#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC2	1244	genome.wustl.edu	37	10	101601847	101601847	+	Silent	SNP	C	C	G			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr10:101601847C>G	ENST00000370449.4	+	26	3851	c.3738C>G	c.(3736-3738)ctC>ctG	p.L1246L		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1246	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CCAATGCACTCAATGTGAGTT	0.413																																						dbGAP											0													231.0	217.0	222.0					10																	101601847		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3738C>G	10.37:g.101601847C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.L1246	ENST00000370449.4	37	c.3738	CCDS7484.1	10																																																																																			ABCC2	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000023839		0.413	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	HGNC	protein_coding	OTTHUMT00000049825.1	117	0.00	0	C	NM_000392		101601847	101601847	+1	no_errors	ENST00000370449	ensembl	human	known	69_37n	silent	275	17.42	58	SNP	0.996	G
ACTR8	93973	genome.wustl.edu	37	3	53908306	53908306	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr3:53908306G>T	ENST00000335754.3	-	8	1097	c.997C>A	c.(997-999)Cag>Aag	p.Q333K	ACTR8_ENST00000482349.1_Missense_Mutation_p.Q222K|ACTR8_ENST00000231909.7_Intron	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	333					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TTTGTTAACTGGCATTCTCTG	0.383																																						dbGAP											0													81.0	81.0	81.0					3																	53908306		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.997C>A	3.37:g.53908306G>T	ENSP00000336842:p.Gln333Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSW7|Q8N566|Q9H663	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like	p.Q333K	ENST00000335754.3	37	c.997	CCDS2875.1	3	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222431	0.58668	.	.	ENSG00000113812	ENST00000335754;ENST00000482349	D;D	0.94280	-3.39;-3.39	5.66	4.78	0.61160	.	0.059004	0.64402	D	0.000001	D	0.91294	0.7255	L	0.56769	1.78	0.80722	D	1	B	0.27166	0.17	B	0.31101	0.124	D	0.88429	0.3034	10	0.34782	T	0.22	-0.2422	13.3251	0.60454	0.0746:0.0:0.9254:0.0	.	333	Q9H981	ARP8_HUMAN	K	333;222	ENSP00000336842:Q333K;ENSP00000419429:Q222K	ENSP00000336842:Q333K	Q	-	1	0	ACTR8	53883346	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.602000	0.82796	2.655000	0.90218	0.637000	0.83480	CAG	ACTR8	-	pfam_Actin-like,smart_Actin-like	ENSG00000113812		0.383	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR8	HGNC	protein_coding	OTTHUMT00000350562.2	44	0.00	0	G	NM_022899		53908306	53908306	-1	no_errors	ENST00000335754	ensembl	human	known	69_37n	missense	95	10.38	11	SNP	1.000	T
ADAMTS3	9508	genome.wustl.edu	37	4	73148964	73148964	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr4:73148964G>T	ENST00000286657.4	-	22	3543	c.3507C>A	c.(3505-3507)ttC>ttA	p.F1169L		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	1169					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGGCTGCAAAGAAGGAAGCAG	0.493																																					NSCLC(168;1941 2048 2918 13048 43078)	dbGAP											0													178.0	159.0	166.0					4																	73148964		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.3507C>A	4.37:g.73148964G>T	ENSP00000286657:p.Phe1169Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U9|Q9BXZ8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.F1169L	ENST00000286657.4	37	c.3507	CCDS3553.1	4	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.973840	0.00452	.	.	ENSG00000156140	ENST00000286657	T	0.59502	0.26	5.78	5.78	0.91487	.	0.926183	0.09057	N	0.854962	T	0.49813	0.1579	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33059	-0.9883	10	0.09590	T	0.72	.	16.4912	0.84201	0.0:0.1394:0.8606:0.0	.	1169	O15072	ATS3_HUMAN	L	1169	ENSP00000286657:F1169L	ENSP00000286657:F1169L	F	-	3	2	ADAMTS3	73367828	0.123000	0.22298	0.110000	0.21437	0.014000	0.08584	0.973000	0.29422	2.733000	0.93635	0.591000	0.81541	TTC	ADAMTS3	-	NULL	ENSG00000156140		0.493	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	HGNC	protein_coding	OTTHUMT00000252164.2	53	0.00	0	G			73148964	73148964	-1	no_errors	ENST00000286657	ensembl	human	known	69_37n	missense	148	11.83	20	SNP	0.105	T
AGPAT4	56895	genome.wustl.edu	37	6	161570318	161570318	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:161570318G>A	ENST00000320285.4	-	6	880	c.668C>T	c.(667-669)tCa>tTa	p.S223L	AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000366911.5_3'UTR|AGPAT4_ENST00000457520.2_Missense_Mutation_p.S61L	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	223					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		ATATACAGCTGAAACTATAAA	0.333																																						dbGAP											0													68.0	63.0	65.0					6																	161570318		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.668C>T	6.37:g.161570318G>A	ENSP00000314036:p.Ser223Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSF9|Q5TEF0	Nonsense_Mutation	SNP	NULL	p.Q2*	ENST00000320285.4	37	c.4	CCDS5280.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.671436|4.671436	0.88348|0.88348	.|.	.|.	ENSG00000026652|ENSG00000026652	ENST00000437165|ENST00000320285;ENST00000457520	.|D	.|0.93426	.|-3.22	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.359442	.|0.29501	.|N	.|0.011978	.|D	.|0.89908	.|0.6851	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|P;P	.|0.47910	.|0.902;0.623	.|B;B	.|0.42188	.|0.342;0.379	.|D	.|0.91640	.|0.5326	.|10	.|0.87932	.|D	.|0	-23.0317|-23.0317	19.1122|19.1122	0.93321|0.93321	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|61;223	.|B4DSF9;Q9NRZ5	.|.;PLCD_HUMAN	X|L	2|223;61	.|ENSP00000314036:S223L	.|ENSP00000314036:S223L	Q|S	-|-	1|2	0|0	AGPAT4|AGPAT4	161490308|161490308	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.397000|7.397000	0.79903|0.79903	2.496000|2.496000	0.84212|0.84212	0.563000|0.563000	0.77884|0.77884	CAG|TCA	AGPAT4	-	NULL	ENSG00000026652		0.333	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT4	HGNC	protein_coding	OTTHUMT00000042983.1	62	0.00	0	G	NM_020133		161570318	161570318	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000437165	ensembl	human	known	69_37n	nonsense	96	19.33	23	SNP	0.999	A
AIFM1	9131	genome.wustl.edu	37	X	129263972	129263972	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chrX:129263972G>C	ENST00000287295.3	-	15	1973	c.1743C>G	c.(1741-1743)atC>atG	p.I581M	AIFM1_ENST00000319908.3_Missense_Mutation_p.I577M|AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000440263.1_Missense_Mutation_p.I229M|AIFM1_ENST00000460436.2_Missense_Mutation_p.I242M|AIFM1_ENST00000346424.2_Missense_Mutation_p.I294M	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	581					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	TTCGGTTAAAGATGTTCCATA	0.507																																						dbGAP											0													173.0	147.0	156.0					X																	129263972		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1743C>G	X.37:g.129263972G>C	ENSP00000287295:p.Ile581Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.I581M	ENST00000287295.3	37	c.1743	CCDS14618.1	X	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509930	0.44660	.	.	ENSG00000156709	ENST00000460436;ENST00000346424;ENST00000319908;ENST00000440263;ENST00000287295	T;T;D;T;T	0.84442	0.79;0.76;-1.85;0.75;-0.86	4.74	4.74	0.60224	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (1);	0.109676	0.64402	D	0.000007	D	0.84875	0.5569	L	0.40543	1.245	0.80722	D	1	P;B;B	0.35242	0.492;0.078;0.089	B;B;B	0.44163	0.443;0.127;0.06	D	0.86468	0.1783	10	0.72032	D	0.01	-2.9117	16.9498	0.86242	0.0:0.0:1.0:0.0	.	294;577;581	O95831-2;O95831-3;O95831	.;.;AIFM1_HUMAN	M	242;294;577;229;581	ENSP00000431222:I242M;ENSP00000316320:I294M;ENSP00000315122:I577M;ENSP00000405879:I229M;ENSP00000287295:I581M	ENSP00000287295:I581M	I	-	3	3	AIFM1	129091653	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.822000	0.62686	2.178000	0.69098	0.600000	0.82982	ATC	AIFM1	-	superfamily_FAD/NAD-linked_Rdtase_dimer	ENSG00000156709		0.507	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	HGNC	protein_coding	OTTHUMT00000058247.2	41	0.00	0	G			129263972	129263972	-1	no_errors	ENST00000287295	ensembl	human	known	69_37n	missense	61	10.29	7	SNP	1.000	C
ARGFX	503582	genome.wustl.edu	37	3	121305394	121305394	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr3:121305394G>C	ENST00000334384.3	+	4	905	c.895G>C	c.(895-897)Gat>Cat	p.D299H		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	299					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		CAGTCTAACAGATAGCCTGGA	0.438																																						dbGAP											0													52.0	57.0	55.0					3																	121305394		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.895G>C	3.37:g.121305394G>C	ENSP00000335578:p.Asp299His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.D299H	ENST00000334384.3	37	c.895	CCDS33834.1	3	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794837	0.31777	.	.	ENSG00000186103	ENST00000334384	D	0.91577	-2.87	3.14	2.25	0.28309	.	0.955061	0.08549	N	0.929370	D	0.89037	0.6601	N	0.24115	0.695	0.09310	N	1	D	0.71674	0.998	P	0.58520	0.84	T	0.78725	-0.2092	10	0.87932	D	0	-0.5435	6.6177	0.22786	0.1347:0.0:0.8653:0.0	.	299	A6NJG6	ARGFX_HUMAN	H	299	ENSP00000335578:D299H	ENSP00000335578:D299H	D	+	1	0	ARGFX	122788084	0.001000	0.12720	0.003000	0.11579	0.011000	0.07611	0.055000	0.14229	0.878000	0.35920	0.561000	0.74099	GAT	ARGFX	-	NULL	ENSG00000186103		0.438	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGFX	HGNC	protein_coding	OTTHUMT00000355096.2	35	0.00	0	G	NM_001012659		121305394	121305394	+1	no_errors	ENST00000334384	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	0.003	C
ASF1A	25842	genome.wustl.edu	37	6	119226836	119226836	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:119226836G>T	ENST00000229595.5	+	3	439	c.245G>T	c.(244-246)gGa>gTa	p.G82V	MCM9_ENST00000316316.6_Intron	NM_014034.2	NP_054753.1	Q9Y294	ASF1A_HUMAN	anti-silencing function 1A histone chaperone	82	Interaction with histone H3, CHAF1B, and HIRA.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|muscle cell differentiation (GO:0042692)|negative regulation of chromatin silencing (GO:0031936)|nucleosome assembly (GO:0006334)|osteoblast differentiation (GO:0001649)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0633)|OV - Ovarian serous cystadenocarcinoma(136;0.188)		CCTAATCCAGGACTCATTCCA	0.383																																						dbGAP											0													192.0	193.0	193.0					6																	119226836		1904	4130	6034	-	-	-	SO:0001583	missense	0			AF279306	CCDS47469.1	6q22.31	2013-05-01	2013-05-01		ENSG00000111875	ENSG00000111875			20995	protein-coding gene	gene with protein product		609189	"""ASF1 anti-silencing function 1 homolog A (S. cerevisiae)"""			10810093, 11042152	Standard	NM_014034		Approved	DKFZP547E2110, CIA	uc011ebn.2	Q9Y294	OTTHUMG00000015470	ENST00000229595.5:c.245G>T	6.37:g.119226836G>T	ENSP00000229595:p.Gly82Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IA08|Q9P014	Missense_Mutation	SNP	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like	p.G82V	ENST00000229595.5	37	c.245	CCDS47469.1	6	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958041	0.53400	.	.	ENSG00000111875	ENST00000229595	.	.	.	6.17	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.42653	0.1212	L	0.34521	1.04	0.80722	D	1	P	0.38551	0.636	P	0.46172	0.506	T	0.51803	-0.8659	9	0.62326	D	0.03	-20.3978	11.9011	0.52685	0.0654:0.1224:0.8122:0.0	.	82	Q9Y294	ASF1A_HUMAN	V	82	.	ENSP00000229595:G82V	G	+	2	0	ASF1A	119268535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.734000	0.62043	1.630000	0.50440	0.655000	0.94253	GGA	ASF1A	-	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like	ENSG00000111875		0.383	ASF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASF1A	HGNC	protein_coding	OTTHUMT00000361910.1	47	0.00	0	G	NM_014034		119226836	119226836	+1	no_errors	ENST00000229595	ensembl	human	known	69_37n	missense	97	11.01	12	SNP	1.000	T
ASH1L	55870	genome.wustl.edu	37	1	155429604	155429604	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:155429604C>G	ENST00000368346.3	-	4	5709	c.5070G>C	c.(5068-5070)gaG>gaC	p.E1690D	ASH1L_ENST00000392403.3_Missense_Mutation_p.E1690D			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1690	Ser-rich.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AAGAAGTACTCTCAGATGAAG	0.413																																						dbGAP											0													81.0	78.0	79.0					1																	155429604		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5070G>C	1.37:g.155429604C>G	ENSP00000357330:p.Glu1690Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.E1690D	ENST00000368346.3	37	c.5070		1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999635	0.54147	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89415	-2.51;-2.51	4.39	1.46	0.22682	.	0.358930	0.26532	N	0.023850	T	0.79707	0.4492	N	0.14661	0.345	0.80722	D	1	P;D	0.56035	0.956;0.974	P;D	0.67725	0.899;0.953	T	0.76019	-0.3112	10	0.26408	T	0.33	.	7.5568	0.27829	0.0:0.6392:0.0:0.3608	.	1690;1690	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	D	1690	ENSP00000357330:E1690D;ENSP00000376204:E1690D	ENSP00000357330:E1690D	E	-	3	2	ASH1L	153696228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.534000	0.23098	0.130000	0.18549	0.591000	0.81541	GAG	ASH1L	-	NULL	ENSG00000116539		0.413	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	66	0.00	0	C	NM_018489		155429604	155429604	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	missense	223	12.20	31	SNP	1.000	G
ASPM	259266	genome.wustl.edu	37	1	197099176	197099176	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:197099176C>T	ENST00000367409.4	-	8	2754	c.2498G>A	c.(2497-2499)gGa>gAa	p.G833E	ASPM_ENST00000367408.1_Missense_Mutation_p.G83E|ASPM_ENST00000294732.7_Missense_Mutation_p.G833E	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	833					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TATGAGTTCTCCATAAGTTGT	0.378																																						dbGAP											0													87.0	85.0	86.0					1																	197099176		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2498G>A	1.37:g.197099176C>T	ENSP00000356379:p.Gly833Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.G833E	ENST00000367409.4	37	c.2498	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983375	0.93044	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.63255	-0.03;-0.03;-0.03	5.52	5.52	0.82312	Calponin homology domain (1);	0.000000	0.64402	D	0.000001	T	0.81903	0.4921	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.97	D	0.83881	0.0279	10	0.87932	D	0	.	19.3912	0.94583	0.0:1.0:0.0:0.0	.	833;833	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	E	833;833;83	ENSP00000356379:G833E;ENSP00000294732:G833E;ENSP00000356378:G83E	ENSP00000294732:G833E	G	-	2	0	ASPM	195365799	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.445000	0.80570	2.744000	0.94065	0.650000	0.86243	GGA	ASPM	-	superfamily_CH-domain	ENSG00000066279		0.378	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	42	0.00	0	C	NM_018136		197099176	197099176	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	missense	114	10.24	13	SNP	1.000	T
ASXL2	55252	genome.wustl.edu	37	2	25978922	25978922	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr2:25978922G>A	ENST00000435504.4	-	10	1294	c.1001C>T	c.(1000-1002)tCa>tTa	p.S334L	ASXL2_ENST00000272341.4_Missense_Mutation_p.S74L|ASXL2_ENST00000404843.1_Missense_Mutation_p.S74L|ASXL2_ENST00000336112.4_Missense_Mutation_p.S306L			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	334					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGGCTGCTGAAGTGAAGAA	0.453																																						dbGAP											0													127.0	125.0	126.0					2																	25978922		1889	4119	6008	-	-	-	SO:0001583	missense	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1001C>T	2.37:g.25978922G>A	ENSP00000391447:p.Ser334Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.S334L	ENST00000435504.4	37	c.1001		2	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614195	0.66672	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.20332	2.08;2.08;2.1;2.1	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.43656	0.1257	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.79108	0.992;0.984	T	0.01537	-1.1330	10	0.32370	T	0.25	-5.207	19.2272	0.93822	0.0:0.0:1.0:0.0	.	74;334	Q76L83-2;Q76L83	.;ASXL2_HUMAN	L	334;306;74;74	ENSP00000391447:S334L;ENSP00000337250:S306L;ENSP00000383920:S74L;ENSP00000272341:S74L	ENSP00000272341:S74L	S	-	2	0	ASXL2	25832426	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.502000	0.66956	2.894000	0.99253	0.655000	0.94253	TCA	ASXL2	-	NULL	ENSG00000143970		0.453	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	33	0.00	0	G	NM_018263		25978922	25978922	-1	no_errors	ENST00000435504	ensembl	human	known	69_37n	missense	65	16.67	13	SNP	1.000	A
ATP2B1	490	genome.wustl.edu	37	12	90010583	90010583	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr12:90010583G>T	ENST00000428670.3	-	12	2519	c.2063C>A	c.(2062-2064)cCt>cAt	p.P688H	ATP2B1_ENST00000348959.3_Missense_Mutation_p.P688H|ATP2B1_ENST00000393164.2_Missense_Mutation_p.P431H|ATP2B1_ENST00000359142.3_Missense_Mutation_p.P688H|ATP2B1_ENST00000261173.2_Missense_Mutation_p.P688H			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	688					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						CACCACCTCAGGTCTCACAGG	0.428																																						dbGAP											0													106.0	101.0	102.0					12																	90010583		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2063C>A	12.37:g.90010583G>T	ENSP00000392043:p.Pro688His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.P688H	ENST00000428670.3	37	c.2063	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930771	0.92389	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4;-4.4	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.99260	0.9742	H	0.98769	4.325	0.80722	D	1	D;P;P	0.89917	1.0;0.809;0.796	D;P;B	0.91635	0.999;0.515;0.434	D	0.98609	1.0662	10	0.87932	D	0	-28.8317	19.8788	0.96888	0.0:0.0:1.0:0.0	.	688;688;688	P20020-3;P20020-2;P20020-6	.;.;.	H	688;688;688;688;431	ENSP00000261173:P688H;ENSP00000343599:P688H;ENSP00000352054:P688H;ENSP00000392043:P688H;ENSP00000376869:P431H	ENSP00000261173:P688H	P	-	2	0	ATP2B1	88534714	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.004000	0.88535	2.708000	0.92522	0.650000	0.86243	CCT	ATP2B1	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA	ENSG00000070961		0.428	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1	51	0.00	0	G	NM_001682		90010583	90010583	-1	no_errors	ENST00000261173	ensembl	human	known	69_37n	missense	103	10.43	12	SNP	1.000	T
B4GALNT4	338707	genome.wustl.edu	37	11	380848	380848	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr11:380848G>T	ENST00000329962.6	+	19	2893	c.2893G>T	c.(2893-2895)Ggc>Tgc	p.G965C		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	965					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAACGGCTTTGGCCTTTTTGG	0.612																																						dbGAP											0													77.0	76.0	77.0					11																	380848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.2893G>T	11.37:g.380848G>T	ENSP00000328277:p.Gly965Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LV2	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_PA14,smart_PA14	p.G965C	ENST00000329962.6	37	c.2893	CCDS7694.1	11	.	.	.	.	.	.	.	.	.	.	g	23.8	4.459351	0.84317	.	.	ENSG00000182272	ENST00000329962	T	0.29917	1.55	3.81	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	M	0.89214	3.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.72792	-0.4186	10	0.87932	D	0	-37.5004	16.2551	0.82510	0.0:0.0:1.0:0.0	.	965	Q76KP1	B4GN4_HUMAN	C	965	ENSP00000328277:G965C	ENSP00000328277:G965C	G	+	1	0	B4GALNT4	370848	1.000000	0.71417	0.994000	0.49952	0.972000	0.66771	9.506000	0.97992	2.118000	0.64928	0.561000	0.74099	GGC	B4GALNT4	-	pfam_Chond_GalNAc	ENSG00000182272		0.612	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT4	HGNC	protein_coding	OTTHUMT00000239289.2	36	0.00	0	G	NM_178537		380848	380848	+1	no_errors	ENST00000329962	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	1.000	T
