	C	T	rs587783047		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr16:68835596C>T	ENST00000261769.5	+	3	378	c.187C>T	c.(187-189)Cga>Tga	p.R63*	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Nonsense_Mutation_p.R63*	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	63					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.R63G(1)|p.R63*(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TTGCACCGGTCGACAAAGGAC	0.448			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Unknown(2)|Substitution - Missense(1)|Substitution - Nonsense(1)	breast(3)|central_nervous_system(1)	GRCh37	CM980317	CDH1	M							164.0	153.0	156.0					16																	68835596		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.187C>T	16.37:g.68835596C>T	ENSP00000261769:p.Arg63*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R63*	ENST00000261769.5	37	c.187	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910855	0.92178	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.43	4.37	0.52481	.	0.335920	0.20846	N	0.084609	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	14.645	0.68754	0.1811:0.8189:0.0:0.0	.	.	.	.	X	63	.	ENSP00000261769:R63X	R	+	1	2	CDH1	67393097	0.000000	0.05858	0.219000	0.23793	0.537000	0.34900	1.123000	0.31308	2.707000	0.92482	0.561000	0.74099	CGA	CDH1	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like	ENSG00000039068		0.448	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	208	0.00	0	C	NM_004360		68835596	68835596	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	120	13.04	18	SNP	0.175	T
CDH10	1008	genome.wustl.edu	37	5	24511615	24511615	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:24511615G>A	ENST00000264463.4	-	6	1330	c.823C>T	c.(823-825)Cat>Tat	p.H275Y		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	275	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H275Y(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		ACTCGAAGATGAATAGTGTCT	0.418										HNSCC(23;0.051)																												dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	52.0	53.0					5																	24511615		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.823C>T	5.37:g.24511615G>A	ENSP00000264463:p.His275Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULB3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H275Y	ENST00000264463.4	37	c.823	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403505	0.83230	.	.	ENSG00000040731	ENST00000264463	T	0.52983	0.64	4.98	4.98	0.66077	Cadherin (4);Cadherin-like (1);	0.163445	0.52532	D	0.000062	T	0.53400	0.1794	L	0.31804	0.96	0.45883	D	0.998731	D	0.63880	0.993	P	0.59643	0.861	T	0.51490	-0.8699	10	0.36615	T	0.2	.	17.2256	0.86969	0.0:0.0:1.0:0.0	.	275	Q9Y6N8	CAD10_HUMAN	Y	275	ENSP00000264463:H275Y	ENSP00000264463:H275Y	H	-	1	0	CDH10	24547372	1.000000	0.71417	0.995000	0.50966	0.939000	0.58152	3.911000	0.56378	2.293000	0.77203	0.650000	0.86243	CAT	CDH10	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000040731		0.418	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	58	0.00	0	G	NM_006727		24511615	24511615	-1	no_errors	ENST00000264463	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	0.995	A
CDH19	28513	genome.wustl.edu	37	18	64221726	64221726	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr18:64221726C>T	ENST00000540086.1	-	4	772	c.526G>A	c.(526-528)Gac>Aac	p.D176N	CDH19_ENST00000262150.2_Missense_Mutation_p.D176N	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	283	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D176N(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				GAGGGATCGTCAGCATCACTT	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											128.0	120.0	122.0					18																	64221726		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.526G>A	18.37:g.64221726C>T	ENSP00000439593:p.Asp176Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O15098	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D176N	ENST00000540086.1	37	c.526	CCDS59325.1	18	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156435	0.38119	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.74002	-0.8;-0.8	5.17	5.17	0.71159	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.90628	0.7061	H	0.95437	3.67	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.93439	0.6792	10	0.87932	D	0	.	18.2464	0.89988	0.0:1.0:0.0:0.0	.	176;176	F5H1K0;Q9H159	.;CAD19_HUMAN	N	176;176;121	ENSP00000262150:D176N;ENSP00000439593:D176N	ENSP00000262150:D176N	D	-	1	0	CDH19	62372706	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	7.169000	0.77578	2.413000	0.81919	0.313000	0.20887	GAC	CDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000071991		0.383	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000442285.1	139	0.00	0	C	NM_021153		64221726	64221726	-1	no_errors	ENST00000262150	ensembl	human	known	69_37n	missense	102	13.56	16	SNP	1.000	T
CEP89	84902	genome.wustl.edu	37	19	33422303	33422303	+	Intron	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr19:33422303G>A	ENST00000305768.5	-	9	1118				CEP89_ENST00000590597.2_Missense_Mutation_p.S354L	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa						cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						TTAAAAATCTGAAAAGCTGAT	0.348																																						dbGAP											0													55.0	52.0	53.0					19																	33422303		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.1029+31C>T	19.37:g.33422303G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGA6|Q8N5J8	Missense_Mutation	SNP	NULL	p.S354L	ENST00000305768.5	37	c.1061	CCDS32987.1	19																																																																																			CEP89	-	NULL	ENSG00000121289		0.348	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	90	0.00	0	G	NM_032816		33422303	33422303	-1	no_errors	ENST00000590597	ensembl	human	known	69_37n	missense	77	14.44	13	SNP	0.000	A
CHD4	1108	genome.wustl.edu	37	12	6702638	6702638	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:6702638C>T	ENST00000357008.2	-	16	2621	c.2458G>A	c.(2458-2460)Gag>Aag	p.E820K	CHD4_ENST00000544040.1_Missense_Mutation_p.E813K|CHD4_ENST00000544484.1_Missense_Mutation_p.E817K|CHD4_ENST00000309577.6_Missense_Mutation_p.E820K	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	820	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						AAGGAGAACTCATTCTCTCGG	0.522																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													194.0	160.0	172.0					12																	6702638		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2458G>A	12.37:g.6702638C>T	ENSP00000349508:p.Glu820Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E820K	ENST00000357008.2	37	c.2458	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.351080	0.95830	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21	4.9	4.9	0.64082	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.97536	0.9193	M	0.92649	3.33	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.996	D;D;D	0.91635	0.994;0.999;0.987	D	0.98470	1.0600	10	0.87932	D	0	0.5914	18.278	0.90089	0.0:1.0:0.0:0.0	.	820;820;813	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	K	817;813;820;820;794	ENSP00000440392:E817K;ENSP00000440542:E813K;ENSP00000312419:E820K;ENSP00000349508:E820K	ENSP00000312419:E820K	E	-	1	0	CHD4	6572899	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.625000	0.83145	2.550000	0.86006	0.591000	0.81541	GAG	CHD4	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111642		0.522	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		149	0.67	1	C	NM_001273		6702638	6702638	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	84	17.65	18	SNP	1.000	T
CKAP5	9793	genome.wustl.edu	37	11	46786748	46786748	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:46786748G>C	ENST00000529230.1	-	28	3516	c.3470C>G	c.(3469-3471)tCc>tGc	p.S1157C	SNORD67_ENST00000390833.1_RNA|CKAP5_ENST00000312055.5_Missense_Mutation_p.S1157C|CKAP5_ENST00000415402.1_Missense_Mutation_p.S1157C|CKAP5_ENST00000354558.3_Missense_Mutation_p.S1157C			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1157					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)		p.S1157C(1)		breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AATAGGCCCGGATTTGTCTTC	0.403																																					Ovarian(4;85 273 2202 4844 13323)	dbGAP											1	Substitution - Missense(1)	breast(1)											189.0	172.0	178.0					11																	46786748		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.3470C>G	11.37:g.46786748G>C	ENSP00000432768:p.Ser1157Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.S1157C	ENST00000529230.1	37	c.3470	CCDS31477.1	11	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226302	0.58668	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.5	5.5	0.81552	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73024	0.3534	M	0.83384	2.64	0.54753	D	0.999981	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.984;0.997;0.997	T	0.75808	-0.3187	10	0.59425	D	0.04	-3.7436	19.4052	0.94644	0.0:0.0:1.0:0.0	.	1157;1157;1157	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	C	1157	ENSP00000432768:S1157C;ENSP00000395302:S1157C;ENSP00000310227:S1157C;ENSP00000346566:S1157C	ENSP00000310227:S1157C	S	-	2	0	CKAP5	46743324	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.197000	0.77814	2.600000	0.87896	0.563000	0.77884	TCC	CKAP5	-	superfamily_ARM-type_fold	ENSG00000175216		0.403	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1	332	0.00	0	G	NM_014756		46786748	46786748	-1	no_errors	ENST00000415402	ensembl	human	known	69_37n	missense	304	11.34	39	SNP	1.000	C
COL11A1	1301	genome.wustl.edu	37	1	103412488	103412488	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:103412488C>T	ENST00000370096.3	-	42	3505	c.3193G>A	c.(3193-3195)Gca>Aca	p.A1065T	COL11A1_ENST00000358392.2_Missense_Mutation_p.A1077T|COL11A1_ENST00000512756.1_Missense_Mutation_p.A949T|COL11A1_ENST00000353414.4_Missense_Mutation_p.A1026T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1065	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.A1065T(1)|p.A1077T(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCTGTACCTGCTGACCCACGT	0.468																																						dbGAP											2	Substitution - Missense(2)	breast(2)											36.0	35.0	35.0					1																	103412488		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3193G>A	1.37:g.103412488C>T	ENSP00000359114:p.Ala1065Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.A1077T	ENST00000370096.3	37	c.3229	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.232367	0.79688	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.94108	0.8111	L	0.35288	1.05	0.80722	D	1	D;D;D;D;D	0.71674	0.997;0.996;0.998;0.997;0.996	D;D;D;D;D	0.83275	0.996;0.993;0.995;0.989;0.993	D	0.94546	0.7749	10	0.56958	D	0.05	.	19.0317	0.92960	0.0:1.0:0.0:0.0	.	949;1026;1077;1065;285	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	T	1065;1077;1026;285;949	ENSP00000359114:A1065T;ENSP00000351163:A1077T;ENSP00000302551:A1026T;ENSP00000426533:A949T	ENSP00000302551:A1026T	A	-	1	0	COL11A1	103185076	1.000000	0.71417	0.995000	0.50966	0.867000	0.49689	7.722000	0.84778	2.580000	0.87095	0.650000	0.86243	GCA	COL11A1	-	NULL	ENSG00000060718		0.468	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	39	0.00	0	C	NM_080630		103412488	103412488	-1	no_errors	ENST00000358392	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	T
COPS6	10980	genome.wustl.edu	37	7	99687264	99687264	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:99687264G>T	ENST00000303904.3	+	3	266	c.229G>T	c.(229-231)Gag>Tag	p.E77*	COPS6_ENST00000418625.1_Nonsense_Mutation_p.E76*	NM_006833.4	NP_006824.2	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	77	MPN.				cullin deneddylation (GO:0010388)|viral process (GO:0016032)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.E77*(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|stomach(1)	12	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TGGCAAGCAGGAGGGCCGAAA	0.468																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											144.0	132.0	136.0					7																	99687264		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC002520	CCDS5682.1	7q22.1	2013-03-14	2013-03-14		ENSG00000168090	ENSG00000168090			21749	protein-coding gene	gene with protein product	"""COP9 subunit 6 (MOV34 homolog, 34 kD)"""	614729	"""COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)"""			12477932	Standard	NM_006833		Approved	MOV34-34KD, CSN6	uc003usu.3	Q7L5N1	OTTHUMG00000154632	ENST00000303904.3:c.229G>T	7.37:g.99687264G>T	ENSP00000304102:p.Glu77*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A3|O15387	Nonsense_Mutation	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.E77*	ENST00000303904.3	37	c.229	CCDS5682.1	7	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673678	0.88445	.	.	ENSG00000168090	ENST00000303904;ENST00000418625	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.6497	17.8477	0.88736	0.0:0.0:1.0:0.0	.	.	.	.	X	77;76	.	ENSP00000304102:E77X	E	+	1	0	COPS6	99525200	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.978000	0.93450	2.826000	0.97356	0.655000	0.94253	GAG	COPS6	-	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	ENSG00000168090		0.468	COPS6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COPS6	HGNC	protein_coding	OTTHUMT00000336412.3	179	0.00	0	G	NM_006833		99687264	99687264	+1	no_errors	ENST00000303904	ensembl	human	known	69_37n	nonsense	108	14.29	18	SNP	1.000	T
CORO7	79585	genome.wustl.edu	37	16	4415517	4415517	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr16:4415517G>T	ENST00000251166.4	-	10	960	c.815C>A	c.(814-816)tCt>tAt	p.S272Y	CORO7_ENST00000574025.1_Missense_Mutation_p.S187Y|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.S272Y|CORO7_ENST00000539968.1_Missense_Mutation_p.S52Y|CORO7_ENST00000423908.2_Missense_Mutation_p.S104Y|CORO7_ENST00000537233.2_Missense_Mutation_p.S254Y	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	272					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)	p.S272Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						CAGGAGCCCAGAGTCAGGGTC	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	40.0	40.0					16																	4415517		2177	4289	6466	-	-	-	SO:0001583	missense	0			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.815C>A	16.37:g.4415517G>T	ENSP00000251166:p.Ser272Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	pfam_DUF1900,pfam_Protein_transpt,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S272Y	ENST00000251166.4	37	c.815	CCDS10513.1	16	.	.	.	.	.	.	.	.	.	.	G	17.08	3.296518	0.60086	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968;ENST00000423908	T;T;T	0.32023	4.9;1.47;4.9	4.98	4.98	0.66077	WD40/YVTN repeat-like-containing domain (1);Domain of unknown function DUF1900 (1);	4.534520	0.00741	N	0.001008	T	0.66416	0.2787	M	0.85859	2.78	0.44508	D	0.997453	D;D;D;D;D;D	0.76494	0.998;0.999;0.991;0.989;0.975;0.991	D;D;P;P;P;P	0.87578	0.916;0.998;0.873;0.832;0.857;0.883	T	0.41787	-0.9489	10	0.87932	D	0	-22.6185	13.76	0.62959	0.0:0.0:1.0:0.0	.	187;254;52;52;272;253	P57737-2;B4DFD6;B3KSY4;B3KUH7;P57737;B4DKU9	.;.;.;.;CORO7_HUMAN;.	Y	272;187;52;104	ENSP00000251166:S272Y;ENSP00000446221:S52Y;ENSP00000391530:S104Y	ENSP00000251166:S272Y	S	-	2	0	CORO7	4355518	1.000000	0.71417	0.974000	0.42286	0.292000	0.27327	4.864000	0.62990	2.298000	0.77334	0.462000	0.41574	TCT	CORO7	-	pfam_DUF1900	ENSG00000103426		0.637	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7	HGNC	protein_coding	OTTHUMT00000251628.2	114	0.00	0	G	NM_024535		4415517	4415517	-1	no_errors	ENST00000572467	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	0.995	T
CPA3	1359	genome.wustl.edu	37	3	148603939	148603939	+	Silent	SNP	C	C	A	rs570897012		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:148603939C>A	ENST00000296046.3	+	10	1093	c.1041C>A	c.(1039-1041)atC>atA	p.I347I	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	347					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.I347I(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			CCCGCTACATCTATGGCCCAA	0.338																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											110.0	103.0	106.0					3																	148603939		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.1041C>A	3.37:g.148603939C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96E94	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.I347	ENST00000296046.3	37	c.1041	CCDS3138.1	3																																																																																			CPA3	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000163751		0.338	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA3	HGNC	protein_coding	OTTHUMT00000355974.1	234	0.00	0	C	NM_001870		148603939	148603939	+1	no_errors	ENST00000296046	ensembl	human	known	69_37n	silent	175	10.71	21	SNP	0.976	A
CPLX4	339302	genome.wustl.edu	37	18	56985530	56985530	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr18:56985530C>G	ENST00000299721.3	-	1	351	c.165G>C	c.(163-165)gaG>gaC	p.E55D	CPLX4_ENST00000587244.1_Missense_Mutation_p.E55D	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	55					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)		p.E55D(1)		autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				GTACTCACTTCTCCTCAATCA	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											214.0	194.0	201.0					18																	56985530		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.165G>C	18.37:g.56985530C>G	ENSP00000299721:p.Glu55Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	F1T0L6	Missense_Mutation	SNP	pfam_Synaphin	p.E55D	ENST00000299721.3	37	c.165	CCDS11973.1	18	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537888	0.65085	.	.	ENSG00000166569	ENST00000299721	.	.	.	5.25	2.16	0.27623	.	0.045255	0.85682	N	0.000000	T	0.54759	0.1878	M	0.66297	2.02	0.54753	D	0.999989	B	0.16603	0.018	B	0.20184	0.028	T	0.48581	-0.9023	9	0.49607	T	0.09	-17.5776	5.3961	0.16271	0.1351:0.575:0.0:0.2899	.	55	Q7Z7G2	CPLX4_HUMAN	D	55	.	ENSP00000299721:E55D	E	-	3	2	CPLX4	55136510	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	0.494000	0.22467	0.189000	0.20188	0.655000	0.94253	GAG	CPLX4	-	pfam_Synaphin	ENSG00000166569		0.388	CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPLX4	HGNC	protein_coding	OTTHUMT00000256127.1	279	0.00	0	C	NM_181654		56985530	56985530	-1	no_errors	ENST00000299721	ensembl	human	known	69_37n	missense	209	14.34	35	SNP	1.000	G
CPSF7	79869	genome.wustl.edu	37	11	61187439	61187439	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:61187439C>T	ENST00000394888.4	-	5	677	c.505G>A	c.(505-507)Gag>Aag	p.E169K	CPSF7_ENST00000340437.4_Missense_Mutation_p.E212K|CPSF7_ENST00000439958.3_Missense_Mutation_p.E169K|CPSF7_ENST00000448745.1_Missense_Mutation_p.E169K	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	169					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E169K(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						GCCTGTGCCTCAAACTGTGAC	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	134.0	133.0					11																	61187439		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.505G>A	11.37:g.61187439C>T	ENSP00000378352:p.Glu169Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E212K	ENST00000394888.4	37	c.634	CCDS44619.1	11	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403421	0.83230	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000477890;ENST00000539952;ENST00000544585;ENST00000413232	T;T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	6.06	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.67924	0.2945	L	0.60455	1.87	0.80722	D	1	P;B;B;B	0.38473	0.633;0.096;0.154;0.154	B;B;B;B	0.30782	0.12;0.014;0.048;0.019	T	0.71424	-0.4597	10	0.62326	D	0.03	-5.3008	13.0897	0.59160	0.0:0.9257:0.0:0.0743	.	169;169;212;169	B4DGF8;Q8N684;Q8N684-3;Q8N684-2	.;CPSF7_HUMAN;.;.	K	212;169;169;169;169;169;169;169	ENSP00000345412:E212K;ENSP00000378352:E169K;ENSP00000397203:E169K;ENSP00000407394:E169K;ENSP00000437860:E169K;ENSP00000438381:E169K;ENSP00000437531:E169K;ENSP00000393828:E169K	ENSP00000345412:E212K	E	-	1	0	CPSF7	60944015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.356000	0.73046	1.567000	0.49668	0.650000	0.86243	GAG	CPSF7	-	NULL	ENSG00000149532		0.527	CPSF7-006	KNOWN	basic|CCDS	protein_coding	CPSF7	HGNC	protein_coding	OTTHUMT00000347835.2	191	0.00	0	C	NM_024811		61187439	61187439	-1	no_errors	ENST00000340437	ensembl	human	known	69_37n	missense	131	10.88	16	SNP	1.000	T
CSMD1	64478	genome.wustl.edu	37	8	3045463	3045463	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr8:3045463C>T	ENST00000520002.1	-	37	6106	c.5551G>A	c.(5551-5553)Gag>Aag	p.E1851K	CSMD1_ENST00000602723.1_Missense_Mutation_p.E1851K|CSMD1_ENST00000400186.3_Missense_Mutation_p.E1851K|CSMD1_ENST00000542608.1_Missense_Mutation_p.E1850K|CSMD1_ENST00000602557.1_Missense_Mutation_p.E1851K|CSMD1_ENST00000539096.1_Missense_Mutation_p.E1850K|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Missense_Mutation_p.E1850K			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1851	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.			IQVISFATEQNWDSL -> DPSDQFCHGAELGLPF (in Ref. 1; AAK73475/AAG52948). {ECO:0000305}.		integral component of membrane (GO:0016021)		p.E1850K(1)|p.E1579K(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CAGTTCTGCTCCGTGGCAAAA	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											55.0	54.0	54.0					8																	3045463		1891	4148	6039	-	-	-	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5551G>A	8.37:g.3045463C>T	ENSP00000430733:p.Glu1851Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.E1851K	ENST00000520002.1	37	c.5551		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.0|29.0	4.971755|4.971755	0.92919|0.92919	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551;ENST00000318252	T;T;T;T;T|.	0.66099|.	-0.19;-0.19;-0.19;-0.19;-0.19|.	5.13|5.13	5.13|5.13	0.70059|0.70059	CUB (5);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.80969|0.80969	0.4726|0.4726	M|M	0.92459|0.92459	3.31|3.31	0.80722|0.80722	D|D	1|1	D;D;P|.	0.69078|.	0.997;0.989;0.755|.	D;D;P|.	0.80764|.	0.994;0.976;0.809|.	T|T	0.80415|0.80415	-0.1392|-0.1392	10|6	0.39692|0.02654	T|T	0.17|1	.|.	18.9493|18.9493	0.92636|0.92636	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1851;1851;1851|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	K|E	1851;1851;1850;1850;1850|1330;1713	ENSP00000383047:E1851K;ENSP00000430733:E1851K;ENSP00000441462:E1850K;ENSP00000446243:E1850K;ENSP00000441675:E1850K|.	ENSP00000383047:E1851K|ENSP00000320445:G1713E	E|G	-|-	1|2	0|0	CSMD1|CSMD1	3032870|3032870	1.000000|1.000000	0.71417|0.71417	0.924000|0.924000	0.36721|0.36721	0.579000|0.579000	0.36224|0.36224	7.474000|7.474000	0.81024|0.81024	2.539000|2.539000	0.85634|0.85634	0.637000|0.637000	0.83480|0.83480	GAG|GGA	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.448	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	66	0.00	0	C	NM_033225		3045463	3045463	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	T
CTGF	1490	genome.wustl.edu	37	6	132271151	132271151	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:132271151C>G	ENST00000367976.3	-	4	891	c.691G>C	c.(691-693)Gag>Cag	p.E231Q	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	231	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)	p.E231Q(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		CTCTGCTTCTCTAGCCTGCAG	0.537											OREG0017666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(127;510 1660 12817 24400 38449)	dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	59.0	61.0					6																	132271151		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.691G>C	6.37:g.132271151C>G	ENSP00000356954:p.Glu231Gln	Somatic	1594	WXS	Illumina GAIIx	Phase_IV	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	pfam_Cys_knot,pfam_IGFBP-like,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.E231Q	ENST00000367976.3	37	c.691	CCDS5151.1	6	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519022	0.85495	.	.	ENSG00000118523	ENST00000367976	T	0.55413	0.52	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.60143	0.2246	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59710	-0.7403	10	0.54805	T	0.06	.	20.0769	0.97748	0.0:1.0:0.0:0.0	.	231	P29279	CTGF_HUMAN	Q	231	ENSP00000356954:E231Q	ENSP00000356954:E231Q	E	-	1	0	CTGF	132312844	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.818000	0.86416	2.820000	0.97059	0.650000	0.86243	GAG	CTGF	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pirsf_IGFBP_CNN,pfscan_Thrombospondin_1_rpt	ENSG00000118523		0.537	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTGF	HGNC	protein_coding	OTTHUMT00000042239.2	116	0.00	0	C	NM_001901		132271151	132271151	-1	no_errors	ENST00000367976	ensembl	human	known	69_37n	missense	88	12.00	12	SNP	1.000	G
CXorf58	254158	genome.wustl.edu	37	X	23934361	23934361	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:23934361C>A	ENST00000379211.3	+	5	888	c.339C>A	c.(337-339)ttC>ttA	p.F113L		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	113								p.F113L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						TTCCACCTTTCATCGTGTTTA	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	90.0	95.0					X																	23934361		2202	4298	6500	-	-	-	SO:0001583	missense	0			AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.339C>A	X.37:g.23934361C>A	ENSP00000368511:p.Phe113Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.F113L	ENST00000379211.3	37	c.339	CCDS14209.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	7.906|7.906	0.735517|0.735517	0.15574|0.15574	.|.	.|.	ENSG00000165182|ENSG00000165182	ENST00000379211|ENST00000435707	T|.	0.28454|.	1.61|.	5.0|5.0	1.72|1.72	0.24424|0.24424	.|.	0.352413|.	0.22693|.	N|.	0.056786|.	T|T	0.37433|0.37433	0.1003|0.1003	L|L	0.51422|0.51422	1.61|1.61	0.24748|0.24748	N|N	0.992996|0.992996	P;P|.	0.42941|.	0.655;0.794|.	B;B|.	0.43052|.	0.269;0.406|.	T|T	0.27739|0.27739	-1.0065|-1.0065	10|5	0.27082|.	T|.	0.32|.	-0.3733|-0.3733	4.4583|4.4583	0.11654|0.11654	0.0:0.524:0.1796:0.2964|0.0:0.524:0.1796:0.2964	.|.	113;113|.	B7ZLS7;Q96LI9|.	.;CX058_HUMAN|.	L|N	113|87	ENSP00000368511:F113L|.	ENSP00000368511:F113L|.	F|H	+|+	3|1	2|0	CXorf58|CXorf58	23844282|23844282	0.991000|0.991000	0.36638|0.36638	0.994000|0.994000	0.49952|0.49952	0.928000|0.928000	0.56348|0.56348	0.006000|0.006000	0.13152|0.13152	0.358000|0.358000	0.24211|0.24211	0.411000|0.411000	0.27672|0.27672	TTC|CAT	CXorf58	-	NULL	ENSG00000165182		0.338	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf58	HGNC	protein_coding	OTTHUMT00000056071.1	255	0.00	0	C	NM_152761		23934361	23934361	+1	no_errors	ENST00000379211	ensembl	human	known	69_37n	missense	182	10.78	22	SNP	0.996	A
CUL4B	8450	genome.wustl.edu	37	X	119678470	119678470	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:119678470G>A	ENST00000404115.3	-	8	1404	c.1003C>T	c.(1003-1005)Cat>Tat	p.H335Y	CUL4B_ENST00000336592.6_Missense_Mutation_p.H322Y|CUL4B_ENST00000371322.5_Missense_Mutation_p.H317Y|snoU13_ENST00000605987.1_RNA	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	335					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.H317Y(1)|p.H335Y(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CTTATAATATGAGCCCTAAAT	0.338																																						dbGAP											2	Substitution - Missense(2)	breast(2)											79.0	76.0	77.0					X																	119678470		2202	4300	6502	-	-	-	SO:0001583	missense	0			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.1003C>T	X.37:g.119678470G>A	ENSP00000384109:p.His335Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.H335Y	ENST00000404115.3	37	c.1003	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	G	13.35	2.212081	0.39102	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115;ENST00000371323	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.82	5.82	0.92795	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.045854	0.85682	D	0.000000	T	0.74741	0.3756	L	0.52905	1.665	0.58432	D	0.999996	B;B;B	0.16396	0.0;0.017;0.007	B;B;B	0.16722	0.001;0.016;0.01	T	0.68743	-0.5328	9	.	.	.	-15.8842	17.9309	0.88998	0.0:0.0:1.0:0.0	.	139;335;317	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	Y	317;322;335;139	ENSP00000360373:H317Y;ENSP00000338919:H322Y;ENSP00000384109:H335Y;ENSP00000360374:H139Y	.	H	-	1	0	CUL4B	119562498	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.219000	0.78000	2.456000	0.83038	0.600000	0.82982	CAT	CUL4B	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	ENSG00000158290		0.338	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	80	0.00	0	G	NM_003588		119678470	119678470	-1	no_errors	ENST00000404115	ensembl	human	known	69_37n	missense	76	13.64	12	SNP	1.000	A
CYP11A1	1583	genome.wustl.edu	37	15	74631005	74631005	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr15:74631005G>A	ENST00000268053.6	-	8	1495	c.1341C>T	c.(1339-1341)atC>atT	p.I447I	CYP11A1_ENST00000358632.4_Silent_p.I289I|CYP11A1_ENST00000419019.2_Silent_p.I289I	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	447					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.I447I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	GGAAGTAGGTGATGTTCTTGT	0.552																																					Esophageal Squamous(87;818 1337 4093 9268 37314)	dbGAP											1	Substitution - coding silent(1)	breast(1)											168.0	150.0	156.0					15																	74631005		2198	4297	6495	-	-	-	SO:0001819	synonymous_variant	0			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.1341C>T	15.37:g.74631005G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_mitochondrial,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.I447	ENST00000268053.6	37	c.1341	CCDS32291.1	15																																																																																			CYP11A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000140459		0.552	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	HGNC	protein_coding	OTTHUMT00000319737.1	214	0.00	0	G			74631005	74631005	-1	no_errors	ENST00000268053	ensembl	human	known	69_37n	silent	145	14.71	25	SNP	0.003	A
CYP3A43	64816	genome.wustl.edu	37	7	99457509	99457509	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:99457509G>C	ENST00000354829.2	+	10	1025	c.922G>C	c.(922-924)Gac>Cac	p.D308H	CYP3A43_ENST00000444905.1_Missense_Mutation_p.D55H|CYP3A43_ENST00000312017.5_Missense_Mutation_p.D308H|CYP3A43_ENST00000477658.1_3'UTR|CYP3A43_ENST00000415413.1_Missense_Mutation_p.D97H|CYP3A43_ENST00000417625.1_Missense_Mutation_p.D198H|CYP3A43_ENST00000342499.4_Missense_Mutation_p.D168H|CYP3A43_ENST00000222382.5_Missense_Mutation_p.D308H	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43	308			Missing (in allele CYP3A43*2).		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)	p.D308H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	TGCTGCCTATGACACAACTAG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											214.0	195.0	201.0					7																	99457509		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.922G>C	7.37:g.99457509G>C	ENSP00000346887:p.Asp308His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.D308H	ENST00000354829.2	37	c.922	CCDS5676.1	7	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218769	0.58560	.	.	ENSG00000021461	ENST00000354829;ENST00000417625;ENST00000342499;ENST00000444905;ENST00000415413;ENST00000312017;ENST00000222382	T;T;T;T;D;T;T	0.84516	-0.74;-0.74;-0.74;-0.74;-1.86;-0.74;-0.74	2.49	2.49	0.30216	.	0.052895	0.64402	D	0.000001	D	0.90621	0.7059	M	0.77313	2.365	0.42100	D	0.991331	P;D;D;D;D	0.71674	0.832;0.997;0.993;0.998;0.998	P;D;D;D;D	0.73708	0.601;0.964;0.919;0.981;0.981	D	0.91358	0.5109	10	0.87932	D	0	.	11.0606	0.47944	0.0:0.0:1.0:0.0	.	198;168;308;308;308	Q495Y1;F8W6L8;Q9HB55-3;Q75MK2;Q9HB55	.;.;.;.;CP343_HUMAN	H	308;198;168;55;97;308;308	ENSP00000346887:D308H;ENSP00000416581:D198H;ENSP00000345351:D168H;ENSP00000405557:D55H;ENSP00000401521:D97H;ENSP00000312110:D308H;ENSP00000222382:D308H	ENSP00000222382:D308H	D	+	1	0	CYP3A43	99295445	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	5.705000	0.68355	1.694000	0.51137	0.205000	0.17691	GAC	CYP3A43	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	ENSG00000021461		0.448	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP3A43	HGNC	protein_coding	OTTHUMT00000344379.1	210	0.00	0	G			99457509	99457509	+1	no_errors	ENST00000222382	ensembl	human	known	69_37n	missense	177	11.94	24	SNP	1.000	C
DCAF4L2	138009	genome.wustl.edu	37	8	88885220	88885220	+	Missense_Mutation	SNP	C	C	T	rs537310751	byFrequency	TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr8:88885220C>T	ENST00000319675.3	-	1	1076	c.980G>A	c.(979-981)gGa>gAa	p.G327E		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	327								p.G327E(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CGCCACGACTCCTTCTTCTTC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	85.0	84.0					8																	88885220		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.980G>A	8.37:g.88885220C>T	ENSP00000316496:p.Gly327Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G327E	ENST00000319675.3	37	c.980	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	C	14.01	2.408789	0.42715	.	.	ENSG00000176566	ENST00000319675	T	0.58210	0.35	1.39	-1.14	0.09741	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.051507	0.85682	N	0.000000	T	0.49372	0.1553	M	0.78637	2.42	0.39283	D	0.964606	B	0.28636	0.218	B	0.36030	0.216	T	0.28650	-1.0037	10	0.32370	T	0.25	.	5.7951	0.18381	0.0:0.6809:0.0:0.3191	.	327	Q8NA75	DC4L2_HUMAN	E	327	ENSP00000316496:G327E	ENSP00000316496:G327E	G	-	2	0	DCAF4L2	88954336	1.000000	0.71417	0.002000	0.10522	0.032000	0.12392	4.876000	0.63079	-0.623000	0.05618	-0.373000	0.07131	GGA	DCAF4L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000176566		0.567	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	138	0.00	0	C	NM_152418		88885220	88885220	-1	no_errors	ENST00000319675	ensembl	human	known	69_37n	missense	105	12.50	15	SNP	0.995	T
