#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS9	56999	genome.wustl.edu	37	3	64518862	64518862	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr3:64518862A>G	ENST00000498707.1	-	38	6040	c.5698T>C	c.(5698-5700)Tct>Cct	p.S1900P	ADAMTS9_ENST00000467257.1_5'UTR|ADAMTS9_ENST00000295903.4_Missense_Mutation_p.S1872P	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1900	GON. {ECO:0000255|PROSITE- ProRule:PRU00383}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTGATGTCAGAGACAGCATAA	0.423																																						dbGAP											0													94.0	92.0	93.0					3																	64518862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5698T>C	3.37:g.64518862A>G	ENSP00000418735:p.Ser1900Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.S1900P	ENST00000498707.1	37	c.5698	CCDS2903.1	3	.	.	.	.	.	.	.	.	.	.	A	14.55	2.568968	0.45798	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.17528	2.27;2.27	5.08	5.08	0.68730	Peptidase M12B, GON-ADAMTSs (2);	0.073437	0.56097	D	0.000026	T	0.29716	0.0742	M	0.62723	1.935	0.80722	D	1	P;P	0.41624	0.645;0.757	P;P	0.53102	0.53;0.718	T	0.01904	-1.1250	10	0.33141	T	0.24	.	10.1732	0.42922	0.8514:0.0:0.0:0.1486	.	1872;1900	B7ZVX9;Q9P2N4	.;ATS9_HUMAN	P	1872;1900	ENSP00000295903:S1872P;ENSP00000418735:S1900P	ENSP00000295903:S1872P	S	-	1	0	ADAMTS9	64493902	0.994000	0.37717	0.975000	0.42487	0.496000	0.33645	2.514000	0.45503	1.918000	0.55548	0.482000	0.46254	TCT	ADAMTS9	-	pfam_Pept_M12B_GON-ADAMTSs,pfscan_Pept_M12B_GON-ADAMTSs	ENSG00000163638		0.423	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	40	0.00	0	A			64518862	64518862	-1	no_errors	ENST00000498707	ensembl	human	known	69_37n	missense	92	26.98	34	SNP	1.000	G
AIMP1	9255	genome.wustl.edu	37	4	107249280	107249280	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr4:107249280A>G	ENST00000442366.1	+	4	323	c.271A>G	c.(271-273)Atg>Gtg	p.M91V	AIMP1_ENST00000394701.4_Missense_Mutation_p.M115V|AIMP1_ENST00000358008.3_Missense_Mutation_p.M91V	NM_001142415.1	NP_001135887.1	Q12904	AIMP1_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 1	91	Interaction with HSP90B1. {ECO:0000250}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of endothelial cell proliferation (GO:0001937)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|endometrium(2)|kidney(1)|lung(5)|skin(1)|urinary_tract(1)	11						CGCTAATTCTATGGTTTCTGA	0.363																																						dbGAP											0													85.0	78.0	80.0					4																	107249280		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10117	CCDS3674.1, CCDS47121.1	4q24	2009-05-20	2009-05-20	2009-05-20	ENSG00000164022	ENSG00000164022			10648	protein-coding gene	gene with protein product	"""EMAP II"", ""ARS-interacting multifunctional protein 1"""	603605	"""small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)"""	SCYE1		7929199, 7545917	Standard	NM_004757		Approved	EMAPII, EMAP-2, p43	uc011cfg.2	Q12904	OTTHUMG00000131217	ENST00000442366.1:c.271A>G	4.37:g.107249280A>G	ENSP00000405248:p.Met91Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTR2|B4E1S7|Q6FG28|Q96CQ9	Missense_Mutation	SNP	pfam_tRNA-bd_dom,superfamily_NA-bd_OB-fold-like,superfamily_t-SNARE,pfscan_tRNA-bd_dom	p.M115V	ENST00000442366.1	37	c.343	CCDS3674.1	4	.	.	.	.	.	.	.	.	.	.	A	2.841	-0.240452	0.05944	.	.	ENSG00000164022	ENST00000510207;ENST00000442366;ENST00000432345;ENST00000358008;ENST00000394701	T;T;T;T	0.20738	2.07;2.06;2.06;2.05	5.07	-10.1	0.00402	.	1.919880	0.01781	N	0.031724	T	0.07007	0.0178	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23726	-1.0180	10	0.30854	T	0.27	-37.4074	2.842	0.05532	0.1457:0.2259:0.4074:0.2209	.	91;91	B4DNK3;Q12904	.;AIMP1_HUMAN	V	91;91;91;91;115	ENSP00000423681:M91V;ENSP00000405248:M91V;ENSP00000350699:M91V;ENSP00000378191:M115V	ENSP00000350699:M91V	M	+	1	0	AIMP1	107468729	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-2.186000	0.01251	-4.085000	0.00075	-1.064000	0.02280	ATG	AIMP1	-	NULL	ENSG00000164022		0.363	AIMP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AIMP1	HGNC	protein_coding	OTTHUMT00000253961.1	69	0.00	0	A	NM_004757		107249280	107249280	+1	no_errors	ENST00000394701	ensembl	human	known	69_37n	missense	108	31.21	49	SNP	0.000	G
CEMP1	752014	genome.wustl.edu	37	16	2580551	2580551	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr16:2580551T>A	ENST00000567119.1	-	1	858	c.524A>T	c.(523-525)cAg>cTg	p.Q175L	CEMP1_ENST00000382350.1_Missense_Mutation_p.Q175L|AMDHD2_ENST00000413459.3_Missense_Mutation_p.W526R|AMDHD2_ENST00000302956.4_3'UTR|CEMP1_ENST00000565480.1_Intron|AMDHD2_ENST00000565570.1_3'UTR|MIR3178_ENST00000581887.1_RNA	NM_001048212.3	NP_001041677.1	Q6PRD7	CEMP1_HUMAN	cementum protein 1	175						cytoplasm (GO:0005737)				lung(1)|skin(1)	2						ATTTGAGTTCTGGGGTGGGTG	0.597																																						dbGAP											0													106.0	113.0	111.0					16																	2580551		2029	4179	6208	-	-	-	SO:0001583	missense	0			AY584596	CCDS42108.1	16p13.3	2006-09-22							32553	protein-coding gene	gene with protein product	"""cementum protein-23"""	611113				16263347	Standard	NM_001048212		Approved	CP-23	uc002cqr.3	Q6PRD7		ENST00000567119.1:c.524A>T	16.37:g.2580551T>A	ENSP00000457380:p.Gln175Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUY1	Missense_Mutation	SNP	pfam_Amidohydro_1,pfam_Amidohydro_3,superfamily_Metal-dep_hydrolase_composite	p.W526R	ENST00000567119.1	37	c.1576	CCDS42108.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.602|6.602	0.479477|0.479477	0.12581|0.12581	.|.	.|.	ENSG00000205923|ENSG00000162066	ENST00000382350|ENST00000413459	T|.	0.52526|.	0.66|.	1.92|1.92	0.822|0.822	0.18806|0.18806	.|.	.|.	.|.	.|.	.|.	T|T	0.19927|0.19927	0.0479|0.0479	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|P	0.65815|0.38020	0.995|0.615	D|B	0.62955|0.27715	0.909|0.082	T|T	0.16512|0.16512	-1.0400|-1.0400	8|7	0.87932|0.87932	D|D	0|0	.|.	3.5899|3.5899	0.07985|0.07985	0.0:0.2046:0.0:0.7954|0.0:0.2046:0.0:0.7954	.|.	175|526	Q6PRD7|Q9Y303-3	CEMP1_HUMAN|.	L|R	175|526	ENSP00000371787:Q175L|.	ENSP00000371787:Q175L|ENSP00000391596:W526R	Q|W	-|+	2|1	0|0	CEMP1|AMDHD2	2520552|2520552	0.000000|0.000000	0.05858|0.05858	0.017000|0.017000	0.16124|0.16124	0.063000|0.063000	0.16089|0.16089	-0.701000|-0.701000	0.05075|0.05075	0.215000|0.215000	0.20761|0.20761	0.459000|0.459000	0.35465|0.35465	CAG|TGG	AMDHD2	-	NULL	ENSG00000162066		0.597	CEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMDHD2	HGNC	protein_coding	OTTHUMT00000435686.1	51	0.00	0	T	NM_001048212		2580551	2580551	+1	no_errors	ENST00000413459	ensembl	human	known	69_37n	missense	145	23.68	45	SNP	0.019	A
AQP12B	653437	genome.wustl.edu	37	2	241621869	241621869	+	Missense_Mutation	SNP	G	G	A	rs74882485	byFrequency	TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr2:241621869G>A	ENST00000407834.3	-	1	448	c.386C>T	c.(385-387)aCg>aTg	p.T129M		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	117						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GCAGAGGCGCGTCAGGGTGCA	0.697																																						dbGAP											0													24.0	24.0	24.0					2																	241621869		2196	4279	6475	-	-	-	SO:0001583	missense	0			BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.386C>T	2.37:g.241621869G>A	ENSP00000384894:p.Thr129Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPB9	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.T129M	ENST00000407834.3	37	c.386	CCDS46560.1	2	.	.	.	.	.	.	.	.	.	.	.	7.337	0.620131	0.14193	.	.	ENSG00000185176	ENST00000407834	T	0.15017	2.46	2.84	1.94	0.25998	.	0.293024	0.38492	N	0.001671	T	0.26810	0.0656	.	.	.	0.80722	P	0.0	D	0.71674	0.998	P	0.61592	0.891	T	0.30995	-0.9959	8	0.28530	T	0.3	-0.0254	8.3053	0.32038	0.1286:0.0:0.8714:0.0	.	129	A6NM10-2	.	M	129	ENSP00000384894:T129M	ENSP00000384894:T129M	T	-	2	0	AQP12B	241270542	0.997000	0.39634	0.002000	0.10522	0.132000	0.20833	5.268000	0.65536	0.748000	0.32831	0.473000	0.43528	ACG	AQP12B	-	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12	ENSG00000185176		0.697	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP12B	HGNC	protein_coding	OTTHUMT00000325625.1	11	0.00	0	G			241621869	241621869	-1	no_errors	ENST00000407834	ensembl	human	known	69_37n	missense	3	81.25	13	SNP	0.017	A
LVRN	206338	genome.wustl.edu	37	5	115329524	115329524	+	Silent	SNP	T	T	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr5:115329524T>A	ENST00000357872.4	+	6	1471	c.1347T>A	c.(1345-1347)atT>atA	p.I449I	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		449						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										TTGAAGTAATTAACTACTTTA	0.303																																						dbGAP											0													72.0	72.0	72.0					5																	115329524		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000357872.4:c.1347T>A	5.37:g.115329524T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.I449	ENST00000357872.4	37	c.1347	CCDS4124.1	5																																																																																			LVRN	-	pfam_Peptidase_M1_N	ENSG00000172901		0.303	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Clone_based_vega_gene	protein_coding	OTTHUMT00000250852.1	56	0.00	0	T			115329524	115329524	+1	no_errors	ENST00000357872	ensembl	human	known	69_37n	silent	105	21.05	28	SNP	0.051	A
BMP8B	656	genome.wustl.edu	37	1	40230633	40230633	+	Intron	SNP	T	T	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:40230633T>A	ENST00000372827.3	-	4	1049				BMP8B_ENST00000397360.2_Missense_Mutation_p.M241L	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b						cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGTTTCCACATCTGAAGCCTG	0.652																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.674-144A>T	1.37:g.40230633T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	pfam_TGF-b_N	p.M241L	ENST00000372827.3	37	c.721	CCDS444.1	1	.	.	.	.	.	.	.	.	.	.	T	9.146	1.014961	0.19355	.	.	ENSG00000116985	ENST00000397360	T	0.57107	0.42	3.04	0.699	0.18093	.	.	.	.	.	T	0.37461	0.1004	.	.	.	0.80722	P	0.0	B	0.25850	0.136	B	0.24394	0.053	T	0.36578	-0.9742	7	0.52906	T	0.07	.	4.7925	0.13256	0.0:0.2801:0.0:0.7199	.	241	E7EMY8	.	L	241	ENSP00000380518:M241L	ENSP00000380518:M241L	M	-	1	0	BMP8B	40003220	0.014000	0.17966	0.224000	0.23877	0.017000	0.09413	1.013000	0.29937	0.120000	0.18254	-0.376000	0.06991	ATG	BMP8B	-	NULL	ENSG00000116985		0.652	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	HGNC	protein_coding	OTTHUMT00000025641.1	8	0.00	0	T	NM_001720		40230633	40230633	-1	no_errors	ENST00000397360	ensembl	human	known	69_37n	missense	3	57.14	4	SNP	0.658	A
CACHD1	57685	genome.wustl.edu	37	1	65157044	65157044	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:65157044C>T	ENST00000371073.2	+	27	3625	c.3625C>T	c.(3625-3627)Cct>Tct	p.P1209S	CACHD1_ENST00000290039.5_Missense_Mutation_p.P1158S|CACHD1_ENST00000495994.1_3'UTR			Q5VU97	CAHD1_HUMAN	cache domain containing 1	1209					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CAGTGAAAATCCTCCATGCAA	0.502																																						dbGAP											0													116.0	103.0	107.0					1																	65157044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.3625C>T	1.37:g.65157044C>T	ENSP00000360113:p.Pro1209Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfscan_VWF_A	p.P1209S	ENST00000371073.2	37	c.3625		1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845525	0.32606	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.20598	2.06;2.06	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.23054	0.0557	L	0.29908	0.895	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.02560	-1.1141	10	0.18710	T	0.47	-17.4526	18.796	0.91994	0.0:1.0:0.0:0.0	.	1209	Q5VU97	CAHD1_HUMAN	S	1209;1158	ENSP00000360113:P1209S;ENSP00000290039:P1158S	ENSP00000290039:P1158S	P	+	1	0	CACHD1	64929632	1.000000	0.71417	0.943000	0.38184	0.895000	0.52256	5.628000	0.67791	2.514000	0.84764	0.561000	0.74099	CCT	CACHD1	-	NULL	ENSG00000158966		0.502	CACHD1-201	KNOWN	basic	protein_coding	CACHD1	HGNC	protein_coding		41	0.00	0	C	NM_020925		65157044	65157044	+1	no_errors	ENST00000371073	ensembl	human	known	69_37n	missense	62	31.87	29	SNP	1.000	T
CACNA1S	779	genome.wustl.edu	37	1	201009077	201009077	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:201009077C>T	ENST00000362061.3	-	44	5730	c.5504G>A	c.(5503-5505)gGa>gAa	p.G1835E	RP11-168O16.2_ENST00000415359.1_RNA|CACNA1S_ENST00000367338.3_Missense_Mutation_p.G1816E	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1835					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCCTCTCGTCCTTTCAGTAG	0.607																																						dbGAP											0													158.0	146.0	150.0					1																	201009077		2203	4300	6503	-	-	-	SO:0001583	missense	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.5504G>A	1.37:g.201009077C>T	ENSP00000355192:p.Gly1835Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.G1835E	ENST00000362061.3	37	c.5504	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	.	8.957	0.969637	0.18659	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	T;T	0.79247	-1.25;-1.25	4.08	1.85	0.25348	.	1.976360	0.03529	N	0.222119	T	0.72236	0.3435	L	0.58810	1.83	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42682	-0.9437	10	0.27082	T	0.32	.	3.7875	0.08705	0.0:0.5086:0.1899:0.3016	.	1835	Q13698	CAC1S_HUMAN	E	1835;1816	ENSP00000355192:G1835E;ENSP00000356307:G1816E	ENSP00000355192:G1835E	G	-	2	0	CACNA1S	199275700	0.262000	0.24073	0.001000	0.08648	0.737000	0.42083	0.803000	0.27083	0.101000	0.17610	0.404000	0.27445	GGA	CACNA1S	-	NULL	ENSG00000081248		0.607	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	60	0.00	0	C	NM_000069		201009077	201009077	-1	no_errors	ENST00000362061	ensembl	human	known	69_37n	missense	260	11.56	34	SNP	0.054	T