BRD8	10902	genome.wustl.edu	37	5	137503631	137503631	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr5:137503631G>T	ENST00000254900.5	-	9	1150	c.779C>A	c.(778-780)gCt>gAt	p.A260D	BRD8_ENST00000515014.1_5'Flank|BRD8_ENST00000455658.2_Missense_Mutation_p.A219D|BRD8_ENST00000411594.2_Missense_Mutation_p.A333D|BRD8_ENST00000230901.5_Missense_Mutation_p.A333D|BRD8_ENST00000402931.1_Missense_Mutation_p.A260D	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	260					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACCTGATGCAGCAGGGGAGGC	0.488																																						dbGAP											0													95.0	89.0	91.0					5																	137503631		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.779C>A	5.37:g.137503631G>T	ENSP00000254900:p.Ala260Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,superfamily_Peptidase_M20_dimer,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.A260D	ENST00000254900.5	37	c.779	CCDS4198.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.39|16.39	3.109111|3.109111	0.56398|0.56398	.|.	.|.	ENSG00000112983|ENSG00000112983	ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000453824|ENST00000441656	T;T;T;T;T;T;T|.	0.35973|.	1.71;1.43;1.29;1.35;1.48;1.28;1.48|.	5.27|5.27	4.4|4.4	0.53042|0.53042	.|.	0.221302|.	0.46145|.	D|.	0.000312|.	T|T	0.47154|0.47154	0.1430|0.1430	N|N	0.17082|0.17082	0.46|0.46	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.998;0.999;1.0;0.999;1.0|.	D;D;D;D;D;D;D;D|.	0.91635|.	0.999;0.998;0.998;0.994;0.991;0.999;0.997;0.998|.	T|T	0.39603|0.39603	-0.9606|-0.9606	10|5	0.40728|.	T|.	0.16|.	-6.8788|-6.8788	13.1842|13.1842	0.59672|0.59672	0.0764:0.0:0.9236:0.0|0.0764:0.0:0.9236:0.0	.|.	219;244;219;333;333;193;333;260|.	F8W820;B4DN43;B4DEG9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9|.	.;.;.;.;.;.;.;BRD8_HUMAN|.	D|M	260;328;328;333;260;333;193;219;148|324	ENSP00000254900:A260D;ENSP00000398067:A328D;ENSP00000398873:A328D;ENSP00000230901:A333D;ENSP00000384845:A260D;ENSP00000394330:A333D;ENSP00000408396:A219D|.	ENSP00000230901:A333D|.	A|L	-|-	2|1	0|2	BRD8|BRD8	137531530|137531530	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	4.898000|4.898000	0.63238|0.63238	1.460000|1.460000	0.47911|0.47911	0.491000|0.491000	0.48974|0.48974	GCT|CTG	BRD8	-	NULL	ENSG00000112983		0.488	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	32	0.00	0	G	NM_006696		137503631	137503631	-1	no_errors	ENST00000254900	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	T
C10orf76	79591	genome.wustl.edu	37	10	103771512	103771512	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr10:103771512G>T	ENST00000370033.4	-	11	918	c.799C>A	c.(799-801)Caa>Aaa	p.Q267K		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	267						integral component of membrane (GO:0016021)		p.Q267K(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AAACCACTTTGGTGTTCTTCT	0.343																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											125.0	124.0	124.0					10																	103771512		1823	4079	5902	-	-	-	SO:0001583	missense	0			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.799C>A	10.37:g.103771512G>T	ENSP00000359050:p.Gln267Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	pfam_DUF1741,superfamily_ARM-type_fold	p.Q267K	ENST00000370033.4	37	c.799	CCDS41563.1	10	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258640	0.59321	.	.	ENSG00000120029	ENST00000370033	T	0.65364	-0.15	6.17	6.17	0.99709	.	0.051755	0.85682	D	0.000000	T	0.56202	0.1969	L	0.46157	1.445	0.80722	D	1	B	0.26258	0.145	B	0.24974	0.057	T	0.54456	-0.8291	10	0.06494	T	0.89	-12.8406	20.8794	0.99867	0.0:0.0:1.0:0.0	.	267	Q5T2E6	CJ076_HUMAN	K	267	ENSP00000359050:Q267K	ENSP00000359050:Q267K	Q	-	1	0	C10orf76	103761502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.097000	0.89539	2.941000	0.99782	0.655000	0.94253	CAA	C10orf76	-	superfamily_ARM-type_fold	ENSG00000120029		0.343	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf76	HGNC	protein_coding	OTTHUMT00000050007.1	90	0.00	0	G	NM_024541		103771512	103771512	-1	no_errors	ENST00000370033	ensembl	human	known	69_37n	missense	114	21.38	31	SNP	1.000	T
C9orf50	375759	genome.wustl.edu	37	9	132381848	132381848	+	Missense_Mutation	SNP	G	G	T	rs76476617	byFrequency	TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr9:132381848G>T	ENST00000372478.4	-	3	868	c.667C>A	c.(667-669)Ccc>Acc	p.P223T	NTMT1_ENST00000372486.1_Intron	NM_199350.3	NP_955382.3	Q5SZB4	CI050_HUMAN	chromosome 9 open reading frame 50	223										central_nervous_system(1)|endometrium(4)|large_intestine(2)|ovary(1)|skin(1)|urinary_tract(1)	10		Ovarian(14;0.00556)				CCCTTCAGGGGCCCCAGAATA	0.527																																						dbGAP											0													103.0	101.0	102.0					9																	132381848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093122	CCDS35159.1	9q34.2	2012-03-15			ENSG00000179058	ENSG00000179058			23677	protein-coding gene	gene with protein product							Standard	NM_199350		Approved	FLJ35803	uc004byc.4	Q5SZB4	OTTHUMG00000020786	ENST00000372478.4:c.667C>A	9.37:g.132381848G>T	ENSP00000361556:p.Pro223Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1I2|Q8NA65	Missense_Mutation	SNP	NULL	p.P223T	ENST00000372478.4	37	c.667	CCDS35159.1	9	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.960005	0.00465	.	.	ENSG00000179058	ENST00000372478	T	0.16897	2.31	3.34	-2.92	0.05615	.	1.050780	0.07558	N	0.916519	T	0.05044	0.0135	N	0.04508	-0.205	0.09310	N	1	B	0.23650	0.089	B	0.20184	0.028	T	0.35475	-0.9787	10	0.02654	T	1	-0.9406	3.6831	0.08317	0.4706:0.0:0.324:0.2054	.	223	Q5SZB4	CI050_HUMAN	T	223	ENSP00000361556:P223T	ENSP00000361556:P223T	P	-	1	0	C9orf50	131421669	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.956000	0.03865	-0.641000	0.05487	-0.455000	0.05494	CCC	C9orf50	-	NULL	ENSG00000179058		0.527	C9orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf50	HGNC	protein_coding	OTTHUMT00000054593.1	65	0.00	0	G	NM_199350		132381848	132381848	-1	no_errors	ENST00000372478	ensembl	human	known	69_37n	missense	115	10.16	13	SNP	0.000	T
ARRDC1-AS1	85026	genome.wustl.edu	37	9	140510463	140510463	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr9:140510463C>T	ENST00000371417.3	-	3	729	c.189G>A	c.(187-189)tgG>tgA	p.W63*	EHMT1_ENST00000460843.1_5'Flank|EHMT1_ENST00000462484.1_5'Flank|EHMT1_ENST00000334856.6_5'Flank|C9orf37_ENST00000496793.1_5'UTR	NM_032937.4	NP_116326.2	Q9H2J1	CI037_HUMAN		63										breast(1)|large_intestine(2)	3	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		GGTTCAAATTCCAGTTCTCCT	0.577																																						dbGAP											0													97.0	97.0	97.0					9																	140510463		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000371417.3:c.189G>A	9.37:g.140510463C>T	ENSP00000360471:p.Trp63*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RM5|Q5T368	Nonsense_Mutation	SNP	NULL	p.W63*	ENST00000371417.3	37	c.189	CCDS35189.1	9	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914121	0.92178	.	.	ENSG00000203993	ENST00000371417	.	.	.	2.06	0.145	0.14829	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.0572	0.09823	0.0:0.6111:0.0:0.3889	.	.	.	.	X	63	.	ENSP00000360471:W63X	W	-	3	0	C9orf37	139630284	0.078000	0.21339	0.527000	0.27925	0.127000	0.20565	0.073000	0.14640	0.033000	0.15463	0.456000	0.33151	TGG	C9orf37	-	NULL	ENSG00000203993		0.577	C9orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf37	HGNC	protein_coding	OTTHUMT00000055328.1	46	0.00	0	C			140510463	140510463	-1	no_errors	ENST00000371417	ensembl	human	known	69_37n	nonsense	90	12.62	13	SNP	0.268	T
CCAR1	55749	genome.wustl.edu	37	10	70520826	70520826	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr10:70520826G>T	ENST00000265872.6	+	16	2102	c.1983G>T	c.(1981-1983)caG>caT	p.Q661H	CCAR1_ENST00000543719.1_Missense_Mutation_p.Q646H|CCAR1_ENST00000535016.1_Missense_Mutation_p.Q646H|MIR1254-1_ENST00000408257.1_RNA	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	661	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TAAAATCCCAGTTAATAGCCC	0.353																																						dbGAP											0													70.0	73.0	72.0					10																	70520826		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1983G>T	10.37:g.70520826G>T	ENSP00000265872:p.Gln661His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	pfam_SAP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.Q661H	ENST00000265872.6	37	c.1983	CCDS7282.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.51|15.51	2.854631|2.854631	0.51376|0.51376	.|.	.|.	ENSG00000060339|ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012|ENST00000543706	T;T;T;T;T;T|.	0.29917|.	1.55;1.72;1.72;1.72;1.77;1.75|.	5.43|5.43	4.53|4.53	0.55603|0.55603	DNA-binding SAP (4);|.	0.060025|.	0.64402|.	D|.	0.000002|.	T|T	0.64757|0.64757	0.2627|0.2627	M|M	0.66939|0.66939	2.045|2.045	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.71674|.	0.988;0.996;0.998|.	D;D;D|.	0.81914|.	0.984;0.995;0.955|.	T|T	0.63730|0.63730	-0.6571|-0.6571	10|5	0.72032|.	D|.	0.01|.	-8.4663|-8.4663	10.399|10.399	0.44218|0.44218	0.1489:0.0:0.8511:0.0|0.1489:0.0:0.8511:0.0	.|.	646;661;635|.	Q8IX12-2;Q8IX12;F5H2E6|.	.;CCAR1_HUMAN;.|.	H|F	661;646;646;646;635;466|31	ENSP00000265872:Q661H;ENSP00000441820:Q646H;ENSP00000445254:Q646H;ENSP00000439252:Q646H;ENSP00000438610:Q635H;ENSP00000439642:Q466H|.	ENSP00000265872:Q661H|.	Q|V	+|+	3|1	2|0	CCAR1|CCAR1	70190832|70190832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	4.424000|4.424000	0.59868|0.59868	1.299000|1.299000	0.44798|0.44798	0.655000|0.655000	0.94253|0.94253	CAG|GTT	CCAR1	-	pfam_SAP_DNA-bd,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	ENSG00000060339		0.353	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	45	0.00	0	G	NM_018237		70520826	70520826	+1	no_errors	ENST00000265872	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	1.000	T
CCL14	6358	genome.wustl.edu	37	17	34312816	34312816	+	Intron	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:34312816G>T	ENST00000394509.4	-	1	188				CCL14_ENST00000536149.1_Missense_Mutation_p.P32Q|CCL14_ENST00000435911.2_Missense_Mutation_p.P32Q|CTB-186H2.3_ENST00000591669.1_Intron|CCL15-CCL14_ENST00000481427.2_Intron|CTB-186H2.3_ENST00000593057.1_Intron|CCL14_ENST00000586216.1_Intron|CCL14_ENST00000480944.2_5'UTR			Q16627	CCL14_HUMAN	chemokine (C-C motif) ligand 14						cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|immune response (GO:0006955)|positive regulation of cell proliferation (GO:0008284)	extracellular space (GO:0005615)				large_intestine(1)|lung(6)	7		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AACAACCTTCGGTTTCCCCCC	0.423																																						dbGAP											0													171.0	151.0	157.0					17																	34312816		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			Z49270	CCDS32624.1, CCDS45652.1	17q11.2	2014-04-10	2002-08-22	2002-08-23	ENSG00000213494	ENSG00000276409		"""Chemokine ligands"", ""Endogenous ligands"""	10612	protein-coding gene	gene with protein product		601392	"""small inducible cytokine subfamily A (Cys-Cys), member 14"""	SCYA14		8661057	Standard	NM_032963		Approved	HCC-1, HCC-3, NCC-2, SCYL2, CKb1, MCIF	uc010wcq.1	Q16627	OTTHUMG00000188403	ENST00000394509.4:c.79+790C>A	17.37:g.34312816G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P649|E1P650|Q13954	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.P32Q	ENST00000394509.4	37	c.95	CCDS32624.1	17	.	.	.	.	.	.	.	.	.	.	T	6.662	0.490639	0.12702	.	.	ENSG00000213494	ENST00000536149;ENST00000435911	T;T	0.03468	3.92;3.92	3.39	-0.605	0.11623	.	.	.	.	.	T	0.01489	0.0048	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47407	-0.9120	8	0.06236	T	0.91	.	4.1753	0.10349	0.0:0.3967:0.1888:0.4145	.	32	Q16627-2	.	Q	32	ENSP00000441771:P32Q;ENSP00000409197:P32Q	ENSP00000409197:P32Q	P	-	2	0	CCL14	31336929	0.000000	0.05858	0.000000	0.03702	0.280000	0.26924	0.112000	0.15479	-0.440000	0.07211	-0.362000	0.07510	CCG	CCL14	-	NULL	ENSG00000213494		0.423	CCL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL14	HGNC	protein_coding	OTTHUMT00000272892.2	74	0.00	0	G	NM_032962		34312816	34312816	-1	no_errors	ENST00000435911	ensembl	human	known	69_37n	missense	119	15.00	21	SNP	0.000	T
CDC40	51362	genome.wustl.edu	37	6	110534290	110534290	+	Splice_Site	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:110534290G>T	ENST00000368932.1	+	9	970	c.869G>T	c.(868-870)gGc>gTc	p.G290V	CDC40_ENST00000368930.1_Splice_Site_p.G290V|CDC40_ENST00000307731.1_Splice_Site_p.G290V			O60508	PRP17_HUMAN	cell division cycle 40	290					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TTTTTATAGGGCGTCAGTGCA	0.378																																						dbGAP											0													197.0	173.0	181.0					6																	110534290		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.868-1G>T	6.37:g.110534290G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G290V	ENST00000368932.1	37	c.869	CCDS5081.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241744	0.79912	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.8	4.91	0.64330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047815	0.85682	D	0.000000	T	0.64461	0.2600	L	0.51914	1.62	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.69957	-0.5004	10	0.66056	D	0.02	-15.0156	16.6781	0.85284	0.0:0.1298:0.8702:0.0	.	290	O60508	PRP17_HUMAN	V	290	ENSP00000357928:G290V;ENSP00000357929:G290V;ENSP00000357926:G290V;ENSP00000304370:G290V	ENSP00000304370:G290V	G	+	2	0	CDC40	110640983	1.000000	0.71417	0.852000	0.33557	0.952000	0.60782	9.042000	0.93793	1.410000	0.46936	0.563000	0.77884	GGC	CDC40	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000168438		0.378	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC40	HGNC	protein_coding	OTTHUMT00000041791.1	99	0.00	0	G	NM_015891	Missense_Mutation	110534290	110534290	+1	no_errors	ENST00000307731	ensembl	human	known	69_37n	missense	151	16.11	29	SNP	0.998	T
CDC42BPA	8476	genome.wustl.edu	37	1	227288919	227288919	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:227288919G>T	ENST00000366769.3	-	15	3314	c.2023C>A	c.(2023-2025)Cca>Aca	p.P675T	CDC42BPA_ENST00000366767.3_Missense_Mutation_p.P594T|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.P675T|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.P675T|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.P675T	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.P675T(2)|p.P594T(1)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CATACTCCTGGTGAGTAACTA	0.259																																						dbGAP											3	Substitution - Missense(3)	endometrium(3)											66.0	67.0	66.0					1																	227288919		2199	4293	6492	-	-	-	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2023C>A	1.37:g.227288919G>T	ENSP00000355731:p.Pro675Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.P675T	ENST00000366769.3	37	c.2023	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	g	10.09	1.254280	0.22965	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.64803	-0.1;-0.1;-0.1;-0.11;-0.12;-0.09;-0.08	5.57	5.57	0.84162	.	0.211271	0.49916	D	0.000132	T	0.59321	0.2185	L	0.55481	1.735	0.42055	D	0.991132	B;B;B;B	0.15473	0.01;0.001;0.004;0.013	B;B;B;B	0.15484	0.007;0.003;0.013;0.008	T	0.55464	-0.8137	10	0.16896	T	0.51	.	19.5667	0.95397	0.0:0.0:1.0:0.0	.	675;675;594;675	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	T	675;594;675;675;675;675;675	ENSP00000355731:P675T;ENSP00000355729:P594T;ENSP00000335341:P675T;ENSP00000355728:P675T;ENSP00000355726:P675T;ENSP00000443275:P675T;ENSP00000355727:P675T	ENSP00000335341:P675T	P	-	1	0	CDC42BPA	225355542	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.439000	0.44846	2.604000	0.88044	0.645000	0.84053	CCA	CDC42BPA	-	NULL	ENSG00000143776		0.259	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	76	0.00	0	G	NM_014826		227288919	227288919	-1	no_errors	ENST00000334218	ensembl	human	known	69_37n	missense	162	14.74	28	SNP	1.000	T
CDH1	999	genome.wustl.edu	37	16	68862107	68862107	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr16:68862107G>A	ENST00000261769.5	+	14	2386	c.2195G>A	c.(2194-2196)cGg>cAg	p.R732Q	CDH1_ENST00000422392.2_Missense_Mutation_p.R671Q|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	732		Cleavage; by gamma-secretase/PS1.			adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.R732Q(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTGTTTCTTCGGAGGAGAGCG	0.527			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	1	Substitution - Missense(1)	endometrium(1)	GRCh37	CM041747	CDH1	M							118.0	108.0	112.0					16																	68862107		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2195G>A	16.37:g.68862107G>A	ENSP00000261769:p.Arg732Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R732Q	ENST00000261769.5	37	c.2195	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.631160	0.96682	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000422392	T;T	0.58940	0.31;0.3	6.07	6.07	0.98685	.	0.000000	0.44285	D	0.000461	T	0.76821	0.4041	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.989;0.991	T	0.74526	-0.3636	10	0.48119	T	0.1	.	20.2544	0.98414	0.0:0.0:1.0:0.0	.	671;732	Q9UII8;P12830	.;CADH1_HUMAN	Q	732;750;671	ENSP00000261769:R732Q;ENSP00000414946:R671Q	ENSP00000261769:R732Q	R	+	2	0	CDH1	67419608	0.984000	0.35163	0.995000	0.50966	0.950000	0.60333	1.907000	0.39897	2.885000	0.99019	0.655000	0.94253	CGG	CDH1	-	NULL	ENSG00000039068		0.527	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	98	0.00	0	G	NM_004360		68862107	68862107	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	missense	151	20.11	38	SNP	1.000	A
CDK5RAP2	55755	genome.wustl.edu	37	9	123171418	123171418	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr9:123171418G>T	ENST00000349780.4	-	30	4770	c.4591C>A	c.(4591-4593)Cag>Aag	p.Q1531K	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.Q1499K|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.Q1531K|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.Q1490K	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1531					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CTCAGCTCCTGGCCGCTGCAG	0.607																																						dbGAP											0													151.0	115.0	127.0					9																	123171418		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.4591C>A	9.37:g.123171418G>T	ENSP00000343818:p.Gln1531Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.Q1531K	ENST00000349780.4	37	c.4591	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	G	6.687	0.495454	0.12762	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T;T	0.81163	1.53;1.53;1.53;1.53;-1.46;-1.46	5.2	-0.39	0.12450	.	2.645450	0.01397	N	0.013446	T	0.75510	0.3859	L	0.36672	1.1	0.09310	N	1	B;B;B;P;B;B	0.38827	0.241;0.029;0.016;0.649;0.038;0.372	B;B;B;B;B;B	0.36567	0.085;0.016;0.01;0.228;0.007;0.121	T	0.64495	-0.6394	10	0.33940	T	0.23	.	14.7038	0.69174	0.0:0.0:0.6115:0.3885	.	541;1300;1499;1531;1531;925	Q5JTU8;Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;.;CK5P2_HUMAN;.	K	1499;1490;1531;1531;925;541;1303	ENSP00000354065:Q1499K;ENSP00000352258:Q1490K;ENSP00000343818:Q1531K;ENSP00000353317:Q1531K;ENSP00000400395:Q925K;ENSP00000409941:Q541K	ENSP00000341695:Q1303K	Q	-	1	0	CDK5RAP2	122211239	0.000000	0.05858	0.017000	0.16124	0.295000	0.27426	0.005000	0.13129	0.051000	0.15978	0.467000	0.42956	CAG	CDK5RAP2	-	NULL	ENSG00000136861		0.607	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	69	0.00	0	G	NM_018249		123171418	123171418	-1	no_errors	ENST00000349780	ensembl	human	known	69_37n	missense	116	10.08	13	SNP	0.003	T