DCLRE1C	64421	genome.wustl.edu	37	10	14951176	14951176	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:14951176C>G	ENST00000378278.2	-	14	1347	c.1310G>C	c.(1309-1311)aGa>aCa	p.R437T	DCLRE1C_ENST00000378249.1_Missense_Mutation_p.R322T|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.R317T|DCLRE1C_ENST00000378242.1_Missense_Mutation_p.R90T|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.R317T|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.R317T|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.R322T|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.R317T|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.R317T|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.R322T|DCLRE1C_ENST00000492201.1_5'UTR			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	437					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.R322T(1)|p.R437T(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						ACACTCTGCTCTGCAGCATCC	0.433								Non-homologous end-joining																														dbGAP											2	Substitution - Missense(2)	breast(2)											94.0	95.0	95.0					10																	14951176		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1310G>C	10.37:g.14951176C>G	ENSP00000367527:p.Arg437Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	pfam_DRMBL	p.R437T	ENST00000378278.2	37	c.1310	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	C	3.486	-0.104972	0.06967	.	.	ENSG00000152457	ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000378242	T;T;T;T;T;T;T;T;T	0.75704	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.96;-0.4	5.67	0.289	0.15723	.	1.681230	0.02293	N	0.070486	T	0.62466	0.2430	N	0.19112	0.55	0.09310	N	1	B;B	0.30973	0.302;0.072	B;B	0.25140	0.058;0.009	T	0.55988	-0.8053	10	0.66056	D	0.02	.	10.8194	0.46595	0.0:0.3753:0.0:0.6247	.	322;437	Q96SD1-3;Q96SD1	.;DCR1C_HUMAN	T	317;322;322;322;317;317;317;437;317;90	ENSP00000400529:R317T;ENSP00000367492:R322T;ENSP00000350349:R322T;ENSP00000367496:R322T;ENSP00000380030:R317T;ENSP00000367503:R317T;ENSP00000367502:R317T;ENSP00000367527:R437T;ENSP00000367506:R317T	ENSP00000350349:R322T	R	-	2	0	DCLRE1C	14991182	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.388000	0.07352	0.103000	0.17682	-0.302000	0.09304	AGA	DCLRE1C	-	NULL	ENSG00000152457		0.433	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	165	0.60	1	C	NM_022487		14951176	14951176	-1	no_errors	ENST00000378278	ensembl	human	known	69_37n	missense	138	13.21	21	SNP	0.000	G
DDX3X	1654	genome.wustl.edu	37	X	41204737	41204737	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:41204737G>A	ENST00000399959.2	+	12	2106	c.1251G>A	c.(1249-1251)caG>caA	p.Q417Q	DDX3X_ENST00000542215.1_3'UTR|DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000457138.2_Silent_p.Q401Q|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000478993.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	417	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)	p.Q417Q(1)		NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						ACATCACACAGAAAGTAGTTT	0.358										HNSCC(61;0.18)																												dbGAP											1	Substitution - coding silent(1)	breast(1)											90.0	88.0	89.0					X																	41204737		2087	4223	6310	-	-	-	SO:0001819	synonymous_variant	0			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1251G>A	X.37:g.41204737G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K538|B4E3E8|O15536	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q417	ENST00000399959.2	37	c.1251	CCDS43931.1	X																																																																																			DDX3X	-	smart_Helicase_ATP-bd,pfscan_Helicase_C	ENSG00000215301		0.358	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	HGNC	protein_coding	OTTHUMT00000056253.1	202	0.49	1	G	NM_024005		41204737	41204737	+1	no_errors	ENST00000399959	ensembl	human	known	69_37n	silent	148	12.35	21	SNP	1.000	A
DENND3	22898	genome.wustl.edu	37	8	142166000	142166000	+	Missense_Mutation	SNP	C	C	G	rs148661685		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr8:142166000C>G	ENST00000262585.2	+	8	1165	c.887C>G	c.(886-888)tCc>tGc	p.S296C	DENND3_ENST00000519811.1_Missense_Mutation_p.S376C|DENND3_ENST00000424248.1_Missense_Mutation_p.S296C	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	296					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S296C(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			ATCACCTACTCCAAGTCCACG	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	112.0	114.0					8																	142166000		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.887C>G	8.37:g.142166000C>G	ENSP00000262585:p.Ser296Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_WD40_repeat,pfam_uDENN_dom,superfamily_WD40_repeat_dom,smart_DENN_dom,smart_dDENN_dom,smart_WD40_repeat,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_WD40_repeat_dom	p.S296C	ENST00000262585.2	37	c.887	CCDS34947.1	8	.	.	.	.	.	.	.	.	.	.	C	15.10	2.734490	0.48939	.	.	ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811	T;T;T	0.16457	2.75;2.34;2.74	5.15	5.15	0.70609	.	0.054969	0.85682	D	0.000000	T	0.34832	0.0911	L	0.40543	1.245	0.50632	D	0.99988	D;D	0.89917	1.0;0.964	D;P	0.74023	0.982;0.634	T	0.03384	-1.1042	10	0.56958	D	0.05	-16.0842	18.582	0.91174	0.0:1.0:0.0:0.0	.	376;296	E9PF32;A2RUS2	.;DEND3_HUMAN	C	296;296;376	ENSP00000262585:S296C;ENSP00000410594:S296C;ENSP00000428714:S376C	ENSP00000262585:S296C	S	+	2	0	DENND3	142235182	0.984000	0.35163	0.035000	0.18076	0.044000	0.14063	3.865000	0.56033	2.553000	0.86117	0.655000	0.94253	TCC	DENND3	-	NULL	ENSG00000105339		0.423	DENND3-201	KNOWN	basic|CCDS	protein_coding	DENND3	HGNC	protein_coding		114	0.00	0	C	NM_014957		142166000	142166000	+1	no_errors	ENST00000262585	ensembl	human	known	69_37n	missense	93	13.89	15	SNP	0.681	G
DYNC2LI1	51626	genome.wustl.edu	37	2	44032338	44032338	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:44032338C>T	ENST00000260605.8	+	12	1046	c.946C>T	c.(946-948)Cag>Tag	p.Q316*	DYNC2LI1_ENST00000443170.3_Nonsense_Mutation_p.Q190*|DYNC2LI1_ENST00000605786.1_Nonsense_Mutation_p.Q317*	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	316					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)	p.Q316*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GAGAGATCCTCAGTATGCTGA	0.353																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											88.0	94.0	92.0					2																	44032338		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.946C>T	2.37:g.44032338C>T	ENSP00000260605:p.Gln316*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Nonsense_Mutation	SNP	pfam_Dynein_light_int_chain	p.Q316*	ENST00000260605.8	37	c.946	CCDS1813.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.091426	0.97276	.	.	ENSG00000138036	ENST00000260605;ENST00000443170	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-10.744	18.5927	0.91220	0.0:1.0:0.0:0.0	.	.	.	.	X	316;190	.	ENSP00000260605:Q316X	Q	+	1	0	DYNC2LI1	43885842	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	4.241000	0.58707	2.687000	0.91594	0.655000	0.94253	CAG	DYNC2LI1	-	NULL	ENSG00000138036		0.353	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYNC2LI1	HGNC	protein_coding	OTTHUMT00000250536.2	132	0.00	0	C	NM_016008		44032338	44032338	+1	no_errors	ENST00000260605	ensembl	human	known	69_37n	nonsense	67	22.09	19	SNP	1.000	T
ECEL1	9427	genome.wustl.edu	37	2	233347817	233347817	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:233347817C>G	ENST00000304546.1	-	9	1789	c.1579G>C	c.(1579-1581)Gag>Cag	p.E527Q	ECEL1_ENST00000409941.1_Missense_Mutation_p.E527Q	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	527					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)	p.E527Q(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GGGCCCACCTCATACTCCTTG	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											49.0	32.0	38.0					2																	233347817		2202	4300	6502	-	-	-	SO:0001583	missense	0			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1579G>C	2.37:g.233347817C>G	ENSP00000302051:p.Glu527Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.E527Q	ENST00000304546.1	37	c.1579	CCDS2493.1	2	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348624	0.41599	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	D;D	0.83075	-1.68;-1.68	5.39	5.39	0.77823	.	0.109084	0.64402	D	0.000008	T	0.76040	0.3932	N	0.22421	0.69	0.58432	D	0.999998	B;P	0.49185	0.134;0.92	B;B	0.40636	0.027;0.335	T	0.80710	-0.1261	10	0.72032	D	0.01	-18.2153	19.1545	0.93504	0.0:1.0:0.0:0.0	.	527;527	O95672-2;O95672	.;ECEL1_HUMAN	Q	527	ENSP00000302051:E527Q;ENSP00000386333:E527Q	ENSP00000302051:E527Q	E	-	1	0	ECEL1	233056061	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	5.808000	0.69165	2.528000	0.85240	0.563000	0.77884	GAG	ECEL1	-	NULL	ENSG00000171551		0.637	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECEL1	HGNC	protein_coding	OTTHUMT00000257039.2	51	0.00	0	C	NM_004826		233347817	233347817	-1	no_errors	ENST00000304546	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	G
ECHDC3	79746	genome.wustl.edu	37	10	11789450	11789450	+	Silent	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:11789450G>C	ENST00000379215.4	+	2	484	c.273G>C	c.(271-273)ctG>ctC	p.L91L	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	91						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)	p.L91L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						GCAACGATCTGAAAGTCATTA	0.448																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											183.0	156.0	165.0					10																	11789450		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.273G>C	10.37:g.11789450G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Silent	SNP	pfam_Crotonase_core	p.L91	ENST00000379215.4	37	c.273	CCDS7084.1	10																																																																																			ECHDC3	-	pfam_Crotonase_core	ENSG00000134463		0.448	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC3	HGNC	protein_coding	OTTHUMT00000046771.1	80	0.00	0	G	NM_024693		11789450	11789450	+1	no_errors	ENST00000379215	ensembl	human	known	69_37n	silent	58	15.94	11	SNP	0.984	C
EPHB6	2051	genome.wustl.edu	37	7	142564664	142564664	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:142564664G>C	ENST00000392957.2	+	11	2375	c.1588G>C	c.(1588-1590)Gaa>Caa	p.E530Q	EPHB6_ENST00000442129.1_Missense_Mutation_p.E530Q|EPHB6_ENST00000411471.2_Missense_Mutation_p.E253Q	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	530	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.E515Q(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CCCCCAGGCAGAAGACGAATC	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	81.0	85.0					7																	142564664		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1588G>C	7.37:g.142564664G>C	ENSP00000376684:p.Glu530Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.E530Q	ENST00000392957.2	37	c.1588	CCDS5873.2	7	.	.	.	.	.	.	.	.	.	.	G	5.659	0.306158	0.10733	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.54675	0.56;0.56;0.56	5.05	5.05	0.67936	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.43747	D	0.000521	T	0.31071	0.0785	N	0.11341	0.13	0.37859	D	0.929647	B	0.22080	0.064	B	0.22880	0.042	T	0.21930	-1.0231	10	0.02654	T	1	.	15.9211	0.79575	0.0:0.0:1.0:0.0	.	530	O15197	EPHB6_HUMAN	Q	530;530;253	ENSP00000376684:E530Q;ENSP00000410789:E530Q;ENSP00000409061:E253Q	ENSP00000376684:E530Q	E	+	1	0	EPHB6	142274786	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.398000	0.66308	2.509000	0.84616	0.542000	0.68232	GAA	EPHB6	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000106123		0.647	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	HGNC	protein_coding	OTTHUMT00000341329.1	49	0.00	0	G			142564664	142564664	+1	no_errors	ENST00000392957	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	1.000	C
ESPL1	9700	genome.wustl.edu	37	12	53666536	53666536	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:53666536C>A	ENST00000257934.4	+	6	1492	c.1401C>A	c.(1399-1401)ttC>ttA	p.F467L	ESPL1_ENST00000552462.1_Missense_Mutation_p.F467L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	467					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.F467L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CCTACAGCTTCTATAGTCACA	0.557																																					Colon(53;1069 1201 2587 5382)	dbGAP											1	Substitution - Missense(1)	breast(1)											271.0	255.0	260.0					12																	53666536		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.1401C>A	12.37:g.53666536C>A	ENSP00000257934:p.Phe467Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C50	p.F467L	ENST00000257934.4	37	c.1401	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300426	0.60195	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.10763	2.84;2.84	5.62	5.62	0.85841	.	0.120415	0.56097	D	0.000022	T	0.11707	0.0285	L	0.59436	1.845	0.39099	D	0.96125	P	0.43750	0.816	B	0.32762	0.152	T	0.15235	-1.0444	10	0.27785	T	0.31	.	17.1577	0.86795	0.0:1.0:0.0:0.0	.	467	Q14674	ESPL1_HUMAN	L	467;142;467	ENSP00000257934:F467L;ENSP00000449831:F467L	ENSP00000257934:F467L	F	+	3	2	ESPL1	51952803	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.343000	0.52167	2.650000	0.89964	0.555000	0.69702	TTC	ESPL1	-	NULL	ENSG00000135476		0.557	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	167	0.00	0	C	NM_012291		53666536	53666536	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	missense	117	12.03	16	SNP	1.000	A
ETS2	2114	genome.wustl.edu	37	21	40194639	40194639	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr21:40194639G>C	ENST00000360214.3	+	11	1696	c.1236G>C	c.(1234-1236)atG>atC	p.M412I	ETS2_ENST00000360938.3_Missense_Mutation_p.M412I	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	412					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M412I(2)		NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				AGCCCAAGATGAACTACGAGA	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(2)											103.0	89.0	94.0					21																	40194639		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.1236G>C	21.37:g.40194639G>C	ENSP00000353344:p.Met412Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	p.M412I	ENST00000360214.3	37	c.1236	CCDS13659.1	21	.	.	.	.	.	.	.	.	.	.	G	34	5.357232	0.95854	.	.	ENSG00000157557	ENST00000360214;ENST00000360938	T;T	0.34667	1.35;1.35	5.47	5.47	0.80525	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (5);	0.037271	0.85682	D	0.000000	T	0.72028	0.3410	H	0.94222	3.51	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.80739	-0.1248	10	0.87932	D	0	.	18.9331	0.92574	0.0:0.0:1.0:0.0	.	412	P15036	ETS2_HUMAN	I	412	ENSP00000353344:M412I;ENSP00000354194:M412I	ENSP00000353344:M412I	M	+	3	0	ETS2	39116509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.706000	0.98722	2.558000	0.86282	0.655000	0.94253	ATG	ETS2	-	pfam_Ets,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	ENSG00000157557		0.488	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS2	HGNC	protein_coding	OTTHUMT00000207544.1	129	0.00	0	G			40194639	40194639	+1	no_errors	ENST00000360214	ensembl	human	known	69_37n	missense	90	16.51	18	SNP	1.000	C
FABP5P3	220832	genome.wustl.edu	37	7	152139796	152139796	+	RNA	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:152139796G>A	ENST00000477993.1	+	0	551					NR_002935.1		A8MUU1	FB5L3_HUMAN	fatty acid binding protein 5 pseudogene 3								lipid binding (GO:0008289)|transporter activity (GO:0005215)										CATAAAAACTGAGAGCACTTT	0.428																																						dbGAP											0																																										-	-	-			0					7q36.1	2010-10-12	2010-10-12	2010-10-12	ENSG00000241735	ENSG00000241735			22573	pseudogene	pseudogene			"""fatty acid binding protein 5-like 3"", ""fatty acid binding protein 5-like 3 (pseudogene)"""	FABP5L3			Standard	NR_002935		Approved	TCAG_1781704	uc003wlb.3	A8MUU1	OTTHUMG00000157257		7.37:g.152139796G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000477993.1	37	NULL		7																																																																																			FABP5P3	-	-	ENSG00000241735		0.428	FABP5P3-001	KNOWN	basic	processed_transcript	FABP5P3	HGNC	pseudogene	OTTHUMT00000348208.1	21	0.00	0	G	NR_002935		152139796	152139796	+1	no_errors	ENST00000477993	ensembl	human	known	69_37n	rna	19	17.39	4	SNP	0.978	A
FAM161B	145483	genome.wustl.edu	37	14	74409190	74409190	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:74409190C>G	ENST00000534936.1	-	4	1259	c.1154G>C	c.(1153-1155)aGa>aCa	p.R385T	FAM161B_ENST00000286544.3_Missense_Mutation_p.R448T			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	385								p.R385T(1)|p.R448T(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						TTTGGCTGCTCTTCTCTGGAA	0.562																																						dbGAP											2	Substitution - Missense(2)	breast(2)											153.0	141.0	145.0					14																	74409190		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.1154G>C	14.37:g.74409190C>G	ENSP00000445326:p.Arg385Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z882|J3KNA2	Missense_Mutation	SNP	pfam_UPF0564	p.R448T	ENST00000534936.1	37	c.1343		14	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223734	0.39300	.	.	ENSG00000156050	ENST00000286544;ENST00000534936	T;T	0.23348	1.91;1.91	5.5	3.54	0.40534	.	0.279471	0.33895	N	0.004445	T	0.28366	0.0701	M	0.69823	2.125	0.09310	N	0.999991	B	0.27316	0.175	B	0.34038	0.174	T	0.20338	-1.0278	10	0.38643	T	0.18	-10.3339	6.9929	0.24765	0.0:0.6676:0.0:0.3324	.	385	Q96MY7	F161B_HUMAN	T	448;385	ENSP00000286544:R448T;ENSP00000445326:R385T	ENSP00000286544:R448T	R	-	2	0	FAM161B	73478943	0.998000	0.40836	0.916000	0.36221	0.857000	0.48899	1.645000	0.37238	0.896000	0.36366	-0.797000	0.03246	AGA	FAM161B	-	pfam_UPF0564	ENSG00000156050		0.562	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	FAM161B	HGNC	protein_coding		238	0.00	0	C	NM_152445		74409190	74409190	-1	no_errors	ENST00000286544	ensembl	human	known	69_37n	missense	187	13.02	28	SNP	0.486	G
FAM76B	143684	genome.wustl.edu	37	11	95521679	95521679	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:95521679C>T	ENST00000358780.5	-	2	448	c.136G>A	c.(136-138)Gaa>Aaa	p.E46K	CEP57_ENST00000325486.5_5'Flank|CEP57_ENST00000538658.1_5'Flank|CEP57_ENST00000325542.5_5'Flank|FAM76B_ENST00000536839.1_Missense_Mutation_p.E46K|FAM76B_ENST00000538047.1_5'UTR|CEP57_ENST00000537677.1_5'Flank	NM_144664.4	NP_653265.3	Q5HYJ3	FA76B_HUMAN	family with sequence similarity 76, member B	46						nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.E46K(1)		breast(1)|kidney(1)|lung(1)	3		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGTTGAAATTCTGATCTGCAG	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	89.0	90.0					11																	95521679		1823	4085	5908	-	-	-	SO:0001583	missense	0				CCDS41700.1	11q21	2008-02-05			ENSG00000077458	ENSG00000077458			28492	protein-coding gene	gene with protein product						12477932	Standard	NM_144664		Approved	MGC33371	uc001pfn.2	Q5HYJ3	OTTHUMG00000167739	ENST00000358780.5:c.136G>A	11.37:g.95521679C>T	ENSP00000351631:p.Glu46Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIU3|Q8TC53	Missense_Mutation	SNP	NULL	p.E46K	ENST00000358780.5	37	c.136	CCDS41700.1	11	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917114	0.92249	.	.	ENSG00000077458	ENST00000358780;ENST00000536839	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.79907	0.4527	M	0.79475	2.455	0.80722	D	1	D	0.65815	0.995	D	0.66716	0.946	T	0.82526	-0.0413	9	0.87932	D	0	-28.5124	18.94	0.92601	0.0:1.0:0.0:0.0	.	46	Q5HYJ3	FA76B_HUMAN	K	46	.	ENSP00000351631:E46K	E	-	1	0	FAM76B	95161327	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.424000	0.80242	2.464000	0.83262	0.561000	0.74099	GAA	FAM76B	-	NULL	ENSG00000077458		0.338	FAM76B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM76B	HGNC	protein_coding	OTTHUMT00000395969.1	162	0.00	0	C	NM_144664		95521679	95521679	-1	no_errors	ENST00000358780	ensembl	human	known	69_37n	missense	96	10.28	11	SNP	1.000	T
FEZ1	9638	genome.wustl.edu	37	11	125351488	125351488	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:125351488G>A	ENST00000278919.3	-	3	587	c.353C>T	c.(352-354)tCa>tTa	p.S118L	FEZ1_ENST00000527350.1_5'UTR	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	118					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)		p.S118L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CCAGTCTTCTGAGAGTGAAGG	0.532																																					Melanoma(180;509 2033 10762 15939 24711)	dbGAP											1	Substitution - Missense(1)	breast(1)											160.0	159.0	160.0					11																	125351488		2201	4299	6500	-	-	-	SO:0001583	missense	0			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.353C>T	11.37:g.125351488G>A	ENSP00000278919:p.Ser118Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00679|O00728|Q6IBI7	Missense_Mutation	SNP	pfam_FEZ	p.S118L	ENST00000278919.3	37	c.353	CCDS31716.1	11	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934690	0.52866	.	.	ENSG00000149557	ENST00000278919	T	0.31510	1.49	5.89	4.96	0.65561	.	0.631691	0.14468	N	0.317751	T	0.21227	0.0511	N	0.08118	0	0.39030	D	0.959919	B;B	0.32010	0.351;0.042	B;B	0.34038	0.174;0.042	T	0.25882	-1.0119	10	0.87932	D	0	-10.4162	16.4265	0.83816	0.0:0.216:0.784:0.0	.	118;118	B4DKG5;Q99689	.;FEZ1_HUMAN	L	118	ENSP00000278919:S118L	ENSP00000278919:S118L	S	-	2	0	FEZ1	124856698	0.977000	0.34250	0.998000	0.56505	0.989000	0.77384	2.532000	0.45659	2.783000	0.95769	0.655000	0.94253	TCA	FEZ1	-	pfam_FEZ	ENSG00000149557		0.532	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZ1	HGNC	protein_coding	OTTHUMT00000386875.1	197	0.00	0	G	NM_005103		125351488	125351488	-1	no_errors	ENST00000278919	ensembl	human	known	69_37n	missense	119	12.50	17	SNP	0.247	A
FGD5	152273	genome.wustl.edu	37	3	14963443	14963443	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:14963443C>T	ENST00000285046.5	+	14	3698	c.3588C>T	c.(3586-3588)gaC>gaT	p.D1196D	FGD5_ENST00000543601.1_Silent_p.D955D|FGD5_ENST00000476851.1_3'UTR|FGD5-AS1_ENST00000430166.1_RNA	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1196	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.			D -> N (in Ref. 5; CAE45896). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.D955D(1)|p.D1196D(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						CAGAGAGGGACGAGTGGTATG	0.632																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											23.0	29.0	27.0					3																	14963443		2118	4240	6358	-	-	-	SO:0001819	synonymous_variant	0			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3588C>T	3.37:g.14963443C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.D1196	ENST00000285046.5	37	c.3588	CCDS46767.1	3																																																																																			FGD5	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000154783		0.632	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	41	0.00	0	C	NM_152536		14963443	14963443	+1	no_errors	ENST00000285046	ensembl	human	known	69_37n	silent	39	11.36	5	SNP	0.997	T
FNBP1L	54874	genome.wustl.edu	37	1	93989865	93989865	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:93989865G>C	ENST00000271234.7	+	5	541	c.390G>C	c.(388-390)tgG>tgC	p.W130C	FNBP1L_ENST00000604705.1_Missense_Mutation_p.W130C|FNBP1L_ENST00000370253.2_Missense_Mutation_p.W130C|FNBP1L_ENST00000260506.8_Missense_Mutation_p.W130C|FNBP1L_ENST00000370256.4_Missense_Mutation_p.W130C	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	130	F-BAR domain. {ECO:0000250}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.W130C(2)		breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		ACATGTGCTGGAAACAGATGG	0.303																																						dbGAP											2	Substitution - Missense(2)	breast(2)											63.0	63.0	63.0					1																	93989865		1836	4034	5870	-	-	-	SO:0001583	missense	0				CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.390G>C	1.37:g.93989865G>C	ENSP00000271234:p.Trp130Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_HR1_rho-bd,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.W130C	ENST00000271234.7	37	c.390	CCDS53343.1	1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689516	0.68271	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	5.89	5.89	0.94794	.	0.160296	0.64402	D	0.000013	T	0.26593	0.0650	L	0.49126	1.545	0.80722	D	1	D;P	0.76494	0.999;0.928	P;P	0.60286	0.872;0.636	T	0.00546	-1.1678	10	0.51188	T	0.08	-14.9569	13.4529	0.61182	0.0712:0.0:0.9288:0.0	.	130;130	Q5T0N5-4;Q5T0N5-3	.;.	C	130	ENSP00000359278:W130C;ENSP00000271234:W130C;ENSP00000260506:W130C;ENSP00000359275:W130C	ENSP00000260506:W130C	W	+	3	0	FNBP1L	93762453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.873000	0.69644	2.783000	0.95769	0.655000	0.94253	TGG	FNBP1L	-	NULL	ENSG00000137942		0.303	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	FNBP1L	HGNC	protein_coding		153	0.65	1	G	NM_017737		93989865	93989865	+1	no_errors	ENST00000271234	ensembl	human	known	69_37n	missense	119	11.19	15	SNP	1.000	C
FRMPD1	22844	genome.wustl.edu	37	9	37735702	37735702	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr9:37735702G>A	ENST00000539465.1	+	13	1965	c.1372G>A	c.(1372-1374)Gtc>Atc	p.V458I	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.V458I|FRMPD1_ENST00000536622.1_Missense_Mutation_p.V280I|FRMPD1_ENST00000541302.1_Missense_Mutation_p.V327I			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	458	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.V458I(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GAAAGTGAGCGTCGTCAAAGT	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	99.0	99.0					9																	37735702		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1372G>A	9.37:g.37735702G>A	ENSP00000444411:p.Val458Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.V458I	ENST00000539465.1	37	c.1372	CCDS6612.1	9	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271450	0.40194	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	5.95	-1.14	0.09741	FERM domain (1);	0.188243	0.56097	D	0.000030	T	0.04907	0.0132	N	0.14661	0.345	0.25826	N	0.984224	B;B	0.11235	0.002;0.004	B;B	0.06405	0.001;0.002	T	0.31971	-0.9924	10	0.33141	T	0.24	-5.512	6.1817	0.20476	0.5947:0.1235:0.2818:0.0	.	327;458	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	I	458;458;280;327	ENSP00000366995:V458I;ENSP00000444411:V458I;ENSP00000437762:V280I;ENSP00000444804:V327I	ENSP00000366995:V458I	V	+	1	0	FRMPD1	37725702	1.000000	0.71417	0.992000	0.48379	0.937000	0.57800	1.833000	0.39161	-0.360000	0.08138	-1.267000	0.01435	GTC	FRMPD1	-	pfscan_FERM_domain	ENSG00000070601		0.458	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	HGNC	protein_coding	OTTHUMT00000402969.1	108	0.00	0	G	NM_014907		37735702	37735702	+1	no_errors	ENST00000377765	ensembl	human	known	69_37n	missense	76	12.64	11	SNP	0.999	A
G3BP1	10146	genome.wustl.edu	37	5	151179471	151179471	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:151179471G>A	ENST00000394123.3	+	9	1010	c.865G>A	c.(865-867)Gaa>Aaa	p.E289K	G3BP1_ENST00000356245.3_Missense_Mutation_p.E289K|G3BP1_ENST00000543466.1_Missense_Mutation_p.E107K			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	289					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.E289K(2)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			GTCTAAGCCTGAATCTCAGAT	0.413																																						dbGAP											2	Substitution - Missense(2)	breast(1)|endometrium(1)											45.0	47.0	46.0					5																	151179471		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.865G>A	5.37:g.151179471G>A	ENSP00000377681:p.Glu289Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HYE9	Missense_Mutation	SNP	pfam_NTF2,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Nuclear_transport_factor_2_euk	p.E289K	ENST00000394123.3	37	c.865	CCDS4319.1	5	.	.	.	.	.	.	.	.	.	.	G	23.8	4.463056	0.84425	.	.	ENSG00000145907	ENST00000394123;ENST00000543466;ENST00000356245;ENST00000274596	T;T;T	0.73575	-0.62;-0.76;-0.62	4.88	4.88	0.63580	.	0.093238	0.64402	D	0.000001	T	0.75845	0.3905	M	0.73962	2.25	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.73880	-0.3843	10	0.48119	T	0.1	1.4217	18.4052	0.90533	0.0:0.0:1.0:0.0	.	289	Q13283	G3BP1_HUMAN	K	289;107;289;131	ENSP00000377681:E289K;ENSP00000445035:E107K;ENSP00000348578:E289K	ENSP00000274596:E131K	E	+	1	0	G3BP1	151159664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.720000	0.91442	2.415000	0.81967	0.650000	0.86243	GAA	G3BP1	-	NULL	ENSG00000145907		0.413	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G3BP1	HGNC	protein_coding	OTTHUMT00000252431.1	89	0.00	0	G	NM_005754		151179471	151179471	+1	no_errors	ENST00000356245	ensembl	human	known	69_37n	missense	70	10.26	8	SNP	1.000	A
G3BP2	9908	genome.wustl.edu	37	4	76570799	76570799	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr4:76570799C>A	ENST00000359707.4	-	12	2049	c.1264G>T	c.(1264-1266)Gat>Tat	p.D422Y	G3BP2_ENST00000395719.3_Missense_Mutation_p.D422Y|G3BP2_ENST00000357854.3_Missense_Mutation_p.D389Y	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	422	Gly-rich.				cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)	p.D422Y(1)		breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CTGCGATCATCACCACCACCT	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											268.0	211.0	230.0					4																	76570799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.1264G>T	4.37:g.76570799C>A	ENSP00000352738:p.Asp422Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	pfam_NTF2,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Nuclear_transport_factor_2_euk	p.D422Y	ENST00000359707.4	37	c.1264	CCDS3571.1	4	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571670	0.65765	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854	D;D;D	0.85861	-2.04;-2.04;-2.04	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);	0.040619	0.85682	D	0.000000	D	0.88455	0.6441	N	0.22421	0.69	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.87488	0.2425	10	0.44086	T	0.13	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	389;422	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	Y	422;422;389	ENSP00000379069:D422Y;ENSP00000352738:D422Y;ENSP00000350518:D389Y	ENSP00000350518:D389Y	D	-	1	0	G3BP2	76789823	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.308000	0.65768	2.941000	0.99782	0.655000	0.94253	GAT	G3BP2	-	NULL	ENSG00000138757		0.488	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	G3BP2	HGNC	protein_coding	OTTHUMT00000252399.2	458	0.00	0	C	NM_012297		76570799	76570799	-1	no_errors	ENST00000359707	ensembl	human	known	69_37n	missense	357	13.98	58	SNP	1.000	A
GALR1	2587	genome.wustl.edu	37	18	74962762	74962762	+	Silent	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr18:74962762C>G	ENST00000299727.3	+	1	258	c.258C>G	c.(256-258)ctC>ctG	p.L86L		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	86					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.L86L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CCTACCTGCTCTTCTGCATCC	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											125.0	111.0	116.0					18																	74962762		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.258C>G	18.37:g.74962762C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VBL7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_Galnin_1_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Galanin_rcpt,prints_NPY_rcpt	p.L86	ENST00000299727.3	37	c.258	CCDS12012.1	18																																																																																			GALR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Galanin_rcpt	ENSG00000166573		0.622	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALR1	HGNC	protein_coding	OTTHUMT00000256362.1	72	0.00	0	C			74962762	74962762	+1	no_errors	ENST00000299727	ensembl	human	known	69_37n	silent	43	14.00	7	SNP	1.000	G
GGN	199720	genome.wustl.edu	37	19	38876804	38876804	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr19:38876804G>A	ENST00000334928.6	-	3	1230	c.1098C>T	c.(1096-1098)ttC>ttT	p.F366F	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	366	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)		p.F366F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAGCCCCGTTGAAGCGGAAGT	0.701																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											27.0	30.0	29.0					19																	38876804		2199	4298	6497	-	-	-	SO:0001819	synonymous_variant	0			AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1098C>T	19.37:g.38876804G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTU6|Q86UU4|Q8NAA1	Silent	SNP	NULL	p.F366	ENST00000334928.6	37	c.1098	CCDS12516.1	19																																																																																			GGN	-	NULL	ENSG00000179168		0.701	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGN	HGNC	protein_coding	OTTHUMT00000459205.1	26	0.00	0	G	NM_152657		38876804	38876804	-1	no_errors	ENST00000334928	ensembl	human	known	69_37n	silent	33	13.16	5	SNP	1.000	A
GLIS3	169792	genome.wustl.edu	37	9	4117903	4117903	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr9:4117903G>A	ENST00000324333.10	-	3	1303	c.1110C>T	c.(1108-1110)caC>caT	p.H370H	GLIS3_ENST00000381971.3_Silent_p.H525H	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	370					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.H525H(1)|p.H370H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		GCTGGTCGATGTGGACCTTCT	0.597																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											120.0	106.0	111.0					9																	4117903		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1110C>T	9.37:g.4117903G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL19|Q1PHK5	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H525	ENST00000324333.10	37	c.1575	CCDS6451.1	9																																																																																			GLIS3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000107249		0.597	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000051559.1	109	0.00	0	G	NM_152629		4117903	4117903	-1	no_errors	ENST00000381971	ensembl	human	known	69_37n	silent	91	12.50	13	SNP	1.000	A