CCDC80	151887	genome.wustl.edu	37	3	112326098	112326098	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr3:112326098G>A	ENST00000206423.3	-	7	3384	c.2431C>T	c.(2431-2433)Cgc>Tgc	p.R811C	CCDC80_ENST00000439685.2_Missense_Mutation_p.R811C	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	811					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						GTTATGTGGCGCAGACCTGAG	0.373																																						dbGAP											0													82.0	78.0	79.0					3																	112326098		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2431C>T	3.37:g.112326098G>A	ENSP00000206423:p.Arg811Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NULL	p.R811C	ENST00000206423.3	37	c.2431	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380294	0.82682	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000479368	T;T;T	0.73897	-0.79;-0.79;-0.79	5.76	5.76	0.90799	.	0.046141	0.85682	D	0.000000	D	0.89192	0.6645	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.90380	0.4387	10	0.87932	D	0	-12.0495	19.9759	0.97304	0.0:0.0:1.0:0.0	.	811;811	A3KC71;Q76M96	.;CCD80_HUMAN	C	811;811;89	ENSP00000206423:R811C;ENSP00000411814:R811C;ENSP00000418188:R89C	ENSP00000206423:R811C	R	-	1	0	CCDC80	113808788	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.939000	0.75911	2.713000	0.92767	0.655000	0.94253	CGC	CCDC80	-	NULL	ENSG00000091986		0.373	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	58	0.00	0	G	NM_199511		112326098	112326098	-1	no_errors	ENST00000206423	ensembl	human	known	69_37n	missense	58	27.50	22	SNP	1.000	A
CDK5RAP1	51654	genome.wustl.edu	37	20	31975264	31975264	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr20:31975264G>A	ENST00000357886.4	-	6	773	c.620C>T	c.(619-621)gCc>gTc	p.A207V	CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.A207V|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.A207V|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.A117V|CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.A207V|CDK5RAP1_ENST00000477105.1_5'UTR			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	207	MTTase N-terminal.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						GTCCCGGTAGGCATCAGGACC	0.542																																						dbGAP											0													92.0	93.0	93.0					20																	31975264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.620C>T	20.37:g.31975264G>A	ENSP00000350558:p.Ala207Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	pfam_rSAM,pfam_Methylthiotransferase_N,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	p.A207V	ENST00000357886.4	37	c.620		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.9|27.9	4.873923|4.873923	0.91664|0.91664	.|.	.|.	ENSG00000101391|ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000375351;ENST00000544843|ENST00000427097	.|.	.|.	.|.	4.8|4.8	4.8|4.8	0.61643|0.61643	Methylthiotransferase, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77857|0.77857	0.4193|0.4193	M|M	0.84219|0.84219	2.685|2.685	0.80722|0.80722	D|D	1|1	P;D;D;D;D;D;D|.	0.89917|.	0.848;1.0;0.991;0.991;0.991;0.995;0.99|.	B;D;D;D;D;D;D|.	0.85130|.	0.378;0.997;0.917;0.917;0.917;0.962;0.927|.	T|T	0.80183|0.80183	-0.1488|-0.1488	9|5	0.62326|.	D|.	0.03|.	-16.103|-16.103	15.4024|15.4024	0.74852|0.74852	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	207;207;207;207;207;207;117|.	Q675N4;Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2|.	.;.;CK5P1_HUMAN;.;.;.;.|.	V|S	207;207;207;117;97;207|26	.|.	ENSP00000341840:A207V|.	A|P	-|-	2|1	0|0	CDK5RAP1|CDK5RAP1	31438925|31438925	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.833000|0.833000	0.47200|0.47200	9.390000|9.390000	0.97246|0.97246	2.479000|2.479000	0.83701|0.83701	0.563000|0.563000	0.77884|0.77884	GCC|CCT	CDK5RAP1	-	tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	ENSG00000101391		0.542	CDK5RAP1-011	KNOWN	basic	protein_coding	CDK5RAP1	HGNC	protein_coding	OTTHUMT00000078697.1	16	0.00	0	G	NM_016408		31975264	31975264	-1	no_errors	ENST00000357886	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	A
CEL	1056	genome.wustl.edu	37	9	135944524	135944524	+	Silent	SNP	C	C	T	rs201255412	byFrequency	TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr9:135944524C>T	ENST00000372080.4	+	9	1189	c.1173C>T	c.(1171-1173)acC>acT	p.T391T	CEL_ENST00000351304.7_Silent_p.T388T	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	388					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		ATGTCTACACCGAGTCCTGGG	0.557																																						dbGAP											0													6.0	8.0	8.0					9																	135944524		1702	3978	5680	-	-	-	SO:0001819	synonymous_variant	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1173C>T	9.37:g.135944524C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.T391	ENST00000372080.4	37	c.1173	CCDS43896.1	9																																																																																			CEL	-	pfam_CarbesteraseB	ENSG00000170835		0.557	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	12	0.00	0	C			135944524	135944524	+1	no_errors	ENST00000372080	ensembl	human	known	69_37n	silent	21	30.00	9	SNP	0.000	T
CEP152	22995	genome.wustl.edu	37	15	49044602	49044602	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr15:49044602G>T	ENST00000380950.2	-	21	3597	c.3410C>A	c.(3409-3411)cCt>cAt	p.P1137H	CEP152_ENST00000399334.3_Missense_Mutation_p.P1137H|CEP152_ENST00000325747.5_Missense_Mutation_p.P1044H	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1137					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TCCAGCAGCAGGTCCAGGGTC	0.473																																						dbGAP											0													105.0	107.0	107.0					15																	49044602		1907	4109	6016	-	-	-	SO:0001583	missense	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3410C>A	15.37:g.49044602G>T	ENSP00000370337:p.Pro1137His	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NULL	p.P1137H	ENST00000380950.2	37	c.3410	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	G	8.568	0.879474	0.17467	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.52754	0.65;0.67;0.65	4.79	3.88	0.44766	.	1.023920	0.07715	N	0.942742	T	0.56731	0.2005	L	0.51422	1.61	0.09310	N	1	P;D;D	0.63046	0.919;0.992;0.992	P;P;P	0.55999	0.487;0.717;0.789	T	0.42464	-0.9450	10	0.54805	T	0.06	0.0105	9.4092	0.38480	0.0947:0.0:0.9053:0.0	.	1044;1137;1137	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	H	1137;1044;1137	ENSP00000370337:P1137H;ENSP00000321000:P1044H;ENSP00000382271:P1137H	ENSP00000321000:P1044H	P	-	2	0	CEP152	46831894	0.005000	0.15991	0.005000	0.12908	0.018000	0.09664	1.501000	0.35693	1.631000	0.50456	0.655000	0.94253	CCT	CEP152	-	NULL	ENSG00000103995		0.473	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1	30	0.00	0	G	NM_014985		49044602	49044602	-1	no_errors	ENST00000380950	ensembl	human	known	69_37n	missense	46	46.59	41	SNP	0.006	T
CHGA	1113	genome.wustl.edu	37	14	93397599	93397599	+	Silent	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr14:93397599G>A	ENST00000216492.5	+	6	640	c.360G>A	c.(358-360)gcG>gcA	p.A120A	CHGA_ENST00000553866.1_3'UTR|CHGA_ENST00000334654.4_Intron	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	120					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		CTGCAGAGGCGGTGGAAGAGC	0.552																																					Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)	dbGAP											0													34.0	41.0	38.0					14																	93397599		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.360G>A	14.37:g.93397599G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Silent	SNP	pfam_Granin,prints_Chromogranin_AB	p.A120	ENST00000216492.5	37	c.360	CCDS9906.1	14																																																																																			CHGA	-	pfam_Granin	ENSG00000100604		0.552	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGA	HGNC	protein_coding	OTTHUMT00000412411.1	19	0.00	0	G	NM_001275		93397599	93397599	+1	no_errors	ENST00000216492	ensembl	human	known	69_37n	silent	31	26.19	11	SNP	0.000	A
CHRM3	1131	genome.wustl.edu	37	1	240071786	240071786	+	Silent	SNP	C	C	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:240071786C>A	ENST00000255380.4	+	5	1814	c.1035C>A	c.(1033-1035)tcC>tcA	p.S345S		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	345					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CTGCTGCCTCCCTGGAGAACT	0.567																																						dbGAP											0													42.0	34.0	37.0					1																	240071786		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1035C>A	1.37:g.240071786C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M3_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	p.S345	ENST00000255380.4	37	c.1035	CCDS1616.1	1																																																																																			CHRM3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000133019		0.567	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	HGNC	protein_coding	OTTHUMT00000095644.2	10	0.00	0	C	NM_000740		240071786	240071786	+1	no_errors	ENST00000255380	ensembl	human	known	69_37n	silent	28	24.32	9	SNP	0.982	A
CNTNAP1	8506	genome.wustl.edu	37	17	40837254	40837254	+	Silent	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr17:40837254C>T	ENST00000264638.4	+	5	748	c.531C>T	c.(529-531)ttC>ttT	p.F177F	CCR10_ENST00000591765.1_5'Flank|CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	177					axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		TACTCTATTTCGACGGCGACG	0.632																																						dbGAP											0													80.0	76.0	78.0					17																	40837254		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.531C>T	17.37:g.40837254C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.F177	ENST00000264638.4	37	c.531	CCDS11436.1	17																																																																																			CNTNAP1	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000108797		0.632	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	26	0.00	0	C	NM_003632		40837254	40837254	+1	no_errors	ENST00000264638	ensembl	human	known	69_37n	silent	20	41.67	15	SNP	0.992	T
COL1A2	1278	genome.wustl.edu	37	7	94034183	94034183	+	Silent	SNP	T	T	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr7:94034183T>A	ENST00000297268.6	+	9	882	c.411T>A	c.(409-411)ccT>ccA	p.P137P		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	137					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CAGCTGGCCCTCCTGGCAAGG	0.388										HNSCC(75;0.22)																												dbGAP											0													81.0	90.0	87.0					7																	94034183		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.411T>A	7.37:g.94034183T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C,smart_Fib_collagen_C	p.P137	ENST00000297268.6	37	c.411	CCDS34682.1	7																																																																																			COL1A2	-	pfam_Collagen	ENSG00000164692		0.388	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	47	0.00	0	T	NM_000089		94034183	94034183	+1	no_errors	ENST00000297268	ensembl	human	known	69_37n	silent	41	40.58	28	SNP	1.000	A
DISC1	27185	genome.wustl.edu	37	1	231885724	231885724	+	Silent	SNP	G	G	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:231885724G>T	ENST00000602281.1	+	4	1223	c.1170G>T	c.(1168-1170)ctG>ctT	p.L390L	DISC1_ENST00000366633.3_Silent_p.L390L|TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000539444.1_Silent_p.L390L|DISC1_ENST00000366636.4_Silent_p.L390L|DISC1_ENST00000535983.1_Silent_p.L390L|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000537876.1_Silent_p.L390L|DISC1_ENST00000439617.2_Silent_p.L390L|DISC1_ENST00000602873.1_Silent_p.L40L	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	390	Interaction with TRAF3IP1.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				AAATCAGCCTGCACTTTCAAC	0.498																																						dbGAP											0													105.0	103.0	104.0					1																	231885724		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.1170G>T	1.37:g.231885724G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Silent	SNP	superfamily_Prefoldin	p.L390	ENST00000602281.1	37	c.1170	CCDS59205.1	1																																																																																			DISC1	-	NULL	ENSG00000162946		0.498	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	DISC1	HGNC	protein_coding	OTTHUMT00000467451.1	52	0.00	0	G	NM_018662		231885724	231885724	+1	no_errors	ENST00000439617	ensembl	human	known	69_37n	silent	131	18.12	29	SNP	0.869	T