CHEK2	11200	genome.wustl.edu	37	22	29095912	29095912	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr22:29095912C>G	ENST00000405598.1	-	10	1113	c.922G>C	c.(922-924)Gag>Cag	p.E308Q	CHEK2_ENST00000403642.1_Missense_Mutation_p.E217Q|CHEK2_ENST00000402731.1_Missense_Mutation_p.E308Q|CHEK2_ENST00000348295.3_Missense_Mutation_p.E308Q|CHEK2_ENST00000382578.1_Missense_Mutation_p.E217Q|CHEK2_ENST00000328354.6_Missense_Mutation_p.E308Q|CHEK2_ENST00000544772.1_Missense_Mutation_p.E87Q|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000382566.1_Missense_Mutation_p.R287T|CHEK2_ENST00000404276.1_Missense_Mutation_p.E308Q|CHEK2_ENST00000382580.2_Missense_Mutation_p.E351Q|CHEK2_ENST00000464581.1_5'UTR			O96017	CHK2_HUMAN	checkpoint kinase 2	308	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						TCAAACAGCTCTCCCCCTTCC	0.453			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																														dbGAP	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	0													181.0	178.0	179.0					22																	29095912		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.922G>C	22.37:g.29095912C>G	ENSP00000386087:p.Glu308Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_FHA_dom,superfamily_Kinase-like_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FHA_dom,pfscan_Prot_kinase_cat_dom	p.E351Q	ENST00000405598.1	37	c.1051	CCDS13843.1	22	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	28.5|28.5|28.5	4.923915|4.923915|4.923915	0.92319|0.92319|0.92319	.|.|.	.|.|.	ENSG00000183765|ENSG00000183765|ENSG00000183765	ENST00000434810;ENST00000456369|ENST00000348295;ENST00000382578;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731;ENST00000447421;ENST00000425190|ENST00000382566	.|T;T;T;T;T;T;T;T;T;T;T|D	.|0.52295|0.94613	.|0.98;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.98;0.67;1.73|-3.47	5.67|5.67|5.67	5.67|5.67|5.67	0.87782|0.87782|0.87782	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|0.000000|.	0.85682|0.85682|.	D|D|.	0.000000|0.000000|.	D|D|D	0.95714|0.95714|0.95714	0.8606|0.8606|0.8606	L|L|L	0.53617|0.53617|0.53617	1.68|1.68|1.68	0.34389|0.34389|0.34389	D|D|D	0.693962|0.693962|0.693962	.|D;D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D;D|.	.|0.97110|.	.|0.997;0.999;0.997;1.0;0.999;0.998;0.995|.	D|D|D	0.98951|0.98951|0.98951	1.0794|1.0794|1.0794	6|10|7	.|0.87932|0.72032	.|D|D	.|0|0.01	0.014|0.014|0.014	18.7461|18.7461|18.7461	0.91794|0.91794|0.91794	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|308;217;87;308;308;308;351|.	.|O96017-7;O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9|.	.|.;.;.;.;.;CHK2_HUMAN;.|.	D|Q|T	51;59|308;217;87;308;308;308;351;217;308;241;87|287	.|ENSP00000329012:E308Q;ENSP00000372021:E217Q;ENSP00000442458:E87Q;ENSP00000329178:E308Q;ENSP00000385747:E308Q;ENSP00000386087:E308Q;ENSP00000372023:E351Q;ENSP00000384919:E217Q;ENSP00000384835:E308Q;ENSP00000397478:E241Q;ENSP00000390244:E87Q|ENSP00000372007:R287T	.|ENSP00000329178:E308Q|ENSP00000372007:R287T	E|E|R	-|-|-	3|1|2	2|0|0	CHEK2|CHEK2|CHEK2	27425912|27425912|27425912	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.923000|0.923000|0.923000	0.55619|0.55619|0.55619	6.589000|6.589000|6.589000	0.74080|0.74080|0.74080	2.675000|2.675000|2.675000	0.91044|0.91044|0.91044	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAG|GAG|AGA	CHEK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000183765		0.453	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHEK2	HGNC	protein_coding	OTTHUMT00000321150.1	75	0.00	0	C	NM_001005735		29095912	29095912	-1	no_errors	ENST00000382580	ensembl	human	known	69_37n	missense	120	13.04	18	SNP	1.000	G
CYP26A1	1592	genome.wustl.edu	37	10	94836960	94836960	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr10:94836960T>A	ENST00000224356.4	+	7	1438	c.1393T>A	c.(1393-1395)Tgg>Agg	p.W465R	CYP26A1_ENST00000394139.1_Missense_Mutation_p.W396R|CYP26A1_ENST00000371531.1_Missense_Mutation_p.W396R	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	465					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	GCATTGTGACTGGCAGCTTCT	0.458																																						dbGAP											0													43.0	44.0	44.0					10																	94836960		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.1393T>A	10.37:g.94836960T>A	ENSP00000224356:p.Trp465Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.W465R	ENST00000224356.4	37	c.1393	CCDS7426.1	10	.	.	.	.	.	.	.	.	.	.	T	19.84	3.902761	0.72754	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.69806	-0.43;-0.43;-0.43	5.49	5.49	0.81192	.	0.062767	0.64402	D	0.000001	D	0.85414	0.5691	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88773	0.3265	10	0.87932	D	0	-15.3298	15.7597	0.78070	0.0:0.0:0.0:1.0	.	396;465	B3KNI4;O43174	.;CP26A_HUMAN	R	396;465;396	ENSP00000360586:W396R;ENSP00000224356:W465R;ENSP00000377695:W396R	ENSP00000224356:W465R	W	+	1	0	CYP26A1	94826950	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.868000	0.87116	2.304000	0.77564	0.528000	0.53228	TGG	CYP26A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000095596		0.458	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP26A1	HGNC	protein_coding	OTTHUMT00000049408.3	20	0.00	0	T			94836960	94836960	+1	no_errors	ENST00000224356	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	A
DCDC2	51473	genome.wustl.edu	37	6	24174967	24174967	+	Silent	SNP	G	G	T	rs146868469	byFrequency	TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:24174967G>T	ENST00000378454.3	-	10	1723	c.1422C>A	c.(1420-1422)gcC>gcA	p.A474A	DCDC2_ENST00000378450.3_Silent_p.A227A	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	474					cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TCTAAGCCACGGCAGCATAGT	0.363																																						dbGAP											0													169.0	140.0	150.0					6																	24174967		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.1422C>A	6.37:g.24174967G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Silent	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.A474	ENST00000378454.3	37	c.1422	CCDS4550.1	6																																																																																			DCDC2	-	NULL	ENSG00000146038		0.363	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC2	HGNC	protein_coding	OTTHUMT00000043604.1	114	0.00	0	G	NM_016356		24174967	24174967	-1	no_errors	ENST00000378454	ensembl	human	known	69_37n	silent	268	10.96	33	SNP	0.001	T
DMPK	1760	genome.wustl.edu	37	19	46283223	46283223	+	Intron	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:46283223C>T	ENST00000291270.4	-	2	286				AC011530.4_ENST00000593999.1_Intron|DMPK_ENST00000354227.5_Intron|DMPK_ENST00000595361.1_5'Flank|DMPK_ENST00000458663.2_Intron|DMPK_ENST00000447742.2_Intron|DMPK_ENST00000343373.4_Missense_Mutation_p.R32K|DMPK_ENST00000600757.1_Missense_Mutation_p.R32K	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase						cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		CCCCTTCTCTCTGCCTCTCAG	0.597																																					Esophageal Squamous(35;307 869 9153 24033 28903)	dbGAP											0													76.0	87.0	83.0					19																	46283223		1323	2309	3632	-	-	-	SO:0001627	intron_variant	0			L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.161-96G>A	19.37:g.46283223C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E5KR08|Q16205|Q6P5Z6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.R32K	ENST00000291270.4	37	c.95	CCDS12674.1	19	.	.	.	.	.	.	.	.	.	.	C	14.10	2.433810	0.43224	.	.	ENSG00000104936	ENST00000343373;ENST00000348168	T	0.64618	-0.11	3.77	0.143	0.14820	.	.	.	.	.	T	0.38612	0.1047	N	0.14661	0.345	0.09310	N	0.999996	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.19386	-1.0307	8	.	.	.	.	6.8677	0.24102	0.0:0.6625:0.226:0.1115	.	32;69;32	B7Z9B5;Q59FU6;E5KR08	.;.;.	K	32	ENSP00000345997:R32K	.	R	-	2	0	DMPK	50975063	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-0.070000	0.11523	0.031000	0.15407	0.650000	0.86243	AGA	DMPK	-	NULL	ENSG00000104936		0.597	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DMPK	HGNC	protein_coding	OTTHUMT00000460572.1	64	0.00	0	C	NM_004409		46283223	46283223	-1	no_errors	ENST00000343373	ensembl	human	known	69_37n	missense	64	21.95	18	SNP	0.000	T
DNAH10	196385	genome.wustl.edu	37	12	124298415	124298415	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr12:124298415G>T	ENST00000409039.3	+	20	3407	c.3382G>T	c.(3382-3384)Gac>Tac	p.D1128Y		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1128	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CAGATATAGGGACGTCCAGGA	0.393																																						dbGAP											0													77.0	74.0	75.0					12																	124298415		1979	4187	6166	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3382G>T	12.37:g.124298415G>T	ENSP00000386770:p.Asp1128Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.D1128Y	ENST00000409039.3	37	c.3382	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945009	0.73672	.	.	ENSG00000197653	ENST00000409039	T	0.22539	1.95	5.72	5.72	0.89469	.	.	.	.	.	T	0.50411	0.1614	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	P	0.61940	0.896	T	0.54214	-0.8327	9	0.72032	D	0.01	.	19.8751	0.96867	0.0:0.0:1.0:0.0	.	1128	Q8IVF4	DYH10_HUMAN	Y	1128	ENSP00000386770:D1128Y	ENSP00000386770:D1128Y	D	+	1	0	DNAH10	122864368	1.000000	0.71417	0.980000	0.43619	0.320000	0.28249	9.609000	0.98334	2.695000	0.91970	0.655000	0.94253	GAC	DNAH10	-	NULL	ENSG00000197653		0.393	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	62	0.00	0	G			124298415	124298415	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	95	15.93	18	SNP	1.000	T
DNHD1	144132	genome.wustl.edu	37	11	6570103	6570103	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr11:6570103C>T	ENST00000527990.2	+	22	7327	c.7327C>T	c.(7327-7329)Cac>Tac	p.H2443Y	DNHD1_ENST00000254579.6_Missense_Mutation_p.H2443Y			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2443					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GCCTGGGCATCACCAGGATTC	0.582																																						dbGAP											0													48.0	45.0	46.0					11																	6570103		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.7327C>T	11.37:g.6570103C>T	ENSP00000436180:p.His2443Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.H2443Y	ENST00000527990.2	37	c.7327	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298029	0.40694	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.28666	1.6;1.6	6.07	3.12	0.35913	.	.	.	.	.	T	0.14570	0.0352	N	0.14661	0.345	0.09310	N	1	B	0.22146	0.065	B	0.15870	0.014	T	0.30475	-0.9977	9	0.10377	T	0.69	.	6.5688	0.22527	0.1447:0.7039:0.0:0.1514	.	2443	Q96M86	DNHD1_HUMAN	Y	2443	ENSP00000254579:H2443Y;ENSP00000436180:H2443Y	ENSP00000254579:H2443Y	H	+	1	0	DNHD1	6526679	0.000000	0.05858	0.001000	0.08648	0.607000	0.37147	-0.096000	0.11059	0.900000	0.36469	0.655000	0.94253	CAC	DNHD1	-	NULL	ENSG00000179532		0.582	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	30	0.00	0	C	NM_144666		6570103	6570103	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	0.001	T
DNMBP	23268	genome.wustl.edu	37	10	101637038	101637038	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr10:101637038G>T	ENST00000324109.4	-	17	4695	c.4604C>A	c.(4603-4605)tCa>tAa	p.S1535*	DNMBP_ENST00000540316.1_Nonsense_Mutation_p.S471*|DNMBP_ENST00000342239.3_Nonsense_Mutation_p.S1559*|DNMBP_ENST00000543621.1_Nonsense_Mutation_p.S781*	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1535	SH3 6. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1535*(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CTGATTGGCTGACACGCTCAG	0.473																																						dbGAP											1	Substitution - Nonsense(1)	endometrium(1)											204.0	190.0	195.0					10																	101637038		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.4604C>A	10.37:g.101637038G>T	ENSP00000315659:p.Ser1535*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVY3|Q9Y2L3	Nonsense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,prints_p67phox,prints_Spectrin_alpha_SH3,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.S1559*	ENST00000324109.4	37	c.4676	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	G	39	7.901302	0.98551	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	.	.	.	5.38	3.48	0.39840	.	0.179826	0.27202	N	0.020456	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0212	11.3289	0.49465	0.1512:0.0:0.8488:0.0	.	.	.	.	X	1559;1535;781;781;471	.	ENSP00000315659:S1535X	S	-	2	0	DNMBP	101627028	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	3.620000	0.54203	1.237000	0.43756	0.561000	0.74099	TCA	DNMBP	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000107554		0.473	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	70	0.00	0	G	NM_015221		101637038	101637038	-1	no_errors	ENST00000342239	ensembl	human	known	69_37n	nonsense	207	11.54	27	SNP	1.000	T
DOCK3	1795	genome.wustl.edu	37	3	51417596	51417596	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr3:51417596G>T	ENST00000266037.9	+	52	5564	c.5541G>T	c.(5539-5541)ctG>ctT	p.L1847L		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1847					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ACCACCCTCTGGGTGATACCC	0.602																																						dbGAP											0													86.0	88.0	87.0					3																	51417596		1915	4126	6041	-	-	-	SO:0001819	synonymous_variant	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5541G>T	3.37:g.51417596G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15017	Silent	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.L1847	ENST00000266037.9	37	c.5541	CCDS46835.1	3																																																																																			DOCK3	-	NULL	ENSG00000088538		0.602	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	70	0.00	0	G	NM_004947		51417596	51417596	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	silent	66	17.50	14	SNP	1.000	T
EML1	2009	genome.wustl.edu	37	14	100364613	100364613	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr14:100364613G>T	ENST00000262233.6	+	8	1010	c.871G>T	c.(871-873)Gtt>Ttt	p.V291F	EML1_ENST00000334192.4_Missense_Mutation_p.V310F|EML1_ENST00000327921.9_Missense_Mutation_p.V279F	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	291	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				AACAGGACAAGTTGCGGGCAC	0.378																																						dbGAP											0													142.0	119.0	127.0					14																	100364613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.871G>T	14.37:g.100364613G>T	ENSP00000262233:p.Val291Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V310F	ENST00000262233.6	37	c.928	CCDS32155.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.207799|5.207799	0.95033|0.95033	.|.	.|.	ENSG00000066629|ENSG00000066629	ENST00000554386|ENST00000554479;ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138;ENST00000556714	.|T;T;T;T;T	.|0.37235	.|2.62;1.57;1.52;1.57;1.21	5.18|5.18	5.18|5.18	0.71444|0.71444	.|WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68118|0.68118	0.2966|0.2966	M|M	0.88377|0.88377	2.95|2.95	0.80722|0.80722	D|D	1|1	.|D;D;P;D;D	.|0.89917	.|1.0;1.0;0.948;1.0;1.0	.|D;D;P;D;D	.|0.91635	.|0.999;0.999;0.771;0.999;0.999	T|T	0.75025|0.75025	-0.3463|-0.3463	5|10	.|0.87932	.|D	.|0	-30.0446|-30.0446	19.0544|19.0544	0.93058|0.93058	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|279;279;291;310;310	.|F8W717;B7Z650;O00423;O00423-3;B3KXA3	.|.;.;EMAL1_HUMAN;.;.	I|F	15|278;279;291;310;310;260	.|ENSP00000451346:V278F;ENSP00000327384:V279F;ENSP00000262233:V291F;ENSP00000334314:V310F;ENSP00000452089:V260F	.|ENSP00000262233:V291F	S|V	+|+	2|1	0|0	EML1|EML1	99434366|99434366	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.991000|0.991000	0.79684|0.79684	7.833000|7.833000	0.86765|0.86765	2.578000|2.578000	0.87016|0.87016	0.591000|0.591000	0.81541|0.81541	AGT|GTT	EML1	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat	ENSG00000066629		0.378	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EML1	HGNC	protein_coding	OTTHUMT00000413943.1	48	0.00	0	G	NM_001008707		100364613	100364613	+1	no_errors	ENST00000334192	ensembl	human	known	69_37n	missense	104	11.86	14	SNP	1.000	T
ERI3	79033	genome.wustl.edu	37	1	44750563	44750563	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:44750563G>T	ENST00000372257.2	-	7	956	c.775C>A	c.(775-777)Cag>Aag	p.Q259K	ERI3_ENST00000537474.1_Missense_Mutation_p.Q82K|ERI3_ENST00000495828.1_5'UTR|ERI3_ENST00000372259.5_Missense_Mutation_p.Q144K	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	259	Exonuclease.						exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCCAAGTACTGGCACTGGCCT	0.507																																						dbGAP											0													69.0	71.0	70.0					1																	44750563		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.775C>A	1.37:g.44750563G>T	ENSP00000361331:p.Gln259Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.Q259K	ENST00000372257.2	37	c.775	CCDS30696.1	1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447704	0.26074	.	.	ENSG00000117419	ENST00000372257;ENST00000372259;ENST00000456170;ENST00000537474;ENST00000433471;ENST00000372253;ENST00000452396	T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12	5.7	5.7	0.88788	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.630858	0.15097	N	0.280733	T	0.06325	0.0163	N	0.00583	-1.355	0.33437	D	0.581931	B;B	0.11235	0.001;0.004	B;B	0.11329	0.004;0.006	T	0.07009	-1.0795	10	0.02654	T	1	.	15.3244	0.74147	0.0:0.1392:0.8608:0.0	.	181;259	B4DN03;O43414	.;ERI3_HUMAN	K	259;144;98;82;141;125;141	ENSP00000361331:Q259K;ENSP00000361333:Q144K;ENSP00000390710:Q98K;ENSP00000438360:Q82K;ENSP00000396764:Q141K	ENSP00000361327:Q125K	Q	-	1	0	ERI3	44523150	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.972000	0.63756	2.688000	0.91661	0.655000	0.94253	CAG	ERI3	-	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	ENSG00000117419		0.507	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERI3	HGNC	protein_coding	OTTHUMT00000020243.1	51	0.00	0	G	NM_024066		44750563	44750563	-1	no_errors	ENST00000372257	ensembl	human	known	69_37n	missense	95	12.04	13	SNP	1.000	T
FHL5	9457	genome.wustl.edu	37	6	97058632	97058632	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:97058632G>T	ENST00000326771.2	+	6	1069	c.689G>T	c.(688-690)aGt>aTt	p.S230I	FHL5_ENST00000541107.1_Missense_Mutation_p.S230I	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	230	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		AAACCCATTAGTGGTGAGTTC	0.388																																						dbGAP											0													135.0	131.0	133.0					6																	97058632		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.689G>T	6.37:g.97058632G>T	ENSP00000326022:p.Ser230Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S230I	ENST00000326771.2	37	c.689	CCDS5035.1	6	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226249	0.39300	.	.	ENSG00000112214	ENST00000541107;ENST00000326771	D;D	0.87256	-2.23;-2.23	5.98	3.24	0.37175	Zinc finger, LIM-type (5);	0.145914	0.32081	N	0.006608	T	0.65217	0.2670	N	0.20685	0.6	0.26476	N	0.975192	B	0.18610	0.029	B	0.25614	0.062	T	0.61987	-0.6949	10	0.87932	D	0	.	10.0727	0.42343	0.0:0.7591:0.1144:0.1264	.	230	Q5TD97	FHL5_HUMAN	I	230	ENSP00000442357:S230I;ENSP00000326022:S230I	ENSP00000326022:S230I	S	+	2	0	FHL5	97165353	0.701000	0.27806	0.989000	0.46669	0.674000	0.39518	0.806000	0.27126	0.879000	0.35944	-0.153000	0.13522	AGT	FHL5	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000112214		0.388	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHL5	HGNC	protein_coding	OTTHUMT00000041559.1	61	0.00	0	G	NM_020482		97058632	97058632	+1	no_errors	ENST00000326771	ensembl	human	known	69_37n	missense	68	10.53	8	SNP	0.921	T