GNAT2	2780	genome.wustl.edu	37	1	110148667	110148667	+	Silent	SNP	G	G	A	rs534677249	byFrequency	TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:110148667G>A	ENST00000351050.3	-	6	831	c.645C>T	c.(643-645)ttC>ttT	p.F215F		NM_005272.3	NP_005263.1	P19087	GNAT2_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2	215					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to light intensity (GO:0009642)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.F215F(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	14		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0422)|Colorectal(144;0.108)|Epithelial(280;0.125)|all cancers(265;0.129)|LUSC - Lung squamous cell carcinoma(189;0.227)		TGACTCCCTCGAAGCAGTGGA	0.507													G|||	2	0.000399361	0.0	0.0	5008	,	,		21206	0.0		0.0	False		,,,				2504	0.002					dbGAP											1	Substitution - coding silent(1)	breast(1)											127.0	115.0	119.0					1																	110148667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000233	CCDS803.1	1p13	2013-01-08			ENSG00000134183	ENSG00000134183			4394	protein-coding gene	gene with protein product		139340				8406495	Standard	NM_005272		Approved	ACHM4	uc001dya.3	P19087	OTTHUMG00000011639	ENST00000351050.3:c.645C>T	1.37:g.110148667G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.F215	ENST00000351050.3	37	c.645	CCDS803.1	1																																																																																			GNAT2	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,smart_Gprotein_alpha_su	ENSG00000134183		0.507	GNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAT2	HGNC	protein_coding	OTTHUMT00000032181.1	159	0.62	1	G	NM_005272		110148667	110148667	-1	no_errors	ENST00000351050	ensembl	human	known	69_37n	silent	124	10.79	15	SNP	1.000	A
GORASP2	26003	genome.wustl.edu	37	2	171807955	171807955	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:171807955G>A	ENST00000234160.4	+	5	1368	c.553G>A	c.(553-555)Ggt>Agt	p.G185S	GORASP2_ENST00000452526.2_Missense_Mutation_p.G197S|GORASP2_ENST00000493692.1_3'UTR	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	185					mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G185S(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						TTCTGCATGGGGTGGAGAAGG	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											141.0	127.0	131.0					2																	171807955		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.553G>A	2.37:g.171807955G>A	ENSP00000234160:p.Gly185Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	pfam_GRASP55/65_PDZ,superfamily_PDZ	p.G197S	ENST00000234160.4	37	c.589	CCDS33325.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.595007	0.96602	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.70516	-0.46;-0.49	5.57	5.57	0.84162	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	D	0.86489	0.5945	M	0.85041	2.73	0.80722	D	1	D;D;D	0.76494	0.994;0.989;0.999	D;D;D	0.80764	0.944;0.993;0.994	D	0.88129	0.2837	10	0.87932	D	0	-10.4111	19.5578	0.95358	0.0:0.0:1.0:0.0	.	141;197;185	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	S	185;197	ENSP00000234160:G185S;ENSP00000410208:G197S	ENSP00000234160:G185S	G	+	1	0	GORASP2	171516201	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.813000	0.99286	2.604000	0.88044	0.563000	0.77884	GGT	GORASP2	-	pfam_GRASP55/65_PDZ,superfamily_PDZ	ENSG00000115806		0.363	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GORASP2	HGNC	protein_coding	OTTHUMT00000333719.2	184	0.00	0	G			171807955	171807955	+1	no_errors	ENST00000452526	ensembl	human	known	69_37n	missense	124	16.78	25	SNP	1.000	A
GPR114	221188	genome.wustl.edu	37	16	57601828	57601828	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr16:57601828G>A	ENST00000340339.4	+	9	1405	c.882G>A	c.(880-882)ctG>ctA	p.L294L	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Silent_p.L294L	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	294					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L294L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						TGCTGCTCCTGAACATCGCCT	0.612																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											103.0	79.0	87.0					16																	57601828		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.882G>A	16.37:g.57601828G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.L294	ENST00000340339.4	37	c.882	CCDS10785.1	16																																																																																			GPR114	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000159618		0.612	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR114	HGNC	protein_coding	OTTHUMT00000257336.3	84	0.00	0	G	NM_153837		57601828	57601828	+1	no_errors	ENST00000340339	ensembl	human	known	69_37n	silent	66	10.81	8	SNP	0.995	A
GPR6	2830	genome.wustl.edu	37	6	110301388	110301388	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:110301388C>G	ENST00000275169.3	+	1	1091	c.1073C>G	c.(1072-1074)tCt>tGt	p.S358C	GPR6_ENST00000414000.2_Missense_Mutation_p.S373C	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	358				S -> P (in Ref. 3; BAG58241). {ECO:0000305}.	G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.S358C(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		CGTTCCAGGTCTCCCAGCGAG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	98.0	96.0					6																	110301388		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.1073C>G	6.37:g.110301388C>G	ENSP00000275169:p.Ser358Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPR6_rcpt,prints_GPR_orph_rcpt,prints_7TM_GPCR_Rhodpsn	p.S373C	ENST00000275169.3	37	c.1118	CCDS5079.1	6	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708464	0.68615	.	.	ENSG00000146360	ENST00000428489;ENST00000414000;ENST00000275169	T;T	0.41400	1.0;1.0	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000002	T	0.54854	0.1884	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.58137	-0.7689	10	0.72032	D	0.01	.	18.3227	0.90244	0.0:1.0:0.0:0.0	.	358	P46095	GPR6_HUMAN	C	336;373;358	ENSP00000406986:S373C;ENSP00000275169:S358C	ENSP00000275169:S358C	S	+	2	0	GPR6	110408081	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.651000	0.83577	2.560000	0.86352	0.655000	0.94253	TCT	GPR6	-	NULL	ENSG00000146360		0.592	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR6	HGNC	protein_coding	OTTHUMT00000041774.1	74	0.00	0	C			110301388	110301388	+1	no_errors	ENST00000414000	ensembl	human	known	69_37n	missense	66	10.81	8	SNP	1.000	G
GREB1L	80000	genome.wustl.edu	37	18	19029545	19029545	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr18:19029545G>A	ENST00000580732.2	+	12	1849	c.1468G>A	c.(1468-1470)Gaa>Aaa	p.E490K	GREB1L_ENST00000431264.1_Missense_Mutation_p.E490K|SNORD23_ENST00000408212.1_RNA|GREB1L_ENST00000578368.1_3'UTR|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000400483.4_Missense_Mutation_p.E490K|GREB1L_ENST00000424526.1_Missense_Mutation_p.E490K|GREB1L_ENST00000269218.6_Intron			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	490						integral component of membrane (GO:0016021)		p.E491K(1)|p.E490K(1)		breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						TACTCTGAGAGAAAGAGCCCT	0.453																																						dbGAP											2	Substitution - Missense(2)	breast(2)											111.0	98.0	102.0					18																	19029545		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.1468G>A	18.37:g.19029545G>A	ENSP00000464162:p.Glu490Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QN17|Q9H8F1	Missense_Mutation	SNP	NULL	p.E490K	ENST00000580732.2	37	c.1468	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	21.7	4.180638	0.78677	.	.	ENSG00000141449	ENST00000424526;ENST00000400483;ENST00000431264	T;T;T	0.16743	3.08;2.32;2.32	5.72	5.72	0.89469	.	.	.	.	.	T	0.22166	0.0534	L	0.57536	1.79	0.45415	D	0.998393	P;P	0.40731	0.728;0.728	B;B	0.36092	0.217;0.217	T	0.01805	-1.1270	9	0.62326	D	0.03	5.5818	19.8611	0.96785	0.0:0.0:1.0:0.0	.	490;490	Q9C091;Q9C091-2	GRB1L_HUMAN;.	K	490	ENSP00000412060:E490K;ENSP00000383331:E490K;ENSP00000393125:E490K	ENSP00000383331:E490K	E	+	1	0	GREB1L	17283543	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.159000	0.77483	2.711000	0.92665	0.650000	0.86243	GAA	GREB1L	-	NULL	ENSG00000141449		0.453	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	117	0.00	0	G	NM_024935		19029545	19029545	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	missense	73	15.12	13	SNP	1.000	A
GRIK1	2897	genome.wustl.edu	37	21	30925922	30925922	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr21:30925922C>T	ENST00000399907.1	-	17	3122	c.2711G>A	c.(2710-2712)cGa>cAa	p.R904Q	GRIK1_ENST00000309434.7_Missense_Mutation_p.R906Q|GRIK1_ENST00000389124.2_Intron|GRIK1_ENST00000327783.4_Intron|GRIK1_ENST00000535441.1_Intron|GRIK1_ENST00000389125.3_Intron|GRIK1_ENST00000399909.1_Missense_Mutation_p.R889Q|GRIK1_ENST00000399914.1_Intron|GRIK1_ENST00000399913.1_Intron	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	904					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R904Q(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	TCTCTCCTCTCGAATTAATTT	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	110.0	109.0					21																	30925922		1829	4086	5915	-	-	-	SO:0001583	missense	0				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2711G>A	21.37:g.30925922C>T	ENSP00000382791:p.Arg904Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13001|Q86SU9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R906Q	ENST00000399907.1	37	c.2717	CCDS42913.1	21	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349503	0.41599	.	.	ENSG00000171189	ENST00000399907;ENST00000399909;ENST00000309434	T;T;T	0.11063	2.82;2.81;2.82	5.4	4.45	0.53987	.	.	.	.	.	T	0.06325	0.0163	N	0.08118	0	0.24908	N	0.99206	B	0.13145	0.007	B	0.04013	0.001	T	0.27020	-1.0086	9	0.17369	T	0.5	.	14.3945	0.67001	0.0:0.9175:0.0:0.0825	.	904	P39086	GRIK1_HUMAN	Q	904;889;906	ENSP00000382791:R904Q;ENSP00000382793:R889Q;ENSP00000311646:R906Q	ENSP00000311646:R906Q	R	-	2	0	GRIK1	29847793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.195000	0.51013	2.805000	0.96524	0.655000	0.94253	CGA	GRIK1	-	NULL	ENSG00000171189		0.343	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIK1	HGNC	protein_coding	OTTHUMT00000171979.1	147	0.00	0	C			30925922	30925922	-1	no_errors	ENST00000309434	ensembl	human	known	69_37n	missense	95	15.18	17	SNP	1.000	T
HAUS3	79441	genome.wustl.edu	37	4	2233655	2233655	+	Nonstop_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr4:2233655C>G	ENST00000243706.4	-	5	2040	c.1811G>C	c.(1810-1812)tGa>tCa	p.*604S	POLN_ENST00000515357.1_Intron|POLN_ENST00000511885.2_Intron|HAUS3_ENST00000506763.1_Intron|POLN_ENST00000382865.1_5'Flank|HAUS3_ENST00000443786.2_Nonstop_Mutation_p.*604S	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	0					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.*604S(1)		breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CAGTAATTTTCAATCTTCAAG	0.254																																						dbGAP											1	Nonstop extension(1)	breast(1)											23.0	24.0	24.0					4																	2233655		2169	4239	6408	-	-	-	SO:0001578	stop_lost	0			AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.1811G>C	4.37:g.2233655C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF64|O43606|Q8TAZ5|Q9BTJ9	Nonstop_Mutation	SNP	NULL	p.*604S	ENST00000243706.4	37	c.1811	CCDS33941.1	4	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280542	0.40294	.	.	ENSG00000214367	ENST00000243706;ENST00000443786	.	.	.	6.03	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8315	0.46663	0.0:0.8694:0.0:0.1306	.	.	.	.	S	604	.	.	X	-	2	2	HAUS3	2203453	0.159000	0.22864	0.989000	0.46669	0.742000	0.42306	-0.193000	0.09573	2.868000	0.98415	0.557000	0.71058	TGA	HAUS3	-	NULL	ENSG00000214367		0.254	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS3	HGNC	protein_coding	OTTHUMT00000357446.1	66	0.00	0	C	NM_024511		2233655	2233655	-1	no_errors	ENST00000243706	ensembl	human	known	69_37n	nonstop	62	10.14	7	SNP	1.000	G
HCRTR1	3061	genome.wustl.edu	37	1	32092459	32092459	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:32092459C>G	ENST00000373706.5	+	7	1309	c.1156C>G	c.(1156-1158)Ctg>Gtg	p.L386V	HCRTR1_ENST00000403528.2_Missense_Mutation_p.L386V|HCRTR1_ENST00000373705.1_Intron|HCRTR1_ENST00000468521.1_Intron			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	386					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)	p.L386V(1)		breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CTGCGGCTCTCTGAAGGCCCC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	107.0	105.0					1																	32092459		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.1156C>G	1.37:g.32092459C>G	ENSP00000362810:p.Leu386Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3A6|Q9HBV6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Orexin_rcpt_1,prints_NPY_rcpt	p.L386V	ENST00000373706.5	37	c.1156	CCDS344.1	1	.	.	.	.	.	.	.	.	.	.	C	3.931	-0.016154	0.07681	.	.	ENSG00000121764	ENST00000403528;ENST00000373706	T;T	0.37411	1.2;1.2	3.91	0.848	0.18966	.	1.003210	0.08033	N	0.993919	T	0.14787	0.0357	N	0.08118	0	0.20926	N	0.999824	B	0.24092	0.097	B	0.16722	0.016	T	0.29181	-1.0020	10	0.14252	T	0.57	.	2.6253	0.04928	0.2327:0.5181:0.0:0.2492	.	386	O43613	OX1R_HUMAN	V	386	ENSP00000384387:L386V;ENSP00000362810:L386V	ENSP00000362810:L386V	L	+	1	2	HCRTR1	31865046	0.565000	0.26610	1.000000	0.80357	0.998000	0.95712	0.308000	0.19314	0.362000	0.24319	0.655000	0.94253	CTG	HCRTR1	-	NULL	ENSG00000121764		0.582	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR1	HGNC	protein_coding	OTTHUMT00000011042.1	86	0.00	0	C	NM_001525		32092459	32092459	+1	no_errors	ENST00000373706	ensembl	human	known	69_37n	missense	71	10.13	8	SNP	1.000	G
HDAC8	55869	genome.wustl.edu	37	X	71715093	71715093	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:71715093G>C	ENST00000373573.3	-	5	804	c.463C>G	c.(463-465)Ctc>Gtc	p.L155V	HDAC8_ENST00000373560.2_Intron|HDAC8_ENST00000373583.1_Intron|HDAC8_ENST00000439122.2_Missense_Mutation_p.L155V|HDAC8_ENST00000373561.4_Missense_Mutation_p.L155V|HDAC8_ENST00000429103.2_De_novo_Start_OutOfFrame|HDAC8_ENST00000373589.4_Missense_Mutation_p.L64V|HDAC8_ENST00000373571.1_Missense_Mutation_p.L155V|HDAC8_ENST00000478743.1_5'UTR|HDAC8_ENST00000373559.4_Missense_Mutation_p.L64V	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	155	Histone deacetylase.				chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)	p.L155V(1)		breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	GCATCATTGAGATAACAAAAA	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	79.0	86.0					X																	71715093		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.463C>G	X.37:g.71715093G>C	ENSP00000362674:p.Leu155Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.L155V	ENST00000373573.3	37	c.463	CCDS14420.1	X	.	.	.	.	.	.	.	.	.	.	G	4.308	0.056404	0.08291	.	.	ENSG00000147099	ENST00000373573;ENST00000373589;ENST00000373568;ENST00000415409;ENST00000373571;ENST00000439122;ENST00000373559;ENST00000373561;ENST00000421523	T;T;T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.03	5.03	0.67393	Histone deacetylase domain (2);	0.056530	0.64402	D	0.000001	T	0.36193	0.0958	N	0.01168	-0.975	0.49213	D	0.999762	B;B;B;B;B	0.19817	0.039;0.005;0.004;0.002;0.0	B;B;B;B;B	0.26770	0.073;0.009;0.005;0.013;0.002	T	0.45338	-0.9268	10	0.02654	T	1	-11.8727	15.2841	0.73814	0.0:0.0:1.0:0.0	.	64;64;64;155;155	B4DH31;B4DKN0;A6NGJ7;B4DV22;Q9BY41	.;.;.;.;HDAC8_HUMAN	V	155;64;64;155;155;155;64;155;116	ENSP00000362674:L155V;ENSP00000362691:L64V;ENSP00000362669:L64V;ENSP00000396424:L155V;ENSP00000362672:L155V;ENSP00000414486:L155V;ENSP00000362660:L64V;ENSP00000362662:L155V;ENSP00000398997:L116V	ENSP00000362660:L64V	L	-	1	0	HDAC8	71631818	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.568000	0.60857	2.418000	0.82041	0.600000	0.82982	CTC	HDAC8	-	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse	ENSG00000147099		0.438	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC8	HGNC	protein_coding	OTTHUMT00000057193.2	178	0.55	1	G	NM_018486		71715093	71715093	-1	no_errors	ENST00000373573	ensembl	human	known	69_37n	missense	137	15.43	25	SNP	1.000	C
HIRA	7290	genome.wustl.edu	37	22	19344476	19344476	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr22:19344476G>C	ENST00000263208.5	-	19	2589	c.2333C>G	c.(2332-2334)tCt>tGt	p.S778C	HIRA_ENST00000541063.1_Missense_Mutation_p.S734C|HIRA_ENST00000340170.4_Intron|HIRA_ENST00000546308.1_Missense_Mutation_p.S734C	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	778	Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.|Interaction with histone H4.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S778C(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					ATGCAAAGTAGAGATCGGGGA	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											259.0	200.0	220.0					22																	19344476		2203	4300	6503	-	-	-	SO:0001583	missense	0			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.2333C>G	22.37:g.19344476G>C	ENSP00000263208:p.Ser778Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BU9|Q8IXN2	Missense_Mutation	SNP	pfam_Hira,pfam_WD40_repeat,pfam_HIRA_B_motif,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S778C	ENST00000263208.5	37	c.2333	CCDS13759.1	22	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897181	0.91962	.	.	ENSG00000100084	ENST00000263208;ENST00000541063;ENST00000539600;ENST00000546308	T;T;T	0.74209	-0.82;-0.67;-0.68	5.55	5.55	0.83447	TUP1-like enhancer of split (1);	0.000000	0.85682	D	0.000000	D	0.84790	0.5550	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.946	D	0.84310	0.0510	10	0.49607	T	0.09	-13.0801	19.4934	0.95062	0.0:0.0:1.0:0.0	.	734;778	F5H4M2;P54198	.;HIRA_HUMAN	C	778;734;287;734	ENSP00000263208:S778C;ENSP00000446073:S734C;ENSP00000441870:S734C	ENSP00000263208:S778C	S	-	2	0	HIRA	17724476	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	9.202000	0.95026	2.592000	0.87571	0.655000	0.94253	TCT	HIRA	-	pfam_Hira	ENSG00000100084		0.592	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRA	HGNC	protein_coding	OTTHUMT00000316488.2	198	0.00	0	G	NM_003325		19344476	19344476	-1	no_errors	ENST00000263208	ensembl	human	known	69_37n	missense	131	12.08	18	SNP	1.000	C
INTU	27152	genome.wustl.edu	37	4	128626754	128626754	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr4:128626754G>C	ENST00000335251.6	+	11	1678	c.1575G>C	c.(1573-1575)ttG>ttC	p.L525F	INTU_ENST00000512995.1_3'UTR	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	525					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.L525F(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AGGGTTATTTGATATGCAGTC	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											161.0	152.0	155.0					4																	128626754		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1575G>C	4.37:g.128626754G>C	ENSP00000334003:p.Leu525Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L525F	ENST00000335251.6	37	c.1575	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	G	14.62	2.589016	0.46110	.	.	ENSG00000164066	ENST00000335251;ENST00000506283	T;T	0.34859	1.34;1.34	5.21	4.34	0.51931	.	0.081899	0.50627	D	0.000109	T	0.53061	0.1773	M	0.77820	2.39	0.80722	D	1	D	0.63880	0.993	D	0.63113	0.911	T	0.55617	-0.8113	10	0.72032	D	0.01	-2.7401	5.9368	0.19171	0.1537:0.0:0.6886:0.1577	.	525	Q9ULD6	PDZD6_HUMAN	F	525;39	ENSP00000334003:L525F;ENSP00000426171:L39F	ENSP00000334003:L525F	L	+	3	2	INTU	128846204	1.000000	0.71417	0.952000	0.39060	0.354000	0.29330	2.830000	0.48136	1.133000	0.42147	0.467000	0.42956	TTG	INTU	-	NULL	ENSG00000164066		0.378	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	HGNC	protein_coding	OTTHUMT00000364147.2	239	0.41	1	G	XM_371707		128626754	128626754	+1	no_errors	ENST00000335251	ensembl	human	known	69_37n	missense	184	11.11	23	SNP	1.000	C
IPO5	3843	genome.wustl.edu	37	13	98660331	98660331	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr13:98660331G>C	ENST00000490680.1	+	15	1800	c.1735G>C	c.(1735-1737)Gat>Cat	p.D579H	IPO5_ENST00000261574.5_Missense_Mutation_p.D597H|IPO5_ENST00000539640.1_Missense_Mutation_p.D454H			O00410	IPO5_HUMAN	importin 5	579					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)	p.D597H(1)		breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GGATGCATCAGATGTGATGCA	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	144.0	150.0					13																	98660331		2203	4300	6503	-	-	-	SO:0001583	missense	0			U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1735G>C	13.37:g.98660331G>C	ENSP00000418393:p.Asp579His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_Importin-beta_N	p.D597H	ENST00000490680.1	37	c.1789		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.902640|4.902640	0.92035|0.92035	.|.	.|.	ENSG00000065150|ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640|ENST00000469360	T;T;T;T|.	0.22336|.	1.96;1.96;1.96;1.96|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Armadillo-type fold (1);|.	0.097389|.	0.64402|.	D|.	0.000001|.	T|T	0.66645|0.66645	0.2810|0.2810	L|L	0.41492|0.41492	1.28|1.28	0.80722|0.80722	D|D	1|1	P;D;D|.	0.56746|.	0.731;0.96;0.977|.	P;P;P|.	0.58873|.	0.614;0.595;0.847|.	T|T	0.62248|0.62248	-0.6894|-0.6894	10|5	0.66056|.	D|.	0.02|.	-21.9067|-21.9067	18.7784|18.7784	0.91922|0.91922	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	454;579;597|.	B4E0R6;O00410;O00410-3|.	.;IPO5_HUMAN;.|.	H|H	597;579;579;454|580	ENSP00000261574:D597H;ENSP00000350219:D579H;ENSP00000418393:D579H;ENSP00000445126:D454H|.	ENSP00000261574:D597H|.	D|Q	+|+	1|3	0|2	IPO5|IPO5	97458332|97458332	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.294000|9.294000	0.96088|0.96088	2.594000|2.594000	0.87642|0.87642	0.563000|0.563000	0.77884|0.77884	GAT|CAG	IPO5	-	superfamily_ARM-type_fold	ENSG00000065150		0.383	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	IPO5	HGNC	protein_coding	OTTHUMT00000354655.1	169	0.00	0	G	NM_002271		98660331	98660331	+1	no_errors	ENST00000261574	ensembl	human	known	69_37n	missense	100	10.71	12	SNP	1.000	C
IQGAP3	128239	genome.wustl.edu	37	1	156500030	156500030	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:156500030G>A	ENST00000361170.2	-	34	4281	c.4271C>T	c.(4270-4272)tCa>tTa	p.S1424L	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1424					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.S1424L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGCTGTCAGTGAGCGGTGTCG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	60.0	62.0					1																	156500030		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4271C>T	1.37:g.156500030G>A	ENSP00000354451:p.Ser1424Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.S1424L	ENST00000361170.2	37	c.4271	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726560	0.89298	.	.	ENSG00000183856	ENST00000361170	T	0.03094	4.05	4.5	4.5	0.54988	.	0.155567	0.44483	D	0.000442	T	0.12135	0.0295	M	0.78637	2.42	0.44523	D	0.99747	D	0.63880	0.993	D	0.72338	0.977	T	0.00780	-1.1569	10	0.72032	D	0.01	-6.5517	15.9486	0.79813	0.0:0.0:1.0:0.0	.	1424	Q86VI3	IQGA3_HUMAN	L	1424	ENSP00000354451:S1424L	ENSP00000354451:S1424L	S	-	2	0	IQGAP3	154766654	1.000000	0.71417	0.966000	0.40874	0.975000	0.68041	8.706000	0.91362	2.336000	0.79503	0.561000	0.74099	TCA	IQGAP3	-	NULL	ENSG00000183856		0.647	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	93	0.00	0	G	NM_178229		156500030	156500030	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	missense	73	13.95	12	SNP	0.999	A
IRF9	10379	genome.wustl.edu	37	14	24631447	24631447	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:24631447G>A	ENST00000396864.3	+	2	381	c.94G>A	c.(94-96)Gat>Aat	p.D32N	IRF9_ENST00000557894.1_Intron|RP11-468E2.4_ENST00000558468.1_3'UTR	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	32					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D32N(1)		NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		GTGCTGGGATGATACAGCTAA	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	123.0	128.0					14																	24631447		2203	4300	6503	-	-	-	SO:0001583	missense	0			M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.94G>A	14.37:g.24631447G>A	ENSP00000380073:p.Asp32Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS61	Missense_Mutation	SNP	pfam_Interferon_reg_fact_DNA-bd_dom,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.D32N	ENST00000396864.3	37	c.94	CCDS9615.1	14	.	.	.	.	.	.	.	.	.	.	G	13.28	2.188625	0.38609	.	.	ENSG00000213928	ENST00000396864	D	0.98249	-4.82	5.64	5.64	0.86602	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (3);	0.077413	0.50627	U	0.000112	D	0.96318	0.8799	N	0.13272	0.32	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	D	0.93091	0.6500	10	0.02654	T	1	-7.4486	11.9016	0.52687	0.0806:0.0:0.9194:0.0	.	32	Q00978	IRF9_HUMAN	N	32	ENSP00000380073:D32N	ENSP00000380073:D32N	D	+	1	0	IRF9	23701287	1.000000	0.71417	0.716000	0.30569	0.699000	0.40488	4.167000	0.58209	2.664000	0.90586	0.655000	0.94253	GAT	IRF9	-	pfam_Interferon_reg_fact_DNA-bd_dom,smart_Interferon_reg_fact_DNA-bd_dom	ENSG00000213928		0.592	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF9	HGNC	protein_coding	OTTHUMT00000071927.2	81	0.00	0	G			24631447	24631447	+1	no_errors	ENST00000396864	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	0.967	A
KCNB2	9312	genome.wustl.edu	37	8	73480017	73480017	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr8:73480017G>A	ENST00000523207.1	+	2	636	c.48G>A	c.(46-48)tcG>tcA	p.S16S		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	16					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.S16S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CTTCAAGGTCGACACTTTCCC	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											89.0	88.0	88.0					8																	73480017		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.48G>A	8.37:g.73480017G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7D0|Q9BXD3	Silent	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.S16	ENST00000523207.1	37	c.48	CCDS6209.1	8																																																																																			KCNB2	-	NULL	ENSG00000182674		0.512	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	60	0.00	0	G	NM_004770		73480017	73480017	+1	no_errors	ENST00000523207	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	0.352	A
KCNK7	10089	genome.wustl.edu	37	11	65360593	65360593	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:65360593G>C	ENST00000340313.4	-	3	1030	c.807C>G	c.(805-807)ttC>ttG	p.F269L	AP001362.1_ENST00000597463.1_5'Flank|KCNK7_ENST00000342202.4_3'UTR|KCNK7_ENST00000394216.2_3'UTR|KCNK7_ENST00000394217.2_3'UTR	NM_033347.1	NP_203133.1	Q9Y2U2	KCNK7_HUMAN	potassium channel, subfamily K, member 7	269					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.F269L(1)		endometrium(1)|liver(1)|lung(1)	3						CACTGGGTCTGAAGAACTTCC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											54.0	50.0	52.0					11																	65360593		2200	4296	6496	-	-	-	SO:0001583	missense	0			AF110522	CCDS8106.1, CCDS31608.1, CCDS41673.1	11q13	2012-03-07			ENSG00000173338	ENSG00000173338		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6282	protein-coding gene	gene with protein product		603940				10206991, 11256078, 16382106	Standard	NM_033347		Approved	K2p7.1	uc001oes.3	Q9Y2U2	OTTHUMG00000166528	ENST00000340313.4:c.807C>G	11.37:g.65360593G>C	ENSP00000344820:p.Phe269Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYI2|Q9Y2U3|Q9Y2U4	Missense_Mutation	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TWIK	p.F269L	ENST00000340313.4	37	c.807	CCDS31608.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.86|19.86	3.906089|3.906089	0.72868|0.72868	.|.	.|.	ENSG00000173338|ENSG00000173338	ENST00000340313|ENST00000530380	T|.	0.09817|.	2.94|.	4.87|4.87	1.41|1.41	0.22369|0.22369	.|.	0.000000|.	0.50627|.	D|.	0.000116|.	T|T	0.32346|0.32346	0.0826|0.0826	L|L	0.36672|0.36672	1.1|1.1	0.25021|0.25021	N|N	0.991336|0.991336	D|.	0.62365|.	0.991|.	P|.	0.49922|.	0.626|.	T|T	0.24368|0.24368	-1.0162|-1.0162	10|5	0.27082|.	T|.	0.32|.	.|.	5.9611|5.9611	0.19301|0.19301	0.5303:0.0:0.4697:0.0|0.5303:0.0:0.4697:0.0	.|.	269|.	Q9Y2U2|.	KCNK7_HUMAN|.	L|E	269|34	ENSP00000344820:F269L|.	ENSP00000344820:F269L|.	F|Q	-|-	3|1	2|0	KCNK7|KCNK7	65117169|65117169	0.129000|0.129000	0.22400|0.22400	0.198000|0.198000	0.23420|0.23420	0.058000|0.058000	0.15608|0.15608	0.120000|0.120000	0.15647|0.15647	-0.056000|-0.056000	0.13221|0.13221	0.561000|0.561000	0.74099|0.74099	TTC|CAG	KCNK7	-	pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TWIK	ENSG00000173338		0.617	KCNK7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK7	HGNC	protein_coding	OTTHUMT00000390206.1	73	0.00	0	G	NM_005714		65360593	65360593	-1	no_errors	ENST00000340313	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	0.410	C
KDM2B	84678	genome.wustl.edu	37	12	121986850	121986850	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:121986850C>T	ENST00000377071.4	-	6	687	c.615G>A	c.(613-615)caG>caA	p.Q205Q	KDM2B_ENST00000536437.1_Silent_p.Q88Q|KDM2B_ENST00000377069.4_Silent_p.Q174Q|KDM2B_ENST00000538046.2_Silent_p.Q205Q	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	205	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)	p.Q205Q(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CCTTCAGATGCTGGGGCCACA	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											143.0	153.0	150.0					12																	121986850		2061	4213	6274	-	-	-	SO:0001819	synonymous_variant	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.615G>A	12.37:g.121986850C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.Q205	ENST00000377071.4	37	c.615	CCDS41850.1	12																																																																																			KDM2B	-	smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000089094		0.552	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	273	0.36	1	C	NM_032590		121986850	121986850	-1	no_errors	ENST00000377071	ensembl	human	known	69_37n	silent	229	10.55	27	SNP	1.000	T
KDM5C	8242	genome.wustl.edu	37	X	53225894	53225894	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:53225894C>T	ENST00000375401.3	-	19	3487	c.2955G>A	c.(2953-2955)gaG>gaA	p.E985E	KDM5C_ENST00000404049.3_Silent_p.E984E|KDM5C_ENST00000375379.3_Silent_p.E985E|KDM5C_ENST00000452825.3_Silent_p.E918E|KDM5C_ENST00000375383.3_Silent_p.E944E	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	985					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.E985E(1)|p.E918E(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GGTGGGCTTTCTCCTCCCAGC	0.592			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	2	Substitution - coding silent(2)	breast(2)											72.0	61.0	65.0					X																	53225894		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2955G>A	X.37:g.53225894C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.E985	ENST00000375401.3	37	c.2955	CCDS14351.1	X																																																																																			KDM5C	-	pfam_Lys_sp_deMease_like_dom	ENSG00000126012		0.592	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	76	0.00	0	C	NM_004187		53225894	53225894	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	silent	53	11.67	7	SNP	1.000	T
KIAA1143	57456	genome.wustl.edu	37	3	44795848	44795848	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:44795848G>T	ENST00000296121.4	-	2	180	c.121C>A	c.(121-123)Cag>Aag	p.Q41K	KIAA1143_ENST00000484437.1_5'UTR	NM_020696.3	NP_065747.1	Q96AT1	K1143_HUMAN	KIAA1143	41								p.Q41K(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.00847)|KIRC - Kidney renal clear cell carcinoma(197;0.0465)|Kidney(197;0.0582)		TCTGGGGGCTGAGGCTGAATT	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	84.0	85.0					3																	44795848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032969	CCDS2721.1	3p21.31	2005-08-15			ENSG00000163807	ENSG00000163807			29198	protein-coding gene	gene with protein product						10574461	Standard	NM_020696		Approved		uc011bac.2	Q96AT1	OTTHUMG00000133088	ENST00000296121.4:c.121C>A	3.37:g.44795848G>T	ENSP00000296121:p.Gln41Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0I4|Q96HJ8|Q9ULS7	Missense_Mutation	SNP	NULL	p.Q41K	ENST00000296121.4	37	c.121	CCDS2721.1	3	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021316	0.35701	.	.	ENSG00000163807	ENST00000296121	T	0.41065	1.01	5.63	4.73	0.59995	.	0.102992	0.64402	D	0.000002	T	0.35941	0.0949	L	0.43152	1.355	0.29282	N	0.869968	P	0.34587	0.458	B	0.35039	0.194	T	0.25152	-1.0140	10	0.24483	T	0.36	-3.2713	15.0284	0.71687	0.0:0.1407:0.8593:0.0	.	41	Q96AT1	K1143_HUMAN	K	41	ENSP00000296121:Q41K	ENSP00000296121:Q41K	Q	-	1	0	KIAA1143	44770852	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.299000	0.59073	2.652000	0.90054	0.655000	0.94253	CAG	KIAA1143	-	NULL	ENSG00000163807		0.408	KIAA1143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1143	HGNC	protein_coding	OTTHUMT00000256746.1	229	0.00	0	G	NM_020696		44795848	44795848	-1	no_errors	ENST00000296121	ensembl	human	known	69_37n	missense	191	14.73	33	SNP	1.000	T
KIAA1731	85459	genome.wustl.edu	37	11	93457518	93457518	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:93457518C>T	ENST00000325212.6	+	22	6457	c.6295C>T	c.(6295-6297)Cca>Tca	p.P2099S	SCARNA9_ENST00000530422.1_RNA|KIAA1731_ENST00000344196.4_Missense_Mutation_p.P279S|KIAA1731_ENST00000531700.1_Missense_Mutation_p.P279S|KIAA1731_ENST00000411936.1_Missense_Mutation_p.P2099S|SCARNA9_ENST00000362805.1_RNA|SCARNA9_ENST00000364329.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731	2099						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P2099S(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGGGATTTCTCCAGACAACAG	0.348																																						dbGAP											2	Substitution - Missense(2)	breast(2)											192.0	161.0	170.0					11																	93457518		692	1591	2283	-	-	-	SO:0001583	missense	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.6295C>T	11.37:g.93457518C>T	ENSP00000316681:p.Pro2099Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.P2099S	ENST00000325212.6	37	c.6295	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315320	0.40996	.	.	ENSG00000166004	ENST00000325212;ENST00000411936;ENST00000344196;ENST00000531700;ENST00000531404	T;T	0.09255	3.0;3.0	5.57	4.64	0.57946	.	.	.	.	.	T	0.08846	0.0219	L	0.29908	0.895	0.26400	N	0.976435	B;B;B	0.21452	0.056;0.056;0.056	B;B;B	0.18871	0.023;0.015;0.015	T	0.29852	-0.9998	9	0.18276	T	0.48	.	12.218	0.54416	0.0:0.7803:0.2197:0.0	.	2099;2099;279	Q9C0D2;Q9C0D2-3;Q9C0D2-2	K1731_HUMAN;.;.	S	2099;2099;279;279;111	ENSP00000316681:P2099S;ENSP00000406505:P2099S	ENSP00000316681:P2099S	P	+	1	0	KIAA1731	93097166	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.534000	0.45676	1.384000	0.46424	0.655000	0.94253	CCA	KIAA1731	-	NULL	ENSG00000166004		0.348	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	244	0.00	0	C	NM_033395		93457518	93457518	+1	no_errors	ENST00000411936	ensembl	human	known	69_37n	missense	212	11.98	29	SNP	1.000	T