DPEP3	64180	genome.wustl.edu	37	16	68011676	68011676	+	Silent	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr16:68011676C>T	ENST00000268793.4	-	6	1261	c.888G>A	c.(886-888)tcG>tcA	p.S296S	DPEP3_ENST00000574342.1_5'Flank	NM_001129758.1|NM_022357.3	NP_001123230.1|NP_071752.3	Q9H4B8	DPEP3_HUMAN	dipeptidase 3	271					male meiosis (GO:0007140)	anchored component of membrane (GO:0031225)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			breast(4)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		TCAAGGTGTCCGATGCATAGG	0.488																																						dbGAP											0													75.0	66.0	69.0					16																	68011676		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AJ291679	CCDS10856.1	16q22.1	2011-07-22			ENSG00000141096	ENSG00000141096	3.4.13.19		23029	protein-coding gene	gene with protein product		609926					Standard	NM_022357		Approved		uc002evc.4	Q9H4B8	OTTHUMG00000137544	ENST00000268793.4:c.888G>A	16.37:g.68011676C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ48|Q6PEZ5|Q6UXE4	Silent	SNP	pfam_Peptidase_M19	p.S296	ENST00000268793.4	37	c.888	CCDS10856.1	16																																																																																			DPEP3	-	pfam_Peptidase_M19	ENSG00000141096		0.488	DPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPEP3	HGNC	protein_coding	OTTHUMT00000268875.3	31	0.00	0	C	NM_022357		68011676	68011676	-1	no_errors	ENST00000268793	ensembl	human	known	69_37n	silent	84	18.10	19	SNP	0.000	T
DUOX1	53905	genome.wustl.edu	37	15	45448061	45448061	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr15:45448061C>A	ENST00000321429.4	+	29	4043	c.3636C>A	c.(3634-3636)caC>caA	p.H1212Q	DUOX1_ENST00000561166.1_Missense_Mutation_p.H858Q|CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Missense_Mutation_p.H1212Q	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1212	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CCTCCCACCACTTCCGCCGCC	0.582																																						dbGAP											0													112.0	105.0	108.0					15																	45448061		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3636C>A	15.37:g.45448061C>A	ENSP00000317997:p.His1212Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.H1212Q	ENST00000321429.4	37	c.3636	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416334	0.42918	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.91295	-2.82;-2.82	4.01	3.07	0.35406	Flavoprotein transmembrane component (1);	0.157754	0.56097	D	0.000023	D	0.87763	0.6259	L	0.43923	1.385	0.42188	D	0.991715	P	0.40681	0.727	P	0.48873	0.593	T	0.83229	-0.0064	10	0.31617	T	0.26	-30.6727	5.6228	0.17467	0.0:0.6864:0.2046:0.109	.	1212	Q9NRD9	DUOX1_HUMAN	Q	1212	ENSP00000317997:H1212Q;ENSP00000373689:H1212Q	ENSP00000317997:H1212Q	H	+	3	2	DUOX1	43235353	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	0.689000	0.25437	0.991000	0.38814	-0.302000	0.09304	CAC	DUOX1	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000137857		0.582	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	78	0.00	0	C	NM_017434		45448061	45448061	+1	no_errors	ENST00000321429	ensembl	human	known	69_37n	missense	186	26.19	66	SNP	1.000	A
FAM71D	161142	genome.wustl.edu	37	14	67671595	67671595	+	3'UTR	SNP	T	T	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr14:67671595T>G	ENST00000556046.1	+	0	1242							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		AGCATAGATTTCCCAGAATTC	0.498																																						dbGAP											0													82.0	73.0	76.0					14																	67671595		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*757T>G	14.37:g.67671595T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VN4	Missense_Mutation	SNP	pfam_DUF3699	p.F234C	ENST00000556046.1	37	c.701		14																																																																																			FAM71D	-	NULL	ENSG00000172717		0.498	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	FAM71D	HGNC	protein_coding	OTTHUMT00000412390.1	32	0.00	0	T	NM_173526		67671595	67671595	+1	no_errors	ENST00000311864	ensembl	human	known	69_37n	missense	53	15.62	10	SNP	1.000	G
FCGBP	8857	genome.wustl.edu	37	19	40383905	40383905	+	Silent	SNP	G	G	A	rs145218790		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr19:40383905G>A	ENST00000221347.6	-	21	9712	c.9705C>T	c.(9703-9705)tgC>tgT	p.C3235C		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3235						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCCAGGCCCGCAGCGACACC	0.677																																						dbGAP											0													1.0	1.0	1.0					19																	40383905		234	700	934	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.9705C>T	19.37:g.40383905G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.C3235	ENST00000221347.6	37	c.9705	CCDS12546.1	19																																																																																			FCGBP	-	smart_VWC_out	ENSG00000090920		0.677	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	12	0.00	0	G	NM_003890		40383905	40383905	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	19	42.42	14	SNP	0.488	A
GLI2	2736	genome.wustl.edu	37	2	121729565	121729565	+	Missense_Mutation	SNP	G	G	A	rs199931941		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr2:121729565G>A	ENST00000452319.1	+	8	1168	c.1108G>A	c.(1108-1110)Gcc>Acc	p.A370T	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_Missense_Mutation_p.A42T|GLI2_ENST00000361492.4_Missense_Mutation_p.A370T					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CAACCCTGTCGCCATTCACAA	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		17588	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													70.0	63.0	66.0					2																	121729565		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1108G>A	2.37:g.121729565G>A	ENSP00000390436:p.Ala370Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A370T	ENST00000452319.1	37	c.1108	CCDS33283.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.556	-0.847233	0.02651	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	T;T;T	0.14022	2.54;2.54;2.66	3.95	-1.65	0.08291	.	1.048260	0.07577	N	0.919653	T	0.05364	0.0142	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.10296	0.001;0.0;0.003;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.001;0.001;0.0	T	0.41251	-0.9519	10	0.02654	T	1	.	8.0259	0.30436	0.6651:0.0:0.3349:0.0	.	370;370;42;42;42	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	T	370;370;42	ENSP00000390436:A370T;ENSP00000354586:A370T;ENSP00000312694:A42T	ENSP00000312694:A42T	A	+	1	0	GLI2	121446035	0.045000	0.20229	0.697000	0.30258	0.076000	0.17211	-0.194000	0.09559	-0.323000	0.08602	-0.258000	0.10820	GCC	GLI2	-	NULL	ENSG00000074047		0.637	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	HGNC	protein_coding	OTTHUMT00000332293.3	18	0.00	0	G	NM_005270		121729565	121729565	+1	no_errors	ENST00000361492	ensembl	human	known	69_37n	missense	35	32.08	17	SNP	0.303	A
HECTD1	25831	genome.wustl.edu	37	14	31605749	31605749	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr14:31605749G>C	ENST00000399332.1	-	20	3590	c.3102C>G	c.(3100-3102)taC>taG	p.Y1034*	HECTD1_ENST00000553700.1_Nonsense_Mutation_p.Y1034*	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1034					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTTTCAAAAGGTACTGTTCCA	0.433																																						dbGAP											0													109.0	107.0	108.0					14																	31605749		1911	4143	6054	-	-	-	SO:0001587	stop_gained	0			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.3102C>G	14.37:g.31605749G>C	ENSP00000382269:p.Tyr1034*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Nonsense_Mutation	SNP	pfam_HECT,pfam_Sad1_UNC_C,pfam_Mib_Herc2,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,superfamily_Galactose-bd-like,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT	p.Y1034*	ENST00000399332.1	37	c.3102	CCDS41939.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.206242	0.95033	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	.	.	.	4.95	2.35	0.29111	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7669	8.2769	0.31877	0.735:0.0:0.265:0.0	.	.	.	.	X	1034;1036;1034;508	.	ENSP00000261312:Y1036X	Y	-	3	2	HECTD1	30675500	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	2.530000	0.45641	0.237000	0.21200	-0.262000	0.10625	TAC	HECTD1	-	NULL	ENSG00000092148		0.433	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD1	HGNC	protein_coding	OTTHUMT00000409942.1	75	0.00	0	G			31605749	31605749	-1	no_errors	ENST00000399332	ensembl	human	known	69_37n	nonsense	155	20.51	40	SNP	1.000	C
HUWE1	10075	genome.wustl.edu	37	X	53652126	53652126	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chrX:53652126A>G	ENST00000342160.3	-	17	2040	c.1583T>C	c.(1582-1584)aTa>aCa	p.I528T	HUWE1_ENST00000218328.8_Missense_Mutation_p.I528T|HUWE1_ENST00000262854.6_Missense_Mutation_p.I528T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	528					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ACCATGTCGTATGCCATCTGA	0.403																																						dbGAP											0													133.0	126.0	128.0					X																	53652126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.1583T>C	X.37:g.53652126A>G	ENSP00000340648:p.Ile528Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.I528T	ENST00000342160.3	37	c.1583	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	A	21.3	4.123014	0.77436	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328;ENST00000396323	T;T;T	0.47177	0.85;0.85;0.85	5.4	5.4	0.78164	E3 ubiquitin ligase, domain of unknown function DUF913 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.124852	0.48286	D	0.000182	T	0.60958	0.2309	L	0.55103	1.725	0.58432	D	0.999996	D	0.53312	0.959	P	0.61658	0.892	T	0.64067	-0.6494	10	0.72032	D	0.01	.	13.3905	0.60821	1.0:0.0:0.0:0.0	.	528	Q7Z6Z7	HUWE1_HUMAN	T	528;528;528;235	ENSP00000340648:I528T;ENSP00000262854:I528T;ENSP00000218328:I528T	ENSP00000218328:I528T	I	-	2	0	HUWE1	53668851	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.883000	0.92426	1.804000	0.52760	0.486000	0.48141	ATA	HUWE1	-	pfam_E3_Ub_ligase_DUF913,superfamily_ARM-type_fold	ENSG00000086758		0.403	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	62	0.00	0	A	XM_497119		53652126	53652126	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	149	17.22	31	SNP	1.000	G
IGLV3-22	28795	genome.wustl.edu	37	22	23047214	23047214	+	RNA	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr22:23047214C>T	ENST00000390307.2	+	0	316									immunoglobulin lambda variable 3-22 (gene/pseudogene)																		CTGGGTCCACCTCAGGGAACA	0.557																																						dbGAP											0													53.0	57.0	55.0					22																	23047214		1975	4154	6129	-	-	-			0			Z73666		22q11.2	2012-02-08	2008-09-12		ENSG00000211661	ENSG00000211661		"""Immunoglobulins / IGL locus"""	5906	other	immunoglobulin gene			"""immunoglobulin lambda variable 3-22"""				Standard	NG_000002		Approved				OTTHUMG00000151229		22.37:g.23047214C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.T84	ENST00000390307.2	37	c.252		22																																																																																			IGLV3-22	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211661		0.557	IGLV3-22-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV3-22	HGNC	IG_V_gene	OTTHUMT00000321833.2	19	0.00	0	C	NG_000002		23047214	23047214	+1	no_stop_codon	ENST00000390307	ensembl	human	known	69_37n	silent	23	34.29	12	SNP	0.983	T
JAK3	3718	genome.wustl.edu	37	19	17937697	17937697	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr19:17937697C>A	ENST00000527670.1	-	23	3259	c.3230G>T	c.(3229-3231)tGc>tTc	p.C1077F	JAK3_ENST00000458235.1_Missense_Mutation_p.C1077F			P52333	JAK3_HUMAN	Janus kinase 3	1077	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	AGGGGCCCAGCACAGCTTCAT	0.607		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																	dbGAP		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0													52.0	53.0	53.0					19																	17937697		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.3230G>T	19.37:g.17937697C>A	ENSP00000432511:p.Cys1077Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak3,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom	p.C1077F	ENST00000527670.1	37	c.3230	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	c	19.77	3.889623	0.72524	.	.	ENSG00000105639	ENST00000458235;ENST00000527670	D;D	0.89875	-2.58;-2.58	3.61	3.61	0.41365	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.95714	0.8606	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96549	0.9406	9	0.87932	D	0	-5.3022	12.7889	0.57522	0.0:1.0:0.0:0.0	.	1077	P52333	JAK3_HUMAN	F	1077	ENSP00000391676:C1077F;ENSP00000432511:C1077F	ENSP00000391676:C1077F	C	-	2	0	JAK3	17798697	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	6.812000	0.75226	1.877000	0.54381	0.306000	0.20318	TGC	JAK3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom	ENSG00000105639		0.607	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	HGNC	protein_coding	OTTHUMT00000385549.1	22	0.00	0	C	NM_000215		17937697	17937697	-1	no_errors	ENST00000458235	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	A