FLOT2	2319	genome.wustl.edu	37	17	27208299	27208299	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:27208299C>T	ENST00000394908.4	-	9	1113	c.1009G>A	c.(1009-1011)Gag>Aag	p.E337K	FLOT2_ENST00000394906.2_Missense_Mutation_p.E392K|FLOT2_ENST00000585169.1_Missense_Mutation_p.E337K|FLOT2_ENST00000577789.1_5'UTR	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	337					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CGCTCAGCCTCTGCCTTGCCC	0.617																																						dbGAP											0													68.0	73.0	71.0					17																	27208299		2104	4222	6326	-	-	-	SO:0001583	missense	0			M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.1009G>A	17.37:g.27208299C>T	ENSP00000378368:p.Glu337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Band_7,smart_Band_7	p.E337K	ENST00000394908.4	37	c.1009	CCDS11245.2	17	.	.	.	.	.	.	.	.	.	.	C	36	5.896387	0.97081	.	.	ENSG00000132589	ENST00000394906;ENST00000394908	T;T	0.25579	1.79;1.79	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.59649	0.2209	M	0.93062	3.375	0.80722	D	1	D	0.64830	0.994	P	0.60173	0.87	T	0.69465	-0.5138	10	0.87932	D	0	-30.6851	18.9843	0.92764	0.0:1.0:0.0:0.0	.	337	Q14254	FLOT2_HUMAN	K	392;337	ENSP00000378366:E392K;ENSP00000378368:E337K	ENSP00000378366:E392K	E	-	1	0	FLOT2	24232425	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	7.729000	0.84864	2.744000	0.94065	0.561000	0.74099	GAG	FLOT2	-	NULL	ENSG00000132589		0.617	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	FLOT2	HGNC	protein_coding	OTTHUMT00000255935.3	32	0.00	0	C	NM_004475		27208299	27208299	-1	no_errors	ENST00000394908	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	T
GATAD2A	54815	genome.wustl.edu	37	19	19603408	19603408	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:19603408C>T	ENST00000360315.3	+	4	733	c.421C>T	c.(421-423)Cga>Tga	p.R141*	GATAD2A_ENST00000358713.3_Nonsense_Mutation_p.R141*|GATAD2A_ENST00000537887.1_Intron|GATAD2A_ENST00000252577.5_Nonsense_Mutation_p.R141*|GATAD2A_ENST00000429563.2_5'UTR|GATAD2A_ENST00000404158.1_Nonsense_Mutation_p.R141*	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	141					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						TCCTGAAGAACGAGAAAGGAT	0.502																																						dbGAP											0													121.0	119.0	120.0					19																	19603408		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.421C>T	19.37:g.19603408C>T	ENSP00000353463:p.Arg141*	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Nonsense_Mutation	SNP	pfam_Znf_GATA,pfscan_Znf_GATA	p.R141*	ENST00000360315.3	37	c.421	CCDS12402.2	19	.	.	.	.	.	.	.	.	.	.	C	37	6.408695	0.97542	.	.	ENSG00000167491	ENST00000417582;ENST00000360315;ENST00000252577;ENST00000457895;ENST00000404158;ENST00000358713	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7673	13.4571	0.61206	0.1567:0.8433:0.0:0.0	.	.	.	.	X	141;141;141;141;160;141	.	ENSP00000252577:R141X	R	+	1	2	GATAD2A	19464408	0.999000	0.42202	0.898000	0.35279	0.976000	0.68499	2.487000	0.45268	2.791000	0.96007	0.561000	0.74099	CGA	GATAD2A	-	NULL	ENSG00000167491		0.502	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATAD2A	HGNC	protein_coding	OTTHUMT00000326671.4	38	0.00	0	C	NM_017660		19603408	19603408	+1	no_errors	ENST00000404158	ensembl	human	known	69_37n	nonsense	63	22.22	18	SNP	0.998	T
GH2	2689	genome.wustl.edu	37	17	61957710	61957710	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:61957710G>T	ENST00000423893.2	-	5	686	c.625C>A	c.(625-627)Cgc>Agc	p.R209S	GH2_ENST00000449787.2_Missense_Mutation_p.R194S|GH2_ENST00000456543.2_Silent_p.A207A|GH2_ENST00000332800.7_3'UTR			P01242	SOM2_HUMAN	growth hormone 2	209					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						TCCACAGAGCGGCACTGCACG	0.607																																						dbGAP											0													99.0	84.0	89.0					17																	61957710		2202	4279	6481	-	-	-	SO:0001583	missense	0			J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.625C>A	17.37:g.61957710G>T	ENSP00000409294:p.Arg209Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.R209S	ENST00000423893.2	37	c.625	CCDS11647.1	17	.	.	.	.	.	.	.	.	.	.	g	13.15	2.150450	0.37923	.	.	ENSG00000136487	ENST00000423893;ENST00000449787	D;D	0.92911	-3.13;-3.13	2.74	2.74	0.32292	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.	.	.	.	D	0.95446	0.8521	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.98	D;P	0.97110	1.0;0.589	D	0.95525	0.8598	8	0.72032	D	0.01	.	12.4782	0.55827	0.0:0.0:1.0:0.0	.	209;194	P01242;O14643	SOM2_HUMAN;.	S	209;194	ENSP00000409294:R209S;ENSP00000410618:R194S	ENSP00000409294:R209S	R	-	1	0	GH2	59311442	1.000000	0.71417	0.998000	0.56505	0.093000	0.18481	4.598000	0.61069	1.531000	0.49152	0.306000	0.20318	CGC	GH2	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	ENSG00000136487		0.607	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GH2	HGNC	protein_coding	OTTHUMT00000417665.1	69	0.00	0	G	NM_002059		61957710	61957710	-1	no_errors	ENST00000423893	ensembl	human	known	69_37n	missense	119	11.19	15	SNP	1.000	T
GLRA4	441509	genome.wustl.edu	37	X	102968564	102968564	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chrX:102968564C>T	ENST00000372617.4	-	8	1387	c.967G>A	c.(967-969)Gct>Act	p.A323T	TMEM31_ENST00000319560.6_Missense_Mutation_p.P49S	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	323						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						AGACACACAGCCATCCAGATG	0.468																																						dbGAP											0													208.0	150.0	170.0					X																	102968564		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.967G>A	X.37:g.102968564C>T	ENSP00000361700:p.Ala323Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Neur_channel,tigrfam_Neur_channel	p.A323T	ENST00000372617.4	37	c.967	CCDS43980.2	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.396077|4.396077	0.83011|0.83011	.|.	.|.	ENSG00000188828|ENSG00000179363	ENST00000372617|ENST00000319560	D|.	0.86030|.	-2.06|.	5.5|5.5	5.5|5.5	0.81552|0.81552	Neurotransmitter-gated ion-channel transmembrane domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.52725|0.52725	0.1752|0.1752	N|N	0.08118|0.08118	0|0	0.47065|0.47065	D|D	0.999309|0.999309	P|D	0.40909|0.89917	0.732|1.0	B|D	0.44278|0.97110	0.445|1.0	T|T	0.56165|0.56165	-0.8024|-0.8024	10|7	0.59425|.	D|.	0.04|.	-5.8278|-5.8278	15.6855|15.6855	0.77405|0.77405	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	323|49	Q5JXX5|Q5JXX7	GLRA4_HUMAN|TMM31_HUMAN	T|S	323|49	ENSP00000361700:A323T|.	ENSP00000361700:A323T|.	A|P	-|+	1|1	0|0	GLRA4|TMEM31	102855220|102855220	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.818000|7.818000	0.86416|0.86416	2.299000|2.299000	0.77371|0.77371	0.523000|0.523000	0.50628|0.50628	GCT|CCA	GLRA4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000188828		0.468	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLRA4	HGNC	protein_coding	OTTHUMT00000057742.2	69	0.00	0	C	NM_001024452		102968564	102968564	-1	no_errors	ENST00000372617	ensembl	human	known	69_37n	missense	116	11.45	15	SNP	1.000	T
HBA2	3040	genome.wustl.edu	37	16	223549	223549	+	Missense_Mutation	SNP	G	G	T	rs33933481		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr16:223549G>T	ENST00000251595.6	+	3	445	c.379G>T	c.(379-381)Gac>Tac	p.D127Y	HBA2_ENST00000397806.1_Missense_Mutation_p.D95Y	NM_000517.4	NP_000508.1	P69905	HBA_HUMAN	hemoglobin, alpha 2	127			D -> G (in West One). {ECO:0000269|PubMed:14576901}.|D -> V (in Fukutomi; O(2) affinity up).|D -> Y (in Monteriore; O(2) affinity up).		bicarbonate transport (GO:0015701)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of cell death (GO:0010942)|protein heterooligomerization (GO:0051291)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)						all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)			Iron Dextran(DB00893)|Mefloquine(DB00358)	CGCCTCCCTGGACAAGTTCCT	0.652											OREG0003686	type=REGULATORY REGION|Gene=SERPINB9|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									GBM(107;1340 2104 14383 27419)	dbGAP											0			GRCh37	CM810008	HBA2	M	rs33933481						37.0	43.0	41.0					16																	223549		2151	4296	6447	-	-	-	SO:0001583	missense	0			BC008572	CCDS10398.1	16p13.3	2014-05-19			ENSG00000188536	ENSG00000188536			4824	protein-coding gene	gene with protein product		141850				6452630, 2649166	Standard	NM_000517		Approved	HBA-T2	uc002cfv.4	P69905	OTTHUMG00000059924	ENST00000251595.6:c.379G>T	16.37:g.223549G>T	ENSP00000251595:p.Asp127Tyr	Somatic	586	WXS	Illumina GAIIx	Phase_IV	P01922|Q1HDT5|Q3MIF5|Q53F97|Q96KF1|Q9NYR7|Q9UCM0	Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_a,prints_Haemoglobin_pi	p.D127Y	ENST00000251595.6	37	c.379	CCDS10398.1	16	.	.	.	.	.	.	.	.	.	.	g	19.66	3.868506	0.72065	.	.	ENSG00000188536	ENST00000251595;ENST00000534957;ENST00000397806	D;D	0.94576	-3.28;-3.46	4.24	4.24	0.50183	Globin-like (1);Globin, structural domain (1);	0.000000	0.85682	D	0.000000	D	0.97346	0.9132	M	0.90019	3.08	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.97820	1.0256	10	0.87932	D	0	-50.7463	11.7008	0.51569	0.0:0.179:0.821:0.0	rs33933481	127	P69905	HBA_HUMAN	Y	127;95;95	ENSP00000251595:D127Y;ENSP00000380908:D95Y	ENSP00000251595:D127Y	D	+	1	0	HBA2	163549	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	7.180000	0.77674	1.919000	0.55581	0.553000	0.69018	GAC	HBA2	-	superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_a	ENSG00000188536		0.652	HBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBA2	HGNC	protein_coding	OTTHUMT00000133194.1	39	0.00	0	G	NM_000517		223549	223549	+1	no_errors	ENST00000251595	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	1.000	T
HCRTR2	3062	genome.wustl.edu	37	6	55147109	55147109	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:55147109C>T	ENST00000370862.3	+	7	1528	c.1192C>T	c.(1192-1194)Cga>Tga	p.R398*		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	398					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CACCAGGGGACGAACTAGCAC	0.468																																						dbGAP											0													85.0	77.0	80.0					6																	55147109		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.1192C>T	6.37:g.55147109C>T	ENSP00000359899:p.Arg398*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTM0	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_Orexin_rcpt_2,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Orexin_rcpt_2,prints_NPY_rcpt	p.R398*	ENST00000370862.3	37	c.1192	CCDS4956.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.167969	0.97343	.	.	ENSG00000137252	ENST00000370862	.	.	.	5.46	1.38	0.22167	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0174	0.71597	0.6087:0.3913:0.0:0.0	.	.	.	.	X	398	.	ENSP00000359899:R398X	R	+	1	2	HCRTR2	55255068	0.142000	0.22610	0.002000	0.10522	0.936000	0.57629	0.828000	0.27435	-0.041000	0.13558	-0.158000	0.13435	CGA	HCRTR2	-	pfam_Orexin_rcpt_2,prints_Orexin_rcpt_2	ENSG00000137252		0.468	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR2	HGNC	protein_coding	OTTHUMT00000043392.1	37	0.00	0	C			55147109	55147109	+1	no_errors	ENST00000370862	ensembl	human	known	69_37n	nonsense	61	26.51	22	SNP	0.180	T
HDAC4	9759	genome.wustl.edu	37	2	240016733	240016733	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr2:240016733G>T	ENST00000345617.3	-	17	3029	c.2238C>A	c.(2236-2238)ttC>ttA	p.F746L	HDAC4_ENST00000543185.1_Missense_Mutation_p.F330L|HDAC4_ENST00000541256.1_Missense_Mutation_p.F720L	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	746	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAGCCGGACGAACACGGAGG	0.612																																						dbGAP											0													77.0	85.0	82.0					2																	240016733		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2238C>A	2.37:g.240016733G>T	ENSP00000264606:p.Phe746Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.F746L	ENST00000345617.3	37	c.2238	CCDS2529.1	2	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962203	0.18583	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185;ENST00000541256;ENST00000393621	T;T;T	0.65364	0.22;-0.15;0.73	4.46	-8.93	0.00771	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	L	0.48935	1.535	0.40990	D	0.984848	D;B;B;B;B;B	0.54601	0.967;0.222;0.013;0.014;0.016;0.2	P;B;B;B;B;B	0.58577	0.841;0.094;0.016;0.005;0.037;0.146	T	0.79305	-0.1858	10	0.56958	D	0.05	.	20.7024	0.99706	0.2754:0.0:0.7246:0.0	.	746;629;720;720;714;746	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	L	746;634;330;720;629	ENSP00000264606:F746L;ENSP00000440481:F330L;ENSP00000443057:F720L	ENSP00000264606:F746L	F	-	3	2	HDAC4	239681670	0.411000	0.25384	0.125000	0.21846	0.040000	0.13550	-0.171000	0.09883	-2.355000	0.00614	-0.768000	0.03414	TTC	HDAC4	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000068024		0.612	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	27	0.00	0	G	NM_006037		240016733	240016733	-1	no_errors	ENST00000345617	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	0.191	T
HHATL	57467	genome.wustl.edu	37	3	42740389	42740389	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr3:42740389G>T	ENST00000441594.1	-	5	555	c.294C>A	c.(292-294)cgC>cgA	p.R98R	HHATL_ENST00000310417.5_Silent_p.R98R	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	98					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		ACATCCAGGAGCGGAGCTGTG	0.597																																						dbGAP											0													61.0	61.0	61.0					3																	42740389		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.294C>A	3.37:g.42740389G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBG3|Q9ULP7	Silent	SNP	pfam_MBOAT_fam	p.R98	ENST00000441594.1	37	c.294	CCDS2704.1	3																																																																																			HHATL	-	NULL	ENSG00000010282		0.597	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HHATL	HGNC	protein_coding	OTTHUMT00000343627.1	31	0.00	0	G	NM_020707		42740389	42740389	-1	no_errors	ENST00000310417	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	1.000	T
HMGN5	79366	genome.wustl.edu	37	X	80371790	80371790	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chrX:80371790G>T	ENST00000358130.2	-	6	508	c.180C>A	c.(178-180)gcC>gcA	p.A60A	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	60					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A60A(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						CAACTGCTTGGGCACTTGTAT	0.328																																						dbGAP											2	Substitution - coding silent(2)	endometrium(2)											148.0	113.0	125.0					X																	80371790		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.180C>A	X.37:g.80371790G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSL1	Silent	SNP	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.A60	ENST00000358130.2	37	c.180	CCDS14448.1	X																																																																																			HMGN5	-	pfam_HMGN_fam,smart_HMGN_fam	ENSG00000198157		0.328	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN5	HGNC	protein_coding	OTTHUMT00000057354.1	150	0.00	0	G	NM_030763		80371790	80371790	-1	no_errors	ENST00000358130	ensembl	human	known	69_37n	silent	247	20.58	64	SNP	0.020	T
HPCAL4	51440	genome.wustl.edu	37	1	40150207	40150207	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:40150207G>T	ENST00000372844.3	-	2	460	c.69C>A	c.(67-69)agC>agA	p.S23R		NM_001282396.1|NM_001282397.1|NM_016257.2	NP_001269325.1|NP_001269326.1|NP_057341.1	Q9UM19	HPCL4_HUMAN	hippocalcin like 4	23					central nervous system development (GO:0007417)|signal transduction (GO:0007165)	intracellular (GO:0005622)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|lung(5)|stomach(1)	8	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCTCCTGCTCGCTGAACTCAG	0.607																																						dbGAP											0													73.0	62.0	66.0					1																	40150207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001105	CCDS441.1, CCDS72761.1	1p34.2	2013-01-10			ENSG00000116983	ENSG00000116983		"""EF-hand domain containing"""	18212	protein-coding gene	gene with protein product						10520747	Standard	NM_016257		Approved	HLP4, DKFZp761G122	uc001cdr.3	Q9UM19	OTTHUMG00000009246	ENST00000372844.3:c.69C>A	1.37:g.40150207G>T	ENSP00000361935:p.Ser23Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5U2|D3DPU1|Q5TG97|Q8N611	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.S23R	ENST00000372844.3	37	c.69	CCDS441.1	1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.546841	0.45383	.	.	ENSG00000116983	ENST00000372844;ENST00000450300	T	0.21932	1.98	4.4	2.46	0.29980	EF-hand-like domain (1);	0.048975	0.85682	D	0.000000	T	0.23572	0.0570	M	0.73430	2.235	0.50171	D	0.999851	B;P	0.41710	0.069;0.76	B;B	0.39935	0.025;0.314	T	0.03060	-1.1077	10	0.87932	D	0	.	7.4637	0.27310	0.361:0.0:0.639:0.0	.	23;23	B4DGW9;Q9UM19	.;HPCL4_HUMAN	R	23	ENSP00000361935:S23R	ENSP00000361935:S23R	S	-	3	2	HPCAL4	39922794	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	0.330000	0.19715	0.525000	0.28522	0.561000	0.74099	AGC	HPCAL4	-	prints_Recoverin	ENSG00000116983		0.607	HPCAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCAL4	HGNC	protein_coding	OTTHUMT00000025640.1	25	0.00	0	G	NM_016257		40150207	40150207	-1	no_errors	ENST00000372844	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	1.000	T
HS6ST1	9394	genome.wustl.edu	37	2	129026227	129026227	+	Missense_Mutation	SNP	G	G	T	rs3958533		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr2:129026227G>T	ENST00000259241.6	-	2	758	c.745C>A	c.(745-747)Cgc>Agc	p.R249S		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	249					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)	p.R249S(1)		endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		CGCACCTGGCGGTTGTTGGCC	0.672																																						dbGAP											1	Substitution - Missense(1)	skin(1)											14.0	18.0	17.0					2																	129026227		1971	4143	6114	-	-	-	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.745C>A	2.37:g.129026227G>T	ENSP00000259241:p.Arg249Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R249S	ENST00000259241.6	37	c.745	CCDS42748.1	2	257	0.11767399267399267	38	0.07723577235772358	38	0.10497237569060773	62	0.10839160839160839	119	0.15699208443271767	G	27.0	4.792392	0.90453	.	.	ENSG00000136720	ENST00000259241	T	0.75821	-0.97	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.02571	0.0078	M	0.89601	3.045	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.48305	-0.9047	9	.	.	.	-0.1889	18.424	0.90602	0.0:0.0:1.0:0.0	rs3958533	249	O60243	H6ST1_HUMAN	S	249	ENSP00000259241:R249S	.	R	-	1	0	HS6ST1	128742697	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.939000	0.70179	2.346000	0.79739	0.462000	0.41574	CGC	HS6ST1	-	pfam_Sulfotransferase	ENSG00000136720		0.672	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	21	0.00	0	G	NM_004807		129026227	129026227	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	T