KIF13A	63971	genome.wustl.edu	37	6	17796927	17796927	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:17796927T>C	ENST00000259711.6	-	23	3020	c.2915A>G	c.(2914-2916)cAt>cGt	p.H972R	KIF13A_ENST00000378843.2_Missense_Mutation_p.H972R|KIF13A_ENST00000378816.5_Missense_Mutation_p.H972R|KIF13A_ENST00000378814.5_Missense_Mutation_p.H972R|KIF13A_ENST00000378826.2_Missense_Mutation_p.H972R	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	972					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H972R(2)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TGTCTTAGCATGAAGAGAATC	0.483																																						dbGAP											2	Substitution - Missense(2)	breast(2)											141.0	135.0	137.0					6																	17796927		1920	4130	6050	-	-	-	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.2915A>G	6.37:g.17796927T>C	ENSP00000259711:p.His972Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.H972R	ENST00000259711.6	37	c.2915	CCDS47381.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.63|14.63	2.593621|2.593621	0.46214|0.46214	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044|ENST00000358380	T;T;T;T;T|.	0.70164|.	-0.45;-0.46;-0.45;-0.45;-0.45|.	5.05|5.05	3.88|3.88	0.44766|0.44766	.|.	0.165784|.	0.53938|.	D|.	0.000044|.	T|T	0.10937|0.10937	0.0267|0.0267	N|N	0.02539|0.02539	-0.55|-0.55	0.37112|0.37112	D|D	0.900398|0.900398	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.08055|.	0.003;0.002;0.001;0.001|.	T|T	0.09100|0.09100	-1.0690|-1.0690	10|5	0.46703|.	T|.	0.11|.	.|.	10.4187|10.4187	0.44338|0.44338	0.0:0.0772:0.0:0.9228|0.0:0.0772:0.0:0.9228	.|.	972;972;972;972|.	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3|.	.;.;KI13A_HUMAN;.|.	R|V	972;972;972;972;972;32|366	ENSP00000368091:H972R;ENSP00000259711:H972R;ENSP00000368103:H972R;ENSP00000368120:H972R;ENSP00000368093:H972R|.	ENSP00000259711:H972R|.	H|M	-|-	2|1	0|0	KIF13A|KIF13A	17904906|17904906	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	6.086000|6.086000	0.71352|0.71352	2.019000|2.019000	0.59389|0.59389	0.460000|0.460000	0.39030|0.39030	CAT|ATG	KIF13A	-	NULL	ENSG00000137177		0.483	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	79	0.00	0	T			17796927	17796927	-1	no_errors	ENST00000259711	ensembl	human	known	69_37n	missense	52	11.67	7	SNP	1.000	C
KIF2B	84643	genome.wustl.edu	37	17	51902101	51902101	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr17:51902101C>T	ENST00000268919.4	+	1	1863	c.1707C>T	c.(1705-1707)atC>atT	p.I569I		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	569					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I569I(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAAGTCACATCGGAAATTCAG	0.388																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											87.0	90.0	89.0					17																	51902101		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1707C>T	17.37:g.51902101C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MA2|Q9BXG6	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I569	ENST00000268919.4	37	c.1707	CCDS32685.1	17																																																																																			KIF2B	-	NULL	ENSG00000141200		0.388	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	99	0.00	0	C	NM_032559		51902101	51902101	+1	no_errors	ENST00000268919	ensembl	human	known	69_37n	silent	63	13.51	10	SNP	0.000	T
LRRC23	10233	genome.wustl.edu	37	12	7019087	7019087	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:7019087G>C	ENST00000007969.8	+	6	875	c.655G>C	c.(655-657)Gag>Cag	p.E219Q	LRRC23_ENST00000443597.2_Missense_Mutation_p.E219Q|LRRC23_ENST00000436789.1_Intron|LRRC23_ENST00000323702.5_Missense_Mutation_p.E219Q|LRRC23_ENST00000429740.1_Intron	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	219								p.E219Q(2)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						GGAAGGCTTGGAGGATCTGAG	0.498																																						dbGAP											2	Substitution - Missense(2)	breast(2)											148.0	128.0	135.0					12																	7019087		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.655G>C	12.37:g.7019087G>C	ENSP00000007969:p.Glu219Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.E219Q	ENST00000007969.8	37	c.655	CCDS8569.1	12	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881477	0.72294	.	.	ENSG00000010626	ENST00000007969;ENST00000323702;ENST00000443597	T;T;T	0.54675	0.56;2.96;0.56	5.76	5.76	0.90799	.	.	.	.	.	T	0.64271	0.2583	L	0.42008	1.315	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.93	D;D;P	0.71184	0.972;0.948;0.577	T	0.63853	-0.6543	9	0.54805	T	0.06	-30.0379	14.155	0.65413	0.0714:0.0:0.9286:0.0	.	219;219;219	A8K8K2;Q53EV4-2;Q53EV4	.;.;LRC23_HUMAN	Q	219	ENSP00000007969:E219Q;ENSP00000317464:E219Q;ENSP00000390932:E219Q	ENSP00000007969:E219Q	E	+	1	0	LRRC23	6889348	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	4.836000	0.62789	2.724000	0.93272	0.561000	0.74099	GAG	LRRC23	-	NULL	ENSG00000010626		0.498	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC23	HGNC	protein_coding	OTTHUMT00000345214.1	123	0.00	0	G	NM_006992		7019087	7019087	+1	no_errors	ENST00000007969	ensembl	human	known	69_37n	missense	102	11.30	13	SNP	1.000	C
LRRC8E	80131	genome.wustl.edu	37	19	7964304	7964304	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr19:7964304C>T	ENST00000306708.6	+	3	998	c.897C>T	c.(895-897)ttC>ttT	p.F299F	RN7SL115P_ENST00000392196.5_RNA|AC010336.1_ENST00000539278.1_3'UTR	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	299					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F299F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						ACGCCAGCTTCTGCTGCAACC	0.547																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											108.0	89.0	95.0					19																	7964304		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.897C>T	19.37:g.7964304C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Silent	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.F299	ENST00000306708.6	37	c.897	CCDS12189.1	19																																																																																			LRRC8E	-	NULL	ENSG00000171017		0.547	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8E	HGNC	protein_coding	OTTHUMT00000461354.1	164	0.00	0	C	NM_025061		7964304	7964304	+1	no_errors	ENST00000306708	ensembl	human	known	69_37n	silent	126	10.64	15	SNP	1.000	T
LRRCC1	85444	genome.wustl.edu	37	8	86047157	86047157	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr8:86047157G>C	ENST00000360375.3	+	13	2193	c.2044G>C	c.(2044-2046)Gaa>Caa	p.E682Q	LRRCC1_ENST00000414626.2_Missense_Mutation_p.E662Q	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	682					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E662Q(1)|p.E682Q(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						TCAACGAAAAGAAAATGAGTC	0.323																																						dbGAP											2	Substitution - Missense(2)	breast(2)											78.0	75.0	76.0					8																	86047157		1818	4069	5887	-	-	-	SO:0001583	missense	0			BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.2044G>C	8.37:g.86047157G>C	ENSP00000353538:p.Glu682Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin	p.E682Q	ENST00000360375.3	37	c.2044	CCDS43750.1	8	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710377	0.89018	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.42900	0.96;0.96	5.85	5.85	0.93711	.	0.000000	0.42172	D	0.000743	T	0.65698	0.2716	M	0.73598	2.24	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.997	T	0.57917	-0.7728	10	0.21014	T	0.42	-27.814	20.1731	0.98165	0.0:0.0:1.0:0.0	.	589;662;589;682	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	Q	682;662	ENSP00000353538:E682Q;ENSP00000394695:E662Q	ENSP00000353538:E682Q	E	+	1	0	LRRCC1	86234409	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.535000	0.82014	2.768000	0.95171	0.655000	0.94253	GAA	LRRCC1	-	NULL	ENSG00000133739		0.323	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRCC1	HGNC	protein_coding	OTTHUMT00000380267.1	131	0.00	0	G	NM_033402		86047157	86047157	+1	no_errors	ENST00000360375	ensembl	human	known	69_37n	missense	105	12.50	15	SNP	1.000	C
LRRFIP2	9209	genome.wustl.edu	37	3	37146954	37146954	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:37146954C>G	ENST00000336686.4	-	14	855	c.775G>C	c.(775-777)Gag>Cag	p.E259Q	LRRFIP2_ENST00000421276.2_Intron|LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000396428.2_Intron|LRRFIP2_ENST00000354379.4_Intron|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.E259Q			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	259	DVL3-binding.|Ser-rich.				Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)|p.E259Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						ACCACACTCTCCCTTCGTCCA	0.383																																						dbGAP											2	Substitution - Missense(1)|Whole gene deletion(1)	ovary(1)|breast(1)											131.0	112.0	118.0					3																	37146954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.775G>C	3.37:g.37146954C>G	ENSP00000338727:p.Glu259Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_DNA-bd,superfamily_Prefoldin	p.E259Q	ENST00000336686.4	37	c.775	CCDS2664.1	3	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707882	0.68615	.	.	ENSG00000093167	ENST00000421307;ENST00000336686	T;T	0.47528	0.84;0.84	6.17	6.17	0.99709	.	0.366054	0.29362	N	0.012361	T	0.35941	0.0949	N	0.08118	0	0.25526	N	0.987329	B	0.21381	0.055	B	0.32533	0.147	T	0.22695	-1.0209	10	0.26408	T	0.33	-12.3836	19.6509	0.95805	0.0:1.0:0.0:0.0	.	259	Q9Y608	LRRF2_HUMAN	Q	259	ENSP00000392217:E259Q;ENSP00000338727:E259Q	ENSP00000338727:E259Q	E	-	1	0	LRRFIP2	37121958	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.068000	0.71201	2.941000	0.99782	0.655000	0.94253	GAG	LRRFIP2	-	NULL	ENSG00000093167		0.383	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	HGNC	protein_coding	OTTHUMT00000253335.3	153	0.00	0	C	NM_006309		37146954	37146954	-1	no_errors	ENST00000336686	ensembl	human	known	69_37n	missense	101	14.41	17	SNP	1.000	G
MADD	8567	genome.wustl.edu	37	11	47300612	47300612	+	Silent	SNP	G	G	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:47300612G>T	ENST00000311027.5	+	7	1437	c.1272G>T	c.(1270-1272)ctG>ctT	p.L424L	MADD_ENST00000395344.3_Silent_p.L424L|MADD_ENST00000402799.1_Silent_p.L424L|MADD_ENST00000406482.1_Silent_p.L424L|MADD_ENST00000342922.4_Silent_p.L424L|MADD_ENST00000402192.2_Silent_p.L424L|MADD_ENST00000407859.3_Silent_p.L424L|MADD_ENST00000349238.3_Silent_p.L424L|MADD_ENST00000489415.1_3'UTR|MADD_ENST00000395336.3_Silent_p.L424L	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.L424L(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CACTAGAGCTGAAAAAGCATT	0.448																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											83.0	75.0	78.0					11																	47300612		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.1272G>T	11.37:g.47300612G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L424	ENST00000311027.5	37	c.1272	CCDS7930.1	11																																																																																			MADD	-	NULL	ENSG00000110514		0.448	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	158	0.00	0	G			47300612	47300612	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	silent	95	14.41	16	SNP	1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56178257	56178257	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:56178257C>G	ENST00000399503.3	+	14	3230	c.3230C>G	c.(3229-3231)tCa>tGa	p.S1077*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1077					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.S1077*(1)|p.S914*(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GGAGATCCCTCAAAAAATAGC	0.448																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											90.0	83.0	85.0					5																	56178257		1906	4126	6032	-	-	-	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3230C>G	5.37:g.56178257C>G	ENSP00000382423:p.Ser1077*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.S1077*	ENST00000399503.3	37	c.3230	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	38	6.939670	0.97948	.	.	ENSG00000095015	ENST00000399503	.	.	.	5.86	4.99	0.66335	.	0.519441	0.20045	N	0.100435	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	7.98	0.30177	0.1294:0.7347:0.0:0.1358	.	.	.	.	X	1077	.	ENSP00000382423:S1077X	S	+	2	0	MAP3K1	56214014	0.100000	0.21855	0.057000	0.19452	0.983000	0.72400	2.137000	0.42130	1.490000	0.48466	0.655000	0.94253	TCA	MAP3K1	-	NULL	ENSG00000095015		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	100	0.00	0	C	XM_042066		56178257	56178257	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	nonsense	74	12.94	11	SNP	0.756	G
MARCH4	57574	genome.wustl.edu	37	2	217234943	217234945	+	In_Frame_Del	DEL	CAC	CAC	-	rs145386484	byFrequency	TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	CAC	CAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:217234943_217234945delCAC	ENST00000273067.4	-	1	1805_1807	c.39_41delGTG	c.(37-42)tggtgc>tgc	p.W13del		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	13						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.W13delW(1)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GGAGCAGCAGCACCACCACCACC	0.616																																						dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0			AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.39_41delGTG	2.37:g.217234952_217234954delCAC	ENSP00000273067:p.Trp13del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMN7|Q86WR8	In_Frame_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.W13in_frame_del	ENST00000273067.4	37	c.41_39	CCDS33376.1	2																																																																																			MARCH4	-	NULL	ENSG00000144583		0.616	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH4	HGNC	protein_coding	OTTHUMT00000337272.2	28	0.00	0	CAC	NM_020814		217234943	217234945	-1	no_errors	ENST00000273067	ensembl	human	known	69_37n	in_frame_del	17	15.00	3	DEL	0.998:0.995:0.644	-
MAST2	23139	genome.wustl.edu	37	1	46496719	46496719	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:46496719G>C	ENST00000361297.2	+	23	3032	c.2749G>C	c.(2749-2751)Gag>Cag	p.E917Q	MAST2_ENST00000372009.2_Missense_Mutation_p.E847Q	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2									p.E917Q(1)		breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					ATCCCACACAGAGAGTGACTC	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											32.0	35.0	34.0					1																	46496719		2050	4184	6234	-	-	-	SO:0001583	missense	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.2749G>C	1.37:g.46496719G>C	ENSP00000354671:p.Glu917Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.E917Q	ENST00000361297.2	37	c.2749	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740532	0.89573	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.65916	-0.18;-0.1	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.81004	0.4733	M	0.84948	2.725	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.98	T	0.81863	-0.0737	10	0.40728	T	0.16	-24.098	17.9836	0.89148	0.0:0.0:1.0:0.0	.	847;917	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	Q	917;847	ENSP00000354671:E917Q;ENSP00000361079:E847Q	ENSP00000354671:E917Q	E	+	1	0	MAST2	46269306	1.000000	0.71417	0.998000	0.56505	0.910000	0.53928	9.449000	0.97603	2.557000	0.86248	0.563000	0.77884	GAG	MAST2	-	NULL	ENSG00000086015		0.637	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	43	0.00	0	G	NM_015112		46496719	46496719	+1	no_errors	ENST00000361297	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	C
MBD5	55777	genome.wustl.edu	37	2	149226685	149226685	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:149226685G>C	ENST00000407073.1	+	9	2170	c.1173G>C	c.(1171-1173)atG>atC	p.M391I	MBD5_ENST00000404807.1_Missense_Mutation_p.M391I	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	391	Pro-rich.				glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.M391I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		AGGTACCTATGATGAATGTAA	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											210.0	208.0	208.0					2																	149226685		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.1173G>C	2.37:g.149226685G>C	ENSP00000386049:p.Met391Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP	p.M391I	ENST00000407073.1	37	c.1173	CCDS33302.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.08|13.08	2.131793|2.131793	0.37630|0.37630	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000407073;ENST00000404807|ENST00000416015	T;T|.	0.32023|.	1.47;1.47|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	0.112229|.	0.39687|.	N|.	0.001293|.	T|.	0.51534|.	0.1680|.	N|N	0.14661|0.14661	0.345|0.345	0.50813|0.50813	D|D	0.999898|0.999898	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|.	0.45440|.	-0.9261|.	10|.	0.46703|.	T|.	0.11|.	-0.8403|-0.8403	19.4396|19.4396	0.94813|0.94813	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	391|.	Q9P267|.	MBD5_HUMAN|.	I|S	391|131	ENSP00000386049:M391I;ENSP00000384672:M391I|.	ENSP00000384672:M391I|.	M|X	+|+	3|2	0|2	MBD5|MBD5	148943155|148943155	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.679000|6.679000	0.74513|0.74513	2.678000|2.678000	0.91216|0.91216	0.655000|0.655000	0.94253|0.94253	ATG|TGA	MBD5	-	NULL	ENSG00000204406		0.418	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	104	0.00	0	G			149226685	149226685	+1	no_errors	ENST00000407073	ensembl	human	known	69_37n	missense	76	13.48	12	SNP	1.000	C
MFF	56947	genome.wustl.edu	37	2	228211994	228211994	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:228211994G>A	ENST00000353339.3	+	8	1087	c.646G>A	c.(646-648)Gaa>Aaa	p.E216K	MFF_ENST00000476924.1_Intron|MFF_ENST00000409616.1_Intron|MFF_ENST00000409565.1_Intron|MFF_ENST00000337110.7_Intron|MFF_ENST00000524634.1_Intron|MFF_ENST00000304593.9_Missense_Mutation_p.E165K|MFF_ENST00000349901.7_Intron|MFF_ENST00000354503.6_Intron|MFF_ENST00000392059.1_Missense_Mutation_p.E216K	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	216					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)	p.E216K(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						TATGTTACCTGAAGATGGAGC	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											199.0	181.0	187.0					2																	228211994		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.646G>A	2.37:g.228211994G>A	ENSP00000302037:p.Glu216Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.E216K	ENST00000353339.3	37	c.646	CCDS2465.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.599584	0.96614	.	.	ENSG00000168958	ENST00000304593;ENST00000353339;ENST00000531278;ENST00000392059;ENST00000456345	T;T	0.40225	1.04;1.04	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.59742	0.2216	L	0.55481	1.735	0.54753	D	0.999987	D;D	0.64830	0.965;0.994	P;P	0.62298	0.655;0.9	T	0.55717	-0.8097	10	0.45353	T	0.12	-17.2365	19.8513	0.96741	0.0:0.0:1.0:0.0	.	165;216	Q9GZY8-2;Q9GZY8	.;MFF_HUMAN	K	165;216;36;216;48	ENSP00000302037:E216K;ENSP00000375912:E216K	ENSP00000304898:E165K	E	+	1	0	MFF	227920238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.241000	0.78201	2.694000	0.91930	0.585000	0.79938	GAA	MFF	-	pfam_FATE/Miff/Tango-11	ENSG00000168958		0.468	MFF-001	KNOWN	basic|CCDS	protein_coding	MFF	HGNC	protein_coding	OTTHUMT00000256887.2	226	0.00	0	G	NM_020194		228211994	228211994	+1	no_errors	ENST00000353339	ensembl	human	known	69_37n	missense	143	17.82	31	SNP	1.000	A
MID2	11043	genome.wustl.edu	37	X	107169922	107169922	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:107169922C>G	ENST00000262843.6	+	10	2375	c.1827C>G	c.(1825-1827)taC>taG	p.Y609*	MID2_ENST00000443968.2_Nonsense_Mutation_p.Y579*|RP6-191P20.4_ENST00000430140.1_RNA	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	609	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.Y589*(1)|p.Y609*(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						GCATTGCCTACAAATCAGCTC	0.393																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											89.0	72.0	78.0					X																	107169922		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.1827C>G	X.37:g.107169922C>G	ENSP00000262843:p.Tyr609*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Y609*	ENST00000262843.6	37	c.1827	CCDS14532.2	X	.	.	.	.	.	.	.	.	.	.	C	41	8.731474	0.98933	.	.	ENSG00000080561	ENST00000262843;ENST00000443968	.	.	.	5.35	2.62	0.31277	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.0494	0.25065	0.0:0.6172:0.0:0.3828	.	.	.	.	X	609;579	.	ENSP00000262843:Y609X	Y	+	3	2	MID2	107056578	0.991000	0.36638	1.000000	0.80357	0.964000	0.63967	0.361000	0.20267	0.116000	0.18110	0.513000	0.50165	TAC	MID2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000080561		0.393	MID2-001	KNOWN	basic|CCDS	protein_coding	MID2	HGNC	protein_coding	OTTHUMT00000057852.2	98	0.00	0	C	NM_012216		107169922	107169922	+1	no_errors	ENST00000262843	ensembl	human	known	69_37n	nonsense	66	10.81	8	SNP	1.000	G
MMS22L	253714	genome.wustl.edu	37	6	97715767	97715767	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:97715767G>A	ENST00000275053.4	-	8	1074	c.809C>T	c.(808-810)tCa>tTa	p.S270L	MMS22L_ENST00000369251.2_Missense_Mutation_p.S270L|MMS22L_ENST00000506256.1_5'UTR	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	270					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.S270L(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CCTGTTGAGTGACAGGCTTAT	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	92.0	95.0					6																	97715767		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.809C>T	6.37:g.97715767G>A	ENSP00000275053:p.Ser270Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S270L	ENST00000275053.4	37	c.809	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730637	0.89390	.	.	ENSG00000146263	ENST00000275053;ENST00000369251;ENST00000510018	T;T;T	0.36157	1.27;1.27;1.27	5.26	5.26	0.73747	.	0.158357	0.43579	D	0.000542	T	0.40272	0.1110	L	0.60455	1.87	0.49051	D	0.999748	D;P	0.55605	0.972;0.952	P;B	0.51453	0.67;0.436	T	0.38564	-0.9655	10	0.72032	D	0.01	-6.7077	18.8486	0.92218	0.0:0.0:1.0:0.0	.	270;270	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	L	270;270;196	ENSP00000275053:S270L;ENSP00000358254:S270L;ENSP00000427288:S196L	ENSP00000275053:S270L	S	-	2	0	MMS22L	97822488	1.000000	0.71417	0.997000	0.53966	0.890000	0.51754	8.860000	0.92272	2.463000	0.83235	0.585000	0.79938	TCA	MMS22L	-	NULL	ENSG00000146263		0.343	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	170	0.00	0	G	NM_198468		97715767	97715767	-1	no_errors	ENST00000275053	ensembl	human	known	69_37n	missense	108	14.96	19	SNP	1.000	A
MSL3	10943	genome.wustl.edu	37	X	11778559	11778559	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:11778559G>A	ENST00000312196.4	+	3	328	c.223G>A	c.(223-225)Gat>Aat	p.D75N	MSL3_ENST00000398527.2_Missense_Mutation_p.D63N|MSL3_ENST00000361672.2_5'UTR|MSL3_ENST00000337339.2_Missense_Mutation_p.D75N|MSL3_ENST00000380693.3_5'UTR	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)	75	Chromo.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D75N(2)		breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						TGTGCTTCGTGATACCGATGA	0.353																																						dbGAP											2	Substitution - Missense(2)	breast(2)											87.0	79.0	82.0					X																	11778559		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	ENST00000312196.4:c.223G>A	X.37:g.11778559G>A	ENSP00000312244:p.Asp75Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Missense_Mutation	SNP	pfam_MRG,pfam_Tudor-knot,superfamily_Chromodomain-like,smart_Chromo_domain/shadow	p.D75N	ENST00000312196.4	37	c.223	CCDS14147.1	X	.	.	.	.	.	.	.	.	.	.	G	27.5	4.838023	0.91117	.	.	ENSG00000005302	ENST00000312196;ENST00000337339;ENST00000421368;ENST00000398527	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	4.77	4.77	0.60923	Chromo domain-like (1);Chromo domain/shadow (1);	0.058161	0.64402	N	0.000003	T	0.56108	0.1963	L	0.48260	1.515	0.80722	D	1	D;D;D;D	0.69078	0.997;0.996;0.993;0.997	D;D;D;D	0.79784	0.989;0.993;0.984;0.989	T	0.51236	-0.8731	10	0.28530	T	0.3	.	15.5626	0.76262	0.0:0.0:1.0:0.0	.	63;16;75;75	B4DUV8;Q8N5Y2-2;Q8N5Y2;A6NHW8	.;.;MS3L1_HUMAN;.	N	75;75;63;63	ENSP00000312244:D75N;ENSP00000338078:D75N;ENSP00000401809:D63N;ENSP00000381538:D63N	ENSP00000312244:D75N	D	+	1	0	MSL3	11688480	1.000000	0.71417	0.909000	0.35828	0.997000	0.91878	8.317000	0.89987	2.119000	0.64992	0.596000	0.82720	GAT	MSL3	-	superfamily_Chromodomain-like,smart_Chromo_domain/shadow	ENSG00000005302		0.353	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	MSL3	HGNC	protein_coding	OTTHUMT00000055757.1	133	0.00	0	G	NM_006800		11778559	11778559	+1	no_errors	ENST00000312196	ensembl	human	known	69_37n	missense	85	12.37	12	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9091122	9091122	+	Silent	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr19:9091122C>G	ENST00000397910.4	-	1	896	c.693G>C	c.(691-693)ggG>ggC	p.G231G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	231	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G231G(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AATAAAGTGTCCCAAATGATG	0.458																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											126.0	121.0	123.0					19																	9091122		1972	4168	6140	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.693G>C	19.37:g.9091122C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.G231	ENST00000397910.4	37	c.693	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	182	0.54	1	C	NM_024690		9091122	9091122	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	154	10.98	19	SNP	0.000	G
MYH6	4624	genome.wustl.edu	37	14	23855274	23855274	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:23855274C>T	ENST00000356287.3	-	33	5055	c.5026G>A	c.(5026-5028)Gtg>Atg	p.V1676M	MYH6_ENST00000405093.3_Missense_Mutation_p.V1676M|MIR208A_ENST00000362287.1_RNA			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1676					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.V1676M(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CGCCGCTCCACGATGGCGATG	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	66.0	70.0					14																	23855274		2203	4300	6503	-	-	-	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.5026G>A	14.37:g.23855274C>T	ENSP00000348634:p.Val1676Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1676M	ENST00000356287.3	37	c.5026	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	c	20.9	4.062533	0.76187	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.82984	-1.67;-1.67	4.05	4.05	0.47172	Myosin tail (1);	.	.	.	.	D	0.86155	0.5865	L	0.41492	1.28	0.49213	D	0.999761	D	0.69078	0.997	D	0.63033	0.91	D	0.87405	0.2372	9	0.52906	T	0.07	.	16.5823	0.84717	0.0:1.0:0.0:0.0	.	1676	P13533	MYH6_HUMAN	M	1676	ENSP00000386041:V1676M;ENSP00000348634:V1676M	ENSP00000348634:V1676M	V	-	1	0	MYH6	22925114	0.938000	0.31826	1.000000	0.80357	0.994000	0.84299	2.057000	0.41365	1.966000	0.57179	0.561000	0.74099	GTG	MYH6	-	pfam_Myosin_tail	ENSG00000197616		0.637	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	108	0.00	0	C			23855274	23855274	-1	no_errors	ENST00000356287	ensembl	human	known	69_37n	missense	66	10.81	8	SNP	1.000	T
NEDD8	4738	genome.wustl.edu	37	14	24687410	24687410	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:24687410G>C	ENST00000250495.5	-	3	264	c.78C>G	c.(76-78)atC>atG	p.I26M	MDP1_ENST00000288087.7_5'Flank|NEDD8_ENST00000524927.1_Missense_Mutation_p.I26M|NEDD8-MDP1_ENST00000534348.1_Missense_Mutation_p.I26M|NEDD8-MDP1_ENST00000604306.1_5'UTR|MDP1_ENST00000532557.1_5'Flank|MDP1_ENST00000396833.2_5'Flank|AL136419.6_ENST00000565988.1_RNA	NM_006156.2	NP_006147.1	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally down-regulated 8	26					anatomical structure morphogenesis (GO:0009653)|cellular protein modification process (GO:0006464)|protein localization (GO:0008104)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to organic cyclic compound (GO:0014070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.I26M(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5				GBM - Glioblastoma multiforme(265;0.0186)		CACGCTCCTTGATTCGCTCCA	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	108.0	114.0					14																	24687410		2203	4300	6503	-	-	-	SO:0001583	missense	0			D23662	CCDS9621.1	14q11.2	2008-08-13			ENSG00000129559	ENSG00000129559			7732	protein-coding gene	gene with protein product		603171				9353319	Standard	NM_006156		Approved	Nedd-8		Q15843	OTTHUMG00000029325	ENST00000250495.5:c.78C>G	14.37:g.24687410G>C	ENSP00000250495:p.Ile26Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXN8|Q6LES6	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.I26M	ENST00000250495.5	37	c.78	CCDS9621.1	14	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284422	0.59867	.	.	ENSG00000255526;ENSG00000129559;ENSG00000129559	ENST00000534348;ENST00000250495;ENST00000524927	T;T;T	0.34859	1.34;1.34;1.34	5.15	3.34	0.38264	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	T	0.58221	0.2107	M	0.87900	2.915	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.58538	-0.7619	10	0.87932	D	0	-7.5436	4.4094	0.11425	0.1723:0.0:0.5562:0.2714	.	26	Q15843	NEDD8_HUMAN	M	26	ENSP00000431482:I26M;ENSP00000250495:I26M;ENSP00000448192:I26M	ENSP00000250495:I26M	I	-	3	3	NEDD8-MDP1;NEDD8	23757250	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.325000	0.33724	0.764000	0.33197	0.655000	0.94253	ATC	NEDD8-MDP1	-	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	ENSG00000255526		0.527	NEDD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEDD8-MDP1	HGNC	protein_coding	OTTHUMT00000073146.2	148	0.00	0	G	NM_006156		24687410	24687410	-1	no_errors	ENST00000530579	ensembl	human	known	69_37n	missense	126	12.50	18	SNP	0.999	C
NF1	4763	genome.wustl.edu	37	17	29546065	29546065	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr17:29546065G>C	ENST00000358273.4	+	14	1953	c.1570G>C	c.(1570-1572)Gaa>Caa	p.E524Q	NF1_ENST00000356175.3_Missense_Mutation_p.E524Q|NF1_ENST00000431387.4_Missense_Mutation_p.E524Q	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	524					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)|p.E524Q(2)|p.N510_E547del(1)|p.E524*(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAGTACAGCAGAATTAATTAC	0.418			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	17	Whole gene deletion(8)|Unknown(5)|Substitution - Missense(2)|Deletion - In frame(1)|Substitution - Nonsense(1)	soft_tissue(8)|autonomic_ganglia(3)|central_nervous_system(2)|breast(2)|large_intestine(1)|lung(1)	GRCh37	CM001254	NF1	M							69.0	66.0	67.0					17																	29546065		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1570G>C	17.37:g.29546065G>C	ENSP00000351015:p.Glu524Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.E524Q	ENST00000358273.4	37	c.1570	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.135013	0.94517	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	T;T;T;T	0.65178	2.69;-0.14;-0.14;2.82	5.65	5.65	0.86999	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79488	0.4454	M	0.73217	2.22	0.80722	D	1	D;D;D;D;D	0.71674	0.987;0.989;0.959;0.998;0.996	P;D;P;D;D	0.80764	0.792;0.979;0.732;0.994;0.991	T	0.78976	-0.1991	10	0.51188	T	0.08	.	19.7165	0.96122	0.0:0.0:1.0:0.0	.	524;524;524;524;524	E1P657;P21359-2;P21359;Q14931;P21359-3	.;.;NF1_HUMAN;.;.	Q	524;524;524;190	ENSP00000412921:E524Q;ENSP00000351015:E524Q;ENSP00000348498:E524Q;ENSP00000389907:E190Q	ENSP00000348498:E524Q	E	+	1	0	NF1	26570191	1.000000	0.71417	0.904000	0.35570	0.947000	0.59692	9.138000	0.94501	2.665000	0.90641	0.585000	0.79938	GAA	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.418	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	147	0.00	0	G	NM_000267		29546065	29546065	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	missense	68	13.92	11	SNP	1.000	C
NFAT5	10725	genome.wustl.edu	37	16	69726330	69726330	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr16:69726330G>C	ENST00000354436.2	+	12	2866	c.2548G>C	c.(2548-2550)Gag>Cag	p.E850Q	NFAT5_ENST00000432919.1_Missense_Mutation_p.E868Q|NFAT5_ENST00000567239.1_Missense_Mutation_p.E867Q|NFAT5_ENST00000566899.1_Missense_Mutation_p.E774Q|NFAT5_ENST00000393742.2_Missense_Mutation_p.E774Q|NFAT5_ENST00000349945.1_Missense_Mutation_p.E774Q	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	850					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E774Q(1)|p.E868Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TTCCTCAACAGAGCCAACAGT	0.408																																						dbGAP											2	Substitution - Missense(2)	breast(2)											106.0	106.0	106.0					16																	69726330		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2548G>C	16.37:g.69726330G>C	ENSP00000346420:p.Glu850Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.E868Q	ENST00000354436.2	37	c.2602	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432080	0.43122	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.69	5.69	0.88448	.	0.087860	0.48767	D	0.000162	T	0.47266	0.1436	L	0.50333	1.59	0.47065	D	0.999308	P;P;P	0.45044	0.813;0.751;0.849	B;B;B	0.39771	0.202;0.309;0.309	T	0.47586	-0.9106	10	0.48119	T	0.1	-3.3768	20.181	0.98201	0.0:0.0:1.0:0.0	.	867;850;868	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	Q	868;867;774;850;774	ENSP00000396538:E868Q;ENSP00000338806:E774Q;ENSP00000346420:E850Q;ENSP00000377343:E774Q	ENSP00000338806:E774Q	E	+	1	0	NFAT5	68283831	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.722000	0.74735	2.840000	0.97914	0.655000	0.94253	GAG	NFAT5	-	NULL	ENSG00000102908		0.408	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2	143	0.00	0	G	NM_138714		69726330	69726330	+1	no_errors	ENST00000432919	ensembl	human	known	69_37n	missense	65	16.67	13	SNP	1.000	C