KIAA1109	84162	genome.wustl.edu	37	4	123111228	123111228	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr4:123111228G>T	ENST00000264501.4	+	10	1268	c.895G>T	c.(895-897)Gag>Tag	p.E299*	KIAA1109_ENST00000455637.1_Nonsense_Mutation_p.E299*|KIAA1109_ENST00000388738.3_Nonsense_Mutation_p.E299*			Q2LD37	K1109_HUMAN	KIAA1109	299					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTACATGGATGAGCCAGGTAt	0.428																																						dbGAP											0													127.0	113.0	118.0					4																	123111228		1936	4128	6064	-	-	-	SO:0001587	stop_gained	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.895G>T	4.37:g.123111228G>T	ENSP00000264501:p.Glu299*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Nonsense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.E299*	ENST00000264501.4	37	c.895	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.626470|5.626470	0.96671|0.96671	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	.|.	.|.	.|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	729.193000|.	0.00721|.	U|.	0.000898|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.29301|.	T|.	0.29|.	.|.	19.3338|19.3338	0.94306|0.94306	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	299|131	.|.	ENSP00000264501:E299X|.	E|X	+|+	1|2	0|2	KIAA1109|KIAA1109	123330678|123330678	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.506000|7.506000	0.81665|0.81665	2.587000|2.587000	0.87381|0.87381	0.655000|0.655000	0.94253|0.94253	GAG|TGA	KIAA1109	-	NULL	ENSG00000138688		0.428	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	74	0.00	0	G	NM_020797		123111228	123111228	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	nonsense	135	22.73	40	SNP	1.000	T
KRT6B	3854	genome.wustl.edu	37	12	52844400	52844400	+	Missense_Mutation	SNP	C	C	T	rs71453293		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr12:52844400C>T	ENST00000252252.3	-	2	592	c.545G>A	c.(544-546)cGg>cAg	p.R182Q		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	182	Coil 1A.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CTCTAGGAACCGCACCTGGAG	0.557																																						dbGAP											0													69.0	81.0	77.0					12																	52844400		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.545G>A	12.37:g.52844400C>T	ENSP00000252252:p.Arg182Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P48669	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.R182Q	ENST00000252252.3	37	c.545	CCDS8828.1	12	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796411	0.70567	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.92099	-2.97	2.85	0.244	0.15507	Filament (1);	0.000000	0.56097	D	0.000035	D	0.94424	0.8206	M	0.87328	2.875	0.47905	D	0.999547	D	0.71674	0.998	D	0.64321	0.924	D	0.91555	0.5260	10	0.62326	D	0.03	.	5.5312	0.16985	0.1771:0.6776:0.0:0.1453	.	182	P04259	K2C6B_HUMAN	Q	182	ENSP00000252252:R182Q	ENSP00000252252:R182Q	R	-	2	0	KRT6B	51130667	0.972000	0.33761	0.844000	0.33320	0.940000	0.58332	2.454000	0.44979	0.056000	0.16144	0.454000	0.30748	CGG	KRT6B	-	pfam_F	ENSG00000185479		0.557	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	HGNC	protein_coding	OTTHUMT00000404969.1	68	0.00	0	C	NM_005555		52844400	52844400	-1	no_errors	ENST00000252252	ensembl	human	known	69_37n	missense	160	28.57	64	SNP	0.986	T
KRTAP6-3	337968	genome.wustl.edu	37	21	31965011	31965011	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr21:31965011G>A	ENST00000391624.1	+	1	253	c.226G>A	c.(226-228)Ggc>Agc	p.G76S	KRTAP22-2_ENST00000382830.2_5'Flank	NM_181605.3	NP_853636.3	Q3LI67	KRA63_HUMAN	keratin associated protein 6-3	76						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(7)	10						ctatggctgtggctatggctA	0.582																																						dbGAP											0													57.0	66.0	63.0					21																	31965011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708		21q22.1	2012-04-19			ENSG00000212938	ENSG00000212938		"""Keratin associated proteins"""	18933	protein-coding gene	gene with protein product						12359730	Standard	NM_181605		Approved	KAP6.3	uc002yom.3	Q3LI67	OTTHUMG00000057791	ENST00000391624.1:c.226G>A	21.37:g.31965011G>A	ENSP00000375482:p.Gly76Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4IF26	Missense_Mutation	SNP	NULL	p.G76S	ENST00000391624.1	37	c.226		21	.	.	.	.	.	.	.	.	.	.	G	6.892	0.534151	0.13188	.	.	ENSG00000212938	ENST00000391624	T	0.49720	0.77	3.41	3.41	0.39046	.	.	.	.	.	T	0.59335	0.2186	L	0.54323	1.7	0.29948	N	0.8205	D	0.71674	0.998	D	0.63703	0.917	T	0.56450	-0.7977	9	0.87932	D	0	.	10.6194	0.45470	0.0:0.0:1.0:0.0	.	76	Q3LI67	KRA63_HUMAN	S	76	ENSP00000375482:G76S	ENSP00000375482:G76S	G	+	1	0	KRTAP6-3	30886882	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	1.398000	0.34554	2.197000	0.70478	0.460000	0.39030	GGC	KRTAP6-3	-	NULL	ENSG00000212938		0.582	KRTAP6-3-001	KNOWN	basic|appris_principal	protein_coding	KRTAP6-3	HGNC	protein_coding	OTTHUMT00000128243.2	155	0.00	0	G	NM_181605		31965011	31965011	+1	no_errors	ENST00000391624	ensembl	human	known	69_37n	missense	185	25.90	65	SNP	1.000	A
LDB3	11155	genome.wustl.edu	37	10	88476372	88476372	+	Missense_Mutation	SNP	C	C	T	rs150188572		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr10:88476372C>T	ENST00000361373.4	+	9	1541	c.1520C>T	c.(1519-1521)aCc>aTc	p.T507I	LDB3_ENST00000263066.6_Missense_Mutation_p.T397I|LDB3_ENST00000429277.2_Missense_Mutation_p.T512I|LDB3_ENST00000458213.2_Missense_Mutation_p.T397I|LDB3_ENST00000352360.5_Missense_Mutation_p.T250I	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						AAGAGCACCACCTCCATCAGC	0.682																																						dbGAP											0													67.0	73.0	71.0					10																	88476372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1520C>T	10.37:g.88476372C>T	ENSP00000355296:p.Thr507Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_ZASP,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.T512I	ENST00000361373.4	37	c.1535	CCDS7377.1	10	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215068	0.58452	.	.	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	T;T;T;T;T	0.54675	0.79;0.64;0.6;0.64;0.56	4.89	3.97	0.46021	.	0.252789	0.20872	N	0.084157	T	0.67306	0.2879	M	0.75264	2.295	0.80722	D	1	P;D;D;D;P	0.69078	0.938;0.98;0.963;0.997;0.739	B;P;P;P;B	0.61201	0.368;0.572;0.572;0.885;0.354	T	0.66126	-0.6001	10	0.28530	T	0.3	.	13.9525	0.64126	0.0:0.7099:0.2901:0.0	.	512;428;250;507;397	B4E3K3;F5H0C2;O75112-3;O75112;O75112-2	.;.;.;LDB3_HUMAN;.	I	428;512;397;250;397;507	ENSP00000401437:T512I;ENSP00000409148:T397I;ENSP00000263067:T250I;ENSP00000263066:T397I;ENSP00000355296:T507I	ENSP00000263066:T397I	T	+	2	0	LDB3	88466352	1.000000	0.71417	0.662000	0.29724	0.948000	0.59901	4.735000	0.62051	1.159000	0.42565	0.650000	0.86243	ACC	LDB3	-	NULL	ENSG00000122367		0.682	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LDB3	HGNC	protein_coding	OTTHUMT00000049160.2	17	0.00	0	C			88476372	88476372	+1	no_errors	ENST00000429277	ensembl	human	known	69_37n	missense	59	19.74	15	SNP	0.996	T
MEGF8	1954	genome.wustl.edu	37	19	42855839	42855839	+	Silent	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr19:42855839C>T	ENST00000251268.6	+	18	3027	c.3027C>T	c.(3025-3027)ttC>ttT	p.F1009F	MEGF8_ENST00000334370.4_Silent_p.F942F	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1009					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GCGATGGCTTCCTGACCTGCC	0.662																																						dbGAP											0													38.0	30.0	32.0					19																	42855839		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.3027C>T	19.37:g.42855839C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Silent	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.F1009	ENST00000251268.6	37	c.3027		19																																																																																			MEGF8	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000105429		0.662	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	15	0.00	0	C	NM_001410		42855839	42855839	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	silent	23	47.73	21	SNP	0.993	T
MRC2	9902	genome.wustl.edu	37	17	60768334	60768334	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr17:60768334A>G	ENST00000303375.5	+	28	4439	c.4037A>G	c.(4036-4038)aAc>aGc	p.N1346S	MRC2_ENST00000446119.2_Missense_Mutation_p.N212S	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1346	C-type lectin 8. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TGGCAGGACAACACAGCTGTG	0.607																																						dbGAP											0													18.0	19.0	19.0					17																	60768334		2202	4297	6499	-	-	-	SO:0001583	missense	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.4037A>G	17.37:g.60768334A>G	ENSP00000307513:p.Asn1346Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,prints_AntifreezeII,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.N1346S	ENST00000303375.5	37	c.4037	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	A	20.6	4.017745	0.75161	.	.	ENSG00000011028	ENST00000303375;ENST00000446119	T;T	0.08546	3.08;3.08	4.25	4.25	0.50352	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.108850	0.64402	D	0.000009	T	0.15912	0.0383	L	0.42245	1.32	0.41565	D	0.988659	P;P	0.49447	0.917;0.924	P;P	0.54759	0.76;0.696	T	0.01249	-1.1406	10	0.49607	T	0.09	-36.1543	13.5442	0.61693	1.0:0.0:0.0:0.0	.	212;1346	E7EME3;Q9UBG0	.;MRC2_HUMAN	S	1346;212	ENSP00000307513:N1346S;ENSP00000400445:N212S	ENSP00000307513:N1346S	N	+	2	0	MRC2	58122066	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.167000	0.50793	1.792000	0.52537	0.459000	0.35465	AAC	MRC2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000011028		0.607	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1	20	0.00	0	A			60768334	60768334	+1	no_errors	ENST00000303375	ensembl	human	known	69_37n	missense	55	14.06	9	SNP	1.000	G
MUC17	140453	genome.wustl.edu	37	7	100684336	100684336	+	Silent	SNP	A	A	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr7:100684336A>G	ENST00000306151.4	+	3	9703	c.9639A>G	c.(9637-9639)ccA>ccG	p.P3213P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3213	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAGCATTCCAACCTCAACTC	0.498																																						dbGAP											0													284.0	286.0	285.0					7																	100684336		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9639A>G	7.37:g.100684336A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.P3213	ENST00000306151.4	37	c.9639	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	150	0.00	0	A	NM_001040105		100684336	100684336	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	silent	141	35.02	76	SNP	0.493	G
MYO5A	4644	genome.wustl.edu	37	15	52643662	52643662	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr15:52643662G>T	ENST00000399231.3	-	28	3881	c.3638C>A	c.(3637-3639)tCa>tAa	p.S1213*	MYO5A_ENST00000358212.6_Nonsense_Mutation_p.S1213*|MYO5A_ENST00000356338.6_Nonsense_Mutation_p.S1213*|MYO5A_ENST00000399233.2_Nonsense_Mutation_p.S1213*|MYO5A_ENST00000553916.1_Nonsense_Mutation_p.S1213*	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1213					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TTTGTTTTCTGATTCTAGTTC	0.463																																						dbGAP											0													128.0	128.0	128.0					15																	52643662		1894	4121	6015	-	-	-	SO:0001587	stop_gained	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3638C>A	15.37:g.52643662G>T	ENSP00000382177:p.Ser1213*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1213*	ENST00000399231.3	37	c.3638	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	G	44	11.024680	0.99504	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916;ENST00000399228	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	18.978	0.92745	0.0:0.0:1.0:0.0	.	.	.	.	X	1213;747;1213;1213;1213;843;1213;6	.	ENSP00000348693:S1213X	S	-	2	0	MYO5A	50430954	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.420000	0.97426	2.558000	0.86282	0.655000	0.94253	TCA	MYO5A	-	NULL	ENSG00000197535		0.463	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	95	0.00	0	G	NM_000259		52643662	52643662	-1	no_errors	ENST00000358212	ensembl	human	known	69_37n	nonsense	181	22.65	53	SNP	1.000	T
NCKAP1	10787	genome.wustl.edu	37	2	183847589	183847589	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr2:183847589C>A	ENST00000361354.4	-	12	1540	c.1168G>T	c.(1168-1170)Gat>Tat	p.D390Y	NCKAP1_ENST00000360982.2_Missense_Mutation_p.D396Y	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	390					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GGCATGTTATCTGCATGACGA	0.313																																						dbGAP											0													45.0	45.0	45.0					2																	183847589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.1168G>T	2.37:g.183847589C>A	ENSP00000355348:p.Asp390Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	pfam_Nck-associated_protein-1	p.D396Y	ENST00000361354.4	37	c.1186	CCDS2287.1	2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780662	0.90195	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.31510	1.49;1.49	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.57932	0.2087	M	0.73598	2.24	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.74023	0.982;0.918	T	0.61441	-0.7062	10	0.66056	D	0.02	-14.5265	18.95	0.92638	0.0:1.0:0.0:0.0	.	390;396	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	Y	390;396	ENSP00000355348:D390Y;ENSP00000354251:D396Y	ENSP00000354251:D396Y	D	-	1	0	NCKAP1	183555834	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.797000	0.85911	2.485000	0.83878	0.655000	0.94253	GAT	NCKAP1	-	pfam_Nck-associated_protein-1	ENSG00000061676		0.313	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	HGNC	protein_coding	OTTHUMT00000255867.2	53	0.00	0	C	NM_205842		183847589	183847589	-1	no_errors	ENST00000360982	ensembl	human	known	69_37n	missense	95	22.13	27	SNP	1.000	A