KHDRBS2	202559	genome.wustl.edu	37	6	62604590	62604590	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:62604590G>T	ENST00000281156.4	-	6	1038	c.760C>A	c.(760-762)Cca>Aca	p.P254T		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	254	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		CTGTATCCTGGCACTGTTGGT	0.517																																						dbGAP											0													70.0	72.0	71.0					6																	62604590		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.760C>A	6.37:g.62604590G>T	ENSP00000281156:p.Pro254Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.P254T	ENST00000281156.4	37	c.760	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655061	0.29425	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.41400	1.0	5.82	5.82	0.92795	.	0.108992	0.64402	D	0.000006	T	0.20210	0.0486	L	0.29908	0.895	0.52501	D	0.999959	B	0.09022	0.002	B	0.08055	0.003	T	0.08249	-1.0731	10	0.16896	T	0.51	-2.8519	20.0856	0.97800	0.0:0.0:1.0:0.0	.	254	Q5VWX1	KHDR2_HUMAN	T	254	ENSP00000281156:P254T	ENSP00000281156:P254T	P	-	1	0	KHDRBS2	62662549	1.000000	0.71417	0.972000	0.41901	0.987000	0.75469	7.731000	0.84895	2.734000	0.93682	0.655000	0.94253	CCA	KHDRBS2	-	NULL	ENSG00000112232		0.517	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2	55	0.00	0	G	NM_152688		62604590	62604590	-1	no_errors	ENST00000281156	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	0.998	T
CCAR2	57805	genome.wustl.edu	37	8	22464825	22464825	+	Silent	SNP	C	C	G			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr8:22464825C>G	ENST00000308511.4	+	6	723	c.474C>G	c.(472-474)ctC>ctG	p.L158L	CCAR2_ENST00000389279.3_Silent_p.L158L|CCAR2_ENST00000520861.1_5'UTR			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	158					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										TTCCCCCACTCTTTCCTCAGA	0.537																																						dbGAP											0													76.0	64.0	68.0					8																	22464825		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.474C>G	8.37:g.22464825C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.L166V	ENST00000308511.4	37	c.496	CCDS34863.1	8	.	.	.	.	.	.	.	.	.	.	C	6.736	0.504526	0.12822	.	.	ENSG00000158941	ENST00000523801;ENST00000518989	.	.	.	5.96	3.22	0.36961	.	0.000000	0.64402	D	0.000003	T	0.63745	0.2537	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62520	-0.6837	6	0.66056	D	0.02	-20.4289	8.4194	0.32692	0.0:0.7547:0.0:0.2453	.	.	.	.	V	166;111	.	ENSP00000431046:L111V	L	+	1	0	KIAA1967	22520770	0.997000	0.39634	0.998000	0.56505	0.993000	0.82548	0.207000	0.17395	0.424000	0.26061	-0.136000	0.14681	CTT	KIAA1967	-	NULL	ENSG00000158941		0.537	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1967	HGNC	protein_coding	OTTHUMT00000375865.1	49	0.00	0	C	NM_021174		22464825	22464825	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000523801	ensembl	human	putative	69_37n	missense	98	16.24	19	SNP	1.000	G
KIF5A	3798	genome.wustl.edu	37	12	57975311	57975311	+	Missense_Mutation	SNP	C	C	G	rs575223790		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr12:57975311C>G	ENST00000455537.2	+	25	3143	c.2869C>G	c.(2869-2871)Ctc>Gtc	p.L957V	KIF5A_ENST00000286452.5_Missense_Mutation_p.L868V	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	957	Globular.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						CTACCAGAATCTCTACCTGCA	0.582																																						dbGAP											0													102.0	90.0	94.0					12																	57975311		2203	4300	6503	-	-	-	SO:0001583	missense	0			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.2869C>G	12.37:g.57975311C>G	ENSP00000408979:p.Leu957Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8M5|Q4LE26	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L957V	ENST00000455537.2	37	c.2869	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	C	10.94	1.491608	0.26774	.	.	ENSG00000155980	ENST00000455537;ENST00000286452;ENST00000547989	T;T	0.73897	-0.79;-0.77	4.52	-2.19	0.07015	.	0.493190	0.16150	N	0.227340	T	0.46560	0.1399	N	0.08118	0	0.21064	N	0.999795	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25641	-1.0126	10	0.24483	T	0.36	.	6.8774	0.24155	0.0:0.4898:0.1542:0.356	.	868;957	B7Z2M7;Q12840	.;KIF5A_HUMAN	V	957;868;51	ENSP00000408979:L957V;ENSP00000286452:L868V	ENSP00000286452:L868V	L	+	1	0	KIF5A	56261578	0.000000	0.05858	0.776000	0.31678	0.978000	0.69477	-1.938000	0.01546	-0.486000	0.06744	-0.367000	0.07326	CTC	KIF5A	-	NULL	ENSG00000155980		0.582	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	HGNC	protein_coding	OTTHUMT00000407634.1	36	0.00	0	C	NM_004984		57975311	57975311	+1	no_errors	ENST00000455537	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	0.354	G
KPNB1	3837	genome.wustl.edu	37	17	45750492	45750492	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:45750492G>T	ENST00000290158.4	+	13	2063	c.1656G>T	c.(1654-1656)ttG>ttT	p.L552F	KPNB1_ENST00000540627.1_Missense_Mutation_p.L407F|KPNB1_ENST00000537679.1_Missense_Mutation_p.L336F|KPNB1_ENST00000535458.2_Missense_Mutation_p.L407F	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	552					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.L552F(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						AAACGACTTTGGTCATCATGG	0.463																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											125.0	119.0	121.0					17																	45750492		2203	4300	6503	-	-	-	SO:0001583	missense	0			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1656G>T	17.37:g.45750492G>T	ENSP00000290158:p.Leu552Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,pfam_Armadillo,superfamily_ARM-type_fold,smart_Importin-beta_N,smart_Armadillo,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.L552F	ENST00000290158.4	37	c.1656	CCDS11513.1	17	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085870	0.36758	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.52	-2.18	0.07037	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.52805	0.1757	L	0.50333	1.59	0.38797	D	0.955109	P;P	0.46784	0.884;0.776	B;B	0.40782	0.34;0.198	T	0.60301	-0.7290	9	0.56958	D	0.05	-16.5928	7.3697	0.26794	0.4933:0.1129:0.3938:0.0	.	336;552	F5H4R7;Q14974	.;IMB1_HUMAN	F	407;552;407;336	ENSP00000438253:L407F;ENSP00000290158:L552F;ENSP00000438964:L407F;ENSP00000445006:L336F	ENSP00000290158:L552F	L	+	3	2	KPNB1	43105491	1.000000	0.71417	0.930000	0.37139	0.990000	0.78478	1.490000	0.35573	-0.010000	0.14271	0.655000	0.94253	TTG	KPNB1	-	superfamily_ARM-type_fold	ENSG00000108424		0.463	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNB1	HGNC	protein_coding	OTTHUMT00000089755.2	56	0.00	0	G	NM_002265		45750492	45750492	+1	no_errors	ENST00000290158	ensembl	human	known	69_37n	missense	68	22.73	20	SNP	0.952	T
KRT76	51350	genome.wustl.edu	37	12	53164973	53164973	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr12:53164973delC	ENST00000332411.2	-	7	1347	c.1294delG	c.(1294-1296)gctfs	p.A432fs		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	432	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CGCTGCTCAGCCTCTGCAATT	0.517																																						dbGAP											0													126.0	112.0	117.0					12																	53164973		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1294delG	12.37:g.53164973delC	ENSP00000330101:p.Ala432fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRR3|Q7Z795	Frame_Shift_Del	DEL	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.A432fs	ENST00000332411.2	37	c.1294	CCDS8838.1	12																																																																																			KRT76	-	pfam_F	ENSG00000185069		0.517	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	HGNC	protein_coding	OTTHUMT00000405928.1	60	0.00	0	C	NM_015848		53164973	53164973	-1	no_errors	ENST00000332411	ensembl	human	known	69_37n	frame_shift_del	130	21.89	37	DEL	1.000	-
LAMB3	3914	genome.wustl.edu	37	1	209791254	209791254	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:209791254C>T	ENST00000356082.4	-	20	3183	c.3049G>A	c.(3049-3051)Gag>Aag	p.E1017K	LAMB3_ENST00000367030.3_Missense_Mutation_p.E1017K|LAMB3_ENST00000391911.1_Missense_Mutation_p.E1017K	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	1017	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TGCCTCACCTCAGCAACCCTG	0.542																																						dbGAP											0													92.0	86.0	88.0					1																	209791254		2203	4300	6503	-	-	-	SO:0001583	missense	0			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.3049G>A	1.37:g.209791254C>T	ENSP00000348384:p.Glu1017Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_Laminin_N	p.E1017K	ENST00000356082.4	37	c.3049	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286584	0.59867	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030;ENST00000455193	T;T;T;T	0.23348	1.92;1.92;1.92;1.91	4.47	4.47	0.54385	.	0.193625	0.44285	D	0.000479	T	0.23014	0.0556	L	0.36672	1.1	0.45541	D	0.998496	B	0.09022	0.002	B	0.09377	0.004	T	0.03268	-1.1054	10	0.33940	T	0.23	.	17.1329	0.86730	0.0:1.0:0.0:0.0	.	1017	Q13751	LAMB3_HUMAN	K	1017;1017;1017;86	ENSP00000375778:E1017K;ENSP00000348384:E1017K;ENSP00000355997:E1017K;ENSP00000398683:E86K	ENSP00000348384:E1017K	E	-	1	0	LAMB3	207857877	0.996000	0.38824	0.992000	0.48379	0.725000	0.41563	3.712000	0.54875	2.200000	0.70718	0.456000	0.33151	GAG	LAMB3	-	NULL	ENSG00000196878		0.542	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	HGNC	protein_coding	OTTHUMT00000088525.2	37	0.00	0	C	NM_000228		209791254	209791254	-1	no_errors	ENST00000356082	ensembl	human	known	69_37n	missense	78	19.59	19	SNP	0.996	T
MAG	4099	genome.wustl.edu	37	19	35793545	35793545	+	Missense_Mutation	SNP	G	G	A	rs34074779		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:35793545G>A	ENST00000392213.3	+	7	1324	c.1165G>A	c.(1165-1167)Gag>Aag	p.E389K	MAG_ENST00000361922.4_Missense_Mutation_p.E389K|MAG_ENST00000537831.2_Missense_Mutation_p.E364K	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	389	Ig-like C2-type 3.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGATGATGGAGAGTACTGGTG	0.582																																						dbGAP											0													109.0	88.0	95.0					19																	35793545		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1165G>A	19.37:g.35793545G>A	ENSP00000376048:p.Glu389Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E389K	ENST00000392213.3	37	c.1165	CCDS12455.1	19	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355453	0.82243	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.11821	2.74;2.74;2.74	5.14	4.03	0.46877	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.193481	0.43919	N	0.000502	T	0.15955	0.0384	L	0.37697	1.125	0.40342	D	0.979046	P;D;D	0.54601	0.901;0.964;0.967	B;P;P	0.53102	0.429;0.703;0.718	T	0.03043	-1.1079	10	0.07990	T	0.79	.	12.7917	0.57537	0.0:0.1661:0.8338:0.0	.	426;389;389	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	K	426;389;389;364	ENSP00000355234:E389K;ENSP00000376048:E389K;ENSP00000440695:E364K	ENSP00000262624:E426K	E	+	1	0	MAG	40485385	1.000000	0.71417	0.975000	0.42487	0.922000	0.55478	3.365000	0.52335	2.381000	0.81170	0.455000	0.32223	GAG	MAG	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000105695		0.582	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	HGNC	protein_coding	OTTHUMT00000466071.1	27	0.00	0	G	NM_080600		35793545	35793545	+1	no_errors	ENST00000392213	ensembl	human	known	69_37n	missense	72	12.20	10	SNP	0.966	A
MAGEB1	4112	genome.wustl.edu	37	X	30268639	30268639	+	Missense_Mutation	SNP	G	G	A	rs113819941		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chrX:30268639G>A	ENST00000378981.3	+	4	350	c.29G>A	c.(28-30)cGt>cAt	p.R10H	MAGEB1_ENST00000397550.1_Missense_Mutation_p.R10H|MAGEB1_ENST00000397548.2_Missense_Mutation_p.R10H	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	10										NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						AGTAAGCTCCGTGCTCGTGAG	0.587																																						dbGAP											0													42.0	33.0	36.0					X																	30268639		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.29G>A	X.37:g.30268639G>A	ENSP00000368264:p.Arg10His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R10H	ENST00000378981.3	37	c.29	CCDS14222.1	X	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278517	0.40294	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.06294	3.32;3.32;3.32	3.99	3.99	0.46301	Melanoma associated antigen, MAGE, N-terminal (1);	0.251113	0.27981	N	0.017071	T	0.23014	0.0556	M	0.81341	2.54	0.22968	N	0.998498	D	0.89917	1.0	D	0.91635	0.999	T	0.01956	-1.1240	10	0.42905	T	0.14	.	10.4831	0.44706	0.0:0.0:1.0:0.0	.	10	P43366	MAGB1_HUMAN	H	10	ENSP00000368264:R10H;ENSP00000380683:R10H;ENSP00000380681:R10H	ENSP00000368264:R10H	R	+	2	0	MAGEB1	30178560	0.174000	0.23070	0.563000	0.28383	0.044000	0.14063	1.373000	0.34272	2.232000	0.73038	0.600000	0.82982	CGT	MAGEB1	-	pfam_Melanoma_ass_antigen_N	ENSG00000214107		0.587	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB1	HGNC	protein_coding	OTTHUMT00000056160.1	31	0.00	0	G	NM_002363		30268639	30268639	+1	no_errors	ENST00000378981	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.491	A
MANBA	4126	genome.wustl.edu	37	4	103578858	103578858	+	Missense_Mutation	SNP	G	G	T	rs374407182		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr4:103578858G>T	ENST00000226578.4	-	12	1784	c.1685C>A	c.(1684-1686)tCc>tAc	p.S562Y	MANBA_ENST00000505239.1_Missense_Mutation_p.S505Y	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	562					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		TGTACTGAAGGACGGCCAGGA	0.373																																						dbGAP											0													97.0	90.0	93.0					4																	103578858		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1685C>A	4.37:g.103578858G>T	ENSP00000226578:p.Ser562Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BC3|Q9NYX9	Missense_Mutation	SNP	pfam_Glyco_hydro_2_N,pfam_Glyco_hydro_2_TIM,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,superfamily_Glyco_hydro_2_Ig-like	p.S562Y	ENST00000226578.4	37	c.1685	CCDS3658.1	4	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260272	0.80246	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	T;T	0.77489	-1.1;-1.1	4.99	4.99	0.66335	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.91878	0.7429	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.94395	0.7617	10	0.87932	D	0	-15.5516	18.2878	0.90120	0.0:0.0:1.0:0.0	.	505;562	E9PFW2;O00462	.;MANBA_HUMAN	Y	562;505	ENSP00000226578:S562Y;ENSP00000427322:S505Y	ENSP00000226578:S562Y	S	-	2	0	MANBA	103797906	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	9.339000	0.96797	2.321000	0.78463	0.650000	0.86243	TCC	MANBA	-	superfamily_Glycoside_hydrolase_SF	ENSG00000109323		0.373	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MANBA	HGNC	protein_coding	OTTHUMT00000253803.2	30	0.00	0	G			103578858	103578858	-1	no_errors	ENST00000226578	ensembl	human	known	69_37n	missense	78	11.36	10	SNP	1.000	T
MAP3K4	4216	genome.wustl.edu	37	6	161470388	161470388	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:161470388G>T	ENST00000392142.4	+	3	1232	c.1084G>T	c.(1084-1086)Gag>Tag	p.E362*	MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.E362*|MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.E362*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.E362*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	362					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GGAGCTGCTAGAGTACATAGA	0.448																																						dbGAP											0													88.0	87.0	87.0					6																	161470388		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1084G>T	6.37:g.161470388G>T	ENSP00000375986:p.Glu362*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E362*	ENST00000392142.4	37	c.1084	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.536083	0.98345	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-38.8153	20.4192	0.99033	0.0:0.0:1.0:0.0	.	.	.	.	X	362	.	ENSP00000297332:E362X	E	+	1	0	MAP3K4	161390378	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.441000	0.97557	2.831000	0.97527	0.650000	0.86243	GAG	MAP3K4	-	NULL	ENSG00000085511		0.448	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	46	0.00	0	G			161470388	161470388	+1	no_errors	ENST00000392142	ensembl	human	known	69_37n	nonsense	72	14.29	12	SNP	1.000	T
MARK1	4139	genome.wustl.edu	37	1	220825486	220825486	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:220825486G>T	ENST00000366917.4	+	15	1996	c.1730G>T	c.(1729-1731)cGg>cTg	p.R577L	MARK1_ENST00000366918.4_Missense_Mutation_p.R555L|MARK1_ENST00000402574.1_Missense_Mutation_p.R442L					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GAAGCTTACCGGCCTGGGTAA	0.438																																						dbGAP											0													122.0	114.0	117.0					1																	220825486		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1730G>T	1.37:g.220825486G>T	ENSP00000355884:p.Arg577Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R577L	ENST00000366917.4	37	c.1730	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802659	0.70682	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.28666	1.6;1.6;1.6	5.74	5.74	0.90152	.	0.143972	0.49305	D	0.000149	T	0.32041	0.0816	L	0.46157	1.445	0.48511	D	0.999668	B;B;B;B	0.30104	0.268;0.081;0.0;0.001	B;B;B;B	0.25506	0.061;0.045;0.002;0.001	T	0.04781	-1.0927	10	0.51188	T	0.08	.	20.2982	0.98569	0.0:0.0:1.0:0.0	.	577;442;577;555	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	L	442;555;577	ENSP00000386017:R442L;ENSP00000355885:R555L;ENSP00000355884:R577L	ENSP00000355884:R577L	R	+	2	0	MARK1	218892109	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.861000	0.69553	2.873000	0.98535	0.563000	0.77884	CGG	MARK1	-	NULL	ENSG00000116141		0.438	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	67	0.00	0	G			220825486	220825486	+1	no_errors	ENST00000366917	ensembl	human	known	69_37n	missense	143	11.73	19	SNP	1.000	T
MBL1P	8512	genome.wustl.edu	37	10	81666457	81666457	+	IGR	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr10:81666457G>T								NUTM2E (55825 upstream) : MBL1P (13476 downstream)																							CCAGCTAGGAGACGAAGAAGA	0.448																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															10.37:g.81666457G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		10																																																																																			MBL1P	-	-	ENSG00000242600	0	0.448					MBL1P	HGNC			48	0.00	0	G			81666457	81666457	+1	no_errors	ENST00000453174	ensembl	human	known	69_37n	rna	78	13.33	12	SNP	0.897	T
MCAM	4162	genome.wustl.edu	37	11	119182249	119182249	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr11:119182249G>T	ENST00000264036.4	-	11	1412	c.1398C>A	c.(1396-1398)gtC>gtA	p.V466V	MCAM_ENST00000392814.1_Silent_p.V415V	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	466	Ig-like C2-type 3.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCGTGCCGTTGACGTTCCAGG	0.582																																						dbGAP											0													95.0	79.0	84.0					11																	119182249		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1398C>A	11.37:g.119182249G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95812|Q59E86|Q6PHR3|Q6ZTR2	Silent	SNP	pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V466	ENST00000264036.4	37	c.1398	CCDS31690.1	11																																																																																			MCAM	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000076706		0.582	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAM	HGNC	protein_coding	OTTHUMT00000388332.2	49	0.00	0	G			119182249	119182249	-1	no_errors	ENST00000264036	ensembl	human	known	69_37n	silent	54	14.29	9	SNP	0.000	T