NLRP12	91662	genome.wustl.edu	37	19	54313212	54313212	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr19:54313212C>T	ENST00000324134.6	-	3	1869	c.1701G>A	c.(1699-1701)ctG>ctA	p.L567L	NLRP12_ENST00000391772.1_Silent_p.L567L|NLRP12_ENST00000354278.3_Silent_p.L567L|NLRP12_ENST00000345770.5_Silent_p.L567L|NLRP12_ENST00000535162.1_Silent_p.L567L|NLRP12_ENST00000351894.4_Silent_p.L567L|NLRP12_ENST00000391773.1_Silent_p.L567L|NLRP12_ENST00000391775.3_Silent_p.L567L	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	567					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.L567L(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TCTCCTCGTTCAGGAGTCCAA	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											84.0	80.0	81.0					19																	54313212		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1701G>A	19.37:g.54313212C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L567	ENST00000324134.6	37	c.1701	CCDS12864.1	19																																																																																			NLRP12	-	NULL	ENSG00000142405		0.577	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	42	0.00	0	C	NM_144687		54313212	54313212	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	silent	36	16.28	7	SNP	0.469	T
NPEPPS	9520	genome.wustl.edu	37	17	45608784	45608784	+	Silent	SNP	C	C	T	rs200065879	byFrequency	TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr17:45608784C>T	ENST00000322157.4	+	1	355	c.118C>T	c.(118-120)Ctg>Ttg	p.L40L	NPEPPS_ENST00000544660.1_5'UTR|NPEPPS_ENST00000530173.1_Silent_p.L36L|NPEPPS_ENST00000525037.1_Intron	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	40					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						cctccACAGCCTGGGCCTCGC	0.697													C|||	18	0.00359425	0.0	0.0058	5008	,	,		5849	0.0		0.0129	False		,,,				2504	0.001					dbGAP											0													1.0	1.0	1.0					17																	45608784		588	1676	2264	-	-	-	SO:0001819	synonymous_variant	0			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.118C>T	17.37:g.45608784C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z463|Q6P145|Q9NP16|Q9UEM2	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.L40	ENST00000322157.4	37	c.118	CCDS45721.1	17																																																																																			NPEPPS	-	NULL	ENSG00000141279		0.697	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPEPPS	HGNC	protein_coding	OTTHUMT00000384269.1	9	0.00	0	C	NM_006310		45608784	45608784	+1	no_errors	ENST00000322157	ensembl	human	known	69_37n	silent	3	50.00	3	SNP	1.000	T
CTD-2524L6.3	0	genome.wustl.edu	37	15	72109926	72109926	+	RNA	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr15:72109926G>C	ENST00000563041.1	+	0	0				CTD-2524L6.3_ENST00000562658.1_RNA|CTD-2524L6.3_ENST00000561834.1_RNA|NR2E3_ENST00000398840.2_RNA														p.L290F(1)									TCCCGTCTTTGAGGTTTATCA	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	122.0	122.0					15																	72109926		1911	4125	6036	-	-	-			0																															15.37:g.72109926G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000563041.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	G	15.20	2.764018	0.49574	.	.	ENSG00000031544	ENST00000326995	.	.	.	5.3	4.39	0.52855	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	T	0.78960	0.4366	.	.	.	0.58432	D	0.999990	D	0.89917	1.0	D	0.91635	0.999	D	0.85264	0.1052	7	0.87932	D	0	.	12.9783	0.58549	0.0797:0.0:0.9203:0.0	.	378	Q9Y5X4	NR2E3_HUMAN	F	290	.	ENSP00000317199:L290F	L	+	3	2	NR2E3	69896980	1.000000	0.71417	0.972000	0.41901	0.981000	0.71138	2.146000	0.42216	1.233000	0.43693	0.563000	0.77884	TTG	NR2E3	-	-	ENSG00000031544		0.502	CTD-2524L6.3-002	KNOWN	basic	antisense	NR2E3	HGNC	antisense	OTTHUMT00000420826.1	116	0.00	0	G			72109926	72109926	+1	no_errors	ENST00000326995	ensembl	human	known	69_37n	rna	81	16.49	16	SNP	1.000	C
POM121	9883	genome.wustl.edu	37	7	72419433	72419433	+	IGR	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:72419433G>A	ENST00000434423.2	+	0	3750				POM121_ENST00000395270.1_3'UTR|NSUN5P2_ENST00000388955.4_RNA			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.F173F(1)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CCCTGTACCTGAAGGCGCCCG	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											39.0	44.0	42.0					7																	72419433		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527		7.37:g.72419433G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	RNA	SNP	-	NULL	ENST00000434423.2	37	NULL		7																																																																																			NSUN5P2	-	-	ENSG00000106133		0.622	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	NSUN5P2	HGNC	protein_coding	OTTHUMT00000347344.1	75	0.00	0	G			72419433	72419433	-1	no_errors	ENST00000388955	ensembl	human	known	69_37n	rna	52	14.75	9	SNP	1.000	A
NTNG1	22854	genome.wustl.edu	37	1	107961246	107961246	+	Intron	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:107961246G>C	ENST00000370068.1	+	5	1933				NTNG1_ENST00000370070.2_Missense_Mutation_p.E378Q|NTNG1_ENST00000542803.1_Intron|NTNG1_ENST00000370066.1_Missense_Mutation_p.E378Q|NTNG1_ENST00000370071.2_Missense_Mutation_p.E378Q|NTNG1_ENST00000370072.3_Intron|NTNG1_ENST00000370065.1_Intron|NTNG1_ENST00000370074.4_Intron|NTNG1_ENST00000370073.2_Intron|NTNG1_ENST00000370067.1_Missense_Mutation_p.E378Q|NTNG1_ENST00000370061.3_Missense_Mutation_p.E378Q			Q9Y2I2	NTNG1_HUMAN	netrin G1						axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.E378Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		TTCTTCCCTTGAGGTTTCTAA	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	76.0	79.0					1																	107961246		1567	3581	5148	-	-	-	SO:0001627	intron_variant	0			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1087+10916G>C	1.37:g.107961246G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.E378Q	ENST00000370068.1	37	c.1132	CCDS44180.1	1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153950	0.38021	.	.	ENSG00000162631	ENST00000370071;ENST00000370061;ENST00000370070;ENST00000370064;ENST00000370062;ENST00000370067;ENST00000370066	T;T;T;T;T	0.71222	-0.36;0.13;-0.53;-0.55;-0.36	5.92	5.92	0.95590	.	.	.	.	.	T	0.39145	0.1067	N	0.08118	0	0.21740	N	0.999565	B;B	0.33073	0.396;0.34	B;B	0.29176	0.099;0.058	T	0.47598	-0.9105	9	0.36615	T	0.2	.	20.3167	0.98654	0.0:0.0:1.0:0.0	.	378;378	B4DKF0;Q9Y2I2-4	.;.	Q	378;378;378;139;139;378;378	ENSP00000359088:E378Q;ENSP00000359078:E378Q;ENSP00000359087:E378Q;ENSP00000359084:E378Q;ENSP00000359083:E378Q	ENSP00000359078:E378Q	E	+	1	0	NTNG1	107762769	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.134000	0.89606	2.809000	0.96659	0.557000	0.71058	GAG	NTNG1	-	NULL	ENSG00000162631		0.378	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTNG1	HGNC	protein_coding	OTTHUMT00000030340.1	245	0.00	0	G	NM_014917		107961246	107961246	+1	no_errors	ENST00000370061	ensembl	human	known	69_37n	missense	193	13.84	31	SNP	1.000	C
OR4B1	119765	genome.wustl.edu	37	11	48238979	48238979	+	Silent	SNP	C	C	G	rs372236234		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:48238979C>G	ENST00000309562.2	+	1	636	c.618C>G	c.(616-618)gtC>gtG	p.V206V		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TATTCTCTGTCTTCTCCTTCC	0.483																																						dbGAP											0													189.0	150.0	163.0					11																	48238979		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.618C>G	11.37:g.48238979C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF75|Q96R64	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V206	ENST00000309562.2	37	c.618	CCDS31485.1	11																																																																																			OR4B1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000175619		0.483	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4B1	HGNC	protein_coding	OTTHUMT00000390554.1	136	0.72	1	C	NM_001005470		48238979	48238979	+1	no_errors	ENST00000309562	ensembl	human	known	69_37n	silent	104	12.61	15	SNP	0.000	G
OR8H1	219469	genome.wustl.edu	37	11	56058164	56058164	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:56058164G>A	ENST00000313022.2	-	1	402	c.375C>T	c.(373-375)atC>atT	p.I125I		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I125I(1)		NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					GAGGACTGCAGATAGCTACGT	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											124.0	120.0	121.0					11																	56058164		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.375C>T	11.37:g.56058164G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNI7|Q6IFC5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I125	ENST00000313022.2	37	c.375	CCDS31526.1	11																																																																																			OR8H1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181693		0.453	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	HGNC	protein_coding	OTTHUMT00000370019.1	160	0.00	0	G	NM_001005199		56058164	56058164	-1	no_errors	ENST00000313022	ensembl	human	known	69_37n	silent	115	12.12	16	SNP	1.000	A
OR9K2	441639	genome.wustl.edu	37	12	55524054	55524054	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:55524054C>G	ENST00000305377.5	+	1	590	c.502C>G	c.(502-504)Cag>Gag	p.Q168E		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q168E(1)		NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						TCTGTGTACTCAGTTGGTGGC	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											141.0	135.0	137.0					12																	55524054		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.502C>G	12.37:g.55524054C>G	ENSP00000307598:p.Gln168Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH19|Q6IFD6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q168E	ENST00000305377.5	37	c.502	CCDS31814.1	12	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888588	0.33348	.	.	ENSG00000170605	ENST00000305377	T	0.00130	8.69	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.279238	0.26007	N	0.026903	T	0.00271	0.0008	M	0.73753	2.245	0.09310	N	1	D	0.53619	0.961	P	0.56648	0.803	T	0.51949	-0.8640	10	0.27785	T	0.31	-7.8464	4.2834	0.10843	0.1621:0.5979:0.1562:0.0838	.	168	Q8NGE7	OR9K2_HUMAN	E	168	ENSP00000307598:Q168E	ENSP00000307598:Q168E	Q	+	1	0	OR9K2	53810321	0.000000	0.05858	0.536000	0.28039	0.731000	0.41821	0.129000	0.15830	2.753000	0.94483	0.650000	0.86243	CAG	OR9K2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000170605		0.473	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9K2	HGNC	protein_coding	OTTHUMT00000406105.1	163	0.00	0	C			55524054	55524054	+1	no_errors	ENST00000305377	ensembl	human	known	69_37n	missense	138	10.97	17	SNP	0.006	G
PAPD4	167153	genome.wustl.edu	37	5	78919237	78919237	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:78919237C>T	ENST00000296783.3	+	5	689	c.390C>T	c.(388-390)gtC>gtT	p.V130V	PAPD4_ENST00000428308.2_Silent_p.V130V|PAPD4_ENST00000423041.2_Silent_p.V130V|PAPD4_ENST00000453514.1_Silent_p.V130V|PAPD4_ENST00000504233.1_Silent_p.V130V			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	130					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)	p.V130V(1)		biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		CAGATATAGTCAGATGTGTTC	0.368																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											158.0	144.0	149.0					5																	78919237		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.390C>T	5.37:g.78919237C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WZ2|Q8N927	Silent	SNP	pfam_PAP_assoc	p.V130	ENST00000296783.3	37	c.390	CCDS4048.1	5																																																																																			PAPD4	-	NULL	ENSG00000164329		0.368	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD4	HGNC	protein_coding	OTTHUMT00000226967.1	165	0.00	0	C	NM_173797		78919237	78919237	+1	no_errors	ENST00000296783	ensembl	human	known	69_37n	silent	99	10.81	12	SNP	1.000	T
PAPSS2	9060	genome.wustl.edu	37	10	89474611	89474611	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:89474611G>A	ENST00000361175.4	+	5	999	c.630G>A	c.(628-630)ctG>ctA	p.L210L	PAPSS2_ENST00000456849.1_Silent_p.L210L|PAPSS2_ENST00000427144.2_Silent_p.L214L	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	210					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		TGGAACTTCTGCAAGAGCAGG	0.378																																						dbGAP											0													164.0	163.0	163.0					10																	89474611		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.630G>A	10.37:g.89474611G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Silent	SNP	pfam_Sulfurylase_cat_dom,pfam_APS_kinase,superfamily_PUA-like_domain,tigrfam_Sulphate_adenylyltransferase,tigrfam_APS_kinase	p.L210	ENST00000361175.4	37	c.630	CCDS7385.1	10																																																																																			PAPSS2	-	tigrfam_APS_kinase	ENSG00000198682		0.378	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPSS2	HGNC	protein_coding	OTTHUMT00000049229.1	224	0.88	2	G			89474611	89474611	+1	no_errors	ENST00000456849	ensembl	human	known	69_37n	silent	150	10.18	17	SNP	1.000	A
PAQR3	152559	genome.wustl.edu	37	4	79856355	79856355	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr4:79856355C>G	ENST00000512733.1	-	2	481	c.268G>C	c.(268-270)Gac>Cac	p.D90H	PAQR3_ENST00000380645.4_Missense_Mutation_p.D90H|PAQR3_ENST00000295462.3_Intron	NM_001040202.1	NP_001035292.1	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III	90					negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein phosphorylation (GO:0001933)|protein localization to Golgi apparatus (GO:0034067)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.D90H(1)		breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	8						GATGTCATGTCATATATTCCC	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											115.0	117.0	116.0					4																	79856355		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055774	CCDS34020.1	4q21	2008-02-05				ENSG00000163291			30130	protein-coding gene	gene with protein product		614577				16044242	Standard	XM_006714104		Approved		uc003hlp.1	Q6TCH7		ENST00000512733.1:c.268G>C	4.37:g.79856355C>G	ENSP00000421981:p.Asp90His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5B7|B3KP59|Q6PIQ1|Q86X05|Q8NCP9	Missense_Mutation	SNP	pfam_HlyIII-related	p.D90H	ENST00000512733.1	37	c.268	CCDS34020.1	4	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875187	0.72180	.	.	ENSG00000163291	ENST00000512733;ENST00000380645	T;T	0.30981	1.51;1.51	5.32	5.32	0.75619	.	0.094303	0.64402	D	0.000001	T	0.49983	0.1589	L	0.56124	1.755	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.28744	-1.0034	10	0.16896	T	0.51	-12.4302	18.9881	0.92780	0.0:1.0:0.0:0.0	.	90	Q6TCH7	PAQR3_HUMAN	H	90	ENSP00000421981:D90H;ENSP00000370019:D90H	ENSP00000344203:D90H	D	-	1	0	PAQR3	80075379	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	4.784000	0.62411	2.497000	0.84241	0.563000	0.77884	GAC	PAQR3	-	pfam_HlyIII-related	ENSG00000163291		0.358	PAQR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR3	HGNC	protein_coding	OTTHUMT00000363442.1	142	0.70	1	C	NM_177453		79856355	79856355	-1	no_errors	ENST00000511594	ensembl	human	known	69_37n	missense	93	12.26	13	SNP	1.000	G
PCDHB14	56122	genome.wustl.edu	37	5	140604293	140604293	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:140604293G>C	ENST00000239449.4	+	1	1216	c.1216G>C	c.(1216-1218)Gaa>Caa	p.E406Q	PCDHB14_ENST00000515856.2_Missense_Mutation_p.E253Q	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E406Q(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTAGTTTCTGAAAAAGCACT	0.463																																					Ovarian(141;50 1831 27899 33809 37648)	dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	123.0	122.0					5																	140604293		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1216G>C	5.37:g.140604293G>C	ENSP00000239449:p.Glu406Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E406Q	ENST00000239449.4	37	c.1216	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	10.27	1.305222	0.23736	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.51325	0.71;0.71	4.54	4.54	0.55810	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.40423	0.1116	L	0.39898	1.24	0.09310	N	1	B	0.30236	0.274	B	0.34452	0.183	T	0.32955	-0.9887	9	0.51188	T	0.08	.	8.1225	0.30980	0.0:0.1451:0.5784:0.2766	.	406	Q9Y5E9	PCDBE_HUMAN	Q	253;406	ENSP00000444518:E253Q;ENSP00000239449:E406Q	ENSP00000239449:E406Q	E	+	1	0	PCDHB14	140584477	0.000000	0.05858	0.040000	0.18447	0.836000	0.47400	0.141000	0.16076	2.257000	0.74773	0.586000	0.80456	GAA	PCDHB14	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120327		0.463	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	115	0.00	0	G	NM_018934		140604293	140604293	+1	no_errors	ENST00000239449	ensembl	human	known	69_37n	missense	121	11.03	15	SNP	0.004	C
PER2	8864	genome.wustl.edu	37	2	239181776	239181776	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:239181776C>G	ENST00000254657.3	-	5	784	c.505G>C	c.(505-507)Gac>Cac	p.D169H	PER2_ENST00000355768.2_Missense_Mutation_p.D169H|PER2_ENST00000254658.3_Missense_Mutation_p.D169H|PER2_ENST00000440245.1_Missense_Mutation_p.D169H	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	169					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.D169H(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GAGGGCACGTCTGCTCCACAG	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											99.0	79.0	86.0					2																	239181776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.505G>C	2.37:g.239181776C>G	ENSP00000254657:p.Asp169His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.D169H	ENST00000254657.3	37	c.505	CCDS2528.1	2	.	.	.	.	.	.	.	.	.	.	C	8.873	0.949649	0.18431	.	.	ENSG00000132326	ENST00000254657;ENST00000254658;ENST00000440245;ENST00000355768	T;T;T;T	0.59906	2.13;0.23;1.52;0.23	4.81	2.96	0.34315	.	0.395747	0.28047	N	0.016818	T	0.42359	0.1199	N	0.25094	0.71	0.42507	D	0.992956	B;B;B;B	0.21309	0.015;0.013;0.02;0.054	B;B;B;B	0.25759	0.015;0.007;0.063;0.062	T	0.29852	-0.9998	10	0.56958	D	0.05	-18.1803	9.4886	0.38944	0.1565:0.6789:0.1646:0.0	.	169;169;169;169	F5GYD5;B4DH14;O15055-2;O15055	.;.;.;PER2_HUMAN	H	169	ENSP00000254657:D169H;ENSP00000254658:D169H;ENSP00000397516:D169H;ENSP00000348013:D169H	ENSP00000254657:D169H	D	-	1	0	PER2	238846515	0.633000	0.27181	0.029000	0.17559	0.002000	0.02628	1.634000	0.37123	0.530000	0.28619	0.655000	0.94253	GAC	PER2	-	NULL	ENSG00000132326		0.532	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1	88	0.00	0	C	NM_022817		239181776	239181776	-1	no_errors	ENST00000254657	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	0.924	G
PEX1	5189	genome.wustl.edu	37	7	92147080	92147080	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:92147080C>T	ENST00000248633.4	-	5	844	c.749G>A	c.(748-750)gGa>gAa	p.G250E	PEX1_ENST00000541751.1_5'Flank|PEX1_ENST00000428214.1_Missense_Mutation_p.G250E|PEX1_ENST00000438045.1_Intron	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	250					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.G250E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			AAAAATGCTTCCTATCATAGT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											99.0	94.0	95.0					7																	92147080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.749G>A	7.37:g.92147080C>T	ENSP00000248633:p.Gly250Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Peroxisome_synth_fac_1_a/b,pfam_PEX-1N,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.G250E	ENST00000248633.4	37	c.749	CCDS5627.1	7	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191736	0.58017	.	.	ENSG00000127980	ENST00000248633;ENST00000428214;ENST00000545192	D;D	0.95272	-3.58;-3.66	5.22	4.35	0.52113	.	0.102699	0.64402	D	0.000003	D	0.94509	0.8232	L	0.32530	0.975	0.80722	D	1	D;D	0.65815	0.995;0.995	P;P	0.61940	0.896;0.896	D	0.94997	0.8139	10	0.72032	D	0.01	-13.161	13.8917	0.63742	0.0:0.927:0.0:0.073	.	42;250	B4DER6;O43933	.;PEX1_HUMAN	E	250	ENSP00000248633:G250E;ENSP00000394413:G250E	ENSP00000248633:G250E	G	-	2	0	PEX1	91985016	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	1.243000	0.32767	1.442000	0.47568	0.555000	0.69702	GGA	PEX1	-	NULL	ENSG00000127980		0.363	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX1	HGNC	protein_coding	OTTHUMT00000254066.3	202	0.00	0	C	NM_000466		92147080	92147080	-1	no_errors	ENST00000248633	ensembl	human	known	69_37n	missense	137	14.37	23	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	3.37:g.178952085A>T	ENSP00000263967:p.His1047Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047L	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	118	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	108	10.74	13	SNP	1.000	T
PITPNM1	9600	genome.wustl.edu	37	11	67265000	67265000	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:67265000G>C	ENST00000534749.1	-	12	2121	c.1933C>G	c.(1933-1935)Cag>Gag	p.Q645E	PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000436757.2_Missense_Mutation_p.Q645E|PITPNM1_ENST00000356404.3_Missense_Mutation_p.Q645E			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	645					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)	p.Q645E(1)|p.P641_S644delPEGS(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						CACCTGTTCTGAGAGCCCTCG	0.662																																					GBM(28;144 709 4607 5525)	dbGAP											2	Substitution - Missense(1)|Deletion - In frame(1)	breast(1)|liver(1)											89.0	97.0	94.0					11																	67265000		2200	4294	6494	-	-	-	SO:0001583	missense	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1933C>G	11.37:g.67265000G>C	ENSP00000437286:p.Gln645Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.Q645E	ENST00000534749.1	37	c.1933	CCDS31620.1	11	.	.	.	.	.	.	.	.	.	.	G	0.211	-1.036473	0.02013	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.41400	1.0;1.0;1.0	3.62	3.62	0.41486	.	1.010270	0.07954	N	0.981280	T	0.10035	0.0246	N	0.00210	-1.845	0.24919	N	0.991997	P;B	0.35033	0.481;0.349	B;B	0.34824	0.19;0.093	T	0.16512	-1.0400	10	0.02654	T	1	-14.0356	7.1237	0.25458	0.1195:0.0:0.8805:0.0	.	645;645	O00562-2;O00562	.;PITM1_HUMAN	E	645	ENSP00000437286:Q645E;ENSP00000398787:Q645E;ENSP00000348772:Q645E	ENSP00000348772:Q645E	Q	-	1	0	PITPNM1	67021576	0.931000	0.31567	0.878000	0.34440	0.973000	0.67179	2.516000	0.45520	2.329000	0.79093	0.561000	0.74099	CAG	PITPNM1	-	NULL	ENSG00000110697		0.662	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	56	0.00	0	G	NM_004910		67265000	67265000	-1	no_errors	ENST00000356404	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	0.785	C
PLCB4	5332	genome.wustl.edu	37	20	9370583	9370583	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr20:9370583C>G	ENST00000378493.1	+	13	1231	c.1216C>G	c.(1216-1218)Ctc>Gtc	p.L406V	PLCB4_ENST00000378473.3_Missense_Mutation_p.L406V|PLCB4_ENST00000414679.2_Missense_Mutation_p.L406V|PLCB4_ENST00000278655.4_Missense_Mutation_p.L406V|PLCB4_ENST00000378501.2_Missense_Mutation_p.L406V|PLCB4_ENST00000334005.3_Missense_Mutation_p.L406V|PLCB4_ENST00000492632.1_3'UTR			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	406	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.L406V(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TCCTGTAATTCTCTCCTTTGA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	122.0	123.0					20																	9370583		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1216C>G	20.37:g.9370583C>G	ENSP00000367754:p.Leu406Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_PLC-beta_CS,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.L406V	ENST00000378493.1	37	c.1216	CCDS13105.1	20	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193244	0.78902	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.65	5.65	0.86999	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.063130	0.64402	D	0.000006	T	0.81064	0.4745	M	0.77616	2.38	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.987;0.979;1.0	D;D;D;D	0.97110	0.999;0.986;0.982;1.0	T	0.82617	-0.0369	10	0.87932	D	0	.	19.7135	0.96105	0.0:1.0:0.0:0.0	.	406;253;406;406	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	V	406;406;406;406;406;242	ENSP00000334105:L406V;ENSP00000367734:L406V;ENSP00000278655:L406V;ENSP00000367754:L406V;ENSP00000367762:L406V;ENSP00000390616:L242V	ENSP00000278655:L406V	L	+	1	0	PLCB4	9318583	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.893000	0.56243	2.648000	0.89879	0.655000	0.94253	CTC	PLCB4	-	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000101333		0.368	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCB4	HGNC	protein_coding	OTTHUMT00000077948.2	212	0.00	0	C			9370583	9370583	+1	no_errors	ENST00000334005	ensembl	human	known	69_37n	missense	140	11.95	19	SNP	1.000	G
PLEKHA7	144100	genome.wustl.edu	37	11	16810673	16810673	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:16810673G>A	ENST00000355661.3	-	23	3337	c.3327C>T	c.(3325-3327)ctC>ctT	p.L1109L	PLEKHA7_ENST00000531066.1_Silent_p.L1109L|PLEKHA7_ENST00000532079.1_3'UTR|PLEKHA7_ENST00000332954.4_5'UTR|PLEKHA7_ENST00000448080.2_Silent_p.L1110L			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	1109					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)	p.L1109L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						GCGGCCGGCTGAGGTAGCGAG	0.662																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	47.0	49.0					11																	16810673		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.3327C>T	11.37:g.16810673G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	NULL	p.S741L	ENST00000355661.3	37	c.2222	CCDS31434.1	11	.	.	.	.	.	.	.	.	.	.	G	10.15	1.271482	0.23221	.	.	ENSG00000166689	ENST00000530489	.	.	.	5.81	4.84	0.62591	.	.	.	.	.	T	0.60945	0.2308	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57289	-0.7837	4	.	.	.	-9.7454	10.0157	0.42014	0.0711:0.0:0.7897:0.1391	.	.	.	.	L	741	.	.	S	-	2	0	PLEKHA7	16767249	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.829000	0.55760	2.745000	0.94114	0.655000	0.94253	TCA	PLEKHA7	-	NULL	ENSG00000166689		0.662	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA7	HGNC	protein_coding	OTTHUMT00000387242.2	56	0.00	0	G	NM_175058		16810673	16810673	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530489	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	1.000	A
PNLDC1	154197	genome.wustl.edu	37	6	160222208	160222208	+	Silent	SNP	C	C	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:160222208C>A	ENST00000610273.1	+	3	336	c.165C>A	c.(163-165)gtC>gtA	p.V55V	PNLDC1_ENST00000392167.3_Silent_p.V66V|PNLDC1_ENST00000609334.1_3'UTR	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	55						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.V55V(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AATTTACAGTCTGTCAGATTG	0.383																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											212.0	200.0	204.0					6																	160222208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.165C>A	6.37:g.160222208C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP7|Q8N7X5	Silent	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.V55	ENST00000610273.1	37	c.165	CCDS5271.1	6																																																																																			PNLDC1	-	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	ENSG00000146453		0.383	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	PNLDC1	HGNC	protein_coding		231	0.00	0	C	NM_173516		160222208	160222208	+1	no_errors	ENST00000275275	ensembl	human	known	69_37n	silent	164	13.68	26	SNP	0.988	A
POMT2	29954	genome.wustl.edu	37	14	77751976	77751976	+	Splice_Site	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:77751976C>G	ENST00000261534.4	-	13	1535		c.e13-1			NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)	p.?(2)		breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CTGTTCCATTCTGCCATAAAA	0.433																																						dbGAP											2	Unknown(2)	breast(2)											235.0	271.0	259.0					14																	77751976		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1333-1G>C	14.37:g.77751976C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSG6|Q9P1W0|Q9P1W2	Splice_Site	SNP	-	e13-1	ENST00000261534.4	37	c.1333-1	CCDS9857.1	14	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954839	0.73902	.	.	ENSG00000009830	ENST00000261534	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8667	0.96806	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POMT2	76821729	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.421000	0.80204	2.773000	0.95371	0.655000	0.94253	.	POMT2	-	-	ENSG00000009830		0.433	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMT2	HGNC	protein_coding	OTTHUMT00000414155.1	70	0.00	0	C	NM_013382	Intron	77751976	77751976	-1	no_errors	ENST00000261534	ensembl	human	known	69_37n	splice_site	47	14.55	8	SNP	1.000	G
PPA1	5464	genome.wustl.edu	37	10	71969403	71969403	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:71969403C>T	ENST00000373232.3	-	7	649	c.550G>A	c.(550-552)Gaa>Aaa	p.E184K		NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	184					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)	p.E184K(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						ACAGTAGCTTCTAAGTAGCCA	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	110.0	109.0					10																	71969403		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.550G>A	10.37:g.71969403C>T	ENSP00000362329:p.Glu184Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	p.E184K	ENST00000373232.3	37	c.550	CCDS7299.1	10	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618029	0.66787	.	.	ENSG00000180817	ENST00000373232	T	0.45276	0.9	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.44767	0.1309	M	0.63208	1.945	0.80722	D	1	B	0.10296	0.003	B	0.20577	0.03	T	0.29274	-1.0017	10	0.33141	T	0.24	-12.6022	17.8306	0.88682	0.0:1.0:0.0:0.0	.	184	Q15181	IPYR_HUMAN	K	184	ENSP00000362329:E184K	ENSP00000362329:E184K	E	-	1	0	PPA1	71639409	1.000000	0.71417	0.994000	0.49952	0.769000	0.43574	5.872000	0.69636	2.548000	0.85928	0.460000	0.39030	GAA	PPA1	-	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	ENSG00000180817		0.343	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPA1	HGNC	protein_coding	OTTHUMT00000048490.2	200	0.00	0	C	NM_021129		71969403	71969403	-1	no_errors	ENST00000373232	ensembl	human	known	69_37n	missense	135	12.34	19	SNP	1.000	T
PPP1R12A	4659	genome.wustl.edu	37	12	80190988	80190988	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:80190988C>T	ENST00000450142.2	-	16	2545	c.2279G>A	c.(2278-2280)aGa>aAa	p.R760K	PPP1R12A_ENST00000437004.2_Missense_Mutation_p.R760K|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.R673K|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.R760K|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.R704K	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	760	Interaction with ROCK2.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.R760K(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						ATCATACGTTCTGGAGTACTT	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											243.0	212.0	222.0					12																	80190988		1852	4098	5950	-	-	-	SO:0001583	missense	0			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.2279G>A	12.37:g.80190988C>T	ENSP00000389168:p.Arg760Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R760K	ENST00000450142.2	37	c.2279	CCDS44947.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.1|29.1	4.979896|4.979896	0.92982|0.92982	.|.	.|.	ENSG00000058272|ENSG00000058272	ENST00000553081|ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107	.|T;T;T;T;T	.|0.37584	.|1.23;1.23;1.25;1.25;1.19	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.091232	.|0.85682	.|D	.|0.000000	T|T	0.55832|0.55832	0.1945|0.1945	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|P;P;P;P	.|0.47910	.|0.902;0.902;0.902;0.841	.|P;P;D;P	.|0.63033	.|0.87;0.87;0.91;0.745	T|T	0.51466|0.51466	-0.8702|-0.8702	5|10	.|0.06891	.|T	.|0.86	.|.	17.7867|17.7867	0.88540|0.88540	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|701;760;704;760	.|F8W8Q6;O14974-2;O14974-3;O14974	.|.;.;.;MYPT1_HUMAN	K|K	352|760;760;760;704;701;760;760;673;704	.|ENSP00000261207:R760K;ENSP00000389168:R760K;ENSP00000416769:R760K;ENSP00000449514:R673K;ENSP00000446855:R704K	.|ENSP00000261207:R760K	E|R	-|-	1|2	0|0	PPP1R12A|PPP1R12A	78715119|78715119	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.877000|0.877000	0.50540|0.50540	3.965000|3.965000	0.56788|0.56788	2.620000|2.620000	0.88729|0.88729	0.655000|0.655000	0.94253|0.94253	GAA|AGA	PPP1R12A	-	pirsf_Pase-1_reg_su_12A/B/C_euk	ENSG00000058272		0.303	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	465	0.00	0	C	NM_002480		80190988	80190988	-1	no_errors	ENST00000261207	ensembl	human	known	69_37n	missense	427	10.67	51	SNP	1.000	T
PPP1R8	5511	genome.wustl.edu	37	1	28169711	28169711	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:28169711C>G	ENST00000311772.5	+	5	565	c.507C>G	c.(505-507)ttC>ttG	p.F169L	PPP1R8_ENST00000236412.7_5'UTR|PPP1R8_ENST00000373931.4_Missense_Mutation_p.F27L	NM_014110.4	NP_054829.2	Q12972	PP1R8_HUMAN	protein phosphatase 1, regulatory subunit 8	169	Interaction with EED.				cell proliferation (GO:0008283)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|protein phosphatase type 1 regulator activity (GO:0008599)|protein serine/threonine phosphatase inhibitor activity (GO:0004865)|ribonuclease E activity (GO:0008995)|RNA binding (GO:0003723)	p.F169L(1)		breast(2)|cervix(1)|endometrium(2)|lung(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.76e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00248)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		TGACAGAGTTCAACACTGCCC	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	123.0	125.0					1																	28169711		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061959	CCDS311.1, CCDS312.1, CCDS313.1	1p35.3	2012-04-17	2011-10-04		ENSG00000117751	ENSG00000117751		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9296	protein-coding gene	gene with protein product	"""RNase E"", ""nuclear subunit of PP-1"", ""nuclear inhibitor of protein phosphatase-1"", ""activator of RNA decay"", ""protein phosphatase 1 regulatory subunit 8"""	602636	"""protein phosphatase 1, regulatory (inhibitor) subunit 8"""			7524097, 8473324	Standard	NM_014110		Approved	ard-1, NIPP-1, PRO2047, ARD1, NIPP1	uc001bov.2	Q12972	OTTHUMG00000003734	ENST00000311772.5:c.507C>G	1.37:g.28169711C>G	ENSP00000311677:p.Phe169Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TEJ2|Q5TEJ4|Q5TIF2|Q6PKF6|Q9UBH1|Q9UBZ0	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.F169L	ENST00000311772.5	37	c.507	CCDS311.1	1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400565	0.62177	.	.	ENSG00000117751	ENST00000311772;ENST00000373931;ENST00000434313;ENST00000399118;ENST00000431586	T	0.57752	0.38	5.96	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.49457	0.1558	L	0.56769	1.78	0.28541	N	0.912116	P	0.35923	0.528	B	0.38985	0.287	T	0.50524	-0.8818	10	0.36615	T	0.2	-15.3197	9.5768	0.39463	0.0:0.8031:0.0:0.1969	.	169	Q12972	PP1R8_HUMAN	L	169;27;169;27;27	ENSP00000311677:F169L	ENSP00000311677:F169L	F	+	3	2	PPP1R8	28042298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.930000	0.40124	1.537000	0.49254	0.650000	0.86243	TTC	PPP1R8	-	NULL	ENSG00000117751		0.448	PPP1R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R8	HGNC	protein_coding	OTTHUMT00000010528.1	102	0.00	0	C	NM_014110		28169711	28169711	+1	no_errors	ENST00000311772	ensembl	human	known	69_37n	missense	77	13.48	12	SNP	1.000	G