NIPAL1	152519	genome.wustl.edu	37	4	48038079	48038079	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr4:48038079G>A	ENST00000295461.5	+	6	1189	c.1123G>A	c.(1123-1125)Gcc>Acc	p.A375T		NM_207330.1	NP_997213.1	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1	375						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|large_intestine(1)|lung(3)|skin(2)	8						TAAGAAAGAAGCCGTCTCTCT	0.378																																						dbGAP											0													98.0	90.0	93.0					4																	48038079		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC067881	CCDS3479.1	4p12	2009-03-24		2009-03-24	ENSG00000163293	ENSG00000163293			27194	protein-coding gene	gene with protein product				NPAL1			Standard	NM_207330		Approved	DKFZp686A06115	uc003gxw.3	Q6NVV3	OTTHUMG00000128622	ENST00000295461.5:c.1123G>A	4.37:g.48038079G>A	ENSP00000295461:p.Ala375Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTB0|Q68DA9	Missense_Mutation	SNP	pfam_Mg_trans_NIPA,pfam_DMT	p.A375T	ENST00000295461.5	37	c.1123	CCDS3479.1	4	.	.	.	.	.	.	.	.	.	.	G	1.663	-0.510902	0.04231	.	.	ENSG00000163293	ENST00000295461	D	0.90133	-2.62	5.96	3.18	0.36537	.	1.328950	0.04768	N	0.427618	T	0.81192	0.4771	N	0.14661	0.345	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.67507	-0.5653	9	.	.	.	.	3.2681	0.06871	0.2232:0.174:0.5018:0.101	.	375	Q6NVV3	NIPA3_HUMAN	T	375	ENSP00000295461:A375T	.	A	+	1	0	NIPAL1	47732836	0.009000	0.17119	0.601000	0.28877	0.060000	0.15804	0.467000	0.22035	0.874000	0.35823	0.655000	0.94253	GCC	NIPAL1	-	NULL	ENSG00000163293		0.378	NIPAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPAL1	HGNC	protein_coding	OTTHUMT00000250491.4	46	0.00	0	G	NM_207330		48038079	48038079	+1	no_errors	ENST00000295461	ensembl	human	known	69_37n	missense	56	32.53	27	SNP	0.003	A
NR1D2	9975	genome.wustl.edu	37	3	24003871	24003871	+	Silent	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr3:24003871C>T	ENST00000312521.4	+	5	1240	c.921C>T	c.(919-921)agC>agT	p.S307S	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	307	Ligand-binding.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						GGCTTAGCAGCCATTTTCCCT	0.448																																						dbGAP											0													66.0	59.0	61.0					3																	24003871		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.921C>T	3.37:g.24003871C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Q3|O00402|Q86XD4	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S307	ENST00000312521.4	37	c.921	CCDS33718.1	3																																																																																			NR1D2	-	NULL	ENSG00000174738		0.448	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D2	HGNC	protein_coding	OTTHUMT00000341017.3	47	0.00	0	C			24003871	24003871	+1	no_errors	ENST00000312521	ensembl	human	known	69_37n	silent	70	26.04	25	SNP	1.000	T
NUDCD1	84955	genome.wustl.edu	37	8	110287602	110287602	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr8:110287602C>G	ENST00000239690.4	-	7	1526	c.1152G>C	c.(1150-1152)atG>atC	p.M384I	NUDCD1_ENST00000427660.2_Missense_Mutation_p.M355I	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			AGGTCAAATGCATCAAACGTT	0.408																																						dbGAP											0													138.0	127.0	131.0					8																	110287602		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.1152G>C	8.37:g.110287602C>G	ENSP00000239690:p.Met384Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.M384I	ENST00000239690.4	37	c.1152	CCDS6312.1	8	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893743	0.52121	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	T;T	0.18174	2.23;2.23	6.07	6.07	0.98685	.	0.124595	0.64402	D	0.000001	T	0.22244	0.0536	L	0.54323	1.7	0.48288	D	0.999623	B;B;B	0.22800	0.075;0.002;0.009	B;B;B	0.13407	0.009;0.003;0.006	T	0.01156	-1.1434	10	0.52906	T	0.07	-10.2728	19.6475	0.95784	0.0:1.0:0.0:0.0	.	297;384;355	Q96RS6-3;Q96RS6;Q96RS6-2	.;NUDC1_HUMAN;.	I	384;355	ENSP00000239690:M384I;ENSP00000410707:M355I	ENSP00000239690:M384I	M	-	3	0	NUDCD1	110356778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.546000	0.53656	2.885000	0.99019	0.655000	0.94253	ATG	NUDCD1	-	NULL	ENSG00000120526		0.408	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD1	HGNC	protein_coding	OTTHUMT00000380996.1	65	0.00	0	C	NM_032869		110287602	110287602	-1	no_errors	ENST00000239690	ensembl	human	known	69_37n	missense	261	31.32	119	SNP	1.000	G
ODF3L2	284451	genome.wustl.edu	37	19	463919	463919	+	Silent	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr19:463919C>T	ENST00000315489.4	-	4	1030	c.795G>A	c.(793-795)tcG>tcA	p.S265S	SHC2_ENST00000264554.6_5'Flank|ODF3L2_ENST00000382696.3_Silent_p.S229S	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	265						cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						TGGCCCGTTTCGAGTGGCGGA	0.701																																						dbGAP											0													20.0	25.0	23.0					19																	463919		2193	4283	6476	-	-	-	SO:0001819	synonymous_variant	0			AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.795G>A	19.37:g.463919C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SX65|Q8N1L2	Silent	SNP	pfam_SHIPPO-rpt	p.S265	ENST00000315489.4	37	c.795	CCDS12027.1	19																																																																																			ODF3L2	-	NULL	ENSG00000181781		0.701	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ODF3L2	HGNC	protein_coding	OTTHUMT00000451849.2	22	0.00	0	C	NM_182577		463919	463919	-1	no_errors	ENST00000315489	ensembl	human	known	69_37n	silent	15	53.12	17	SNP	0.002	T
OR1A1	8383	genome.wustl.edu	37	17	3119269	3119269	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr17:3119269G>A	ENST00000304094.1	+	1	355	c.355G>A	c.(355-357)Gca>Aca	p.A119T		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GGCTGCAATGGCATATGATCG	0.478																																						dbGAP											0													134.0	117.0	122.0					17																	3119269		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.355G>A	17.37:g.3119269G>A	ENSP00000305207:p.Ala119Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A119T	ENST00000304094.1	37	c.355	CCDS11022.1	17	.	.	.	.	.	.	.	.	.	.	G	21.1	4.094309	0.76870	.	.	ENSG00000172146	ENST00000304094	T	0.54071	0.59	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000100	T	0.81702	0.4878	H	0.98005	4.125	0.38179	D	0.939575	D	0.89917	1.0	D	0.87578	0.998	D	0.88636	0.3172	10	0.87932	D	0	.	12.7991	0.57576	0.0:0.0:0.8357:0.1643	.	119	Q9P1Q5	OR1A1_HUMAN	T	119	ENSP00000305207:A119T	ENSP00000305207:A119T	A	+	1	0	OR1A1	3066019	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.910000	0.63321	2.584000	0.87258	0.436000	0.28706	GCA	OR1A1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172146		0.478	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A1	HGNC	protein_coding	OTTHUMT00000207292.1	93	0.00	0	G	NM_014565		3119269	3119269	+1	no_errors	ENST00000304094	ensembl	human	known	69_37n	missense	95	31.16	43	SNP	1.000	A
OR2G2	81470	genome.wustl.edu	37	1	247752384	247752384	+	Silent	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:247752384C>T	ENST00000320065.1	+	1	723	c.723C>T	c.(721-723)ttC>ttT	p.F241F	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGAAAGCATTCGGGACCTGCT	0.502																																						dbGAP											0													143.0	129.0	134.0					1																	247752384		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.723C>T	1.37:g.247752384C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQT2|Q6IEZ0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F241	ENST00000320065.1	37	c.723	CCDS31092.1	1																																																																																			OR2G2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000177489		0.502	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G2	HGNC	protein_coding	OTTHUMT00000097623.1	69	0.00	0	C			247752384	247752384	+1	no_errors	ENST00000320065	ensembl	human	known	69_37n	silent	158	11.24	20	SNP	0.000	T
PAK7	57144	genome.wustl.edu	37	20	9561437	9561437	+	Silent	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr20:9561437G>A	ENST00000378429.3	-	5	891	c.345C>T	c.(343-345)caC>caT	p.H115H	PAK7_ENST00000378423.1_Silent_p.H115H|PAK7_ENST00000353224.5_Silent_p.H115H	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	115	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GGCCTGGACCGTGGCTGGAGG	0.542																																						dbGAP											0													153.0	158.0	156.0					20																	9561437		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.345C>T	20.37:g.9561437G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.H115	ENST00000378429.3	37	c.345	CCDS13107.1	20																																																																																			PAK7	-	NULL	ENSG00000101349		0.542	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	HGNC	protein_coding	OTTHUMT00000077962.1	59	0.00	0	G			9561437	9561437	-1	no_errors	ENST00000353224	ensembl	human	known	69_37n	silent	101	24.63	33	SNP	0.016	A
PCNXL4	64430	genome.wustl.edu	37	14	60591901	60591901	+	Silent	SNP	T	T	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr14:60591901T>G	ENST00000406854.1	+	9	3566	c.3012T>G	c.(3010-3012)ccT>ccG	p.P1004P	PCNXL4_ENST00000404681.2_Silent_p.P1004P|PCNXL4_ENST00000317623.4_Silent_p.P770P|PCNXL4_ENST00000535349.1_Silent_p.P211P|PCNXL4_ENST00000406949.1_Silent_p.P770P			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	1004						integral component of membrane (GO:0016021)											GTGTTTTGCCTTGGTCTGTTG	0.368																																						dbGAP											0													47.0	46.0	47.0					14																	60591901		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.3012T>G	14.37:g.60591901T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXM2|Q9BQG8|Q9H9F2	Silent	SNP	pfam_Pecanex	p.P1004	ENST00000406854.1	37	c.3012		14																																																																																			PCNXL4	-	pfam_Pecanex	ENSG00000126773		0.368	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PCNXL4	HGNC	protein_coding	OTTHUMT00000317847.1	62	0.00	0	T	NM_022495		60591901	60591901	+1	no_errors	ENST00000404681	ensembl	human	known	69_37n	silent	63	21.95	18	SNP	0.938	G
PIGA	5277	genome.wustl.edu	37	X	15349901	15349901	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chrX:15349901C>T	ENST00000333590.4	-	2	236	c.152G>A	c.(151-153)aGc>aAc	p.S51N	PIGA_ENST00000542278.1_Intron|PIGA_ENST00000428964.1_Intron|PIGA_ENST00000482148.1_5'UTR	NM_002641.3	NP_002632.1	P37287	PIGA_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class A	51					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|positive regulation of metabolic process (GO:0009893)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)|UDP-glycosyltransferase activity (GO:0008194)			endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Hepatocellular(33;0.183)					GTAAATGTGGCTTTCCACGCC	0.448																																						dbGAP											0													128.0	112.0	117.0					X																	15349901		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038236	CCDS14165.1, CCDS48086.1, CCDS48086.2	Xp22.1	2014-09-17	2008-07-31		ENSG00000165195	ENSG00000165195	2.4.1.198	"""Glycosyltransferase group 1 domain containing"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8957	protein-coding gene	gene with protein product	"""paroxysmal nocturnal hemoglobinuria"", ""phosphatidylinositol N-acetylglucosaminyltransferase"""	311770	"""phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria)"""			8500164	Standard	NM_002641		Approved	GPI3	uc004cwr.3	P37287	OTTHUMG00000021174	ENST00000333590.4:c.152G>A	X.37:g.15349901C>T	ENSP00000369820:p.Ser51Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0V2|Q16025|Q16250	Missense_Mutation	SNP	pfam_PIGA_GPI_anchor_biosynthesis,pfam_Glyco_trans_1	p.S51N	ENST00000333590.4	37	c.152	CCDS14165.1	X	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848217	0.32699	.	.	ENSG00000165195	ENST00000333590	T	0.75477	-0.94	6.08	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.56247	0.1972	N	0.17474	0.49	0.80722	D	1	P;B;P	0.43519	0.809;0.046;0.809	B;B;B	0.37943	0.261;0.027;0.261	T	0.54384	-0.8302	10	0.15499	T	0.54	-7.7882	13.3627	0.60665	0.0:0.9234:0.0:0.0766	.	51;51;51	A8K382;P37287-2;P37287	.;.;PIGA_HUMAN	N	51	ENSP00000369820:S51N	ENSP00000369820:S51N	S	-	2	0	PIGA	15259822	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.406000	0.80017	1.304000	0.44892	0.600000	0.82982	AGC	PIGA	-	NULL	ENSG00000165195		0.448	PIGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGA	HGNC	protein_coding	OTTHUMT00000055854.1	46	0.00	0	C	NM_002641		15349901	15349901	-1	no_errors	ENST00000333590	ensembl	human	known	69_37n	missense	88	40.54	60	SNP	1.000	T