MED12	9968	genome.wustl.edu	37	X	70345962	70345962	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chrX:70345962C>G	ENST00000374080.3	+	18	2531	c.2499C>G	c.(2497-2499)ttC>ttG	p.F833L	MED12_ENST00000374102.1_Missense_Mutation_p.F833L|MED12_ENST00000333646.6_Missense_Mutation_p.F833L			Q93074	MED12_HUMAN	mediator complex subunit 12	833					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					TTGCTAAGTTCCAGCACCTTT	0.562			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													133.0	124.0	127.0					X																	70345962		1974	4140	6114	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2499C>G	X.37:g.70345962C>G	ENSP00000363193:p.Phe833Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.F833L	ENST00000374080.3	37	c.2499	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	9.184	1.024251	0.19433	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	4.61	3.66	0.41972	.	0.000000	0.85682	D	0.000000	T	0.61148	0.2324	N	0.17474	0.49	0.53688	D	0.999974	B;B;B;B	0.33103	0.002;0.397;0.038;0.002	B;B;B;B	0.24974	0.009;0.057;0.054;0.007	T	0.60806	-0.7190	10	0.30854	T	0.27	-15.8733	8.9805	0.35961	0.0:0.8083:0.0:0.1917	.	833;680;833;833	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	L	833;833;833;833;801	ENSP00000333125:F833L;ENSP00000363215:F833L;ENSP00000363193:F833L;ENSP00000414203:F801L	ENSP00000333125:F833L	F	+	3	2	MED12	70262687	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.795000	0.47861	2.142000	0.66516	0.462000	0.41574	TTC	MED12	-	NULL	ENSG00000184634		0.562	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	25	0.00	0	C	NM_005120		70345962	70345962	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	1.000	G
STRN3	29966	genome.wustl.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				MIR624_ENST00000385217.1_RNA|STRN3_ENST00000355683.5_Intron	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																						dbGAP											0													47.0	42.0	43.0					14																	31483858		1502	3414	4916	-	-	-	SO:0001627	intron_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	-	NULL	ENST00000357479.5	37	NULL	CCDS41938.1	14																																																																																			MIR624	-	-	ENSG00000207952		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR624	HGNC	protein_coding	OTTHUMT00000409713.1	48	0.00	0	G	NM_014574		31483858	31483858	-1	no_errors	ENST00000385217	ensembl	human	known	69_37n	rna	53	18.46	12	SNP	0.001	T
MPHOSPH8	54737	genome.wustl.edu	37	13	20235848	20235848	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr13:20235848G>T	ENST00000361479.5	+	8	1870	c.1802G>T	c.(1801-1803)gGa>gTa	p.G601V	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.G601V	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	601					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		GATTCCAGTGGAATGACACTG	0.483																																						dbGAP											0													142.0	152.0	149.0					13																	20235848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.1802G>T	13.37:g.20235848G>T	ENSP00000355388:p.Gly601Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.G601V	ENST00000361479.5	37	c.1802	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986481	0.93044	.	.	ENSG00000196199	ENST00000414242;ENST00000361479	T;T	0.78816	-1.21;-1.21	6.08	6.08	0.98989	Ankyrin repeat-containing domain (4);	0.104769	0.64402	D	0.000003	D	0.91841	0.7418	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92794	0.6251	10	0.87932	D	0	.	20.2672	0.98462	0.0:0.0:1.0:0.0	.	601;601	Q99549;Q99549-2	MPP8_HUMAN;.	V	601	ENSP00000414663:G601V;ENSP00000355388:G601V	ENSP00000355388:G601V	G	+	2	0	MPHOSPH8	19133848	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.128000	0.94424	2.894000	0.99253	0.591000	0.81541	GGA	MPHOSPH8	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000196199		0.483	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	25	0.00	0	G	NM_017520		20235848	20235848	+1	no_errors	ENST00000414242	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	T
NINL	22981	genome.wustl.edu	37	20	25498423	25498423	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr20:25498423G>T	ENST00000278886.6	-	3	316	c.243C>A	c.(241-243)cgC>cgA	p.R81R	NINL_ENST00000422516.1_Silent_p.R81R	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	81					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)	p.R81R(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CATCTGAGGGGCGAACACCAG	0.383																																						dbGAP											2	Substitution - coding silent(2)	endometrium(2)											137.0	117.0	123.0					20																	25498423		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.243C>A	20.37:g.25498423G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.R81	ENST00000278886.6	37	c.243	CCDS33452.1	20																																																																																			NINL	-	NULL	ENSG00000101004		0.383	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	81	0.00	0	G	NM_025176		25498423	25498423	-1	no_errors	ENST00000278886	ensembl	human	known	69_37n	silent	111	17.16	23	SNP	0.003	T
OGDHL	55753	genome.wustl.edu	37	10	50954843	50954843	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr10:50954843G>T	ENST00000374103.4	-	10	1334	c.1249C>A	c.(1249-1251)Ccc>Acc	p.P417T	OGDHL_ENST00000432695.1_Missense_Mutation_p.P208T|OGDHL_ENST00000419399.1_Missense_Mutation_p.P360T	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	417					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GTGTAGGAGGGCAGGTCGCTC	0.607																																						dbGAP											0													151.0	102.0	119.0					10																	50954843		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1249C>A	10.37:g.50954843G>T	ENSP00000363216:p.Pro417Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.P417T	ENST00000374103.4	37	c.1249	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715749	0.89112	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.95656	-3.77;-3.77;-3.77	5.76	5.76	0.90799	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.97776	0.9270	M	0.79343	2.45	0.80722	D	1	D;D;D	0.89917	0.998;0.996;1.0	D;D;D	0.85130	0.991;0.984;0.997	D	0.98104	1.0416	10	0.87932	D	0	.	19.9576	0.97228	0.0:0.0:1.0:0.0	.	360;208;417	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	T	417;360;208	ENSP00000363216:P417T;ENSP00000401356:P360T;ENSP00000390240:P208T	ENSP00000363216:P417T	P	-	1	0	OGDHL	50624849	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	9.814000	0.99346	2.736000	0.93811	0.655000	0.94253	CCC	OGDHL	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000197444		0.607	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	40	0.00	0	G	NM_018245		50954843	50954843	-1	no_errors	ENST00000374103	ensembl	human	known	69_37n	missense	64	12.33	9	SNP	1.000	T
OR5L2	26338	genome.wustl.edu	37	11	55595570	55595570	+	Silent	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr11:55595570G>A	ENST00000378397.1	+	1	876	c.876G>A	c.(874-876)ctG>ctA	p.L292L		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TCTACAGCCTGAGAAATAAGG	0.463										HNSCC(27;0.073)																												dbGAP											0													48.0	49.0	49.0					11																	55595570		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.876G>A	11.37:g.55595570G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF66|Q96RB2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L292	ENST00000378397.1	37	c.876	CCDS31511.1	11																																																																																			OR5L2	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000205030		0.463	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	17	0.00	0	G	NM_001004739		55595570	55595570	+1	no_errors	ENST00000378397	ensembl	human	known	69_37n	silent	47	17.54	10	SNP	0.994	A
OR6B1	135946	genome.wustl.edu	37	7	143701740	143701740	+	Silent	SNP	C	C	G			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr7:143701740C>G	ENST00000408922.2	+	1	719	c.651C>G	c.(649-651)tcC>tcG	p.S217S		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					CTGTCCTGTCCTACGGATGCA	0.458																																						dbGAP											0													205.0	195.0	198.0					7																	143701740		2014	4185	6199	-	-	-	SO:0001819	synonymous_variant	0				CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.651C>G	7.37:g.143701740C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2G2|B9EH47|Q6IFP6|Q96R38	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S217	ENST00000408922.2	37	c.651	CCDS43667.1	7																																																																																			OR6B1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221813		0.458	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B1	HGNC	protein_coding	OTTHUMT00000349566.1	62	0.00	0	C			143701740	143701740	+1	no_errors	ENST00000408922	ensembl	human	known	69_37n	silent	165	12.70	24	SNP	0.976	G
OR6C76	390326	genome.wustl.edu	37	12	55820958	55820959	+	Frame_Shift_Ins	INS	-	-	A	rs77587450|rs397719965|rs57387180		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr12:55820958_55820959insA	ENST00000328314.3	+	1	921_922	c.921_922insA	c.(922-924)aaafs	p.K308fs		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H307Q(1)		NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AGATTTCCCACAAAAAAAAAAA	0.337																																						dbGAP											1	Substitution - Missense(1)	NS(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.933dupA	12.37:g.55820969_55820969dupA	ENSP00000328402:p.Lys308fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K311fs	ENST00000328314.3	37	c.921_922	CCDS31823.1	12																																																																																			OR6C76	-	NULL	ENSG00000185821		0.337	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	HGNC	protein_coding	OTTHUMT00000406675.1	9	0.00	0	-	NM_001005183		55820958	55820959	+1	no_errors	ENST00000328314	ensembl	human	known	69_37n	frame_shift_ins	22	26.67	8	INS	0.003:0.016	A
OR8K1	390157	genome.wustl.edu	37	11	56113597	56113597	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr11:56113597G>A	ENST00000279783.2	+	1	177	c.83G>A	c.(82-84)gGg>gAg	p.G28E		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					GACAACCCTGGGCTGCAGGCT	0.458										HNSCC(65;0.19)																												dbGAP											0													116.0	106.0	110.0					11																	56113597		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.83G>A	11.37:g.56113597G>A	ENSP00000279783:p.Gly28Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G28E	ENST00000279783.2	37	c.83	CCDS31528.1	11	.	.	.	.	.	.	.	.	.	.	G	7.385	0.629669	0.14257	.	.	ENSG00000150261	ENST00000279783	T	0.00655	5.95	5.18	-10.2	0.00374	.	1.178250	0.06311	N	0.702633	T	0.00210	0.0006	N	0.00355	-1.605	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46317	-0.9200	10	0.02654	T	1	3.1496	5.3037	0.15791	0.5679:0.1654:0.1841:0.0825	.	28	Q8NGG5	OR8K1_HUMAN	E	28	ENSP00000279783:G28E	ENSP00000279783:G28E	G	+	2	0	OR8K1	55870173	0.000000	0.05858	0.000000	0.03702	0.767000	0.43475	-0.766000	0.04725	-2.166000	0.00780	0.549000	0.68633	GGG	OR8K1	-	NULL	ENSG00000150261		0.458	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K1	HGNC	protein_coding	OTTHUMT00000391605.1	50	0.00	0	G	NM_001002907		56113597	56113597	+1	no_errors	ENST00000279783	ensembl	human	known	69_37n	missense	101	11.30	13	SNP	0.000	A
OR8B3	390271	genome.wustl.edu	37	11	124266647	124266647	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr11:124266647T>C	ENST00000354597.3	-	1	617	c.601A>G	c.(601-603)Att>Gtt	p.I201V		NM_001005467.1	NP_001005467.1	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B, member 3	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CCCACAACAATGAGAACAACC	0.423																																						dbGAP											0													131.0	135.0	134.0					11																	124266647		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB065827	CCDS31709.1	11q24.1	2012-08-09			ENSG00000196661	ENSG00000196661		"""GPCR / Class A : Olfactory receptors"""	8472	protein-coding gene	gene with protein product							Standard	NM_001005467		Approved		uc010saj.2	Q8NGG8	OTTHUMG00000165983	ENST00000354597.3:c.601A>G	11.37:g.124266647T>C	ENSP00000346611:p.Ile201Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFQ8|Q8NGH1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I201V	ENST00000354597.3	37	c.601	CCDS31709.1	11	.	.	.	.	.	.	.	.	.	.	N	0.049	-1.257476	0.01457	.	.	ENSG00000196661	ENST00000354597	T	0.00032	8.88	3.62	-0.265	0.12946	GPCR, rhodopsin-like superfamily (1);	0.552907	0.17564	N	0.169719	T	0.00073	0.0002	N	0.11106	0.095	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.04128	-1.0975	10	0.17832	T	0.49	.	4.9642	0.14082	0.1372:0.3451:0.0:0.5176	.	201	Q8NGG8	OR8B3_HUMAN	V	201	ENSP00000346611:I201V	ENSP00000346611:I201V	I	-	1	0	OR8B3	123771857	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-1.942000	0.01541	-0.059000	0.13154	0.454000	0.30748	ATT	OR8B3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196661		0.423	OR8B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B3	HGNC	protein_coding	OTTHUMT00000387291.1	30	0.00	0	T	NM_001005467		124266647	124266647	-1	no_errors	ENST00000354597	ensembl	human	known	69_37n	missense	86	18.10	19	SNP	0.001	C
OSBPL1A	114876	genome.wustl.edu	37	18	21761133	21761133	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr18:21761133G>T	ENST00000319481.3	-	19	1994	c.1788C>A	c.(1786-1788)ctC>ctA	p.L596L	OSBPL1A_ENST00000399443.3_Silent_p.L83L|OSBPL1A_ENST00000357041.4_Silent_p.L214L	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	596					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)	p.L596L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CAGGATCAGAGAGTGAACTGG	0.483																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											110.0	85.0	94.0					18																	21761133		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1788C>A	18.37:g.21761133G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	pfam_Oxysterol-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pleckstrin_homology,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,prints_Ankyrin_rpt	p.L596	ENST00000319481.3	37	c.1788	CCDS11884.1	18																																																																																			OSBPL1A	-	pfam_Oxysterol-bd	ENSG00000141447		0.483	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL1A	HGNC	protein_coding	OTTHUMT00000254902.1	36	0.00	0	G	NM_080597		21761133	21761133	-1	no_errors	ENST00000319481	ensembl	human	known	69_37n	silent	78	19.59	19	SNP	0.000	T
OSMR	9180	genome.wustl.edu	37	5	38933388	38933388	+	Missense_Mutation	SNP	G	G	T	rs375084696		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr5:38933388G>T	ENST00000274276.3	+	18	3184	c.2782G>T	c.(2782-2784)Gac>Tac	p.D928Y		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	928					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					CATGTTTGGAGACAAGGACAG	0.483																																						dbGAP											0													95.0	99.0	98.0					5																	38933388		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.2782G>T	5.37:g.38933388G>T	ENSP00000274276:p.Asp928Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4E8|Q96QJ6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D928Y	ENST00000274276.3	37	c.2782	CCDS3928.1	5	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488047	0.64074	.	.	ENSG00000145623	ENST00000274276	T	0.54866	0.55	5.58	4.7	0.59300	.	0.229922	0.30658	N	0.009149	T	0.67859	0.2938	M	0.61703	1.905	0.35793	D	0.822527	D	0.89917	1.0	D	0.72625	0.978	T	0.77051	-0.2731	10	0.72032	D	0.01	.	12.3947	0.55378	0.0:0.1693:0.8307:0.0	.	928	Q99650	OSMR_HUMAN	Y	928	ENSP00000274276:D928Y	ENSP00000274276:D928Y	D	+	1	0	OSMR	38969145	1.000000	0.71417	0.426000	0.26672	0.949000	0.60115	3.468000	0.53086	1.310000	0.45006	0.655000	0.94253	GAC	OSMR	-	NULL	ENSG00000145623		0.483	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OSMR	HGNC	protein_coding	OTTHUMT00000207609.2	34	0.00	0	G	NM_003999		38933388	38933388	+1	no_errors	ENST00000274276	ensembl	human	known	69_37n	missense	61	19.74	15	SNP	0.937	T
PCDH1	5097	genome.wustl.edu	37	5	141244076	141244076	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr5:141244076T>C	ENST00000394536.3	-	3	1959	c.1820A>G	c.(1819-1821)gAc>gGc	p.D607G	PCDH1_ENST00000536585.1_Missense_Mutation_p.D585G|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000456271.1_Missense_Mutation_p.D595G|PCDH1_ENST00000287008.3_Missense_Mutation_p.D607G|PCDH1_ENST00000503492.1_Intron	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	607	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GGGGTCATTGTCATTGCAGTC	0.542																																					Ovarian(132;1609 1739 4190 14731 45037)	dbGAP											0													83.0	75.0	78.0					5																	141244076		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1820A>G	5.37:g.141244076T>C	ENSP00000378043:p.Asp607Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUP2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D607G	ENST00000394536.3	37	c.1820	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	t	17.44	3.389687	0.61956	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59	5.76	5.76	0.90799	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.53938	D	0.000044	D	0.90154	0.6923	H	0.98559	4.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93551	0.6886	10	0.87932	D	0	.	14.0375	0.64654	0.0:0.0:0.0:1.0	.	607;607	Q08174;Q08174-2	PCDH1_HUMAN;.	G	607;607;595;618;585	ENSP00000287008:D607G;ENSP00000378043:D607G;ENSP00000403497:D595G;ENSP00000350122:D618G;ENSP00000438825:D585G	ENSP00000287008:D607G	D	-	2	0	PCDH1	141224260	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.212000	0.71576	0.454000	0.30748	GAC	PCDH1	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000156453		0.542	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	33	0.00	0	T	NM_032420		141244076	141244076	-1	no_errors	ENST00000287008	ensembl	human	known	69_37n	missense	54	20.59	14	SNP	1.000	C
PEX14	5195	genome.wustl.edu	37	1	10596278	10596278	+	Silent	SNP	G	G	T	rs139797106		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:10596278G>T	ENST00000356607.4	+	3	173	c.93G>T	c.(91-93)acG>acT	p.T31T	PEX14_ENST00000538836.1_Intron|PEX14_ENST00000492696.1_3'UTR	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	31					microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		AGATTGCCACGGCAGTGAAGT	0.463																																						dbGAP											0													54.0	55.0	55.0					1																	10596278		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.93G>T	1.37:g.10596278G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N1|B3KML6|B7Z1N2|Q8WX51	Silent	SNP	pfam_Pex14_N	p.T31	ENST00000356607.4	37	c.93	CCDS30582.1	1																																																																																			PEX14	-	pfam_Pex14_N	ENSG00000142655		0.463	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX14	HGNC	protein_coding	OTTHUMT00000005414.1	50	0.00	0	G			10596278	10596278	+1	no_errors	ENST00000356607	ensembl	human	known	69_37n	silent	84	14.29	14	SNP	0.895	T