PRKD3	23683	genome.wustl.edu	37	2	37516501	37516501	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:37516501C>G	ENST00000379066.1	-	5	1477	c.715G>C	c.(715-717)Gag>Cag	p.E239Q	PRKD3_ENST00000234179.2_Missense_Mutation_p.E239Q			O94806	KPCD3_HUMAN	protein kinase D3	239					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.E239Q(2)		breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				ATACGTACCTCTTCACTGGGA	0.408																																					Melanoma(80;621 1355 8613 11814 51767)	dbGAP											2	Substitution - Missense(2)	breast(2)											94.0	90.0	91.0					2																	37516501		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.715G>C	2.37:g.37516501C>G	ENSP00000368356:p.Glu239Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.E239Q	ENST00000379066.1	37	c.715	CCDS1789.1	2	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600655	0.66332	.	.	ENSG00000115825	ENST00000379066;ENST00000234179;ENST00000443187	T;T;D	0.86164	-0.25;-0.25;-2.08	5.45	5.45	0.79879	.	0.059229	0.64402	D	0.000003	D	0.89417	0.6709	M	0.65498	2.005	0.80722	D	1	P;B	0.51791	0.948;0.066	P;B	0.51135	0.66;0.064	D	0.87261	0.2279	10	0.24483	T	0.36	-19.5561	17.4786	0.87667	0.0:1.0:0.0:0.0	.	239;239	O94806-2;O94806	.;KPCD3_HUMAN	Q	239;239;135	ENSP00000368356:E239Q;ENSP00000234179:E239Q;ENSP00000401839:E135Q	ENSP00000234179:E239Q	E	-	1	0	PRKD3	37370005	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.369000	0.66138	2.546000	0.85860	0.655000	0.94253	GAG	PRKD3	-	NULL	ENSG00000115825		0.408	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	157	0.00	0	C	NM_005813		37516501	37516501	-1	no_errors	ENST00000234179	ensembl	human	known	69_37n	missense	122	12.23	17	SNP	1.000	G
PTPN7	5778	genome.wustl.edu	37	1	202121761	202121761	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:202121761C>T	ENST00000308986.5	-	8	914	c.784G>A	c.(784-786)Gaa>Aaa	p.E262K	PTPN7_ENST00000543735.1_Missense_Mutation_p.E91K|PTPN7_ENST00000544762.1_Missense_Mutation_p.E38K|PTPN7_ENST00000492977.1_5'UTR|PTPN7_ENST00000367279.4_Missense_Mutation_p.E301K|PTPN7_ENST00000309017.3_Missense_Mutation_p.E367K			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7	262	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)	p.E301K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						CCAGCTGATTCTGGTGTCTGA	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	62.0	64.0					1																	202121761		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931	ENST00000308986.5:c.784G>A	1.37:g.202121761C>T	ENSP00000311133:p.Glu262Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt	p.E367K	ENST00000308986.5	37	c.1099		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.16|14.16	2.451195|2.451195	0.43531|0.43531	.|.	.|.	ENSG00000143851|ENSG00000143851	ENST00000367279;ENST00000309017;ENST00000308986;ENST00000544762;ENST00000543735;ENST00000477554|ENST00000477625	D;D;D;D;D;D|.	0.83755|.	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76|.	5.32|5.32	5.32|5.32	0.75619|0.75619	Protein-tyrosine phosphatase, receptor/non-receptor type (4);|.	0.000000|.	0.56097|.	D|.	0.000028|.	T|T	0.61048|0.61048	0.2316|0.2316	L|L	0.37630|0.37630	1.12|1.12	0.48341|0.48341	D|D	0.999638|0.999638	B;B;B;B;B|.	0.30439|.	0.279;0.022;0.055;0.055;0.236|.	B;B;B;B;B|.	0.28465|.	0.09;0.058;0.039;0.039;0.054|.	T|T	0.56177|0.56177	-0.8022|-0.8022	10|5	0.62326|.	D|.	0.03|.	.|.	18.5821|18.5821	0.91176|0.91176	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	336;210;214;262;301|.	B4DZD9;B4DVF0;Q8NFX3;P35236;P35236-2|.	.;.;.;PTN7_HUMAN;.|.	K|K	301;367;262;38;91;343|193	ENSP00000356248:E301K;ENSP00000309116:E367K;ENSP00000311133:E262K;ENSP00000438272:E38K;ENSP00000444624:E91K;ENSP00000418416:E343K|.	ENSP00000311133:E262K|.	E|R	-|-	1|2	0|0	PTPN7|PTPN7	200388384|200388384	1.000000|1.000000	0.71417|0.71417	0.441000|0.441000	0.26858|0.26858	0.221000|0.221000	0.24807|0.24807	4.723000|4.723000	0.61965|0.61965	2.463000|2.463000	0.83235|0.83235	0.563000|0.563000	0.77884|0.77884	GAA|AGA	PTPN7	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000143851		0.617	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	PTPN7	HGNC	protein_coding		122	0.00	0	C	NM_002832		202121761	202121761	-1	no_errors	ENST00000309017	ensembl	human	known	69_37n	missense	72	12.20	10	SNP	0.970	T
PROX1	5629	genome.wustl.edu	37	1	214170738	214170738	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:214170738G>C	ENST00000366958.4	+	2	1468	c.860G>C	c.(859-861)aGg>aCg	p.R287T	PROX1_ENST00000435016.1_Missense_Mutation_p.R287T|PROX1_ENST00000261454.4_Missense_Mutation_p.R287T|PROX1_ENST00000498508.2_Missense_Mutation_p.R287T	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	287					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.R287T(1)|p.R287M(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CTGGATGCCAGGGCCCAGGAC	0.502																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											65.0	67.0	66.0					1																	214170738		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.860G>C	1.37:g.214170738G>C	ENSP00000355925:p.Arg287Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	pfam_Prox1,superfamily_Homeodomain-like	p.R287T	ENST00000366958.4	37	c.860	CCDS31021.1	1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.608047	0.28623	.	.	ENSG00000117707	ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.54279	0.6;0.58;0.6;0.6	5.61	5.61	0.85477	.	0.165360	0.52532	D	0.000070	T	0.44664	0.1304	L	0.36672	1.1	0.46078	D	0.998859	B	0.25048	0.117	B	0.23150	0.044	T	0.34153	-0.9840	10	0.46703	T	0.11	-4.4647	14.8699	0.70448	0.0708:0.0:0.9292:0.0	.	287	Q92786	PROX1_HUMAN	T	287	ENSP00000420283:R287T;ENSP00000355925:R287T;ENSP00000400694:R287T;ENSP00000261454:R287T	ENSP00000261454:R287T	R	+	2	0	PROX1	212237361	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.634000	0.83273	2.635000	0.89317	0.563000	0.77884	AGG	PROX1	-	pfam_Prox1	ENSG00000117707		0.502	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	HGNC	protein_coding	OTTHUMT00000089727.6	70	0.00	0	G	NM_002763		214170738	214170738	+1	no_errors	ENST00000261454	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	0.981	C
PTPRK	5796	genome.wustl.edu	37	6	128410949	128410949	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:128410949G>A	ENST00000368215.3	-	8	1350	c.1351C>T	c.(1351-1353)Cag>Tag	p.Q451*	PTPRK_ENST00000368213.5_Nonsense_Mutation_p.Q451*|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000532331.1_Nonsense_Mutation_p.Q451*|PTPRK_ENST00000368210.3_Nonsense_Mutation_p.Q451*|PTPRK_ENST00000368207.3_Nonsense_Mutation_p.Q451*|PTPRK_ENST00000368226.4_Nonsense_Mutation_p.Q451*|PTPRK_ENST00000368227.3_Nonsense_Mutation_p.Q451*			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	451	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q451*(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ACAACATGCTGAGGGGCTTTG	0.468																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											192.0	163.0	173.0					6																	128410949		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1351C>T	6.37:g.128410949G>A	ENSP00000357198:p.Gln451*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Q451*	ENST00000368215.3	37	c.1351		6	.	.	.	.	.	.	.	.	.	.	G	39	7.387333	0.98252	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	.	.	.	5.73	5.73	0.89815	.	0.125563	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	19.8939	0.96942	0.0:0.0:1.0:0.0	.	.	.	.	X	451;451;451;451;451;451;451;308	.	ENSP00000357190:Q451X	Q	-	1	0	PTPRK	128452642	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.876000	0.87215	2.706000	0.92434	0.585000	0.79938	CAG	PTPRK	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000152894		0.468	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1	270	0.37	1	G			128410949	128410949	-1	no_errors	ENST00000368227	ensembl	human	known	69_37n	nonsense	231	10.12	26	SNP	1.000	A
PUM1	9698	genome.wustl.edu	37	1	31406059	31406059	+	Nonstop_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:31406059C>G	ENST00000257075.5	-	22	3653	c.3560G>C	c.(3559-3561)tGa>tCa	p.*1187S	PUM1_ENST00000373741.4_Nonstop_Mutation_p.*1225S|PUM1_ENST00000373742.2_Nonstop_Mutation_p.*1128S|PUM1_ENST00000426105.2_Nonstop_Mutation_p.*1189S|PUM1_ENST00000423018.2_Nonstop_Mutation_p.*1045S|PUM1_ENST00000424085.2_Nonstop_Mutation_p.*945S|SNORD103A_ENST00000363284.1_RNA|PUM1_ENST00000440538.2_Nonstop_Mutation_p.*1163S|PUM1_ENST00000373747.3_Nonstop_Mutation_p.*1190S	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	0					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)	p.*1187S(1)		breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GACACTGCCTCAGATGATACC	0.527																																						dbGAP											1	Nonstop extension(1)	breast(1)											143.0	132.0	136.0					1																	31406059		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.3560G>C	1.37:g.31406059C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Nonstop_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.*1189S	ENST00000257075.5	37	c.3566	CCDS338.1	1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.459998	0.43736	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5777	0.84705	0.0:1.0:0.0:0.0	.	.	.	.	S	945;1187;1190;927;1189;1163;1225;1045;1128	.	.	X	-	2	2	PUM1	31178646	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.530000	0.53539	2.592000	0.87571	0.555000	0.69702	TGA	PUM1	-	NULL	ENSG00000134644		0.527	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	115	0.00	0	C			31406059	31406059	-1	no_errors	ENST00000426105	ensembl	human	known	69_37n	nonstop	76	14.61	13	SNP	1.000	G
QRICH1	54870	genome.wustl.edu	37	3	49083950	49083950	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:49083950C>T	ENST00000395443.2	-	5	2051	c.1579G>A	c.(1579-1581)Ggg>Agg	p.G527R	QRICH1_ENST00000357496.2_Missense_Mutation_p.G527R|QRICH1_ENST00000479449.1_5'UTR|QRICH1_ENST00000424300.1_Missense_Mutation_p.G527R	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	527						nucleus (GO:0005634)		p.G527R(1)		breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		AGACAGAGCCCATAATTCAAC	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	104.0	109.0					3																	49083950		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.1579G>A	3.37:g.49083950C>T	ENSP00000378830:p.Gly527Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	pfam_DUF3504,superfamily_DEATH-like	p.G527R	ENST00000395443.2	37	c.1579	CCDS2787.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.515316	0.96402	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300	.	.	.	6.07	6.07	0.98685	.	0.046217	0.85682	D	0.000000	T	0.79656	0.4483	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.75850	-0.3172	9	0.39692	T	0.17	-3.4782	20.6525	0.99598	0.0:1.0:0.0:0.0	.	527	Q2TAL8	QRIC1_HUMAN	R	527	.	ENSP00000350094:G527R	G	-	1	0	QRICH1	49058954	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.209000	0.77916	2.890000	0.99128	0.585000	0.79938	GGG	QRICH1	-	NULL	ENSG00000198218		0.478	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QRICH1	HGNC	protein_coding	OTTHUMT00000345669.1	113	0.00	0	C	NM_017730		49083950	49083950	-1	no_errors	ENST00000357496	ensembl	human	known	69_37n	missense	87	12.12	12	SNP	1.000	T
RALGAPB	57148	genome.wustl.edu	37	20	37202806	37202806	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr20:37202806G>C	ENST00000262879.6	+	29	4440	c.4156G>C	c.(4156-4158)Gaa>Caa	p.E1386Q	RALGAPB_ENST00000490114.1_3'UTR|RALGAPB_ENST00000397038.1_Missense_Mutation_p.E1165Q|RALGAPB_ENST00000397040.1_Missense_Mutation_p.E1386Q|RALGAPB_ENST00000397042.3_Missense_Mutation_p.E1383Q			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1386	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TACAACTCTTGAAAAAGAAGT	0.398																																						dbGAP											0													61.0	70.0	67.0					20																	37202806		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.4156G>C	20.37:g.37202806G>C	ENSP00000262879:p.Glu1386Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP	p.E1386Q	ENST00000262879.6	37	c.4156	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908084	0.92107	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	D;D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28;-3.28	6.01	6.01	0.97437	Rap/ran-GAP (1);	0.000000	0.85682	D	0.000000	D	0.94440	0.8211	L	0.44542	1.39	0.80722	D	1	D;D	0.61697	0.99;0.99	P;P	0.59115	0.852;0.852	D	0.91861	0.5499	10	0.23302	T	0.38	.	20.5211	0.99222	0.0:0.0:1.0:0.0	.	1383;1386	A2A2E9;Q86X10	.;RLGPB_HUMAN	Q	1386;1383;1165;1386;1215	ENSP00000262879:E1386Q;ENSP00000380235:E1383Q;ENSP00000380231:E1165Q;ENSP00000380233:E1386Q;ENSP00000416646:E1215Q	ENSP00000262879:E1386Q	E	+	1	0	RALGAPB	36636220	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.861000	0.98227	0.650000	0.86243	GAA	RALGAPB	-	pfscan_Rap_GAP	ENSG00000170471		0.398	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1	173	0.56	1	G	NM_020336		37202806	37202806	+1	no_errors	ENST00000262879	ensembl	human	known	69_37n	missense	100	11.50	13	SNP	1.000	C
R3HDML	140902	genome.wustl.edu	37	20	42972038	42972038	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr20:42972038C>T	ENST00000217043.2	+	3	574	c.402C>T	c.(400-402)ctC>ctT	p.L134L	Y_RNA_ENST00000364493.1_RNA	NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	134	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)	p.L134L(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			TAGTGGATCTCATGAAGTCCT	0.617																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	81.0	94.0					20																	42972038		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.402C>T	20.37:g.42972038C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.L134	ENST00000217043.2	37	c.402	CCDS13329.1	20																																																																																			R3HDML	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	ENSG00000101074		0.617	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	R3HDML	HGNC	protein_coding	OTTHUMT00000079344.1	89	0.00	0	C	NM_178491		42972038	42972038	+1	no_errors	ENST00000217043	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	0.012	T
RCSD1	92241	genome.wustl.edu	37	1	167663386	167663386	+	Missense_Mutation	SNP	G	G	C	rs376615773		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:167663386G>C	ENST00000367854.3	+	5	652	c.321G>C	c.(319-321)aaG>aaC	p.K107N	RCSD1_ENST00000537350.1_Missense_Mutation_p.K77N	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	107					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)	p.K107N(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					CCTCACCCAAGAGTCCTGGAC	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	76.0	78.0					1																	167663386		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.321G>C	1.37:g.167663386G>C	ENSP00000356828:p.Lys107Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	pfam_RCSD	p.K107N	ENST00000367854.3	37	c.321	CCDS1263.1	1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676254	0.67928	.	.	ENSG00000198771	ENST00000367854;ENST00000361496;ENST00000537350	T;T	0.58797	0.34;0.31	5.18	2.22	0.28083	.	0.000000	0.85682	D	0.000000	T	0.64649	0.2617	M	0.80616	2.505	0.38055	D	0.935919	D;D	0.89917	0.997;1.0	P;D	0.85130	0.902;0.997	T	0.68496	-0.5393	9	0.87932	D	0	-29.6965	8.6268	0.33895	0.367:0.0:0.633:0.0	.	77;107	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	N	107;83;77	ENSP00000356828:K107N;ENSP00000439409:K77N	ENSP00000355291:K83N	K	+	3	2	RCSD1	165930010	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	0.984000	0.29565	0.666000	0.31087	0.655000	0.94253	AAG	RCSD1	-	NULL	ENSG00000198771		0.542	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RCSD1	HGNC	protein_coding	OTTHUMT00000085451.1	87	0.00	0	G	NM_052862		167663386	167663386	+1	no_errors	ENST00000367854	ensembl	human	known	69_37n	missense	62	15.07	11	SNP	1.000	C
REC8	9985	genome.wustl.edu	37	14	24642177	24642177	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:24642177C>G	ENST00000311457.3	+	4	794	c.195C>G	c.(193-195)ttC>ttG	p.F65L	REC8_ENST00000559919.1_Missense_Mutation_p.F65L			O95072	REC8_HUMAN	REC8 meiotic recombination protein	65					double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|reciprocal meiotic recombination (GO:0007131)|seminiferous tubule development (GO:0072520)|sister chromatid cohesion (GO:0007062)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)	condensed nuclear chromosome kinetochore (GO:0000778)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)		p.F65L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(265;0.00839)		GGCCCCGCTTCTCCCTCTATC	0.597																																					NSCLC(139;1764 2537 12868 49041)	dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	78.0	75.0					14																	24642177		1966	4135	6101	-	-	-	SO:0001583	missense	0			AF006264	CCDS41932.1	14q11.2-q12	2013-08-06	2013-08-06	2007-04-03		ENSG00000100918			16879	protein-coding gene	gene with protein product		608193	"""REC8-like 1 (yeast)"", ""REC8 homolog (yeast)"""	REC8L1		10207075, 15935783, 12759374	Standard	NM_005132		Approved	Rec8p, kleisin-alpha	uc001wms.3	O95072		ENST00000311457.3:c.195C>G	14.37:g.24642177C>G	ENSP00000308699:p.Phe65Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K576|D3DS62|Q658V5|Q6IA92|Q8WUV8|Q9BTF2|Q9NVQ9	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.F65L	ENST00000311457.3	37	c.195	CCDS41932.1	14	.	.	.	.	.	.	.	.	.	.	C	33	5.235730	0.95240	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.25250	1.81	5.39	4.49	0.54785	Rad21/Rec8-like protein, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.28566	0.0707	N	0.17345	0.48	0.46564	D	0.999104	B;D	0.76494	0.135;0.999	B;D	0.79108	0.174;0.992	T	0.04565	-1.0942	10	0.06365	T	0.9	-20.5608	12.6568	0.56791	0.1659:0.8341:0.0:0.0	.	65;65	O95072-2;O95072	.;REC8_HUMAN	L	65	ENSP00000308699:F65L	ENSP00000308699:F65L	F	+	3	2	REC8	23712017	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.826000	0.69293	1.235000	0.43724	0.561000	0.74099	TTC	REC8	-	pfam_Rad21_Rec8_N	ENSG00000100918		0.597	REC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REC8	HGNC	protein_coding	OTTHUMT00000415889.3	96	0.00	0	C	NM_005132		24642177	24642177	+1	no_errors	ENST00000311457	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	1.000	G
RGS12	6002	genome.wustl.edu	37	4	3344728	3344728	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr4:3344728C>T	ENST00000344733.5	+	3	2850	c.1946C>T	c.(1945-1947)tCa>tTa	p.S649L	RGS12_ENST00000336727.3_Missense_Mutation_p.S649L|RGS12_ENST00000382788.3_Missense_Mutation_p.S649L|RGS12_ENST00000543385.1_Missense_Mutation_p.S649L|RGS12_ENST00000306648.7_Missense_Mutation_p.S47L	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	649					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)	p.S649L(1)		autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCTCGGAGATCATTTGGGAGA	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	134.0	136.0					4																	3344728		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1946C>T	4.37:g.3344728C>T	ENSP00000339381:p.Ser649Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_Regulat_G_prot_signal,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTyr_interaction_dom,smart_Regulat_G_prot_signal,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTyr_interaction_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.S649L	ENST00000344733.5	37	c.1946	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493227	0.64186	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648	T;T;T;T;T	0.40476	1.03;1.38;1.39;1.39;1.14	4.92	4.92	0.64577	.	0.069712	0.64402	D	0.000012	T	0.59266	0.2181	L	0.58101	1.795	0.80722	D	1	D;D;D;D	0.89917	0.985;1.0;1.0;1.0	P;D;D;D	0.74023	0.771;0.971;0.959;0.982	T	0.61628	-0.7024	10	0.62326	D	0.03	-6.476	13.614	0.62097	0.0:1.0:0.0:0.0	.	47;649;649;649	Q8WX95;Q8WX97;O14924;O14924-4	.;.;RGS12_HUMAN;.	L	649;649;649;649;47	ENSP00000440566:S649L;ENSP00000339381:S649L;ENSP00000338509:S649L;ENSP00000372238:S649L;ENSP00000304459:S47L	ENSP00000304459:S47L	S	+	2	0	RGS12	3314526	0.997000	0.39634	0.262000	0.24481	0.518000	0.34316	4.832000	0.62759	2.277000	0.76020	0.655000	0.94253	TCA	RGS12	-	NULL	ENSG00000159788		0.403	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1	231	0.43	1	C	NM_002926		3344728	3344728	+1	no_errors	ENST00000344733	ensembl	human	known	69_37n	missense	168	12.50	24	SNP	0.845	T
RIT1	6016	genome.wustl.edu	37	1	155880559	155880559	+	5'UTR	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:155880559C>T	ENST00000368323.3	-	0	198				RIT1_ENST00000368322.3_Silent_p.K15K|RIT1_ENST00000539040.1_Intron	NM_006912.5	NP_008843.1	Q92963	RIT1_HUMAN	Ras-like without CAAX 1						GTP catabolic process (GO:0006184)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|skin(1)|urinary_tract(1)	19	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			CCATTGTCCTCTTGGGGCCTT	0.577																																						dbGAP											0													68.0	72.0	70.0					1																	155880559		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF084462	CCDS1123.1, CCDS58037.1, CCDS58036.1	1q21.2	2014-05-09	2002-09-11	2002-09-13	ENSG00000143622	ENSG00000143622			10023	protein-coding gene	gene with protein product	"""Ric-like, expressed in many tissues"", ""GTP-binding protein Roc1"""	609591	"""Ric (Drosophila)-like, expressed in many tissues"""	RIT		8824319, 8918462	Standard	NM_006912		Approved	RIBB, ROC1, MGC125864, MGC125865	uc031pqc.1	Q92963	OTTHUMG00000014104	ENST00000368323.3:c.-7G>A	1.37:g.155880559C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQE8|O00646|O00720|Q5VY89|Q5VY90	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K15	ENST00000368323.3	37	c.45	CCDS1123.1	1																																																																																			RIT1	-	NULL	ENSG00000143622		0.577	RIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIT1	HGNC	protein_coding	OTTHUMT00000039593.1	108	0.00	0	C	NM_006912		155880559	155880559	-1	no_errors	ENST00000368322	ensembl	human	putative	69_37n	silent	83	14.43	14	SNP	0.006	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037843	10037843	+	RNA	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrY:10037843C>T	ENST00000515896.1	+	0	80									RNA, 5.8S ribosomal pseudogene 6																		AATTGCAGGACACATTGATCA	0.512																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037843C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.512	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		34	0.00	0	C			10037843	10037843	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	22	18.52	5	SNP	1.000	T
RPAP2	79871	genome.wustl.edu	37	1	92789578	92789578	+	Silent	SNP	T	T	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:92789578T>G	ENST00000610020.1	+	8	1210	c.1101T>G	c.(1099-1101)ctT>ctG	p.L367L	RPAP2_ENST00000484158.1_3'UTR	NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	367					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)	p.L367L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		GAAACTTACTTAAAGTTTTGA	0.398																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											105.0	109.0	108.0					1																	92789578		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.1101T>G	1.37:g.92789578T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JKB5|Q49AS7|Q9H8Y2	Silent	SNP	pfam_DUF408	p.L367	ENST00000610020.1	37	c.1101	CCDS740.1	1																																																																																			RPAP2	-	NULL	ENSG00000122484		0.398	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP2	HGNC	protein_coding	OTTHUMT00000028368.2	135	0.00	0	T	NM_024813		92789578	92789578	+1	no_errors	ENST00000370343	ensembl	human	known	69_37n	silent	90	18.92	21	SNP	1.000	G
RPGR	6103	genome.wustl.edu	37	X	38146055	38146055	+	Intron	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chrX:38146055C>T	ENST00000339363.3	-	14	2688				RPGR_ENST00000318842.7_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000338898.3_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.E733K|RPGR_ENST00000342811.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.E733K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						ccatgctcctcctcccctccc	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											172.0	102.0	125.0					X																	38146055		2121	4202	6323	-	-	-	SO:0001627	intron_variant	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+291G>A	X.37:g.38146055C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.E733K	ENST00000339363.3	37	c.2197		X	.	.	.	.	.	.	.	.	.	.	c	6.901	0.535816	0.13188	.	.	ENSG00000156313	ENST00000378505	T	0.02395	4.31	2.37	0.178	0.15058	.	0.379473	0.08080	U	1.000000	T	0.03477	0.0100	L	0.56769	1.78	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.46789	-0.9166	10	0.28530	T	0.3	.	3.3917	0.07291	0.2027:0.5136:0.0:0.2837	.	733	E9PE28	.	K	733	ENSP00000367766:E733K	ENSP00000367766:E733K	E	-	1	0	RPGR	38030999	0.001000	0.12720	0.001000	0.08648	0.110000	0.19582	1.356000	0.34079	0.255000	0.21593	0.353000	0.21931	GAG	RPGR	-	NULL	ENSG00000156313		0.542	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		480	0.00	0	C	NM_000328		38146055	38146055	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	missense	483	10.20	55	SNP	0.000	T
RYR3	6263	genome.wustl.edu	37	15	33927951	33927951	+	Silent	SNP	G	G	A	rs565425018	byFrequency	TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr15:33927951G>A	ENST00000389232.4	+	26	3382	c.3312G>A	c.(3310-3312)gcG>gcA	p.A1104A	RYR3_ENST00000415757.3_Silent_p.A1104A	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1104	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.A1104A(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCGGCTGGGCGAGGCCAGGCT	0.517													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19700	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	60.0	59.0					15																	33927951		2017	4185	6202	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3312G>A	15.37:g.33927951G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.A1104	ENST00000389232.4	37	c.3312	CCDS45210.1	15																																																																																			RYR3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198838		0.517	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	169	0.00	0	G			33927951	33927951	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	125	11.97	17	SNP	1.000	A
SCAMP3	10067	genome.wustl.edu	37	1	155231934	155231934	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:155231934C>T	ENST00000302631.3	-	1	116	c.9G>A	c.(7-9)caG>caA	p.Q3Q	CLK2_ENST00000497188.1_5'Flank|SCAMP3_ENST00000355379.3_Silent_p.Q3Q|SCAMP3_ENST00000472397.1_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	3				Q -> R (in Ref. 2; AAB62724). {ECO:0000305}.	post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)	p.Q3Q(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGTCTCTGCTCTGAGCCATGT	0.647																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											70.0	70.0	70.0					1																	155231934		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.9G>A	1.37:g.155231934C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Silent	SNP	pfam_SCAMP	p.Q3	ENST00000302631.3	37	c.9	CCDS1105.1	1																																																																																			SCAMP3	-	NULL	ENSG00000116521		0.647	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP3	HGNC	protein_coding	OTTHUMT00000087399.1	89	0.00	0	C	NM_005698		155231934	155231934	-1	no_errors	ENST00000302631	ensembl	human	known	69_37n	silent	66	13.16	10	SNP	0.850	T
SF1	7536	genome.wustl.edu	37	11	64534715	64534715	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:64534715G>A	ENST00000377390.3	-	11	1688	c.1351C>T	c.(1351-1353)Ctg>Ttg	p.L451L	SF1_ENST00000433274.2_Silent_p.L425L|SF1_ENST00000227503.9_Silent_p.L451L|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000334944.5_Silent_p.L451L|SF1_ENST00000422298.2_Silent_p.L336L|SF1_ENST00000377387.1_Silent_p.L576L|SF1_ENST00000377394.3_Missense_Mutation_p.P452L	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	451	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.L451L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GTACTTCCCAGGTACTGATCT	0.547											OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											139.0	120.0	127.0					11																	64534715		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1351C>T	11.37:g.64534715G>A		Somatic	1077	WXS	Illumina GAIIx	Phase_IV	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_KH_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_KH_dom_type_1	p.P452L	ENST00000377390.3	37	c.1355	CCDS31599.1	11	.	.	.	.	.	.	.	.	.	.	G	13.22	2.170777	0.38315	.	.	ENSG00000168066	ENST00000377394;ENST00000486867	T;T	0.58940	0.3;0.48	5.34	5.34	0.76211	.	.	.	.	.	T	0.70193	0.3196	.	.	.	0.80722	D	1	P	0.51449	0.945	P	0.59056	0.851	T	0.70051	-0.4978	7	.	.	.	.	14.5526	0.68078	0.0:0.0:1.0:0.0	.	452	Q15637-6	.	L	452;170	ENSP00000366611:P452L;ENSP00000419062:P170L	.	P	-	2	0	SF1	64291291	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.517000	0.67061	2.516000	0.84829	0.561000	0.74099	CCT	SF1	-	NULL	ENSG00000168066		0.547	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SF1	HGNC	protein_coding	OTTHUMT00000143242.1	127	0.00	0	G	NM_004630		64534715	64534715	-1	no_errors	ENST00000377394	ensembl	human	known	69_37n	missense	81	14.74	14	SNP	1.000	A
SHE	126669	genome.wustl.edu	37	1	154471712	154471712	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:154471712G>A	ENST00000304760.2	-	2	680	c.594C>T	c.(592-594)gtC>gtT	p.V198V	TDRD10_ENST00000368482.4_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	198								p.V198V(1)		breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTAAAATGATGACCTGAAAAA	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											127.0	106.0	113.0					1																	154471712		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.594C>T	1.37:g.154471712G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEQ5	Silent	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.V198	ENST00000304760.2	37	c.594	CCDS30877.1	1																																																																																			SHE	-	NULL	ENSG00000169291		0.453	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHE	HGNC	protein_coding	OTTHUMT00000087910.2	176	0.56	1	G	NM_001010846		154471712	154471712	-1	no_errors	ENST00000304760	ensembl	human	known	69_37n	silent	154	13.48	24	SNP	0.999	A
SLC17A6	57084	genome.wustl.edu	37	11	22397575	22397575	+	Missense_Mutation	SNP	A	A	G	rs200240544	byFrequency	TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:22397575A>G	ENST00000263160.3	+	10	1659	c.1222A>G	c.(1222-1224)Act>Gct	p.T408A		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	408					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						CTATTCTCATACTAGAGGGGT	0.373																																						dbGAP											0													166.0	175.0	172.0					11																	22397575		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1222A>G	11.37:g.22397575A>G	ENSP00000263160:p.Thr408Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T408A	ENST00000263160.3	37	c.1222	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	A	18.74	3.688050	0.68271	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.59224	0.28	6.17	6.17	0.99709	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.039549	0.85682	D	0.000000	T	0.55449	0.1921	L	0.48260	1.515	0.45307	D	0.998303	B	0.19073	0.033	B	0.32149	0.141	T	0.50118	-0.8865	10	0.17369	T	0.5	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	408	Q9P2U8	VGLU2_HUMAN	A	408;296	ENSP00000263160:T408A	ENSP00000263160:T408A	T	+	1	0	SLC17A6	22354151	1.000000	0.71417	0.905000	0.35620	0.985000	0.73830	7.574000	0.82434	2.371000	0.80710	0.533000	0.62120	ACT	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.373	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	245	0.80	2	A	NM_020346		22397575	22397575	+1	no_errors	ENST00000263160	ensembl	human	known	69_37n	missense	171	10.94	21	SNP	1.000	G
SIDT2	51092	genome.wustl.edu	37	11	117052583	117052583	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:117052583G>A	ENST00000324225.4	+	3	897	c.366G>A	c.(364-366)aaG>aaA	p.K122K	SIDT2_ENST00000431081.2_Silent_p.K122K|SIDT2_ENST00000530948.1_3'UTR	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	122					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)	p.K122K(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		CCCCCACCAAGAATGAGTCGG	0.542											OREG0021368	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	89.0	91.0					11																	117052583		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.366G>A	11.37:g.117052583G>A		Somatic	1478	WXS	Illumina GAIIx	Phase_IV	Q8NBY7|Q9Y357	Silent	SNP	NULL	p.K122	ENST00000324225.4	37	c.366	CCDS31682.1	11																																																																																			SIDT2	-	NULL	ENSG00000149577		0.542	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1	127	0.00	0	G	NM_015996		117052583	117052583	+1	no_errors	ENST00000278951	ensembl	human	known	69_37n	silent	89	10.10	10	SNP	1.000	A