PLIN4	729359	genome.wustl.edu	37	19	4511750	4511750	+	Missense_Mutation	SNP	G	G	A	rs202029971		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr19:4511750G>A	ENST00000301286.3	-	3	2179	c.2180C>T	c.(2179-2181)gCg>gTg	p.A727V		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	727	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.A655V(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GGCCACATTCGCAGCACCGGT	0.582																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											153.0	142.0	145.0					19																	4511750		2041	4179	6220	-	-	-	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2180C>T	19.37:g.4511750G>A	ENSP00000301286:p.Ala727Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.A727V	ENST00000301286.3	37	c.2180	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	g	0.054	-1.241882	0.01493	.	.	ENSG00000167676	ENST00000301286	T	0.02863	4.13	4.56	-2.07	0.07276	.	1.845790	0.03331	N	0.193423	T	0.00936	0.0031	N	0.00146	-1.995	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.48647	-0.9017	10	0.20519	T	0.43	-0.0672	10.3918	0.44175	0.5964:0.0:0.4036:0.0	.	727	Q96Q06	PLIN4_HUMAN	V	727	ENSP00000301286:A727V	ENSP00000301286:A727V	A	-	2	0	PLIN4	4462750	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.348000	0.07740	-0.544000	0.06232	-2.613000	0.00159	GCG	PLIN4	-	NULL	ENSG00000167676		0.582	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	95	0.00	0	G	XM_170901		4511750	4511750	-1	no_errors	ENST00000301286	ensembl	human	novel	69_37n	missense	177	14.08	29	SNP	0.000	A
POLR2B	5431	genome.wustl.edu	37	4	57876368	57876368	+	Intron	SNP	T	T	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr4:57876368T>G	ENST00000381227.1	+	12	1817				POLR2B_ENST00000314595.5_Intron|POLR2B_ENST00000441246.2_Intron|POLR2B_ENST00000431623.2_Intron|POLR2B_ENST00000510355.1_Splice_Site			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa						7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					AAGTGGCAGGTAAGTTAAAGT	0.353																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.1405-159T>G	4.37:g.57876368T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A8|Q8IZ61	Splice_Site	SNP	-	NULL	ENST00000381227.1	37	c.NULL	CCDS3511.1	4																																																																																			POLR2B	-	-	ENSG00000047315		0.353	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2B	HGNC	protein_coding	OTTHUMT00000250692.1	12	0.00	0	T	NM_000938		57876368	57876368	+1	no_errors	ENST00000510355	ensembl	human	known	69_37n	splice_site	4	77.78	14	SNP	0.001	G
PREX2	80243	genome.wustl.edu	37	8	69011939	69011939	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr8:69011939G>A	ENST00000288368.4	+	23	2853	c.2576G>A	c.(2575-2577)aGt>aAt	p.S859N	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	859					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CTGGCTAAAAGTGATGAGCAT	0.403																																						dbGAP											0													155.0	134.0	141.0					8																	69011939		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2576G>A	8.37:g.69011939G>A	ENSP00000288368:p.Ser859Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S859N	ENST00000288368.4	37	c.2576	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058945	0.55325	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.34472	1.36	5.66	5.66	0.87406	.	0.101306	0.64402	D	0.000003	T	0.22742	0.0549	N	0.04880	-0.145	0.42564	D	0.99315	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.10450	0.003;0.001;0.005	T	0.07597	-1.0764	10	0.23302	T	0.38	.	19.7461	0.96252	0.0:0.0:1.0:0.0	.	859;859;859	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	N	859	ENSP00000288368:S859N	ENSP00000288368:S859N	S	+	2	0	PREX2	69174493	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.691000	0.61738	2.645000	0.89757	0.650000	0.86243	AGT	PREX2	-	NULL	ENSG00000046889		0.403	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	66	0.00	0	G	NM_025170		69011939	69011939	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	198	16.10	38	SNP	1.000	A
RFX1	5989	genome.wustl.edu	37	19	14076542	14076542	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr19:14076542A>C	ENST00000254325.4	-	15	2243	c.2009T>G	c.(2008-2010)cTc>cGc	p.L670R		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	670					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			GAACTTGGAGAGGAGCACCAG	0.632																																						dbGAP											0													135.0	116.0	122.0					19																	14076542		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2009T>G	19.37:g.14076542A>C	ENSP00000254325:p.Leu670Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.L670R	ENST00000254325.4	37	c.2009	CCDS12301.1	19	.	.	.	.	.	.	.	.	.	.	A	20.1	3.935367	0.73442	.	.	ENSG00000132005	ENST00000254325	T	0.08102	3.13	4.03	4.03	0.46877	.	0.070718	0.56097	D	0.000021	T	0.24275	0.0588	M	0.82823	2.61	0.80722	D	1	D	0.56968	0.978	P	0.55871	0.786	T	0.03863	-1.0997	10	0.87932	D	0	-28.3663	12.0707	0.53616	1.0:0.0:0.0:0.0	.	670	P22670	RFX1_HUMAN	R	670	ENSP00000254325:L670R	ENSP00000254325:L670R	L	-	2	0	RFX1	13937542	1.000000	0.71417	0.961000	0.40146	0.833000	0.47200	9.066000	0.93949	1.678000	0.50952	0.334000	0.21626	CTC	RFX1	-	NULL	ENSG00000132005		0.632	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX1	HGNC	protein_coding	OTTHUMT00000458510.1	29	0.00	0	A	NM_002918		14076542	14076542	-1	no_errors	ENST00000254325	ensembl	human	known	69_37n	missense	57	28.75	23	SNP	1.000	C
SART1	9092	genome.wustl.edu	37	11	65744012	65744012	+	Silent	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr11:65744012C>T	ENST00000312397.5	+	13	1811	c.1719C>T	c.(1717-1719)ggC>ggT	p.G573G		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	573					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGCTGGCTGGCAATCGCGAGG	0.697																																						dbGAP											0													37.0	37.0	37.0					11																	65744012		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.1719C>T	11.37:g.65744012C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDN1|Q53GB5	Silent	SNP	pfam_SART_1	p.G573	ENST00000312397.5	37	c.1719	CCDS31611.1	11																																																																																			SART1	-	pfam_SART_1	ENSG00000175467		0.697	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART1	HGNC	protein_coding	OTTHUMT00000391409.1	14	0.00	0	C			65744012	65744012	+1	no_errors	ENST00000312397	ensembl	human	known	69_37n	silent	33	37.04	20	SNP	0.999	T
SCN4A	6329	genome.wustl.edu	37	17	62049998	62049998	+	Silent	SNP	G	G	A	rs80266947	byFrequency	TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr17:62049998G>A	ENST00000435607.1	-	1	280	c.204C>T	c.(202-204)taC>taT	p.Y68Y	SCN4A_ENST00000578147.1_Silent_p.Y68Y|CTC-264K15.6_ENST00000577329.1_lincRNA	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	68					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGGGGTCTCCGTAGATCATGG	0.597													G|||	3	0.000599042	0.0	0.0	5008	,	,		17612	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													28.0	31.0	30.0					17																	62049998		2027	4194	6221	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.204C>T	17.37:g.62049998G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.Y68	ENST00000435607.1	37	c.204	CCDS45761.1	17																																																																																			SCN4A	-	NULL	ENSG00000007314		0.597	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		42	0.00	0	G	NM_000334		62049998	62049998	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	204	19.69	50	SNP	0.430	A
SEMA3D	223117	genome.wustl.edu	37	7	84670042	84670042	+	Silent	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr7:84670042G>A	ENST00000284136.6	-	9	1036	c.993C>T	c.(991-993)ctC>ctT	p.L331L	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	331	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CTCTTGTGGGGAGTAAATAAA	0.284																																					Ovarian(63;442 1191 17318 29975 31528)	dbGAP											0													51.0	56.0	54.0					7																	84670042		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.993C>T	7.37:g.84670042G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ig_V-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.L331	ENST00000284136.6	37	c.993	CCDS34676.1	7																																																																																			SEMA3D	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000153993		0.284	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	66	0.00	0	G	NM_152754		84670042	84670042	-1	no_errors	ENST00000284136	ensembl	human	known	69_37n	silent	67	15.00	12	SNP	0.959	A
SIGLEC1	6614	genome.wustl.edu	37	20	3687268	3687268	+	Silent	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr20:3687268G>A	ENST00000344754.4	-	2	134	c.135C>T	c.(133-135)ttC>ttT	p.F45F	SIGLEC1_ENST00000202578.4_Silent_p.F45F	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	45	Ig-like V-type.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CGTCGGCAGGGAAGCTGAAGA	0.662																																						dbGAP											0													22.0	17.0	19.0					20																	3687268		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.135C>T	20.37:g.3687268G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.F45	ENST00000344754.4	37	c.135	CCDS13060.1	20																																																																																			SIGLEC1	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000088827		0.662	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	11	0.00	0	G	NM_023068		3687268	3687268	-1	no_errors	ENST00000344754	ensembl	human	known	69_37n	silent	41	19.23	10	SNP	0.987	A
SLC2A7	155184	genome.wustl.edu	37	1	9079361	9079361	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:9079361C>T	ENST00000400906.1	-	4	342	c.343G>A	c.(343-345)Gcc>Acc	p.A115T		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	115					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GGGATGATGGCAAAGATGTTG	0.592																																						dbGAP											0													74.0	64.0	67.0					1																	9079361		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.343G>A	1.37:g.9079361C>T	ENSP00000383698:p.Ala115Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A333	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.A115T	ENST00000400906.1	37	c.343	CCDS98.2	1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753723	0.69648	.	.	ENSG00000197241	ENST00000400906	T	0.74106	-0.81	4.56	1.06	0.20224	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.065222	0.64402	D	0.000008	T	0.73118	0.3546	M	0.62266	1.93	0.35409	D	0.792291	P	0.39376	0.67	P	0.47251	0.542	T	0.74355	-0.3692	10	0.72032	D	0.01	.	6.177	0.20449	0.5694:0.3165:0.0:0.1141	.	115	Q6PXP3	GTR7_HUMAN	T	115	ENSP00000383698:A115T	ENSP00000383698:A115T	A	-	1	0	SLC2A7	9001948	0.259000	0.24043	0.066000	0.19879	0.931000	0.56810	0.877000	0.28106	0.013000	0.14918	0.491000	0.48974	GCC	SLC2A7	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000197241		0.592	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A7	HGNC	protein_coding	OTTHUMT00000127768.3	29	0.00	0	C	NM_207420		9079361	9079361	-1	no_errors	ENST00000400906	ensembl	human	known	69_37n	missense	33	36.54	19	SNP	0.937	T
SLC39A2	29986	genome.wustl.edu	37	14	21467657	21467660	+	Frame_Shift_Del	DEL	CTCA	CTCA	-			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	CTCA	CTCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr14:21467657_21467660delCTCA	ENST00000298681.4	+	1	209_212	c.52_55delCTCA	c.(52-57)ctcactfs	p.LT18fs	SLC39A2_ENST00000554422.1_Frame_Shift_Del_p.LT18fs|RP11-84C10.4_ENST00000557335.1_RNA	NM_014579.3	NP_055394.2	Q9NP94	S39A2_HUMAN	solute carrier family 39 (zinc transporter), member 2	18					transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	14	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0187)		CCTGTTGGCTCTCACTCTGGGCTG	0.515																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF186081	CCDS9563.1, CCDS58303.1	14q11.1	2013-05-22			ENSG00000165794	ENSG00000165794		"""Solute carriers"""	17127	protein-coding gene	gene with protein product		612166				10681536, 7751801	Standard	NM_014579		Approved	ZIP2	uc001vyr.3	Q9NP94	OTTHUMG00000029616	ENST00000298681.4:c.52_55delCTCA	14.37:g.21467657_21467660delCTCA	ENSP00000298681:p.Leu18fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC76|G3V5X2|Q4QQJ1|Q4V9S4|Q96JT6|Q9UD20	Frame_Shift_Del	DEL	pfam_ZIP	p.T19fs	ENST00000298681.4	37	c.52_55	CCDS9563.1	14																																																																																			SLC39A2	-	pfam_ZIP	ENSG00000165794		0.515	SLC39A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A2	HGNC	protein_coding	OTTHUMT00000073829.2	76	0.00	0	CTCA	NM_014579		21467657	21467660	+1	no_errors	ENST00000298681	ensembl	human	known	69_37n	frame_shift_del	183	19.91	46	DEL	0.113:0.990:0.996:1.000	-