PIAS1	8554	genome.wustl.edu	37	15	68438931	68438931	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr15:68438931G>T	ENST00000249636.6	+	6	869	c.721G>T	c.(721-723)Gtg>Ttg	p.V241L	PIAS1_ENST00000545237.1_Missense_Mutation_p.V243L	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	241	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.V241L(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						AAAAAATGGCGTGGAACCAAA	0.368																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											95.0	90.0	91.0					15																	68438931		1825	4074	5899	-	-	-	SO:0001583	missense	0			AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.721G>T	15.37:g.68438931G>T	ENSP00000249636:p.Val241Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.V241L	ENST00000249636.6	37	c.721	CCDS45290.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.264597	0.95399	.	.	ENSG00000033800	ENST00000249636;ENST00000545237	T;T	0.43294	0.95;0.95	5.55	5.55	0.83447	PINIT domain (1);	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	M	0.64567	1.98	0.80722	D	1	P;P	0.52316	0.952;0.893	P;P	0.58077	0.832;0.627	T	0.62077	-0.6930	10	0.72032	D	0.01	-9.8198	19.5037	0.95106	0.0:0.0:1.0:0.0	.	241;241	C5J4B4;O75925	.;PIAS1_HUMAN	L	241;243	ENSP00000249636:V241L;ENSP00000438574:V243L	ENSP00000249636:V241L	V	+	1	0	PIAS1	66225985	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.596000	0.87737	0.655000	0.94253	GTG	PIAS1	-	NULL	ENSG00000033800		0.368	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS1	HGNC	protein_coding	OTTHUMT00000419642.2	53	0.00	0	G			68438931	68438931	+1	no_errors	ENST00000249636	ensembl	human	known	69_37n	missense	99	13.91	16	SNP	1.000	T
PIAS1	8554	genome.wustl.edu	37	15	68438944	68438944	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr15:68438944G>T	ENST00000249636.6	+	6	882	c.734G>T	c.(733-735)cGa>cTa	p.R245L	PIAS1_ENST00000545237.1_Missense_Mutation_p.R247L	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	245	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R245L(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						GAACCAAAGCGACCCAGCCGA	0.378																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											114.0	108.0	110.0					15																	68438944		1832	4072	5904	-	-	-	SO:0001583	missense	0			AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.734G>T	15.37:g.68438944G>T	ENSP00000249636:p.Arg245Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.R245L	ENST00000249636.6	37	c.734	CCDS45290.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.307116	0.95629	.	.	ENSG00000033800	ENST00000249636;ENST00000545237	T;T	0.39592	1.08;1.07	5.54	5.54	0.83059	PINIT domain (1);	0.061993	0.64402	D	0.000003	T	0.71358	0.3330	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.76418	-0.2966	10	0.87932	D	0	-8.5286	19.4841	0.95022	0.0:0.0:1.0:0.0	.	245;245	C5J4B4;O75925	.;PIAS1_HUMAN	L	245;247	ENSP00000249636:R245L;ENSP00000438574:R247L	ENSP00000249636:R245L	R	+	2	0	PIAS1	66225998	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.592000	0.87571	0.650000	0.86243	CGA	PIAS1	-	NULL	ENSG00000033800		0.378	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS1	HGNC	protein_coding	OTTHUMT00000419642.2	61	0.00	0	G			68438944	68438944	+1	no_errors	ENST00000249636	ensembl	human	known	69_37n	missense	90	24.59	30	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	67	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	115	16.67	23	SNP	1.000	A
POLDIP3	84271	genome.wustl.edu	37	22	42992321	42992321	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr22:42992321G>T	ENST00000252115.5	-	5	788	c.684C>A	c.(682-684)acC>acA	p.T228T	POLDIP3_ENST00000348657.2_Silent_p.T199T|POLDIP3_ENST00000339677.6_Intron|POLDIP3_ENST00000491021.1_5'UTR|POLDIP3_ENST00000451060.2_Silent_p.T72T	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	228					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.T228T(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						GAACCACTTTGGTGAGAGGGA	0.493																																					Ovarian(52;967 1128 5875 19997 42537)	dbGAP											1	Substitution - coding silent(1)	endometrium(1)											116.0	108.0	111.0					22																	42992321		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.684C>A	22.37:g.42992321G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T228	ENST00000252115.5	37	c.684	CCDS14038.1	22	.	.	.	.	.	.	.	.	.	.	G	9.691	1.151813	0.21371	.	.	ENSG00000100227	ENST00000452567	.	.	.	5.82	3.7	0.42460	.	.	.	.	.	T	0.60856	0.2301	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61113	-0.7128	5	0.87932	D	0	-31.124	5.1934	0.15223	0.1549:0.0:0.4224:0.4227	.	.	.	.	Q	163	.	ENSP00000394315:P163Q	P	-	2	0	POLDIP3	41322265	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.947000	0.40293	0.762000	0.33152	0.563000	0.77884	CCA	POLDIP3	-	NULL	ENSG00000100227		0.493	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLDIP3	HGNC	protein_coding	OTTHUMT00000320433.1	75	0.00	0	G	NM_032311		42992321	42992321	-1	no_errors	ENST00000252115	ensembl	human	known	69_37n	silent	104	15.45	19	SNP	1.000	T
PTPRK	5796	genome.wustl.edu	37	6	128294905	128294905	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr6:128294905G>T	ENST00000368215.3	-	28	4033	c.4034C>A	c.(4033-4035)cCt>cAt	p.P1345H	PTPRK_ENST00000368213.5_Missense_Mutation_p.P1352H|PTPRK_ENST00000368227.3_Missense_Mutation_p.P1363H|PTPRK_ENST00000532331.1_Missense_Mutation_p.P1368H|PTPRK_ENST00000368207.3_Missense_Mutation_p.P1378H|PTPRK_ENST00000368210.3_Missense_Mutation_p.P1364H|PTPRK_ENST00000368226.4_Missense_Mutation_p.P1346H			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1345	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTTGGATCCAGGCACTTCTCG	0.478																																						dbGAP											0													126.0	115.0	119.0					6																	128294905		2203	4300	6503	-	-	-	SO:0001583	missense	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.4034C>A	6.37:g.128294905G>T	ENSP00000357198:p.Pro1345His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.P1363H	ENST00000368215.3	37	c.4088		6	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008267	0.93346	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.82	5.82	0.92795	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.72622	0.3483	H	0.99261	4.49	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.84547	0.0642	10	0.87932	D	0	.	20.0789	0.97764	0.0:0.0:1.0:0.0	.	1368;1352;1345;1346	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	H	1346;1363;1368;1352;1364;1345;1378	ENSP00000357209:P1346H;ENSP00000357210:P1363H;ENSP00000432973:P1368H;ENSP00000357196:P1352H;ENSP00000357193:P1364H;ENSP00000357198:P1345H;ENSP00000357190:P1378H	ENSP00000357190:P1378H	P	-	2	0	PTPRK	128336598	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.810000	0.99221	2.750000	0.94351	0.655000	0.94253	CCT	PTPRK	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000152894		0.478	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1	38	0.00	0	G			128294905	128294905	-1	no_errors	ENST00000368227	ensembl	human	known	69_37n	missense	61	11.59	8	SNP	1.000	T
RAB3A	5864	genome.wustl.edu	37	19	18309636	18309636	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:18309636G>A	ENST00000222256.4	-	4	549	c.371C>T	c.(370-372)tCa>tTa	p.S124L	RAB3A_ENST00000464076.3_Missense_Mutation_p.S29L	NM_002866.4	NP_002857.1	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	124					axonogenesis (GO:0007409)|constitutive secretory pathway (GO:0045054)|glutamate secretion (GO:0014047)|GTP catabolic process (GO:0006184)|lung development (GO:0030324)|maintenance of presynaptic active zone structure (GO:0048790)|mitochondrion organization (GO:0007005)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|positive regulation of exocytosis (GO:0045921)|post-embryonic development (GO:0009791)|protein transport (GO:0015031)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|respiratory system process (GO:0003016)|response to electrical stimulus (GO:0051602)|sensory perception of touch (GO:0050975)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle recycling (GO:0036465)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.S124*(1)		NS(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	8						ATTGTCCCATGAGTAGGTCTT	0.592																																						dbGAP											1	Substitution - Nonsense(1)	kidney(1)											125.0	95.0	105.0					19																	18309636		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12372.1	19p13.2	2008-07-17			ENSG00000105649	ENSG00000105649		"""RAB, member RAS oncogene"""	9777	protein-coding gene	gene with protein product	"""RAS-associated protein RAB3A"""	179490				2687157, 7532276	Standard	NM_002866		Approved		uc002nie.2	P20336	OTTHUMG00000137378	ENST00000222256.4:c.371C>T	19.37:g.18309636G>A	ENSP00000222256:p.Ser124Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0J4|Q9NYE1	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S124L	ENST00000222256.4	37	c.371	CCDS12372.1	19	.	.	.	.	.	.	.	.	.	.	G	34	5.293725	0.95546	.	.	ENSG00000105649	ENST00000222256	T	0.75938	-0.98	5.35	5.35	0.76521	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	L	0.39692	1.235	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83496	0.0072	10	0.87932	D	0	-10.6835	16.5307	0.84357	0.0:0.0:1.0:0.0	.	124	P20336	RAB3A_HUMAN	L	124	ENSP00000222256:S124L	ENSP00000222256:S124L	S	-	2	0	RAB3A	18170636	1.000000	0.71417	0.937000	0.37676	0.982000	0.71751	9.630000	0.98420	2.492000	0.84095	0.561000	0.74099	TCA	RAB3A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000105649		0.592	RAB3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3A	HGNC	protein_coding	OTTHUMT00000268056.2	41	0.00	0	G	NM_002866		18309636	18309636	-1	no_errors	ENST00000222256	ensembl	human	known	69_37n	missense	96	12.73	14	SNP	1.000	A
RAPGEF2	9693	genome.wustl.edu	37	4	160235812	160235812	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr4:160235812G>T	ENST00000264431.4	+	3	681	c.262G>T	c.(262-264)Gac>Tac	p.D88Y	RAPGEF2_ENST00000504604.1_3'UTR	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	88					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TTCCGAAGACGACGACGATGA	0.478																																						dbGAP											0													119.0	126.0	124.0					4																	160235812		2051	4196	6247	-	-	-	SO:0001583	missense	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.262G>T	4.37:g.160235812G>T	ENSP00000264431:p.Asp88Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP27	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.D88Y	ENST00000264431.4	37	c.262	CCDS43277.1	4	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174798	0.57692	.	.	ENSG00000109756	ENST00000505478;ENST00000511336;ENST00000510510;ENST00000264431;ENST00000514565	T	0.39406	1.08	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.58163	0.2103	L	0.39898	1.24	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.59931	-0.7361	10	0.87932	D	0	.	19.4806	0.95008	0.0:0.0:1.0:0.0	.	88	Q9Y4G8	RPGF2_HUMAN	Y	244;16;86;88;69	ENSP00000264431:D88Y	ENSP00000264431:D88Y	D	+	1	0	RAPGEF2	160455262	1.000000	0.71417	0.172000	0.22920	0.050000	0.14768	9.869000	0.99810	2.591000	0.87537	0.585000	0.79938	GAC	RAPGEF2	-	NULL	ENSG00000109756		0.478	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	HGNC	protein_coding	OTTHUMT00000364980.2	69	0.00	0	G	NM_014247		160235812	160235812	+1	no_errors	ENST00000264431	ensembl	human	known	69_37n	missense	79	13.19	12	SNP	1.000	T
RBBP8	5932	genome.wustl.edu	37	18	20596862	20596862	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr18:20596862G>T	ENST00000399722.2	+	17	2780	c.2429G>T	c.(2428-2430)gGg>gTg	p.G810V	RBBP8_ENST00000581687.1_5'UTR|RBBP8_ENST00000360790.5_Missense_Mutation_p.G815V|RBBP8_ENST00000399725.2_Intron|RBBP8_ENST00000327155.5_Missense_Mutation_p.G810V	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	810					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.G810V(1)		central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			AAACTGCTTGGGCACACGTGT	0.318								Homologous recombination																														dbGAP											1	Substitution - Missense(1)	endometrium(1)											107.0	109.0	108.0					18																	20596862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.2429G>T	18.37:g.20596862G>T	ENSP00000382628:p.Gly810Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	pfam_CtIP_N,pfam_DNA-repair_Sae2/CtIP	p.G810V	ENST00000399722.2	37	c.2429	CCDS11875.1	18	.	.	.	.	.	.	.	.	.	.	g	21.1	4.093801	0.76870	.	.	ENSG00000101773	ENST00000327155;ENST00000399722;ENST00000360790	T;T;T	0.63096	-0.02;-0.02;-0.01	5.33	4.46	0.54185	.	0.110694	0.64402	D	0.000008	T	0.80783	0.4689	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84031	0.0359	10	0.87932	D	0	-7.3178	13.0342	0.58860	0.0777:0.0:0.9223:0.0	.	815;810	E7ETY1;Q99708	.;COM1_HUMAN	V	810;810;815	ENSP00000323050:G810V;ENSP00000382628:G810V;ENSP00000354024:G815V	ENSP00000323050:G810V	G	+	2	0	RBBP8	18850860	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.252000	0.78309	1.253000	0.44018	0.637000	0.83480	GGG	RBBP8	-	pfam_DNA-repair_Sae2/CtIP	ENSG00000101773		0.318	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBBP8	HGNC	protein_coding	OTTHUMT00000446387.1	79	0.00	0	G	NM_203291		20596862	20596862	+1	no_errors	ENST00000327155	ensembl	human	known	69_37n	missense	97	20.33	25	SNP	1.000	T
RBM18	92400	genome.wustl.edu	37	9	125023778	125023778	+	5'UTR	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr9:125023778C>T	ENST00000417201.3	-	0	134				RBM18_ENST00000483428.1_5'UTR	NM_033117.3	NP_149108.1	Q96H35	RBM18_HUMAN	RNA binding motif protein 18								nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7						CCATCAATGTCTATGAAATAC	0.423																																						dbGAP											0													104.0	98.0	100.0					9																	125023778		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK057676	CCDS6839.1	9q34.11	2013-02-12			ENSG00000119446	ENSG00000119446		"""RNA binding motif (RRM) containing"""	28413	protein-coding gene	gene with protein product						12477932	Standard	NM_033117		Approved	MGC2734	uc004bma.2	Q96H35	OTTHUMG00000020602	ENST00000417201.3:c.-7G>A	9.37:g.125023778C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ89	RNA	SNP	-	NULL	ENST00000417201.3	37	NULL	CCDS6839.1	9																																																																																			RBM18	-	-	ENSG00000119446		0.423	RBM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM18	HGNC	protein_coding	OTTHUMT00000053928.2	70	0.00	0	C	NM_033117		125023778	125023778	-1	no_errors	ENST00000483428	ensembl	human	known	69_37n	rna	102	15.70	19	SNP	1.000	T
RNF40	9810	genome.wustl.edu	37	16	30779332	30779332	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr16:30779332G>T	ENST00000324685.6	+	12	1982	c.1547G>T	c.(1546-1548)gGc>gTc	p.G516V	RNF40_ENST00000563683.1_Missense_Mutation_p.G476V|RNF40_ENST00000357890.5_Missense_Mutation_p.G416V|RNF40_ENST00000402121.3_Missense_Mutation_p.G208V	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	516					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GCTGAGATTGGCAAGGTGAGA	0.537																																						dbGAP											0													102.0	105.0	104.0					16																	30779332		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.1547G>T	16.37:g.30779332G>T	ENSP00000325677:p.Gly516Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.G516V	ENST00000324685.6	37	c.1547	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	G	8.635	0.894495	0.17613	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121	T;T;T	0.20069	2.1;2.1;2.1	5.76	3.77	0.43336	.	0.259139	0.44688	D	0.000427	T	0.14313	0.0346	N	0.17474	0.49	0.53688	D	0.999977	B;D;B;B	0.53745	0.009;0.962;0.177;0.282	B;P;B;B	0.46685	0.008;0.524;0.111;0.111	T	0.07252	-1.0782	10	0.19147	T	0.46	-8.7354	9.6771	0.40047	0.0741:0.2843:0.6416:0.0	.	208;416;516;516	F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;BRE1B_HUMAN	V	516;416;208	ENSP00000325677:G516V;ENSP00000350563:G416V;ENSP00000384942:G208V	ENSP00000325677:G516V	G	+	2	0	RNF40	30686833	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	2.901000	0.48695	0.765000	0.33221	0.655000	0.94253	GGC	RNF40	-	NULL	ENSG00000103549		0.537	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	32	0.00	0	G	NM_014771		30779332	30779332	+1	no_errors	ENST00000324685	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	1.000	T
RRM2	6241	genome.wustl.edu	37	2	10269209	10269209	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr2:10269209G>A	ENST00000304567.5	+	9	1014	c.945G>A	c.(943-945)atG>atA	p.M315I	RRM2_ENST00000360566.2_Missense_Mutation_p.M375I	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2	315					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	TCATTGGGATGAATTGCACTC	0.418																																						dbGAP											0													179.0	178.0	179.0					2																	10269209		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449	ENST00000304567.5:c.945G>A	2.37:g.10269209G>A	ENSP00000302955:p.Met315Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9B5|J3KP43|Q5WRU7	Missense_Mutation	SNP	pfam_Ribonucl_Rdtase_small,superfamily_Ferritin/RR-like	p.M375I	ENST00000304567.5	37	c.1125	CCDS1669.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173251	0.78452	.	.	ENSG00000171848	ENST00000360566;ENST00000304567;ENST00000474701	D;D;D	0.97303	-4.33;-4.33;-4.33	6.08	6.08	0.98989	Ferritin/ribonucleotide reductase-like (1);Ribonucleotide reductase-related (1);	0.035607	0.85682	D	0.000000	D	0.97436	0.9161	M	0.87617	2.895	0.80722	D	1	B	0.18461	0.028	B	0.26517	0.07	D	0.94611	0.7804	10	0.66056	D	0.02	-8.9519	20.6634	0.99662	0.0:0.0:1.0:0.0	.	315	P31350	RIR2_HUMAN	I	375;315;265	ENSP00000353770:M375I;ENSP00000302955:M315I;ENSP00000419177:M265I	ENSP00000302955:M315I	M	+	3	0	RRM2	10186660	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.624000	0.98398	2.894000	0.99253	0.655000	0.94253	ATG	RRM2	-	pfam_Ribonucl_Rdtase_small,superfamily_Ferritin/RR-like	ENSG00000171848		0.418	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	RRM2	HGNC	protein_coding	OTTHUMT00000364902.2	105	0.00	0	G			10269209	10269209	+1	no_errors	ENST00000360566	ensembl	human	known	69_37n	missense	240	11.11	30	SNP	1.000	A
SELP	6403	genome.wustl.edu	37	1	169565174	169565174	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr1:169565174G>T	ENST00000263686.6	-	12	2127	c.2090C>A	c.(2089-2091)cCa>cAa	p.P697Q	SELP_ENST00000367794.2_Missense_Mutation_p.P635Q|SELP_ENST00000367788.2_Missense_Mutation_p.P635Q|SELP_ENST00000367791.2_Missense_Mutation_p.P511Q|SELP_ENST00000458599.2_Missense_Mutation_p.P513Q|SELP_ENST00000367792.2_Missense_Mutation_p.P513Q|SELP_ENST00000367786.2_Missense_Mutation_p.P635Q|SELP_ENST00000367793.2_Missense_Mutation_p.P635Q	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	697	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TCTGCATGCTGGAGTTACTGC	0.488																																						dbGAP											0													386.0	369.0	375.0					1																	169565174		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.2090C>A	1.37:g.169565174G>T	ENSP00000263686:p.Pro697Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R344|Q8IVD1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.P697Q	ENST00000263686.6	37	c.2090	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962449	0.53400	.	.	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367788;ENST00000367786;ENST00000458599	D;D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	4.22	4.22	0.49857	Complement control module (3);Sushi/SCR/CCP (3);	0.000000	0.53938	D	0.000042	D	0.95370	0.8497	H	0.99286	4.5	0.18873	N	0.999981	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.989	D	0.89265	0.3600	10	0.87932	D	0	-13.6558	12.2662	0.54679	0.0:0.0:1.0:0.0	.	697;697;697	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	Q	511;697;696;513;697;697;635;635;513;511;635;635;620	ENSP00000263686:P697Q;ENSP00000356767:P635Q;ENSP00000356768:P635Q;ENSP00000356766:P513Q;ENSP00000356765:P511Q;ENSP00000356762:P635Q;ENSP00000356760:P635Q	ENSP00000263686:P697Q	P	-	2	0	SELP	167831798	0.998000	0.40836	0.055000	0.19348	0.287000	0.27160	4.969000	0.63735	2.328000	0.79073	0.563000	0.77884	CCA	SELP	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000174175		0.488	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4	50	0.00	0	G	NM_003005		169565174	169565174	-1	no_errors	ENST00000263686	ensembl	human	known	69_37n	missense	126	12.50	18	SNP	0.108	T