SLC1A6	6511	genome.wustl.edu	37	19	15082654	15082654	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr19:15082654G>T	ENST00000221742.3	-	2	245	c.238C>A	c.(238-240)Cag>Aag	p.Q80K	SLC1A6_ENST00000544886.2_Missense_Mutation_p.Q80K|SLC1A6_ENST00000430939.2_Nonsense_Mutation_p.S84*|SLC1A6_ENST00000598504.1_Missense_Mutation_p.Q80K|SLC1A6_ENST00000600144.1_Missense_Mutation_p.Q80K	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	80					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.Q80K(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						TAGGTGAGCTGATATGGGCGC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	107.0	111.0					19																	15082654		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.238C>A	19.37:g.15082654G>T	ENSP00000221742:p.Gln80Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N753	Nonsense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.S84*	ENST00000221742.3	37	c.251	CCDS12321.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.068947|5.068947	0.93950|0.93950	.|.	.|.	ENSG00000105143|ENSG00000105143	ENST00000221742;ENST00000544886;ENST00000542610|ENST00000430939	T;T|.	0.58358|.	0.34;0.34|.	4.26|4.26	3.19|3.19	0.36642|0.36642	.|.	0.339115|.	0.31082|.	N|.	0.008290|.	T|.	0.13670|.	0.0331|.	N|N	0.02296|0.02296	-0.605|-0.605	0.30456|0.30456	N|N	0.774784|0.774784	B;B;B|.	0.15930|.	0.005;0.015;0.002|.	B;B;B|.	0.17098|.	0.01;0.017;0.006|.	T|.	0.17837|.	-1.0356|.	10|.	0.05620|0.09338	T|T	0.96|0.73	-14.6078|-14.6078	10.985|10.985	0.47516|0.47516	0.0:0.0:0.8117:0.1883|0.0:0.0:0.8117:0.1883	.|.	80;81;80|.	Q8N753;Q59GB0;P48664|.	.;.;EAA4_HUMAN|.	K|X	80;80;81|84	ENSP00000221742:Q80K;ENSP00000446175:Q80K|.	ENSP00000221742:Q80K|ENSP00000409386:S84X	Q|S	-|-	1|2	0|0	SLC1A6|SLC1A6	14943654|14943654	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.570000|0.570000	0.35934|0.35934	2.496000|2.496000	0.45346|0.45346	0.959000|0.959000	0.37980|0.37980	0.561000|0.561000	0.74099|0.74099	CAG|TCA	SLC1A6	-	NULL	ENSG00000105143		0.567	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	HGNC	protein_coding	OTTHUMT00000466283.1	121	0.00	0	G	NM_005071		15082654	15082654	-1	no_errors	ENST00000430939	ensembl	human	known	69_37n	nonsense	78	11.36	10	SNP	0.883	T
SLC25A13	10165	genome.wustl.edu	37	7	95906630	95906630	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr7:95906630G>A	ENST00000265631.5	-	3	226	c.90C>T	c.(88-90)aaC>aaT	p.N30N	SLC25A13_ENST00000542654.1_De_novo_Start_InFrame|SLC25A13_ENST00000416240.2_Silent_p.N30N			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	30					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)	p.N30N(1)		breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	AAAATTCACCGTTTTTCTCAA	0.323																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											47.0	44.0	45.0					7																	95906630		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.90C>T	7.37:g.95906630G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_EF_HAND_2,pfscan_Mitochondrial_sb/sol_carrier	p.N30	ENST00000265631.5	37	c.90	CCDS5645.1	7																																																																																			SLC25A13	-	NULL	ENSG00000004864		0.323	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A13	HGNC	protein_coding	OTTHUMT00000059395.2	113	0.00	0	G	NM_014251		95906630	95906630	-1	no_errors	ENST00000416240	ensembl	human	known	69_37n	silent	80	15.79	15	SNP	1.000	A
SLC25A34	284723	genome.wustl.edu	37	1	16063212	16063212	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:16063212C>T	ENST00000294454.5	+	1	313	c.232C>T	c.(232-234)Ctg>Ttg	p.L78L	RP11-288I21.1_ENST00000453804.1_RNA	NM_207348.1	NP_997231.1	Q6PIV7	S2534_HUMAN	solute carrier family 25, member 34	78					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.L78L(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(1)|lung(2)|skin(1)	9		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCGGCCTTCTGTACCAAGG	0.652																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											21.0	25.0	23.0					1																	16063212		2199	4298	6497	-	-	-	SO:0001819	synonymous_variant	0			BC027998	CCDS162.1	1p36.13	2013-05-22			ENSG00000162461	ENSG00000162461		"""Solute carriers"""	27653	protein-coding gene	gene with protein product		610817					Standard	NM_207348		Approved	DKFZp781A10161	uc001axb.1	Q6PIV7	OTTHUMG00000003063	ENST00000294454.5:c.232C>T	1.37:g.16063212C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DV0	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.L78	ENST00000294454.5	37	c.232	CCDS162.1	1																																																																																			SLC25A34	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000162461		0.652	SLC25A34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A34	HGNC	protein_coding	OTTHUMT00000008467.1	40	0.00	0	C	NM_207348		16063212	16063212	+1	no_errors	ENST00000294454	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	0.994	T
SLC26A1	10861	genome.wustl.edu	37	4	985117	985117	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr4:985117G>C	ENST00000361661.2	-	3	752	c.375C>G	c.(373-375)atC>atG	p.I125M	IDUA_ENST00000453894.1_Intron|SLC26A1_ENST00000398516.2_Missense_Mutation_p.I125M|IDUA_ENST00000247933.4_Intron|SLC26A1_ENST00000398520.2_Missense_Mutation_p.I125M|SLC26A1_ENST00000513138.1_5'Flank	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	125					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCAGGCTGAAGATGCCCACGG	0.637																																						dbGAP											0													104.0	98.0	100.0					4																	985117		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.375C>G	4.37:g.985117G>C	ENSP00000354721:p.Ile125Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.I125M	ENST00000361661.2	37	c.375	CCDS33934.1	4	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276539	0.59758	.	.	ENSG00000145217	ENST00000398520;ENST00000361661;ENST00000398516	D;D;D	0.91351	-2.83;-2.83;-2.83	5.3	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.90075	0.6900	L	0.35341	1.055	0.80722	D	1	P;P	0.47604	0.898;0.885	P;P	0.59221	0.854;0.688	D	0.89198	0.3555	10	0.56958	D	0.05	.	8.1785	0.31296	0.1827:0.0:0.8173:0.0	.	125;125	Q9H2B4;Q96BK0	S26A1_HUMAN;.	M	125	ENSP00000381532:I125M;ENSP00000354721:I125M;ENSP00000381528:I125M	ENSP00000354721:I125M	I	-	3	3	SLC26A1	975117	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	1.764000	0.38471	1.227000	0.43598	0.462000	0.41574	ATC	SLC26A1	-	tigrfam_SulP_transpt	ENSG00000145217		0.637	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A1	HGNC	protein_coding	OTTHUMT00000358783.1	32	0.00	0	G	NM_022042, NM_134425		985117	985117	-1	no_errors	ENST00000361661	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	C
MIEF2	125170	genome.wustl.edu	37	17	18167940	18167940	+	Silent	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr17:18167940C>T	ENST00000323019.4	+	4	1438	c.1227C>T	c.(1225-1227)atC>atT	p.I409I	MIEF2_ENST00000395706.2_Silent_p.I420I|MIEF2_ENST00000395704.4_3'UTR	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	409					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)		p.I409I(1)									AGCTGCTCATCGGCAGCCTGG	0.632																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											45.0	43.0	44.0					17																	18167940		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.1227C>T	17.37:g.18167940C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	J3KPT3|Q6ZRD4|Q96N07	Silent	SNP	NULL	p.I409	ENST00000323019.4	37	c.1227	CCDS11193.1	17																																																																																			SMCR7	-	NULL	ENSG00000177427		0.632	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR7	HGNC	protein_coding	OTTHUMT00000132060.2	30	0.00	0	C	NM_139162		18167940	18167940	+1	no_errors	ENST00000323019	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	0.005	T
SLFN5	162394	genome.wustl.edu	37	17	33592664	33592664	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr17:33592664G>A	ENST00000299977.4	+	5	2581	c.2433G>A	c.(2431-2433)atG>atA	p.M811I	SLFN5_ENST00000542451.1_3'UTR	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	811					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.M811I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		TAACAGCAATGAGGAAGAGAA	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	88.0	91.0					17																	33592664		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.2433G>A	17.37:g.33592664G>A	ENSP00000299977:p.Met811Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.M811I	ENST00000299977.4	37	c.2433	CCDS32619.1	17	.	.	.	.	.	.	.	.	.	.	g	10.95	1.495756	0.26774	.	.	ENSG00000166750	ENST00000299977	T	0.81415	-1.49	3.14	-0.461	0.12172	.	0.387803	0.19368	N	0.115973	T	0.68879	0.3049	L	0.54965	1.715	0.58432	D	0.999998	B	0.11235	0.004	B	0.08055	0.003	T	0.58578	-0.7612	10	0.48119	T	0.1	.	2.4597	0.04538	0.2808:0.0:0.4849:0.2343	.	811	Q08AF3	SLFN5_HUMAN	I	811	ENSP00000299977:M811I	ENSP00000299977:M811I	M	+	3	0	SLFN5	30616777	0.583000	0.26757	0.915000	0.36163	0.099000	0.18886	0.700000	0.25601	0.167000	0.19631	-0.150000	0.13652	ATG	SLFN5	-	NULL	ENSG00000166750		0.433	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN5	HGNC	protein_coding	OTTHUMT00000448649.2	117	0.00	0	G	NM_144975		33592664	33592664	+1	no_errors	ENST00000299977	ensembl	human	known	69_37n	missense	69	14.81	12	SNP	0.889	A
SMYD3	64754	genome.wustl.edu	37	1	246078940	246078940	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:246078940G>A	ENST00000388985.4	-	8	704	c.705C>T	c.(703-705)ctC>ctT	p.L235L	SMYD3_ENST00000366517.1_5'UTR|SMYD3_ENST00000541742.1_Silent_p.L176L|SMYD3_ENST00000490107.1_Silent_p.L176L			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	235	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)	p.L235L(1)|p.L176L(1)		breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		AGCAGATGGTGAGCTGTGCAG	0.468																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											80.0	67.0	71.0					1																	246078940		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.705C>T	1.37:g.246078940G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.L235	ENST00000388985.4	37	c.705	CCDS53486.1	1																																																																																			SMYD3	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000185420		0.468	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD3	HGNC	protein_coding		105	0.00	0	G	NM_022743		246078940	246078940	-1	no_errors	ENST00000388985	ensembl	human	known	69_37n	silent	78	15.22	14	SNP	1.000	A
SMYD3	64754	genome.wustl.edu	37	1	246670372	246670372	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:246670372C>T	ENST00000388985.4	-	1	147	c.148G>A	c.(148-150)Gac>Aac	p.D50N	SMYD3_ENST00000403792.3_Missense_Mutation_p.D50N|SMYD3_ENST00000490107.1_5'UTR			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	50	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)	p.D50N(1)		breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		AGGCAGCGGTCGCAGACGACG	0.731																																						dbGAP											1	Substitution - Missense(1)	breast(1)											30.0	39.0	36.0					1																	246670372		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.148G>A	1.37:g.246670372C>T	ENSP00000373637:p.Asp50Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.D50N	ENST00000388985.4	37	c.148	CCDS53486.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098754	0.76870	.	.	ENSG00000185420	ENST00000388985;ENST00000403792	T;T	0.15139	2.45;2.45	5.45	4.48	0.54585	SET domain (2);Zinc finger, MYND-type (3);	0.149655	0.44483	D	0.000453	T	0.15565	0.0375	L	0.35593	1.075	0.80722	D	1	D	0.61697	0.99	P	0.47075	0.536	T	0.02075	-1.1218	10	0.21540	T	0.41	.	11.3595	0.49636	0.0:0.817:0.183:0.0	.	50	Q9H7B4	SMYD3_HUMAN	N	50	ENSP00000373637:D50N;ENSP00000385380:D50N	ENSP00000373637:D50N	D	-	1	0	SMYD3	244736995	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	3.921000	0.56454	2.568000	0.86640	0.591000	0.81541	GAC	SMYD3	-	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_Znf_MYND	ENSG00000185420		0.731	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD3	HGNC	protein_coding		19	0.00	0	C	NM_022743		246670372	246670372	-1	no_errors	ENST00000388985	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.999	T
SNRK	54861	genome.wustl.edu	37	3	43384891	43384891	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:43384891G>C	ENST00000296088.7	+	6	1304	c.1000G>C	c.(1000-1002)Gaa>Caa	p.E334Q	SNRK_ENST00000437827.1_Missense_Mutation_p.E128Q|SNRK_ENST00000429705.2_Missense_Mutation_p.E334Q|SNRK_ENST00000454177.1_Missense_Mutation_p.E334Q	NM_017719.4	NP_060189.3			SNF related kinase									p.E334Q(2)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		CCTGCTGGCTGAAAGGATCCT	0.458																																						dbGAP											2	Substitution - Missense(2)	breast(2)											102.0	99.0	100.0					3																	43384891		1854	4105	5959	-	-	-	SO:0001583	missense	0			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1000G>C	3.37:g.43384891G>C	ENSP00000296088:p.Glu334Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.E334Q	ENST00000296088.7	37	c.1000	CCDS43075.1	3	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968458	0.92855	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.68624	-0.34;-0.34;-0.34;2.54	5.27	5.27	0.74061	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);	0.056474	0.64402	D	0.000001	T	0.82116	0.4967	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.83377	0.0010	10	0.62326	D	0.03	.	19.2583	0.93955	0.0:0.0:1.0:0.0	.	334	Q9NRH2	SNRK_HUMAN	Q	334;334;334;128	ENSP00000401246:E334Q;ENSP00000411375:E334Q;ENSP00000296088:E334Q;ENSP00000409516:E128Q	ENSP00000296088:E334Q	E	+	1	0	SNRK	43359895	1.000000	0.71417	0.754000	0.31244	0.893000	0.52053	9.813000	0.99286	2.640000	0.89533	0.655000	0.94253	GAA	SNRK	-	pfscan_UBA/transl_elong_EF1B_N_euk	ENSG00000163788		0.458	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRK	HGNC	protein_coding	OTTHUMT00000344325.1	101	0.00	0	G	NM_017719		43384891	43384891	+1	no_errors	ENST00000296088	ensembl	human	known	69_37n	missense	74	14.94	13	SNP	1.000	C
SNX27	81609	genome.wustl.edu	37	1	151641007	151641007	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:151641007G>T	ENST00000458013.2	+	7	1165	c.1045G>T	c.(1045-1047)Gct>Tct	p.A349S	SNX27_ENST00000482791.1_3'UTR|SNX27_ENST00000368843.3_Missense_Mutation_p.A349S|SNX27_ENST00000368838.1_Missense_Mutation_p.A256S			Q96L92	SNX27_HUMAN	sorting nexin family member 27	349	FERM-like region F1.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.A349S(1)		central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTATACATCAGCTGTGCCAGG	0.383																																					Colon(46;291 966 40145 41237 41888)	dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	114.0	115.0					1																	151641007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1045G>T	1.37:g.151641007G>T	ENSP00000400333:p.Ala349Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.A349S	ENST00000458013.2	37	c.1045		1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.733376	0.89482	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.18174	2.23;2.23;2.23	5.1	5.1	0.69264	Ras-association (2);	0.000000	0.85682	D	0.000000	T	0.25717	0.0626	M	0.64997	1.995	0.80722	D	1	P;D	0.69078	0.926;0.997	P;D	0.65443	0.802;0.935	T	0.01666	-1.1300	10	0.17369	T	0.5	.	17.2485	0.87035	0.0:0.0:1.0:0.0	.	349;349	Q96L92;Q96L92-3	SNX27_HUMAN;.	S	349;349;256	ENSP00000400333:A349S;ENSP00000357836:A349S;ENSP00000357831:A256S	ENSP00000357831:A256S	A	+	1	0	SNX27	149907631	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.907000	0.92634	2.656000	0.90262	0.305000	0.20034	GCT	SNX27	-	pfam_Ras-assoc,pfscan_Ras-assoc	ENSG00000143376		0.383	SNX27-003	NOVEL	basic	protein_coding	SNX27	HGNC	protein_coding	OTTHUMT00000036624.3	196	0.50	1	G	NM_030918		151641007	151641007	+1	no_errors	ENST00000368843	ensembl	human	known	69_37n	missense	134	11.26	17	SNP	1.000	T
ST18	9705	genome.wustl.edu	37	8	53038648	53038648	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr8:53038648C>T	ENST00000276480.7	-	23	3402	c.2719G>A	c.(2719-2721)Gaa>Aaa	p.E907K		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	907					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E907K(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				ATGAGTTCTTCAGAAACCTTG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											205.0	163.0	177.0					8																	53038648		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2719G>A	8.37:g.53038648C>T	ENSP00000276480:p.Glu907Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.E907K	ENST00000276480.7	37	c.2719	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.373753	0.95923	.	.	ENSG00000147488	ENST00000276480	T	0.51817	0.69	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.64630	-0.6362	10	0.46703	T	0.11	-27.5642	20.0067	0.97435	0.0:1.0:0.0:0.0	.	907	O60284	ST18_HUMAN	K	907	ENSP00000276480:E907K	ENSP00000276480:E907K	E	-	1	0	ST18	53201201	1.000000	0.71417	0.994000	0.49952	0.758000	0.43043	7.237000	0.78164	2.731000	0.93534	0.650000	0.86243	GAA	ST18	-	NULL	ENSG00000147488		0.448	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	209	0.00	0	C			53038648	53038648	-1	no_errors	ENST00000276480	ensembl	human	known	69_37n	missense	124	13.29	19	SNP	0.999	T
ST5	6764	genome.wustl.edu	37	11	8728716	8728716	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr11:8728716G>A	ENST00000534127.1	-	16	2872	c.2487C>T	c.(2485-2487)ttC>ttT	p.F829F	ST5_ENST00000530991.1_Silent_p.F301F|ST5_ENST00000530438.1_Silent_p.F409F|ST5_ENST00000526099.1_Silent_p.F342F|ST5_ENST00000526757.1_Silent_p.F409F|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000313726.6_Silent_p.F829F|ST5_ENST00000534278.1_Silent_p.F20F|ST5_ENST00000357665.1_Silent_p.F829F	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	829	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.F829F(1)		NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		GACTTCTCATGAAAGGATAGA	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											108.0	102.0	104.0					11																	8728716		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.2487C>T	11.37:g.8728716G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.F829	ENST00000534127.1	37	c.2487	CCDS7791.1	11																																																																																			ST5	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000166444		0.582	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ST5	HGNC	protein_coding	OTTHUMT00000386518.1	131	0.76	1	G	NM_005418		8728716	8728716	-1	no_errors	ENST00000313726	ensembl	human	known	69_37n	silent	107	14.40	18	SNP	1.000	A
SUSD2	56241	genome.wustl.edu	37	22	24583679	24583679	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr22:24583679G>C	ENST00000358321.3	+	12	2293	c.2032G>C	c.(2032-2034)Gag>Cag	p.E678Q		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	678					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.E678Q(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CCTGGCACAAGAGGCAGCCAA	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	131.0	132.0					22																	24583679		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.2032G>C	22.37:g.24583679G>C	ENSP00000351075:p.Glu678Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H5Y6	Missense_Mutation	SNP	pfam_AMOP,pfam_VWF_type-D,pfam_Sushi_SCR_CCP,pfam_Somatomedin_B_dom,superfamily_Complement_control_module,superfamily_Ig_E-set,smart_AMOP,smart_VWF_type-D,smart_Sushi_SCR_CCP,pfscan_AMOP,pfscan_Somatomedin_B_dom,pfscan_Sushi_SCR_CCP	p.E678Q	ENST00000358321.3	37	c.2032	CCDS13824.1	22	.	.	.	.	.	.	.	.	.	.	G	9.324	1.058783	0.19987	.	.	ENSG00000099994	ENST00000358321	T	0.22134	1.97	4.12	3.08	0.35506	.	0.336502	0.31589	N	0.007389	T	0.21387	0.0515	L	0.45228	1.405	0.09310	N	1	D	0.54397	0.966	P	0.49012	0.598	T	0.08932	-1.0698	10	0.17832	T	0.49	-22.4356	10.414	0.44311	0.0:0.1998:0.8002:0.0	.	678	Q9UGT4	SUSD2_HUMAN	Q	678	ENSP00000351075:E678Q	ENSP00000351075:E678Q	E	+	1	0	SUSD2	22913679	0.994000	0.37717	0.018000	0.16275	0.032000	0.12392	2.573000	0.46007	1.011000	0.39340	0.505000	0.49811	GAG	SUSD2	-	NULL	ENSG00000099994		0.607	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	HGNC	protein_coding	OTTHUMT00000320088.1	177	0.00	0	G	NM_019601		24583679	24583679	+1	no_errors	ENST00000358321	ensembl	human	known	69_37n	missense	120	11.76	16	SNP	0.150	C
SYT2	127833	genome.wustl.edu	37	1	202568369	202568369	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:202568369C>G	ENST00000367267.1	-	8	1222	c.1030G>C	c.(1030-1032)Gag>Cag	p.E344Q	SYT2_ENST00000367268.4_Missense_Mutation_p.E344Q	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	344	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.E344Q(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	AAGGGGATCTCAAAGCTGAAG	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											278.0	267.0	270.0					1																	202568369		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.1030G>C	1.37:g.202568369C>G	ENSP00000356236:p.Glu344Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q496K5|Q8NBE5	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting	p.E344Q	ENST00000367267.1	37	c.1030	CCDS1427.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609571	0.87258	.	.	ENSG00000143858	ENST00000367268;ENST00000367267	T;T	0.71698	-0.59;-0.59	5.31	4.39	0.52855	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.76111	0.3942	L	0.38692	1.165	0.80722	D	1	D	0.65815	0.995	D	0.63793	0.918	T	0.78788	-0.2067	10	0.72032	D	0.01	.	15.0168	0.71591	0.1437:0.8563:0.0:0.0	.	344	Q8N9I0	SYT2_HUMAN	Q	344	ENSP00000356237:E344Q;ENSP00000356236:E344Q	ENSP00000356236:E344Q	E	-	1	0	SYT2	200834992	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	5.976000	0.70484	1.214000	0.43395	0.563000	0.77884	GAG	SYT2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000143858		0.522	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT2	HGNC	protein_coding	OTTHUMT00000099157.1	391	0.00	0	C	NM_177402		202568369	202568369	-1	no_errors	ENST00000367267	ensembl	human	known	69_37n	missense	356	12.71	52	SNP	1.000	G
TCP11	6954	genome.wustl.edu	37	6	35086222	35086222	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:35086222G>T	ENST00000512012.1	-	9	1492	c.1336C>A	c.(1336-1338)Cta>Ata	p.L446I	TCP11_ENST00000418521.2_Missense_Mutation_p.L383I|TCP11_ENST00000373974.4_Missense_Mutation_p.L413I|TCP11_ENST00000412155.2_Missense_Mutation_p.L408I|TCP11_ENST00000444780.2_Missense_Mutation_p.L454I|TCP11_ENST00000373979.2_Missense_Mutation_p.L384I|TCP11_ENST00000311875.5_Missense_Mutation_p.L459I|TCP11_ENST00000244645.3_Missense_Mutation_p.L384I			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	446					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.L384I(1)|p.L459I(1)		breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						AGGTCTAATAGAGACCGCTGC	0.458																																						dbGAP											2	Substitution - Missense(2)	breast(2)											85.0	81.0	83.0					6																	35086222		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.1336C>A	6.37:g.35086222G>T	ENSP00000425995:p.Leu446Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	pfam_Tcp11	p.L459I	ENST00000512012.1	37	c.1375		6	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142134	0.77775	.	.	ENSG00000124678	ENST00000373979;ENST00000412155;ENST00000244645;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012	T;T;T;T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76	5.42	5.42	0.78866	.	0.300602	0.28465	N	0.015252	T	0.20251	0.0487	L	0.58428	1.81	0.33415	D	0.579154	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.997	D;D;D;D;D;D	0.79784	0.993;0.993;0.993;0.993;0.993;0.947	T	0.00958	-1.1500	10	0.35671	T	0.21	-11.6306	17.8011	0.88587	0.0:0.0:1.0:0.0	.	413;408;454;519;446;384	B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.;.;.;.;TCP11_HUMAN;.	I	384;408;384;459;454;413;383;446	ENSP00000363091:L384I;ENSP00000402816:L408I;ENSP00000244645:L384I;ENSP00000308708:L459I;ENSP00000404479:L454I;ENSP00000363085:L413I;ENSP00000415320:L383I;ENSP00000425995:L446I	ENSP00000244645:L384I	L	-	1	2	TCP11	35194200	1.000000	0.71417	0.943000	0.38184	0.929000	0.56500	2.583000	0.46094	2.537000	0.85549	0.563000	0.77884	CTA	TCP11	-	pfam_Tcp11	ENSG00000124678		0.458	TCP11-014	PUTATIVE	basic	protein_coding	TCP11	HGNC	protein_coding	OTTHUMT00000370354.1	133	0.74	1	G	NM_001093728		35086222	35086222	-1	no_errors	ENST00000311875	ensembl	human	known	69_37n	missense	76	13.64	12	SNP	1.000	T
TGM5	9333	genome.wustl.edu	37	15	43525482	43525482	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr15:43525482C>A	ENST00000220420.5	-	13	2077	c.2070G>T	c.(2068-2070)aaG>aaT	p.K690N	TGM5_ENST00000349114.4_Missense_Mutation_p.K608N	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	690					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	TTTGTCCACTCTTGAAGGGGA	0.428																																						dbGAP											0													181.0	152.0	162.0					15																	43525482		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.2070G>T	15.37:g.43525482C>A	ENSP00000220420:p.Lys690Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.K690N	ENST00000220420.5	37	c.2070	CCDS32212.1	15	.	.	.	.	.	.	.	.	.	.	C	22.3	4.272550	0.80580	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	T;T	0.70045	-0.45;-0.45	5.97	5.05	0.67936	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.052691	0.64402	D	0.000001	T	0.81959	0.4933	M	0.82716	2.605	0.39834	D	0.973012	D;D	0.89917	0.996;1.0	D;D	0.81914	0.962;0.995	D	0.85489	0.1184	10	0.87932	D	0	-32.2957	12.729	0.57187	0.0:0.9211:0.0:0.0789	.	608;690	O43548-2;O43548	.;TGM5_HUMAN	N	690;608;689	ENSP00000220420:K690N;ENSP00000220419:K608N	ENSP00000220420:K690N	K	-	3	2	TGM5	41312774	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.319000	0.51983	1.526000	0.49068	0.655000	0.94253	AAG	TGM5	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000104055		0.428	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	HGNC	protein_coding	OTTHUMT00000432257.1	331	0.30	1	C	NM_004245		43525482	43525482	-1	no_errors	ENST00000220420	ensembl	human	known	69_37n	missense	240	10.78	29	SNP	1.000	A
TMED7	51014	genome.wustl.edu	37	5	114952043	114952043	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:114952043C>T	ENST00000456936.3	-	3	918	c.538G>A	c.(538-540)Gag>Aag	p.E180K	TICAM2_ENST00000408996.4_Missense_Mutation_p.E180K|AC010226.4_ENST00000508517.1_RNA|TMED7-TICAM2_ENST00000333314.3_Missense_Mutation_p.E180K|AC010226.4_ENST00000515570.1_RNA|TMED7-TICAM2_ENST00000282382.4_Missense_Mutation_p.E180K|TMED7_ENST00000503010.1_5'UTR	NM_181836.5	NP_861974.1	Q9Y3B3	TMED7_HUMAN	transmembrane emp24 protein transport domain containing 7	180					protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|COPII vesicle coat (GO:0030127)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.E180K(1)		breast(1)|endometrium(2)|liver(1)|lung(1)|urinary_tract(1)	6		all_cancers(142;0.0223)|all_epithelial(76;0.000869)|Prostate(80;0.0115)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;3.34e-07)|Epithelial(69;1.08e-06)|all cancers(49;4.56e-05)		TTTAGATCCTCTGCTCGGCTT	0.443																																					Pancreas(167;237 2002 3207 14549 49356)	dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	95.0	95.0					5																	114952043		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK074962	CCDS4120.1	5q22.3	2011-04-19			ENSG00000134970	ENSG00000134970			24253	protein-coding gene	gene with protein product						10810093	Standard	NM_181836		Approved	CGI-109, FLJ90481		Q9Y3B3	OTTHUMG00000132013	ENST00000456936.3:c.538G>A	5.37:g.114952043C>T	ENSP00000405926:p.Glu180Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBU8|Q8WUU6|Q96K51	Missense_Mutation	SNP	pfam_GOLD,pfam_TIR_dom,superfamily_GOLD,superfamily_TIR_dom,pfscan_GOLD,pfscan_TIR_dom	p.E180K	ENST00000456936.3	37	c.538	CCDS4120.1	5	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989470	0.93106	.	.	ENSG00000243414;ENSG00000251201;ENSG00000251201;ENSG00000134970	ENST00000408996;ENST00000282382;ENST00000333314;ENST00000456936	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	6.03	5.15	0.70609	GOLD (1);	0.000000	0.85682	D	0.000000	T	0.45637	0.1352	M	0.84948	2.725	0.80722	D	1	P;P	0.46859	0.763;0.885	B;P	0.48770	0.41;0.589	T	0.56263	-0.8008	10	0.87932	D	0	-23.2598	16.1274	0.81404	0.0:0.8658:0.1342:0.0	.	180;180	Q9Y3B3;Q6JUT2	TMED7_HUMAN;.	K	180	ENSP00000386341:E180K;ENSP00000282382:E180K;ENSP00000333650:E180K;ENSP00000405926:E180K	ENSP00000405926:E180K	E	-	1	0	TMED7;TICAM2;TMED7-TICAM2	114979942	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	1.524000	0.49035	0.557000	0.71058	GAG	TICAM2	-	pfam_GOLD	ENSG00000243414		0.443	TMED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TICAM2	HGNC	protein_coding	OTTHUMT00000254990.4	167	0.00	0	C	NM_181836		114952043	114952043	-1	no_errors	ENST00000408996	ensembl	human	known	69_37n	missense	125	11.97	17	SNP	1.000	T
TLR4	7099	genome.wustl.edu	37	9	120476002	120476002	+	Missense_Mutation	SNP	C	C	G	rs34953464		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr9:120476002C>G	ENST00000355622.6	+	3	1697	c.1596C>G	c.(1594-1596)ttC>ttG	p.F532L	TLR4_ENST00000394487.4_Missense_Mutation_p.F492L|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	532					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.F532L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACAACAACTTCTTTTCATTGG	0.423																																						dbGAP											1	Substitution - Missense(1)	lung(1)											97.0	87.0	90.0					9																	120476002		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1596C>G	9.37:g.120476002C>G	ENSP00000363089:p.Phe532Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.F532L	ENST00000355622.6	37	c.1596	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.144558	0.00332	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.00666	5.91;5.91	5.82	-0.865	0.10662	.	0.310011	0.28082	N	0.016678	T	0.00241	0.0007	N	0.00683	-1.26	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43475	-0.9389	10	0.02654	T	1	.	2.6009	0.04866	0.3711:0.3623:0.0901:0.1765	.	532	O00206	TLR4_HUMAN	L	492;532	ENSP00000377997:F492L;ENSP00000363089:F532L	ENSP00000363089:F532L	F	+	3	2	TLR4	119515823	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.717000	0.04986	-0.162000	0.10964	-0.188000	0.12872	TTC	TLR4	-	pirsf_Toll-like_receptor,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136869		0.423	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	186	0.00	0	C	NM_138554		120476002	120476002	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	132	10.81	16	SNP	0.000	G
TRIOBP	11078	genome.wustl.edu	37	22	38131375	38131375	+	Silent	SNP	C	C	T	rs557256047		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr22:38131375C>T	ENST00000406386.3	+	9	5287	c.5032C>T	c.(5032-5034)Ctg>Ttg	p.L1678L		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1678					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.L1678L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GACCGCAACTCTGGCAGGCCT	0.662											OREG0026548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											23.0	27.0	26.0					22																	38131375		1983	4158	6141	-	-	-	SO:0001819	synonymous_variant	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5032C>T	22.37:g.38131375C>T		Somatic	875	WXS	Illumina GAIIx	Phase_IV	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1678	ENST00000406386.3	37	c.5032	CCDS43015.1	22																																																																																			TRIOBP	-	NULL	ENSG00000100106		0.662	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	43	0.00	0	C			38131375	38131375	+1	no_errors	ENST00000406386	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	0.000	T
TSHR	7253	genome.wustl.edu	37	14	81606069	81606069	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr14:81606069G>A	ENST00000541158.2	+	10	1061	c.739G>A	c.(739-741)Gag>Aag	p.E247K	RP11-114N19.3_ENST00000557775.1_RNA|TSHR_ENST00000298171.2_Missense_Mutation_p.E247K			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	247					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.E247K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	CAAAGGCCTGGAGCACCTGAA	0.522			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															dbGAP	yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	1	Substitution - Missense(1)	breast(1)											106.0	86.0	93.0					14																	81606069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.739G>A	14.37:g.81606069G>A	ENSP00000441235:p.Glu247Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_TSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_FSH_rcpt,prints_LSH_rcpt	p.E247K	ENST00000541158.2	37	c.739	CCDS9872.1	14	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968327	0.74131	.	.	ENSG00000165409	ENST00000541158;ENST00000298171	D;D	0.83506	-1.73;-1.73	5.46	3.57	0.40892	.	0.201118	0.51477	D	0.000091	T	0.78892	0.4355	L	0.45744	1.44	0.50467	D	0.999873	P	0.34639	0.461	B	0.33295	0.161	T	0.77935	-0.2401	10	0.87932	D	0	.	15.7791	0.78246	0.0:0.2578:0.7422:0.0	.	247	F5GYU5	.	K	247	ENSP00000441235:E247K;ENSP00000298171:E247K	ENSP00000298171:E247K	E	+	1	0	TSHR	80675822	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.653000	0.67967	0.631000	0.30412	0.655000	0.94253	GAG	TSHR	-	NULL	ENSG00000165409		0.522	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHR	HGNC	protein_coding	OTTHUMT00000413364.1	124	0.00	0	G	NM_000369		81606069	81606069	+1	no_errors	ENST00000298171	ensembl	human	known	69_37n	missense	70	17.65	15	SNP	1.000	A