SLC45A2	51151	genome.wustl.edu	37	5	33963829	33963829	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr5:33963829C>T	ENST00000296589.4	-	3	1001	c.855G>A	c.(853-855)atG>atA	p.M285I	SLC45A2_ENST00000509381.1_Intron|SLC45A2_ENST00000382102.3_Missense_Mutation_p.M285I|SLC45A2_ENST00000342059.3_Missense_Mutation_p.M226I|SLC45A2_ENST00000345083.5_Intron	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	285					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						TTGCTCCCTGCATTGCCAGCT	0.378																																					Ovarian(31;380 859 8490 22203 49048)	dbGAP											0													158.0	164.0	162.0					5																	33963829		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.855G>A	5.37:g.33963829C>T	ENSP00000296589:p.Met285Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.M285I	ENST00000296589.4	37	c.855	CCDS3901.1	5	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028541	0.54790	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;T;D;D	0.93307	-3.2;2.35;-3.2;-3.2	5.83	-1.05	0.10036	Major facilitator superfamily domain, general substrate transporter (1);	1.650900	0.02600	N	0.100911	T	0.78941	0.4363	N	0.01576	-0.805	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.71573	-0.4552	10	0.27082	T	0.32	-5.6067	1.1284	0.01740	0.1505:0.3072:0.1468:0.3954	.	285;285	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	I	285;226;285;110	ENSP00000296589:M285I;ENSP00000341014:M226I;ENSP00000371534:M285I;ENSP00000424010:M110I	ENSP00000296589:M285I	M	-	3	0	SLC45A2	33999586	0.000000	0.05858	0.007000	0.13788	0.891000	0.51852	-1.093000	0.03362	0.076000	0.16826	0.563000	0.77884	ATG	SLC45A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000164175		0.378	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A2	HGNC	protein_coding	OTTHUMT00000207443.2	75	0.00	0	C	NM_016180		33963829	33963829	-1	no_errors	ENST00000296589	ensembl	human	known	69_37n	missense	198	21.12	53	SNP	0.000	T
SLC6A1	6529	genome.wustl.edu	37	3	11064046	11064046	+	Silent	SNP	C	C	T	rs146894194		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr3:11064046C>T	ENST00000287766.4	+	7	1027	c.606C>T	c.(604-606)gaC>gaT	p.D202D	SLC6A1_ENST00000536032.1_Silent_p.D24D	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	202					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	AGATGACGGACGGGCTGGATA	0.592																																						dbGAP											0													75.0	66.0	69.0					3																	11064046		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.606C>T	3.37:g.11064046C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4K8	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT1	p.D202	ENST00000287766.4	37	c.606	CCDS2603.1	3																																																																																			SLC6A1	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT1	ENSG00000157103		0.592	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A1	HGNC	protein_coding	OTTHUMT00000102767.2	50	0.00	0	C	NM_003042		11064046	11064046	+1	no_errors	ENST00000287766	ensembl	human	known	69_37n	silent	105	16.67	21	SNP	0.980	T
SRGAP2	23380	genome.wustl.edu	37	1	206611342	206611342	+	Silent	SNP	C	C	T	rs534685024		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:206611342C>T	ENST00000414007.1	+	12	1242	c.1242C>T	c.(1240-1242)aaC>aaT	p.N414N	SRGAP2_ENST00000419187.2_5'UTR			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	554	F-BAR domain.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.N414N(1)		NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					GGGACCAGAACGACCATGACA	0.547																																						dbGAP											1	Substitution - coding silent(1)	prostate(1)											100.0	102.0	101.0					1																	206611342		1903	4114	6017	-	-	-	SO:0001819	synonymous_variant	0			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.1242C>T	1.37:g.206611342C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_RhoGAP_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R468*	ENST00000414007.1	37	c.1402		1	.	.	.	.	.	.	.	.	.	.	C	8.516	0.867630	0.17250	.	.	ENSG00000163486	ENST00000295713	.	.	.	6.03	-0.334	0.12666	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8015	0.52130	0.0:0.3595:0.0:0.6405	.	.	.	.	X	468	.	.	R	+	1	2	SRGAP2	204677965	0.710000	0.27896	1.000000	0.80357	0.875000	0.50365	-0.161000	0.10026	0.167000	0.19631	-1.105000	0.02106	CGA	SRGAP2	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000163486		0.547	SRGAP2-201	KNOWN	basic	protein_coding	SRGAP2	HGNC	protein_coding		57	0.00	0	C	NM_015326		206611342	206611342	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000295713	ensembl	human	known	69_37n	nonsense	19	77.11	64	SNP	0.995	T
SYNE2	23224	genome.wustl.edu	37	14	64608223	64608223	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr14:64608223T>G	ENST00000344113.4	+	81	15353	c.15141T>G	c.(15139-15141)atT>atG	p.I5047M	SYNE2_ENST00000555002.1_Missense_Mutation_p.I1681M|SYNE2_ENST00000358025.3_Missense_Mutation_p.I5047M|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.I1432M|SYNE2_ENST00000394768.2_Missense_Mutation_p.I1432M|SYNE2_ENST00000554584.1_Missense_Mutation_p.I4964M	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5047					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTCCAGATATTCAAGAAAAAC	0.353																																						dbGAP											0													77.0	79.0	78.0					14																	64608223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.15141T>G	14.37:g.64608223T>G	ENSP00000341781:p.Ile5047Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.I5047M	ENST00000344113.4	37	c.15141	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	T	16.52	3.147367	0.57151	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34	5.93	-1.28	0.09318	.	0.000000	0.53938	D	0.000052	T	0.43055	0.1230	L	0.54323	1.7	0.80722	D	1	P;D;D;D	0.76494	0.785;0.999;0.997;0.998	P;D;D;D	0.71656	0.509;0.974;0.945;0.935	T	0.34950	-0.9808	10	0.45353	T	0.12	.	3.9051	0.09178	0.337:0.4202:0.0:0.2428	.	1432;4964;5047;5047	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	M	5047;1432;5047;4964;4970;1681;1432	ENSP00000350719:I5047M;ENSP00000349969:I1432M;ENSP00000341781:I5047M;ENSP00000452570:I4964M;ENSP00000450831:I1681M;ENSP00000378249:I1432M	ENSP00000261678:I4970M	I	+	3	3	SYNE2	63677976	0.945000	0.32115	0.999000	0.59377	0.998000	0.95712	0.014000	0.13333	0.090000	0.17273	0.533000	0.62120	ATT	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.353	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	34	0.00	0	T	NM_182914		64608223	64608223	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	85	26.72	31	SNP	0.993	G
TBC1D21	161514	genome.wustl.edu	37	15	74177166	74177166	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr15:74177166G>T	ENST00000300504.2	+	5	495	c.412G>T	c.(412-414)Gtc>Ttc	p.V138F	TBC1D21_ENST00000535547.2_Missense_Mutation_p.V102F|TBC1D21_ENST00000562056.1_Intron	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	138	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						CCTGGGCAACGTCCTCATCGA	0.537																																						dbGAP											0													109.0	90.0	97.0					15																	74177166		2198	4297	6495	-	-	-	SO:0001583	missense	0			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.412G>T	15.37:g.74177166G>T	ENSP00000300504:p.Val138Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6M2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.V138F	ENST00000300504.2	37	c.412	CCDS10252.1	15	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627598	0.46944	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.10960	2.82;2.82	5.44	4.53	0.55603	Rab-GAP/TBC domain (4);	0.122718	0.36703	N	0.002459	T	0.10380	0.0254	L	0.29908	0.895	0.58432	D	0.999992	P;P	0.47841	0.81;0.901	B;B	0.44278	0.275;0.445	T	0.05784	-1.0864	10	0.59425	D	0.04	.	10.2055	0.43109	0.0921:0.0:0.9079:0.0	.	102;138	B9A6M2;Q8IYX1	.;TBC21_HUMAN	F	138;102	ENSP00000300504:V138F;ENSP00000439325:V102F	ENSP00000300504:V138F	V	+	1	0	TBC1D21	71964219	0.773000	0.28580	0.220000	0.23810	0.966000	0.64601	1.715000	0.37971	1.303000	0.44873	0.555000	0.69702	GTC	TBC1D21	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000167139		0.537	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D21	HGNC	protein_coding	OTTHUMT00000268994.1	21	0.00	0	G	NM_153356		74177166	74177166	+1	no_errors	ENST00000300504	ensembl	human	known	69_37n	missense	54	28.57	22	SNP	0.458	T
TBC1D8B	54885	genome.wustl.edu	37	X	106096864	106096864	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chrX:106096864T>C	ENST00000357242.5	+	13	2411	c.2237T>C	c.(2236-2238)aTt>aCt	p.I746T	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.I740T	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	746							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ACAGATTTGATTAGAGAATCA	0.313																																						dbGAP											0													91.0	89.0	90.0					X																	106096864		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.2237T>C	X.37:g.106096864T>C	ENSP00000349781:p.Ile746Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.I746T	ENST00000357242.5	37	c.2237	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	T	18.90	3.721946	0.68959	.	.	ENSG00000133138	ENST00000357242;ENST00000276175;ENST00000394972	T;T	0.11821	2.75;2.74	5.23	5.23	0.72850	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	M	0.81497	2.545	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.33752	-0.9856	10	0.87932	D	0	-16.4852	12.8952	0.58095	0.0:0.0:0.0:1.0	.	746	Q0IIM8	TBC8B_HUMAN	T	746;740;41	ENSP00000349781:I746T;ENSP00000276175:I740T	ENSP00000276175:I740T	I	+	2	0	TBC1D8B	105983520	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.698000	0.84413	1.721000	0.51461	0.441000	0.28932	ATT	TBC1D8B	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000133138		0.313	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	HGNC	protein_coding	OTTHUMT00000057807.2	61	0.00	0	T	NM_017752		106096864	106096864	+1	no_errors	ENST00000357242	ensembl	human	known	69_37n	missense	108	17.56	23	SNP	1.000	C
TDRD6	221400	genome.wustl.edu	37	6	46660616	46660616	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr6:46660616A>T	ENST00000316081.6	+	1	4751	c.4751A>T	c.(4750-4752)tAt>tTt	p.Y1584F	TDRD6_ENST00000544460.1_Missense_Mutation_p.Y1584F	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1584	Tudor 7. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GATGGACATTATTATAGGGCA	0.398																																						dbGAP											0													128.0	130.0	129.0					6																	46660616		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.4751A>T	6.37:g.46660616A>T	ENSP00000346065:p.Tyr1584Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.Y1584F	ENST00000316081.6	37	c.4751	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	A	6.142	0.394496	0.11638	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.12147	2.71;2.71	5.87	1.83	0.25207	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.524928	0.20312	N	0.094808	T	0.02380	0.0073	N	0.16478	0.41	0.37193	D	0.904005	B;B	0.06786	0.001;0.001	B;B	0.12156	0.004;0.007	T	0.36890	-0.9729	10	0.28530	T	0.3	-9.9406	6.1876	0.20506	0.3374:0.0:0.0819:0.5807	.	1584;1584	F5H5M3;O60522	.;TDRD6_HUMAN	F	1584	ENSP00000443299:Y1584F;ENSP00000346065:Y1584F	ENSP00000346065:Y1584F	Y	+	2	0	TDRD6	46768575	1.000000	0.71417	0.851000	0.33527	0.770000	0.43624	3.402000	0.52608	0.438000	0.26450	-0.333000	0.08304	TAT	TDRD6	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000180113		0.398	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	HGNC	protein_coding	OTTHUMT00000040800.1	97	0.00	0	A	XM_166443		46660616	46660616	+1	no_errors	ENST00000316081	ensembl	human	known	69_37n	missense	163	18.50	37	SNP	0.997	T
TESC	54997	genome.wustl.edu	37	12	117494644	117494644	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr12:117494644C>T	ENST00000335209.7	-	3	362	c.176G>A	c.(175-177)cGa>cAa	p.R59Q	TESC_ENST00000392545.4_Missense_Mutation_p.R112Q|TESC_ENST00000535198.1_5'Flank|TESC_ENST00000541210.1_Intron			Q96BS2	CHP3_HUMAN	tescalcin	59					cell differentiation (GO:0030154)|cellular response to retinoic acid (GO:0071300)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell proliferation (GO:0008285)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of sodium:proton antiporter activity (GO:0032417)|positive regulation of transcription, DNA-templated (GO:0045893)|protein maturation (GO:0051604)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of cell adhesion mediated by integrin (GO:0033628)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphatase inhibitor activity (GO:0019212)|protein homodimerization activity (GO:0042803)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)		AATTTTGGATCGGATGGGGTT	0.512																																						dbGAP											0													158.0	124.0	136.0					12																	117494644		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF443207	CCDS9183.2, CCDS9183.3, CCDS53835.1	12q24.22	2013-01-10			ENSG00000088992	ENSG00000088992		"""EF-hand domain containing"""	26065	protein-coding gene	gene with protein product	"""calcineurin-like EF hand protein 3"""	611585				11145610, 11696366, 12809501, 14661968	Standard	NM_017899		Approved	TSC, FLJ20607, CHP3	uc001twh.3	Q96BS2	OTTHUMG00000144168	ENST00000335209.7:c.176G>A	12.37:g.117494644C>T	ENSP00000334785:p.Arg59Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H1Y5|Q9NWT9	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.R112Q	ENST00000335209.7	37	c.335	CCDS9183.3	12	.	.	.	.	.	.	.	.	.	.	C	34	5.326393	0.95708	.	.	ENSG00000088992	ENST00000335209;ENST00000392545	T;T	0.54675	0.56;0.56	5.45	5.45	0.79879	EF-hand-like domain (1);	0.067497	0.56097	D	0.000026	T	0.60625	0.2283	M	0.80422	2.495	0.80722	D	1	P	0.52692	0.955	B	0.43052	0.406	T	0.67461	-0.5665	10	0.48119	T	0.1	-14.4747	18.8757	0.92334	0.0:1.0:0.0:0.0	.	59	Q96BS2	TESC_HUMAN	Q	59;112	ENSP00000334785:R59Q;ENSP00000376328:R112Q	ENSP00000334785:R59Q	R	-	2	0	TESC	115979027	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	5.745000	0.68672	2.543000	0.85770	0.655000	0.94253	CGA	TESC	-	NULL	ENSG00000088992		0.512	TESC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESC	HGNC	protein_coding	OTTHUMT00000291363.2	69	0.00	0	C	NM_017899		117494644	117494644	-1	no_errors	ENST00000392545	ensembl	human	known	69_37n	missense	173	14.36	29	SNP	0.999	T