TSPEAR	54084	genome.wustl.edu	37	21	45929254	45929254	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr21:45929254C>T	ENST00000323084.4	-	10	1647	c.1582G>A	c.(1582-1584)Gac>Aac	p.D528N	TSPEAR-AS1_ENST00000430181.1_RNA|TSPEAR-AS1_ENST00000451035.1_RNA|TSPEAR_ENST00000397916.1_Missense_Mutation_p.D460N	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	528					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)		p.D528N(2)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						ACCTCCCAGTCTGCAGCACCG	0.602																																						dbGAP											2	Substitution - Missense(2)	cervix(1)|breast(1)											100.0	72.0	81.0					21																	45929254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1582G>A	21.37:g.45929254C>T	ENSP00000321987:p.Asp528Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_EAR	p.D528N	ENST00000323084.4	37	c.1582	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542510	0.85917	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000397916;ENST00000341581	D;D	0.82255	-1.59;-1.59	3.98	3.98	0.46160	.	0.053040	0.85682	D	0.000000	D	0.89832	0.6829	M	0.69823	2.125	0.80722	D	1	D	0.67145	0.996	D	0.68353	0.957	D	0.91219	0.5005	10	0.62326	D	0.03	-21.8433	17.0238	0.86440	0.0:1.0:0.0:0.0	.	528	Q8WU66	TSEAR_HUMAN	N	528;381;460;529	ENSP00000321987:D528N;ENSP00000381012:D460N	ENSP00000321987:D528N	D	-	1	0	TSPEAR	44753682	1.000000	0.71417	0.915000	0.36163	0.584000	0.36387	7.060000	0.76692	2.164000	0.68074	0.558000	0.71614	GAC	TSPEAR	-	pfam_EPTP,pfscan_EAR	ENSG00000175894		0.602	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	82	0.00	0	C	NM_144991		45929254	45929254	-1	no_errors	ENST00000323084	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	1.000	T
TTLL1	25809	genome.wustl.edu	37	22	43464475	43464475	+	Missense_Mutation	SNP	G	G	C	rs145162777	byFrequency	TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr22:43464475G>C	ENST00000266254.7	-	5	684	c.444C>G	c.(442-444)atC>atG	p.I148M	TTLL1_ENST00000331018.7_Missense_Mutation_p.I148M	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	148	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)	p.I148M(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TGATAAGGAAGATGCCCTTTC	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											217.0	206.0	210.0					22																	43464475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.444C>G	22.37:g.43464475G>C	ENSP00000266254:p.Ile148Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.I148M	ENST00000266254.7	37	c.444	CCDS14043.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.13|17.13	3.310287|3.310287	0.60414|0.60414	.|.	.|.	ENSG00000100271|ENSG00000100271	ENST00000331018;ENST00000266254|ENST00000495814	T;T|.	0.14144|.	2.53;2.53|.	5.54|5.54	3.38|3.38	0.38709|0.38709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88351|0.88351	0.6413|0.6413	H|H	0.99675|0.99675	4.695|4.695	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.76575|.	0.979;0.988|.	D|D	0.89334|0.89334	0.3649|0.3649	10|5	0.87932|.	D|.	0|.	.|.	8.4457|8.4457	0.32841|0.32841	0.0883:0.0:0.6823:0.2294|0.0883:0.0:0.6823:0.2294	.|.	148;148|.	O95922-4;O95922|.	.;TTLL1_HUMAN|.	M|C	148|74	ENSP00000333734:I148M;ENSP00000266254:I148M|.	ENSP00000266254:I148M|.	I|S	-|-	3|2	3|0	TTLL1|TTLL1	41794419|41794419	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.884000|0.884000	0.51177|0.51177	3.773000|3.773000	0.55333|0.55333	1.347000|1.347000	0.45714|0.45714	-0.136000|-0.136000	0.14681|0.14681	ATC|TCT	TTLL1	-	pfam_Tub_tyr_ligase	ENSG00000100271		0.552	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL1	HGNC	protein_coding	OTTHUMT00000319659.1	107	0.00	0	G	NM_012263		43464475	43464475	-1	no_errors	ENST00000266254	ensembl	human	known	69_37n	missense	73	14.12	12	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179592543	179592543	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr2:179592543C>G	ENST00000591111.1	-	66	19035	c.18811G>C	c.(18811-18813)Gat>Cat	p.D6271H	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.D5344H|RP11-171I2.1_ENST00000590024.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.D6588H			Q8WZ42	TITIN_HUMAN	titin	13048	Ig-like 44.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D5344H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGTAGAATCAGGTATGGCT	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	87.0	88.0					2																	179592543		1844	4085	5929	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18811G>C	2.37:g.179592543C>G	ENSP00000465570:p.Asp6271His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D5344H	ENST00000591111.1	37	c.16030		2	.	.	.	.	.	.	.	.	.	.	C	9.615	1.132416	0.21041	.	.	ENSG00000155657	ENST00000342992	T	0.68331	-0.32	5.99	5.99	0.97316	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81484	0.4832	M	0.70275	2.135	0.80722	D	1	D	0.60575	0.988	D	0.64237	0.923	T	0.81854	-0.0741	9	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	6271	Q8WZ42	TITIN_HUMAN	H	5344	ENSP00000343764:D5344H	ENSP00000343764:D5344H	D	-	1	0	TTN	179300788	0.997000	0.39634	1.000000	0.80357	0.955000	0.61496	3.118000	0.50414	2.840000	0.97914	0.655000	0.94253	GAT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.348	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	115	0.00	0	C	NM_133378		179592543	179592543	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	92	11.54	12	SNP	1.000	G
UBE2D2	7322	genome.wustl.edu	37	5	138994175	138994175	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr5:138994175C>G	ENST00000398733.3	+	3	719	c.93C>G	c.(91-93)ttC>ttG	p.F31L	UBE2D2_ENST00000253815.2_Missense_Mutation_p.F2L|UBE2D2_ENST00000511725.1_Missense_Mutation_p.F2L|UBE2D2_ENST00000505548.1_Missense_Mutation_p.F2L	NM_003339.2	NP_003330.1	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2	31					cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.F31L(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTTCAGTGTTCCATTGGCAAG	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											127.0	117.0	121.0					5																	138994175		1856	4085	5941	-	-	-	SO:0001583	missense	0			L40146	CCDS43369.1, CCDS47275.1	5q31.2	2013-10-18	2011-05-19		ENSG00000131508	ENSG00000131508		"""Ubiquitin-conjugating enzymes E2"""	12475	protein-coding gene	gene with protein product		602962	"""ubiquitin-conjugating enzyme E2D 2 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181838		Approved	UbcH5B, UBC4	uc003ler.3	P62837	OTTHUMG00000163282	ENST00000398733.3:c.93C>G	5.37:g.138994175C>G	ENSP00000381717:p.Phe31Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQC9|P51669|Q3MN78|Q96RP6	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.F31L	ENST00000398733.3	37	c.93	CCDS43369.1	5	.	.	.	.	.	.	.	.	.	.	C	18.66	3.670920	0.67814	.	.	ENSG00000131508	ENST00000511725;ENST00000398733;ENST00000253815;ENST00000505007;ENST00000398734;ENST00000505548	T;T;T;T;T;T	0.70986	-0.53;0.95;-0.53;-0.53;0.95;-0.53	5.9	4.82	0.62117	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.64182	0.2575	L	0.45228	1.405	0.80722	D	1	B	0.25743	0.133	B	0.31812	0.136	T	0.63346	-0.6658	10	0.87932	D	0	.	9.2523	0.37562	0.0:0.8076:0.0:0.1924	.	31	P62837	UB2D2_HUMAN	L	2;31;2;2;31;2	ENSP00000429613:F2L;ENSP00000381717:F31L;ENSP00000253815:F2L;ENSP00000426523:F2L;ENSP00000381718:F31L;ENSP00000424941:F2L	ENSP00000253815:F2L	F	+	3	2	UBE2D2	138974359	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.110000	0.41873	1.147000	0.42369	0.563000	0.77884	TTC	UBE2D2	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000131508		0.303	UBE2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2D2	HGNC	protein_coding	OTTHUMT00000372454.3	328	0.00	0	C	NM_181838		138994175	138994175	+1	no_errors	ENST00000398733	ensembl	human	known	69_37n	missense	209	12.92	31	SNP	1.000	G
UNC13A	23025	genome.wustl.edu	37	19	17780393	17780393	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr19:17780393G>A	ENST00000519716.2	-	5	362	c.363C>T	c.(361-363)atC>atT	p.I121I	UNC13A_ENST00000551649.1_Silent_p.I121I|UNC13A_ENST00000428389.2_Silent_p.I209I|UNC13A_ENST00000252773.7_Silent_p.I121I|UNC13A_ENST00000552293.1_Silent_p.I121I|UNC13A_ENST00000550896.1_Silent_p.I121I	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	121					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.I209I(1)|p.I121I(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TGTCCAGGAGGATGCGGTGGA	0.627																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											39.0	44.0	42.0					19																	17780393		2066	4208	6274	-	-	-	SO:0001819	synonymous_variant	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.363C>T	19.37:g.17780393G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E5RHY9	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.I209	ENST00000519716.2	37	c.627	CCDS46013.2	19																																																																																			UNC13A	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000130477		0.627	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	73	0.00	0	G	XM_038604		17780393	17780393	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	silent	49	14.04	8	SNP	0.998	A
UNC13C	440279	genome.wustl.edu	37	15	54305910	54305910	+	Silent	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr15:54305910C>G	ENST00000260323.11	+	1	810	c.810C>G	c.(808-810)ctC>ctG	p.L270L	UNC13C_ENST00000537900.1_Silent_p.L270L|UNC13C_ENST00000545554.1_Silent_p.L270L	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	270					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.L270L(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCAATGCTCTCAAGCACTCCA	0.458																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											98.0	96.0	96.0					15																	54305910		1982	4164	6146	-	-	-	SO:0001819	synonymous_variant	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.810C>G	15.37:g.54305910C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P613|Q8ND48|Q96NP3	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.L270	ENST00000260323.11	37	c.810	CCDS45264.1	15																																																																																			UNC13C	-	NULL	ENSG00000137766		0.458	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	61	0.00	0	C	NM_173166		54305910	54305910	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	silent	37	19.57	9	SNP	0.992	G
USH2A	7399	genome.wustl.edu	37	1	216390820	216390820	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:216390820G>C	ENST00000307340.3	-	15	3452	c.3066C>G	c.(3064-3066)ttC>ttG	p.F1022L	USH2A_ENST00000366943.2_Missense_Mutation_p.F1022L|USH2A_ENST00000366942.3_Missense_Mutation_p.F1022L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1022	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.F1022L(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTGTTTACAGAAACACTGGC	0.423										HNSCC(13;0.011)																												dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	88.0	91.0					1																	216390820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3066C>G	1.37:g.216390820G>C	ENSP00000305941:p.Phe1022Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.F1022L	ENST00000307340.3	37	c.3066	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	7.426	0.637795	0.14386	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.59772	0.24;0.24;0.24	4.9	3.97	0.46021	EGF-like, laminin (3);	0.180905	0.26528	U	0.023869	T	0.42108	0.1188	N	0.12502	0.225	0.29702	N	0.840101	B;D	0.57571	0.001;0.98	B;P	0.52454	0.012;0.699	T	0.27502	-1.0072	10	0.11182	T	0.66	.	7.3915	0.26913	0.149:0.1476:0.7034:0.0	.	1022;1022	O75445-2;O75445	.;USH2A_HUMAN	L	1022	ENSP00000305941:F1022L;ENSP00000355910:F1022L;ENSP00000355909:F1022L	ENSP00000305941:F1022L	F	-	3	2	USH2A	214457443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.224000	0.42945	2.269000	0.75478	0.591000	0.81541	TTC	USH2A	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000042781		0.423	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	100	0.00	0	G	NM_007123		216390820	216390820	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	112	16.30	22	SNP	1.000	C
UTRN	7402	genome.wustl.edu	37	6	145103087	145103087	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:145103087G>A	ENST00000367545.3	+	60	8662	c.8662G>A	c.(8662-8664)Gaa>Aaa	p.E2888K	UTRN_ENST00000367526.4_Missense_Mutation_p.E443K	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2888	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E2888K(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TACAACAAATGAAATTTTCAA	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	92.0	93.0					6																	145103087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.8662G>A	6.37:g.145103087G>A	ENSP00000356515:p.Glu2888Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.E2888K	ENST00000367545.3	37	c.8662	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639504	0.67244	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.67698	-0.28;-0.28	5.49	5.49	0.81192	EF-hand domain, type 1 (1);EF-hand-like domain (1);	0.000000	0.53938	D	0.000048	T	0.55242	0.1908	M	0.68593	2.085	0.40641	D	0.981941	B	0.24043	0.096	B	0.28232	0.087	T	0.62272	-0.6889	10	0.72032	D	0.01	.	12.6858	0.56946	0.0754:0.0:0.9246:0.0	.	2888	P46939	UTRO_HUMAN	K	2888;443	ENSP00000356515:E2888K;ENSP00000356496:E443K	ENSP00000356496:E443K	E	+	1	0	UTRN	145144780	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.216000	0.58540	2.582000	0.87167	0.557000	0.71058	GAA	UTRN	-	pfam_EF-hand_dom_typ1,pirsf_Dystrophin/utrophin	ENSG00000152818		0.363	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	142	0.00	0	G			145103087	145103087	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	missense	126	13.70	20	SNP	1.000	A
UST	10090	genome.wustl.edu	37	6	149395130	149395130	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:149395130C>T	ENST00000367463.4	+	8	1202	c.1099C>T	c.(1099-1101)Cac>Tac	p.H367Y	UST_ENST00000466695.1_3'UTR	NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	367					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.H367Y(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		ACTTAAGTCTCACGTCAGCAA	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	114.0	116.0					6																	149395130		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.1099C>T	6.37:g.149395130C>T	ENSP00000356433:p.His367Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCX6	Missense_Mutation	SNP	pfam_Sulfotransferase,pfam_Gal-3-0_sulfotransfrase	p.H367Y	ENST00000367463.4	37	c.1099	CCDS5213.1	6	.	.	.	.	.	.	.	.	.	.	C	11.95	1.791442	0.31685	.	.	ENSG00000111962	ENST00000367463	T	0.44083	0.93	5.3	5.3	0.74995	.	0.938053	0.09110	N	0.847178	T	0.13243	0.0321	N	0.14661	0.345	0.09310	N	1	B	0.25272	0.122	B	0.19946	0.027	T	0.10917	-1.0609	10	0.24483	T	0.36	-0.1224	13.6143	0.62099	0.0:0.9252:0.0:0.0748	.	367	Q9Y2C2	UST_HUMAN	Y	367	ENSP00000356433:H367Y	ENSP00000356433:H367Y	H	+	1	0	UST	149436823	0.660000	0.27420	0.140000	0.22221	0.783000	0.44284	2.751000	0.47508	2.632000	0.89209	0.563000	0.77884	CAC	UST	-	NULL	ENSG00000111962		0.507	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UST	HGNC	protein_coding	OTTHUMT00000043363.1	134	0.00	0	C	NM_005715		149395130	149395130	+1	no_errors	ENST00000367463	ensembl	human	known	69_37n	missense	108	10.74	13	SNP	0.051	T
VPS13B	157680	genome.wustl.edu	37	8	100729481	100729481	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr8:100729481G>A	ENST00000358544.2	+	37	6723	c.6612G>A	c.(6610-6612)ctG>ctA	p.L2204L	VPS13B_ENST00000357162.2_Silent_p.L2179L|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2204					protein transport (GO:0015031)			p.L2179L(1)|p.L2204L(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GCCGCATTCTGATAGGACCAT	0.393																																					Colon(161;2205 2542 7338 31318)	dbGAP											2	Substitution - coding silent(2)	breast(2)											89.0	88.0	88.0					8																	100729481		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.6612G>A	8.37:g.100729481G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	pfam_Autophagy-rel_C	p.L2204	ENST00000358544.2	37	c.6612	CCDS6280.1	8																																																																																			VPS13B	-	NULL	ENSG00000132549		0.393	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	124	0.00	0	G	NM_184042		100729481	100729481	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	silent	87	11.22	11	SNP	0.578	A
VSTM4	196740	genome.wustl.edu	37	10	50294048	50294048	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr10:50294048C>G	ENST00000332853.4	-	3	501	c.478G>C	c.(478-480)Gaa>Caa	p.E160Q		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E160Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						GATGACTCTTCAGAAGCTTTG	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	54.0	53.0					10																	50294048		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.478G>C	10.37:g.50294048C>G	ENSP00000331062:p.Glu160Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNI6|Q96MX7	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.E160Q	ENST00000332853.4	37	c.478	CCDS31198.1	10	.	.	.	.	.	.	.	.	.	.	C	15.31	2.794195	0.50102	.	.	ENSG00000165633	ENST00000332853	T	0.07908	3.15	5.06	5.06	0.68205	.	0.318671	0.29830	N	0.011084	T	0.09774	0.0240	L	0.36672	1.1	0.80722	D	1	P	0.45044	0.849	B	0.42798	0.398	T	0.03259	-1.1055	10	0.51188	T	0.08	-11.6365	14.1192	0.65175	0.0:1.0:0.0:0.0	.	160	Q8IW00	VSTM4_HUMAN	Q	160	ENSP00000331062:E160Q	ENSP00000331062:E160Q	E	-	1	0	VSTM4	49964054	0.995000	0.38212	0.978000	0.43139	0.934000	0.57294	4.044000	0.57361	2.790000	0.95986	0.655000	0.94253	GAA	VSTM4	-	NULL	ENSG00000165633		0.323	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM4	HGNC	protein_coding	OTTHUMT00000047966.2	146	0.00	0	C	NM_144984		50294048	50294048	-1	no_errors	ENST00000332853	ensembl	human	known	69_37n	missense	103	11.21	13	SNP	0.981	G
WDR47	22911	genome.wustl.edu	37	1	109554133	109554133	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:109554133C>A	ENST00000369962.3	-	5	757	c.535G>T	c.(535-537)Gat>Tat	p.D179Y	WDR47_ENST00000369965.4_Missense_Mutation_p.D179Y|WDR47_ENST00000357672.3_Missense_Mutation_p.D151Y|WDR47_ENST00000400794.3_Missense_Mutation_p.D186Y|WDR47_ENST00000361054.3_Missense_Mutation_p.D151Y			O94967	WDR47_HUMAN	WD repeat domain 47	179					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.D179Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		AGCTTCCTATCAGCAGGGATG	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											203.0	208.0	206.0					1																	109554133		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.535G>T	1.37:g.109554133C>A	ENSP00000358979:p.Asp179Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D186Y	ENST00000369962.3	37	c.556	CCDS44187.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383106	0.82792	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	T;T;T;T;T	0.60548	0.22;0.26;0.18;0.22;0.18	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	L	0.58101	1.795	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.72323	-0.4328	10	0.72032	D	0.01	-10.1884	19.0307	0.92955	0.0:1.0:0.0:0.0	.	151;186;179;179	O94967-2;A8MX09;O94967;O94967-3	.;.;WDR47_HUMAN;.	Y	186;179;151;179;151	ENSP00000383599:D186Y;ENSP00000358979:D179Y;ENSP00000354339:D151Y;ENSP00000358982:D179Y;ENSP00000350301:D151Y	ENSP00000350301:D151Y	D	-	1	0	WDR47	109355656	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.481000	0.83766	0.563000	0.77884	GAT	WDR47	-	NULL	ENSG00000085433		0.428	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR47	HGNC	protein_coding	OTTHUMT00000032414.2	187	0.00	0	C	NM_014969		109554133	109554133	-1	no_errors	ENST00000400794	ensembl	human	known	69_37n	missense	137	12.74	20	SNP	1.000	A
WARS2	10352	genome.wustl.edu	37	1	119683237	119683237	+	Nonsense_Mutation	SNP	C	C	A	rs367733670		TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:119683237C>A	ENST00000235521.4	-	1	57	c.31G>T	c.(31-33)Gag>Tag	p.E11*	WARS2_ENST00000369426.5_Nonsense_Mutation_p.E11*|WARS2_ENST00000497761.1_5'UTR|RP11-418J17.1_ENST00000413531.1_RNA|WARS2_ENST00000537870.1_5'Flank|RP11-418J17.1_ENST00000425884.1_RNA|RP11-418J17.1_ENST00000440150.1_RNA|RP11-418J17.1_ENST00000457043.1_RNA|RP11-418J17.1_ENST00000418015.1_RNA	NM_015836.3|NM_201263.2	NP_056651.1|NP_957715.1	Q9UGM6	SYWM_HUMAN	tryptophanyl tRNA synthetase 2, mitochondrial	11					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)|vasculogenesis (GO:0001570)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)	p.E11*(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(2)	15	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	CTCCAGCGCTCACGCGCTTTC	0.607																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											41.0	43.0	42.0					1																	119683237		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC021722	CCDS900.1, CCDS30817.1	1p12	2011-07-01	2007-02-23		ENSG00000116874	ENSG00000116874	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12730	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 2, mitochondrial"""	604733				10072595, 10828066	Standard	NM_201263		Approved	TrpRS	uc001ehn.3	Q9UGM6	OTTHUMG00000012335	ENST00000235521.4:c.31G>T	1.37:g.119683237C>A	ENSP00000235521:p.Glu11*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALR1|B2R9D4|Q53FT4|Q5VUD2|Q86TQ0	Nonsense_Mutation	SNP	pfam_aa-tRNA-synth_Ic,prints_Trp-tRNA-synth,tigrfam_Trp-tRNA-synth	p.E11*	ENST00000235521.4	37	c.31	CCDS900.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.972106	0.97162	.	.	ENSG00000116874	ENST00000369426;ENST00000235521	.	.	.	6.04	4.17	0.49024	.	0.499386	0.22772	N	0.055821	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-8.9612	8.4089	0.32632	0.0:0.8287:0.0:0.1713	.	.	.	.	X	11	.	ENSP00000235521:E11X	E	-	1	0	WARS2	119484760	0.039000	0.19947	0.995000	0.50966	0.919000	0.55068	0.877000	0.28106	1.566000	0.49654	0.561000	0.74099	GAG	WARS2	-	NULL	ENSG00000116874		0.607	WARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WARS2	HGNC	protein_coding	OTTHUMT00000034362.1	54	0.00	0	C	NM_015836		119683237	119683237	-1	no_errors	ENST00000235521	ensembl	human	known	69_37n	nonsense	48	12.73	7	SNP	0.929	A
YTHDF1	54915	genome.wustl.edu	37	20	61835143	61835143	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr20:61835143G>C	ENST00000370339.3	-	4	490	c.149C>G	c.(148-150)tCa>tGa	p.S50*	YTHDF1_ENST00000370334.4_Intron|YTHDF1_ENST00000370333.4_5'UTR	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	50							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.S50*(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						GTCGCTCATTGAGGGGTAACT	0.517																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											52.0	59.0	57.0					20																	61835143		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.149C>G	20.37:g.61835143G>C	ENSP00000359364:p.Ser50*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Nonsense_Mutation	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.S50*	ENST00000370339.3	37	c.149	CCDS13511.1	20	.	.	.	.	.	.	.	.	.	.	G	39	7.637831	0.98403	.	.	ENSG00000149658	ENST00000370339	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-22.7886	18.8357	0.92162	0.0:0.0:1.0:0.0	.	.	.	.	X	50	.	ENSP00000359364:S50X	S	-	2	0	YTHDF1	61305588	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.738000	0.84966	2.448000	0.82819	0.561000	0.74099	TCA	YTHDF1	-	NULL	ENSG00000149658		0.517	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF1	HGNC	protein_coding	OTTHUMT00000080110.2	131	0.00	0	G	NM_017798		61835143	61835143	-1	no_errors	ENST00000370339	ensembl	human	known	69_37n	nonsense	94	10.48	11	SNP	1.000	C
ZCCHC17	51538	genome.wustl.edu	37	1	31811816	31811816	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:31811816A>T	ENST00000373714.1	+	5	499	c.238A>T	c.(238-240)Aga>Tga	p.R80*	ZCCHC17_ENST00000344147.5_Nonsense_Mutation_p.R80*|ZCCHC17_ENST00000422613.2_Nonsense_Mutation_p.R56*|RP11-266K22.2_ENST00000430143.1_RNA|ZCCHC17_ENST00000479629.1_3'UTR|ZCCHC17_ENST00000546109.1_Nonsense_Mutation_p.R72*	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	80	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.					cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R80*(1)|p.R56*(1)		breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		GAAAAATGATAGAATAAAAGT	0.338																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											64.0	64.0	64.0					1																	31811816		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.238A>T	1.37:g.31811816A>T	ENSP00000362819:p.Arg80*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Nonsense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.R56*	ENST00000373714.1	37	c.166	CCDS341.1	1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.957896	0.92726	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	.	.	.	5.41	5.41	0.78517	.	0.042911	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5648	0.68168	1.0:0.0:0.0:0.0	.	.	.	.	X	80;80;72;56	.	ENSP00000343557:R80X	R	+	1	2	ZCCHC17	31584403	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.624000	0.83124	2.276000	0.75962	0.455000	0.32223	AGA	ZCCHC17	-	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000121766		0.338	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZCCHC17	HGNC	protein_coding	OTTHUMT00000010665.1	155	0.00	0	A	NM_016505		31811816	31811816	+1	no_errors	ENST00000422613	ensembl	human	known	69_37n	nonsense	131	14.38	22	SNP	1.000	T
ZDHHC17	23390	genome.wustl.edu	37	12	77243248	77243248	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr12:77243248C>G	ENST00000426126.2	+	16	2407	c.1758C>G	c.(1756-1758)ttC>ttG	p.F586L	ZDHHC17_ENST00000334822.5_Missense_Mutation_p.F586L	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	586					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.F586L(1)		breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						AAAGCCCATTCAAGTATGTAC	0.284																																						dbGAP											1	Substitution - Missense(1)	breast(1)											46.0	44.0	45.0					12																	77243248		1800	4048	5848	-	-	-	SO:0001583	missense	0			AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.1758C>G	12.37:g.77243248C>G	ENSP00000403397:p.Phe586Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase,prints_Ankyrin_rpt	p.F586L	ENST00000426126.2	37	c.1758	CCDS44946.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.267826	0.95399	.	.	ENSG00000186908	ENST00000426126;ENST00000334822	T;T	0.38077	1.16;1.16	5.62	5.62	0.85841	.	0.129554	0.64402	D	0.000001	T	0.51500	0.1678	M	0.70595	2.14	0.80722	D	1	D	0.61697	0.99	P	0.55749	0.783	T	0.47749	-0.9093	10	0.38643	T	0.18	-8.8342	13.9644	0.64200	0.0:0.9275:0.0:0.0725	.	586	Q8IUH5	ZDH17_HUMAN	L	586	ENSP00000403397:F586L;ENSP00000334868:F586L	ENSP00000334868:F586L	F	+	3	2	ZDHHC17	75767379	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.040000	0.57333	2.674000	0.91012	0.454000	0.30748	TTC	ZDHHC17	-	NULL	ENSG00000186908		0.284	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC17	HGNC	protein_coding	OTTHUMT00000406555.1	125	0.00	0	C	NM_015336		77243248	77243248	+1	no_errors	ENST00000334822	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	1.000	G
ZNF165	7718	genome.wustl.edu	37	6	28056897	28056897	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr6:28056897G>C	ENST00000377325.1	+	4	1663	c.1107G>C	c.(1105-1107)gaG>gaC	p.E369D	ZSCAN12P1_ENST00000529104.1_RNA	NM_003447.3	NP_003438.1	P49910	ZN165_HUMAN	zinc finger protein 165	369					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E369D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ACACTGGAGAGAGATGCTATG	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	59.0	58.0					6																	28056897		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78722	CCDS4643.1	6p21	2013-01-09			ENSG00000197279	ENSG00000197279		"""-"", ""Zinc fingers, C2H2-type"""	12953	protein-coding gene	gene with protein product	"""cancer/testis antigen 53"""	600834				7490084	Standard	NM_003447		Approved	ZSCAN7, CT53	uc021yro.1	P49910	OTTHUMG00000014505	ENST00000377325.1:c.1107G>C	6.37:g.28056897G>C	ENSP00000366542:p.Glu369Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E369D	ENST00000377325.1	37	c.1107	CCDS4643.1	6	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445383	0.43429	.	.	ENSG00000197279	ENST00000377325	T	0.26810	1.71	3.04	1.17	0.20885	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24851	0.0603	L	0.51914	1.62	0.25438	N	0.98813	D	0.54772	0.968	D	0.72075	0.976	T	0.05241	-1.0897	9	0.72032	D	0.01	.	7.6726	0.28468	0.2265:0.0:0.7735:0.0	.	369	P49910	ZN165_HUMAN	D	369	ENSP00000366542:E369D	ENSP00000366542:E369D	E	+	3	2	ZNF165	28164876	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	0.926000	0.28804	0.160000	0.19432	0.585000	0.79938	GAG	ZNF165	-	pfscan_Znf_C2H2	ENSG00000197279		0.438	ZNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF165	HGNC	protein_coding	OTTHUMT00000040173.1	83	0.00	0	G	NM_003447		28056897	28056897	+1	no_errors	ENST00000377325	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	1.000	C
ZNF648	127665	genome.wustl.edu	37	1	182025757	182025757	+	Silent	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr1:182025757G>A	ENST00000339948.3	-	2	1596	c.1389C>T	c.(1387-1389)ctC>ctT	p.L463L		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	463					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L463L(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GGTGGCGCACGAGGCGCGAGG	0.662																																					NSCLC(71;908 1374 5429 20458 35642)	dbGAP											1	Substitution - coding silent(1)	breast(1)											35.0	33.0	34.0					1																	182025757		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1389C>T	1.37:g.182025757G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP16	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L463	ENST00000339948.3	37	c.1389	CCDS30952.1	1																																																																																			ZNF648	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179930		0.662	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	48	0.00	0	G	XM_060597		182025757	182025757	-1	no_errors	ENST00000339948	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.571	A
ZNF662	389114	genome.wustl.edu	37	3	42956022	42956022	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr3:42956022G>A	ENST00000541208.1	+	5	826	c.457G>A	c.(457-459)Gat>Aat	p.D153N	ZNF662_ENST00000422021.1_Intron|KRBOX1_ENST00000426937.1_Intron|ZNF662_ENST00000328199.6_Missense_Mutation_p.D179N|ZNF662_ENST00000440367.2_Missense_Mutation_p.D153N			Q6ZS27	ZN662_HUMAN	zinc finger protein 662	153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D179N(1)|p.D153N(1)		breast(2)|endometrium(1)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.217)		TTCTACAAATGATATTATAGA	0.403																																						dbGAP											2	Substitution - Missense(2)	breast(2)											88.0	90.0	89.0					3																	42956022		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127779	CCDS2708.1, CCDS46807.1	3p22.1	2013-01-08			ENSG00000182983	ENSG00000182983		"""Zinc fingers, C2H2-type"", ""-"""	31930	protein-coding gene	gene with protein product							Standard	NM_207404		Approved	FLJ45880	uc003cmk.2	Q6ZS27	OTTHUMG00000133041	ENST00000541208.1:c.457G>A	3.37:g.42956022G>A	ENSP00000446208:p.Asp153Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4T9|F8W7S8|Q6ZNF8|Q6ZQW8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D179N	ENST00000541208.1	37	c.535	CCDS2708.1	3	.	.	.	.	.	.	.	.	.	.	G	11.36	1.616512	0.28801	.	.	ENSG00000182983	ENST00000440367;ENST00000328199;ENST00000541208	T;T;T	0.08282	3.11;3.28;3.11	2.78	1.88	0.25563	.	.	.	.	.	T	0.06416	0.0165	L	0.36672	1.1	0.09310	N	1	B;B	0.23128	0.08;0.048	B;B	0.20955	0.032;0.014	T	0.37079	-0.9721	9	0.18276	T	0.48	.	7.2911	0.26366	0.1444:0.0:0.8556:0.0	.	179;153	F8W7S8;Q6ZS27	.;ZN662_HUMAN	N	153;179;153	ENSP00000405047:D153N;ENSP00000329264:D179N;ENSP00000446208:D153N	ENSP00000329264:D179N	D	+	1	0	ZNF662	42931026	0.007000	0.16637	0.219000	0.23793	0.468000	0.32798	1.671000	0.37513	1.578000	0.49821	0.555000	0.69702	GAT	ZNF662	-	NULL	ENSG00000182983		0.403	ZNF662-201	KNOWN	basic|CCDS	protein_coding	ZNF662	HGNC	protein_coding	OTTHUMT00000256646.4	147	0.00	0	G	NM_207404		42956022	42956022	+1	no_errors	ENST00000328199	ensembl	human	known	69_37n	missense	104	11.86	14	SNP	0.025	A
ZNF778	197320	genome.wustl.edu	37	16	89293913	89293913	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YK-01A-22D-A117-09	TCGA-A2-A0YK-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7c27f81e-62fb-478c-9cee-8e20db9300f2	134d71cc-c1c7-40b7-9cc1-927b8f6f393d	g.chr16:89293913C>T	ENST00000433976.2	+	6	1465	c.1133C>T	c.(1132-1134)tCa>tTa	p.S378L	ZNF778_ENST00000306502.6_Missense_Mutation_p.S336L|RP11-46C24.6_ENST00000563182.1_RNA	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	378					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		AGAAATTCCTCATGCCTTAAT	0.448																																						dbGAP											0													93.0	104.0	100.0					16																	89293913		2106	4229	6335	-	-	-	SO:0001583	missense	0			AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.1133C>T	16.37:g.89293913C>T	ENSP00000405289:p.Ser378Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AG0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S378L	ENST00000433976.2	37	c.1133	CCDS45550.1	16	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439527	0.43326	.	.	ENSG00000170100	ENST00000433976;ENST00000306502	T;T	0.17691	2.26;2.26	1.13	1.13	0.20643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26666	0.0652	M	0.70275	2.135	0.09310	N	1	P;P	0.48694	0.914;0.86	P;P	0.51999	0.687;0.489	T	0.09751	-1.0660	9	0.62326	D	0.03	.	5.182	0.15165	0.0:0.6237:0.3762:0.0	.	336;378	Q96MU6-2;Q96MU6	.;ZN778_HUMAN	L	378;336	ENSP00000405289:S378L;ENSP00000305203:S336L	ENSP00000305203:S336L	S	+	2	0	ZNF778	87821414	0.000000	0.05858	0.028000	0.17463	0.223000	0.24884	-0.371000	0.07513	0.927000	0.37143	0.558000	0.71614	TCA	ZNF778	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170100		0.448	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF778	HGNC	protein_coding	OTTHUMT00000430383.1	162	0.60	1	C	NM_182531		89293913	89293913	+1	no_errors	ENST00000433976	ensembl	human	known	69_37n	missense	121	11.03	15	SNP	0.001	T