TLR4	7099	genome.wustl.edu	37	9	120474689	120474689	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr9:120474689G>T	ENST00000355622.6	+	3	384	c.283G>T	c.(283-285)Gat>Tat	p.D95Y	TLR4_ENST00000394487.4_Missense_Mutation_p.D55Y|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	95					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GACAATTGAAGATGGGGCATA	0.378																																						dbGAP											0													42.0	42.0	42.0					9																	120474689		2203	4299	6502	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.283G>T	9.37:g.120474689G>T	ENSP00000363089:p.Asp95Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.D95Y	ENST00000355622.6	37	c.283	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288304	0.40494	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.59772	0.24;5.5	5.63	5.63	0.86233	.	0.083521	0.51477	D	0.000093	T	0.69214	0.3086	L	0.45422	1.42	0.50039	D	0.999844	D	0.63046	0.992	P	0.61397	0.888	T	0.70960	-0.4730	10	0.87932	D	0	.	19.6898	0.95996	0.0:0.0:1.0:0.0	.	95	O00206	TLR4_HUMAN	Y	55;95	ENSP00000377997:D55Y;ENSP00000363089:D95Y	ENSP00000363089:D95Y	D	+	1	0	TLR4	119514510	1.000000	0.71417	0.998000	0.56505	0.053000	0.15095	3.666000	0.54540	2.669000	0.90835	0.655000	0.94253	GAT	TLR4	-	pirsf_Toll-like_receptor,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136869		0.378	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	29	0.00	0	G	NM_138554		120474689	120474689	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	T
TNKS1BP1	85456	genome.wustl.edu	37	11	57080520	57080520	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr11:57080520G>C	ENST00000532437.1	-	4	1953	c.1642C>G	c.(1642-1644)Cca>Gca	p.P548A	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.P548A			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	548	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GACATGCTTGGATCATCCCCC	0.597																																						dbGAP											0													68.0	60.0	63.0					11																	57080520		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1642C>G	11.37:g.57080520G>C	ENSP00000437271:p.Pro548Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	NULL	p.P548A	ENST00000532437.1	37	c.1642	CCDS7951.1	11	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320708	0.23994	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.32023	1.47;1.47	4.01	-0.132	0.13489	.	0.762466	0.10715	N	0.642424	T	0.19765	0.0475	L	0.27053	0.805	0.09310	N	1	B	0.25272	0.122	B	0.22601	0.04	T	0.23691	-1.0181	10	0.59425	D	0.04	0.5936	7.4517	0.27242	0.5047:0.0:0.4953:0.0	.	548	Q9C0C2	TB182_HUMAN	A	548	ENSP00000350990:P548A;ENSP00000437271:P548A	ENSP00000350990:P548A	P	-	1	0	TNKS1BP1	56837096	0.000000	0.05858	0.001000	0.08648	0.169000	0.22640	0.108000	0.15396	0.061000	0.16311	-0.379000	0.06801	CCA	TNKS1BP1	-	NULL	ENSG00000149115		0.597	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1	12	0.00	0	G	NM_033396		57080520	57080520	-1	no_errors	ENST00000358252	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179632645	179632645	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr2:179632645C>G	ENST00000591111.1	-	40	9536	c.9312G>C	c.(9310-9312)aaG>aaC	p.K3104N	TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K3058N|TTN_ENST00000342992.6_Missense_Mutation_p.K3104N|TTN_ENST00000359218.5_Missense_Mutation_p.K3058N|TTN_ENST00000460472.2_Missense_Mutation_p.K3058N|TTN_ENST00000360870.5_Missense_Mutation_p.K3104N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K3104N			Q8WZ42	TITIN_HUMAN	titin	13436	Ig-like 18.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K3104N(2)|p.K3058N(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTCTGAATCTTTATTCTAT	0.458																																						dbGAP											4	Substitution - Missense(4)	large_intestine(4)											80.0	81.0	81.0					2																	179632645		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9312G>C	2.37:g.179632645C>G	ENSP00000465570:p.Lys3104Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.K3104N	ENST00000591111.1	37	c.9312		2	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292042	0.23564	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.8	3.02	0.34903	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61375	0.2342	L	0.45352	1.415	0.80722	D	1	B;B;B;B;P	0.42203	0.175;0.175;0.175;0.175;0.773	B;B;B;B;P	0.45829	0.081;0.081;0.081;0.129;0.494	T	0.59506	-0.7442	9	0.87932	D	0	.	7.798	0.29158	0.0:0.5582:0.0:0.4418	.	3058;3058;3058;3104;3104	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	3104;3058;3058;3058;3058;3104	ENSP00000343764:K3104N;ENSP00000434586:K3058N;ENSP00000340554:K3058N;ENSP00000352154:K3058N;ENSP00000354117:K3104N	ENSP00000340554:K3058N	K	-	3	2	TTN	179340890	1.000000	0.71417	0.903000	0.35520	0.730000	0.41778	0.983000	0.29552	0.353000	0.24079	0.561000	0.74099	AAG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	48	0.00	0	C	NM_133378		179632645	179632645	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	74	22.92	22	SNP	0.931	G
USH1C	10083	genome.wustl.edu	37	11	17545007	17545007	+	Nonsense_Mutation	SNP	C	C	A	rs369461618		TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr11:17545007C>A	ENST00000318024.4	-	10	886	c.778G>T	c.(778-780)Gaa>Taa	p.E260*	USH1C_ENST00000527720.1_Nonsense_Mutation_p.E229*|USH1C_ENST00000005226.7_Nonsense_Mutation_p.E260*|USH1C_ENST00000527020.1_Nonsense_Mutation_p.E260*	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	260	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)	p.E260K(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CCATTGACTTCGACAATCTGG	0.537																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											125.0	108.0	114.0					11																	17545007		2200	4293	6493	-	-	-	SO:0001587	stop_gained	0			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.778G>T	11.37:g.17545007C>A	ENSP00000317018:p.Glu260*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Nonsense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E260*	ENST00000318024.4	37	c.778	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.610135	0.96637	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226;ENST00000526181	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.718	0.85402	0.0:1.0:0.0:0.0	.	.	.	.	X	260;229;260;260;271	.	ENSP00000005226:E260X	E	-	1	0	USH1C	17501583	1.000000	0.71417	0.973000	0.42090	0.786000	0.44442	6.533000	0.73829	2.684000	0.91462	0.557000	0.71058	GAA	USH1C	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000006611		0.537	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	48	0.00	0	C	NM_005709		17545007	17545007	-1	no_errors	ENST00000005226	ensembl	human	known	69_37n	nonsense	192	15.04	34	SNP	1.000	A
WBP5	51186	genome.wustl.edu	37	X	102612872	102612872	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chrX:102612872T>G	ENST00000372661.3	+	3	571	c.260T>G	c.(259-261)cTt>cGt	p.L87R	WBP5_ENST00000372656.3_Missense_Mutation_p.L87R	NM_001006612.1|NM_016303.2	NP_001006613.1|NP_057387.1	Q9UHQ7	WBP5_HUMAN	WW domain binding protein 5	87										breast(2)|endometrium(2)|large_intestine(2)|ovary(1)|urinary_tract(1)	8						AGAAACAAACTTATAGTGATG	0.333																																						dbGAP											0													104.0	101.0	102.0					X																	102612872		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC023544	CCDS14507.1	Xq22.2	2014-03-21			ENSG00000185222	ENSG00000185222			30084	protein-coding gene	gene with protein product	"""pp21 homolog"""					16221301	Standard	NM_001006612		Approved	DKFZp313K1940, TCEAL9, WEX6	uc004ekg.3	Q9UHQ7	OTTHUMG00000022097	ENST00000372661.3:c.260T>G	X.37:g.102612872T>G	ENSP00000361745:p.Leu87Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5H6	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.L87R	ENST00000372661.3	37	c.260	CCDS14507.1	X	.	.	.	.	.	.	.	.	.	.	T	16.75	3.210257	0.58343	.	.	ENSG00000185222	ENST00000372661;ENST00000372656	T;T	0.14022	2.54;2.54	4.04	4.04	0.47022	.	0.000000	0.35739	N	0.003011	T	0.25082	0.0609	L	0.48642	1.525	0.32681	N	0.51555	D	0.69078	0.997	D	0.65874	0.939	T	0.22521	-1.0214	10	0.87932	D	0	-7.1667	8.4027	0.32597	0.0:0.0:0.0:1.0	.	87	Q9UHQ7	WPB5_HUMAN	R	87	ENSP00000361745:L87R;ENSP00000361740:L87R	ENSP00000361740:L87R	L	+	2	0	WBP5	102499528	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	2.898000	0.48672	1.803000	0.52742	0.481000	0.45027	CTT	WBP5	-	pfam_TF_A-like/BEX-like	ENSG00000185222		0.333	WBP5-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WBP5	HGNC	protein_coding	OTTHUMT00000057706.1	51	0.00	0	T	NM_016303		102612872	102612872	+1	no_errors	ENST00000372656	ensembl	human	known	69_37n	missense	103	20.77	27	SNP	0.996	G
ZNF251	90987	genome.wustl.edu	37	8	145947416	145947416	+	Silent	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr8:145947416G>A	ENST00000292562.7	-	5	1904	c.1629C>T	c.(1627-1629)caC>caT	p.H543H	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	543					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		AGGCTCTGCCGTGCTTCTCTC	0.483																																						dbGAP											0													93.0	97.0	96.0					8																	145947416		2072	4228	6300	-	-	-	SO:0001819	synonymous_variant	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.1629C>T	8.37:g.145947416G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M219	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H543	ENST00000292562.7	37	c.1629	CCDS47944.1	8																																																																																			ZNF251	-	NULL	ENSG00000198169		0.483	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	32	0.00	0	G	NM_138367		145947416	145947416	-1	no_errors	ENST00000292562	ensembl	human	known	69_37n	silent	106	13.82	17	SNP	0.000	A
ZNF507	22847	genome.wustl.edu	37	19	32845865	32845865	+	Splice_Site	SNP	T	T	C			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr19:32845865T>C	ENST00000311921.4	+	2	2319		c.e2+2		ZNF507_ENST00000355898.5_Splice_Site|ZNF507_ENST00000544431.1_Splice_Site	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					CATTATAAGGTAAGCATTGGT	0.403																																						dbGAP											0													70.0	66.0	67.0					19																	32845865		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.2127+2T>C	19.37:g.32845865T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Splice_Site	SNP	-	e1+2	ENST00000311921.4	37	c.2127+2	CCDS32985.1	19	.	.	.	.	.	.	.	.	.	.	T	24.2	4.507400	0.85282	.	.	ENSG00000168813	ENST00000355898;ENST00000311921;ENST00000544431	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4857	0.75564	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF507	37537705	1.000000	0.71417	0.934000	0.37439	0.964000	0.63967	7.698000	0.84413	2.054000	0.61138	0.402000	0.26972	.	ZNF507	-	-	ENSG00000168813		0.403	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF507	HGNC	protein_coding	OTTHUMT00000450301.3	31	0.00	0	T	NM_014910	Intron	32845865	32845865	+1	no_errors	ENST00000311921	ensembl	human	known	69_37n	splice_site	42	34.38	22	SNP	1.000	C
ZNF648	127665	genome.wustl.edu	37	1	182025787	182025787	+	Silent	SNP	G	G	A			TCGA-A2-A1FW-01A-11D-A13L-09	TCGA-A2-A1FW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6ccdb42e-1ad1-4175-b83a-a24b019dc640	c2563fdc-a603-4974-a849-a938ca683f7c	g.chr1:182025787G>A	ENST00000339948.3	-	2	1566	c.1359C>T	c.(1357-1359)tgC>tgT	p.C453C		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						AGGCCACGCCGCAGTCAGCGC	0.672																																					NSCLC(71;908 1374 5429 20458 35642)	dbGAP											0													34.0	32.0	33.0					1																	182025787		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1359C>T	1.37:g.182025787G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP16	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C453	ENST00000339948.3	37	c.1359	CCDS30952.1	1																																																																																			ZNF648	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179930		0.672	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	19	0.00	0	G	XM_060597		182025787	182025787	-1	no_errors	ENST00000339948	ensembl	human	known	69_37n	silent	37	21.28	10	SNP	1.000	A