SLCO4A1	28231	genome.wustl.edu	37	20	61297777	61297777	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr20:61297777G>T	ENST00000370507.1	+	6	1418	c.1322G>T	c.(1321-1323)gGc>gTc	p.G441V	RP11-93B14.5_ENST00000433126.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.G441V|SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000451648.1_RNA			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	441					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TTCCTGGGCGGCTTCTTTGTG	0.647																																					Pancreas(168;741 2006 10379 40139 45334)	dbGAP											0													97.0	95.0	95.0					20																	61297777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1322G>T	20.37:g.61297777G>T	ENSP00000359538:p.Gly441Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.G441V	ENST00000370507.1	37	c.1322	CCDS13501.1	20	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231954	0.79688	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674	T;T	0.81078	-1.45;-1.45	4.71	4.71	0.59529	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.93334	0.7875	H	0.96748	3.875	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95802	0.8834	10	0.87932	D	0	.	17.6438	0.88144	0.0:0.0:1.0:0.0	.	441	Q96BD0	SO4A1_HUMAN	V	441;441;441;293	ENSP00000217159:G441V;ENSP00000359538:G441V	ENSP00000217159:G441V	G	+	2	0	SLCO4A1	60768222	1.000000	0.71417	0.995000	0.50966	0.763000	0.43281	9.271000	0.95698	2.165000	0.68154	0.555000	0.69702	GGC	SLCO4A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000101187		0.647	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4A1	HGNC	protein_coding	OTTHUMT00000080048.2	48	0.00	0	G	NM_016354		61297777	61297777	+1	no_errors	ENST00000217159	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	1.000	T
SMYD4	114826	genome.wustl.edu	37	17	1703986	1703986	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:1703986G>T	ENST00000305513.7	-	5	869	c.702C>A	c.(700-702)tcC>tcA	p.S234S		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	234	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						ATAAGCCGATGGATGATGAGG	0.507																																						dbGAP											0													175.0	168.0	171.0					17																	1703986		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.702C>A	17.37:g.1703986G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.S234	ENST00000305513.7	37	c.702	CCDS11013.1	17																																																																																			SMYD4	-	NULL	ENSG00000186532		0.507	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	64	0.00	0	G	XM_056082		1703986	1703986	-1	no_errors	ENST00000305513	ensembl	human	known	69_37n	silent	92	10.68	11	SNP	0.667	T
SORCS2	57537	genome.wustl.edu	37	4	7714483	7714483	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr4:7714483G>T	ENST00000507866.2	+	15	2001	c.1892G>T	c.(1891-1893)cGc>cTc	p.R631L	SORCS2_ENST00000329016.9_Missense_Mutation_p.R459L	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	631					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						ATCAGCTTCCGCTCCGATTGG	0.587																																						dbGAP											0													55.0	60.0	58.0					4																	7714483		2030	4202	6232	-	-	-	SO:0001583	missense	0			AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.1892G>T	4.37:g.7714483G>T	ENSP00000422185:p.Arg631Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L7	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.R631L	ENST00000507866.2	37	c.1892	CCDS47008.1	4	.	.	.	.	.	.	.	.	.	.	G	19.27	3.794630	0.70452	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.30714	1.52;1.52	3.91	3.91	0.45181	VPS10 (1);	0.000000	0.64402	D	0.000001	T	0.59169	0.2174	M	0.86178	2.8	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	T	0.68112	-0.5495	10	0.72032	D	0.01	.	14.8411	0.70226	0.0:0.0:1.0:0.0	.	459;631	B5MED8;Q96PQ0	.;SORC2_HUMAN	L	631;459	ENSP00000422185:R631L;ENSP00000329124:R459L	ENSP00000329124:R459L	R	+	2	0	SORCS2	7765383	1.000000	0.71417	0.999000	0.59377	0.399000	0.30720	7.660000	0.83776	1.992000	0.58205	0.563000	0.77884	CGC	SORCS2	-	smart_VPS10	ENSG00000184985		0.587	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS2	HGNC	protein_coding	OTTHUMT00000358685.4	34	0.00	0	G	NM_020777		7714483	7714483	+1	no_errors	ENST00000507866	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
SPOCK1	6695	genome.wustl.edu	37	5	136328289	136328289	+	Splice_Site	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr5:136328289G>T	ENST00000394945.1	-	7	759	c.590C>A	c.(589-591)gCc>gAc	p.A197D	SPOCK1_ENST00000282223.7_Splice_Site_p.A197D	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	197					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTCTGTGCAGGCTAGAGAAAA	0.542																																						dbGAP											0													91.0	87.0	88.0					5																	136328289		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.590-1C>A	5.37:g.136328289G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Thyroglobulin_1,smart_Prot_inh_Kazal,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.A197D	ENST00000394945.1	37	c.590	CCDS4191.1	5	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012308	0.35511	.	.	ENSG00000152377	ENST00000394945;ENST00000282223;ENST00000510689	T;T;T	0.46819	0.91;0.91;0.86	5.89	4.98	0.66077	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.563584	0.18424	N	0.141657	T	0.34978	0.0916	N	0.19112	0.55	0.40639	D	0.981922	B	0.26708	0.157	B	0.31016	0.123	T	0.25572	-1.0128	10	0.56958	D	0.05	.	11.2566	0.49058	0.0748:0.1404:0.7848:0.0	.	197	Q08629	TICN1_HUMAN	D	197;197;52	ENSP00000378401:A197D;ENSP00000282223:A197D;ENSP00000421677:A52D	ENSP00000282223:A197D	A	-	2	0	SPOCK1	136356188	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	2.742000	0.47434	2.794000	0.96219	0.655000	0.94253	GCC	SPOCK1	-	pfam_SPARC/Testican_Ca-bd-dom	ENSG00000152377		0.542	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOCK1	HGNC	protein_coding	OTTHUMT00000251222.1	44	0.00	0	G	NM_004598	Missense_Mutation	136328289	136328289	-1	no_errors	ENST00000282223	ensembl	human	known	69_37n	missense	80	13.98	13	SNP	0.998	T
TBC1D3P5	440419	genome.wustl.edu	37	17	25753496	25753496	+	RNA	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:25753496G>T	ENST00000586223.1	+	0	1506					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		ATCTCTCTCGGGCTCACCCCG	0.567																																						dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25753496G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.567	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	44	0.00	0	G	NR_033892		25753496	25753496	+1	no_errors	ENST00000586223	ensembl	human	known	69_37n	rna	51	12.07	7	SNP	1.000	T
SUPT6H	6830	genome.wustl.edu	37	17	27002030	27002030	+	Missense_Mutation	SNP	G	G	T	rs376272646		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:27002030G>T	ENST00000314616.6	+	5	671	c.388G>T	c.(388-390)Gat>Tat	p.D130Y	AC010761.13_ENST00000578819.1_RNA|SUPT6H_ENST00000347486.4_Missense_Mutation_p.D130Y	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	130	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D130Y(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGACGAGGACGATGACGAGGA	0.498																																						dbGAP											1	Substitution - Missense(1)	lung(1)											92.0	84.0	87.0					17																	27002030		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.388G>T	17.37:g.27002030G>T	ENSP00000319104:p.Asp130Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.D130Y	ENST00000314616.6	37	c.388	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161209	0.57368	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.41	5.41	0.78517	.	0.046129	0.85682	D	0.000000	T	0.74809	0.3765	M	0.65975	2.015	0.80722	D	1	D	0.60575	0.988	P	0.56088	0.791	T	0.77446	-0.2585	9	0.87932	D	0	-24.5167	19.558	0.95361	0.0:0.0:1.0:0.0	.	130	Q7KZ85	SPT6H_HUMAN	Y	130	.	ENSP00000319104:D130Y	D	+	1	0	SUPT6H	24026157	1.000000	0.71417	0.961000	0.40146	0.628000	0.37860	7.049000	0.76613	2.697000	0.92050	0.655000	0.94253	GAT	SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	41	0.00	0	G	NM_003170		27002030	27002030	+1	no_errors	ENST00000314616	ensembl	human	known	69_37n	missense	62	20.51	16	SNP	1.000	T
TEX264	51368	genome.wustl.edu	37	3	51718482	51718482	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr3:51718482G>T	ENST00000415259.1	+	3	1393	c.312G>T	c.(310-312)gaG>gaT	p.E104D	TEX264_ENST00000463857.1_3'UTR|TEX264_ENST00000341333.5_Missense_Mutation_p.E104D|TEX264_ENST00000457573.1_Missense_Mutation_p.E104D|TEX264_ENST00000395057.1_Missense_Mutation_p.E104D|TEX264_ENST00000416589.1_Missense_Mutation_p.E104D			Q9Y6I9	TX264_HUMAN	testis expressed 264	104						extracellular vesicular exosome (GO:0070062)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		GTGAAGGTGAGGAATCGCCCT	0.587																																						dbGAP											0													70.0	57.0	62.0					3																	51718482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072733	CCDS2833.1, CCDS74945.1	3p21	2007-03-13	2007-03-13		ENSG00000164081	ENSG00000164081			30247	protein-coding gene	gene with protein product			"""testis expressed gene 264"", ""testis expressed sequence 264"""			12975309	Standard	NM_001243725		Approved	ZSIG11, FLJ13935	uc003dbm.4	Q9Y6I9	OTTHUMG00000156901	ENST00000415259.1:c.312G>T	3.37:g.51718482G>T	ENSP00000396628:p.Glu104Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN87|Q9UKD7	Missense_Mutation	SNP	superfamily_Reg_factor_effector_bac	p.E104D	ENST00000415259.1	37	c.312	CCDS2833.1	3	.	.	.	.	.	.	.	.	.	.	G	10.93	1.488992	0.26686	.	.	ENSG00000164081	ENST00000419358;ENST00000457573;ENST00000341333;ENST00000412249;ENST00000425781;ENST00000415259;ENST00000395057;ENST00000416589;ENST00000457927;ENST00000444233	T;T;T;T;T;T;T;T;T	0.02446	4.29;4.29;4.29;4.29;4.29;4.29;4.29;4.29;4.29	4.45	1.58	0.23477	Regulatory factor, effector, bacterial (1);	0.113275	0.64402	D	0.000017	T	0.01835	0.0058	N	0.21282	0.65	0.37561	D	0.919065	B;B	0.21071	0.051;0.004	B;B	0.23716	0.048;0.019	T	0.52328	-0.8590	10	0.31617	T	0.26	-5.1856	0.9419	0.01357	0.2425:0.1249:0.3943:0.2383	.	104;104	Q53GI2;Q9Y6I9	.;TX264_HUMAN	D	104	ENSP00000408186:E104D;ENSP00000340969:E104D;ENSP00000393736:E104D;ENSP00000405783:E104D;ENSP00000396628:E104D;ENSP00000378497:E104D;ENSP00000398802:E104D;ENSP00000407151:E104D;ENSP00000415957:E104D	ENSP00000340969:E104D	E	+	3	2	TEX264	51693522	0.835000	0.29415	0.994000	0.49952	0.784000	0.44337	-0.067000	0.11579	0.316000	0.23135	0.305000	0.20034	GAG	TEX264	-	superfamily_Reg_factor_effector_bac	ENSG00000164081		0.587	TEX264-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TEX264	HGNC	protein_coding	OTTHUMT00000346530.1	36	0.00	0	G	NM_015926		51718482	51718482	+1	no_errors	ENST00000341333	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.959	T
TM9SF4	9777	genome.wustl.edu	37	20	30729674	30729674	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr20:30729674G>T	ENST00000398022.2	+	5	739	c.504G>T	c.(502-504)cgG>cgT	p.R168R	TM9SF4_ENST00000217315.5_Silent_p.R151R	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	168						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ACGGCTACCGGCTCGGCTTCA	0.562																																						dbGAP											0													130.0	139.0	136.0					20																	30729674		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.504G>T	20.37:g.30729674G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYT7|Q9NUA3	Silent	SNP	pfam_EMP70	p.R168	ENST00000398022.2	37	c.504	CCDS13196.2	20																																																																																			TM9SF4	-	pfam_EMP70	ENSG00000101337		0.562	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF4	HGNC	protein_coding	OTTHUMT00000323568.1	49	0.00	0	G	NM_014742		30729674	30729674	+1	no_errors	ENST00000398022	ensembl	human	known	69_37n	silent	68	10.39	8	SNP	1.000	T
TMEM38A	79041	genome.wustl.edu	37	19	16798954	16798954	+	Splice_Site	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:16798954G>T	ENST00000187762.2	+	6	763		c.e6-1			NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						CCCCACCTCAGGTGTTTCTGA	0.607																																						dbGAP											0													179.0	191.0	187.0					19																	16798954		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.673-1G>T	19.37:g.16798954G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9P9	Splice_Site	SNP	-	e6-1	ENST00000187762.2	37	c.673-1	CCDS12349.1	19	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377410	0.61735	.	.	ENSG00000072954	ENST00000187762	.	.	.	4.27	4.27	0.50696	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6941	0.77481	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM38A	16659954	1.000000	0.71417	0.994000	0.49952	0.741000	0.42261	8.793000	0.91862	1.936000	0.56123	0.462000	0.41574	.	TMEM38A	-	-	ENSG00000072954		0.607	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38A	HGNC	protein_coding	OTTHUMT00000462841.1	35	0.00	0	G	NM_024074	Intron	16798954	16798954	+1	no_errors	ENST00000187762	ensembl	human	known	69_37n	splice_site	46	11.54	6	SNP	1.000	T
TMEM67	91147	genome.wustl.edu	37	8	94770765	94770765	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr8:94770765G>T	ENST00000453321.3	+	3	425	c.367G>T	c.(367-369)Gcc>Tcc	p.A123S	TMEM67_ENST00000409623.3_5'UTR	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	123					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			TGACTTAACTGCCGAAGGAAA	0.308																																						dbGAP											0													115.0	117.0	117.0					8																	94770765		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.367G>T	8.37:g.94770765G>T	ENSP00000389998:p.Ala123Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	pfam_Meckelin,superfamily_Growth_fac_rcpt	p.A123S	ENST00000453321.3	37	c.367	CCDS6258.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.67|12.67	2.007619|2.007619	0.35415|0.35415	.|.	.|.	ENSG00000164953|ENSG00000164953	ENST00000452276;ENST00000453321;ENST00000453906|ENST00000521517	D;T;T|.	0.95821|.	-3.82;0.01;0.01|.	5.82|5.82	4.9|4.9	0.64082|0.64082	Growth factor, receptor (1);|.	0.252549|.	0.40302|.	N|.	0.001122|.	T|T	0.56673|0.56673	0.2001|0.2001	L|L	0.37561|0.37561	1.115|1.115	0.80722|0.80722	D|D	1|1	B;P|.	0.40970|.	0.014;0.734|.	B;B|.	0.35470|.	0.005;0.203|.	T|T	0.50268|0.50268	-0.8848|-0.8848	10|5	0.07644|.	T|.	0.81|.	-11.4619|-11.4619	13.6425|13.6425	0.62260|0.62260	0.0:0.1553:0.8447:0.0|0.0:0.1553:0.8447:0.0	.|.	123;123|.	Q5HYA8;F8WCQ6|.	MKS3_HUMAN;.|.	S|F	20;123;123|120	ENSP00000388671:A20S;ENSP00000389998:A123S;ENSP00000403035:A123S|.	ENSP00000314488:A113S|.	A|C	+|+	1|2	0|0	TMEM67|TMEM67	94839941|94839941	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.837000|0.837000	0.47467|0.47467	1.293000|1.293000	0.33353|0.33353	2.760000|2.760000	0.94817|0.94817	0.655000|0.655000	0.94253|0.94253	GCC|TGC	TMEM67	-	superfamily_Growth_fac_rcpt	ENSG00000164953		0.308	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM67	HGNC	protein_coding	OTTHUMT00000329641.2	58	0.00	0	G	NM_153704		94770765	94770765	+1	no_errors	ENST00000453321	ensembl	human	known	69_37n	missense	91	12.50	13	SNP	1.000	T
TMPRSS9	360200	genome.wustl.edu	37	19	2415770	2415770	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:2415770C>T	ENST00000332578.3	+	10	1574	c.1574C>T	c.(1573-1575)tCc>tTc	p.S525F		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	525	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGAAGGGTCCCGGCACTTC	0.692																																						dbGAP											0													47.0	53.0	51.0					19																	2415770		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.1574C>T	19.37:g.2415770C>T	ENSP00000330264:p.Ser525Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZND6|Q7Z411	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6	p.S525F	ENST00000332578.3	37	c.1574	CCDS12088.1	19	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205994	0.39003	.	.	ENSG00000178297	ENST00000332578	D	0.89939	-2.59	3.8	2.76	0.32466	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.680084	0.12860	N	0.433259	D	0.87581	0.6213	L	0.33245	0.995	0.20638	N	0.999876	P	0.45428	0.858	P	0.54312	0.748	T	0.76572	-0.2910	10	0.25106	T	0.35	.	10.0251	0.42066	0.0:0.8988:0.0:0.1012	.	525	Q7Z410	TMPS9_HUMAN	F	525	ENSP00000330264:S525F	ENSP00000330264:S525F	S	+	2	0	TMPRSS9	2366770	0.000000	0.05858	0.406000	0.26421	0.659000	0.38960	0.828000	0.27435	0.823000	0.34589	0.561000	0.74099	TCC	TMPRSS9	-	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000178297		0.692	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	HGNC	protein_coding	OTTHUMT00000451330.3	20	0.00	0	C	NM_182973		2415770	2415770	+1	no_errors	ENST00000332578	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.296	T
TRBV6-8	28599	genome.wustl.edu	37	7	142124249	142124249	+	RNA	SNP	C	C	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr7:142124249C>A	ENST00000390376.2	-	0	228									T cell receptor beta variable 6-8																		TTGGGGACTTCTTTGTCAGTA	0.507																																						dbGAP											0													163.0	166.0	165.0					7																	142124249		1957	4155	6112	-	-	-			0			L36092		7q34	2012-02-07			ENSG00000253534	ENSG00000253534		"""T cell receptors / TRB locus"""	12233	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV68, TCRBV13S7P, TCRBV6S8			OTTHUMG00000158916		7.37:g.142124249C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E77*	ENST00000390376.2	37	c.229		7																																																																																			TRBV6-8	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000253534		0.507	TRBV6-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV6-8	HGNC	TR_V_gene	OTTHUMT00000352531.2	90	0.00	0	C	NG_001333		142124249	142124249	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390376	ensembl	human	known	69_37n	nonsense	157	15.14	28	SNP	0.920	A
ULK2	9706	genome.wustl.edu	37	17	19728468	19728468	+	Missense_Mutation	SNP	G	G	T	rs373026240		TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr17:19728468G>T	ENST00000395544.4	-	12	1362	c.863C>A	c.(862-864)tCt>tAt	p.S288Y	ULK2_ENST00000580130.1_5'UTR|ULK2_ENST00000361658.2_Missense_Mutation_p.S288Y	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	288					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					GACAGAACCAGAATACATGGG	0.418																																						dbGAP											0													67.0	66.0	66.0					17																	19728468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.863C>A	17.37:g.19728468G>T	ENSP00000378914:p.Ser288Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY69|O75119	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S288Y	ENST00000395544.4	37	c.863	CCDS11213.1	17	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861295	0.32884	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.24908	1.83;1.83	5.74	4.75	0.60458	Protein kinase-like domain (1);	0.237414	0.44285	D	0.000466	T	0.23532	0.0569	L	0.29908	0.895	0.34000	D	0.650195	B	0.31009	0.303	B	0.33890	0.172	T	0.35126	-0.9801	10	0.72032	D	0.01	-5.0993	15.6585	0.77162	0.0:0.1375:0.8625:0.0	.	288	Q8IYT8	ULK2_HUMAN	Y	288	ENSP00000354877:S288Y;ENSP00000378914:S288Y	ENSP00000354877:S288Y	S	-	2	0	ULK2	19669060	1.000000	0.71417	0.835000	0.33067	0.169000	0.22640	6.023000	0.70848	1.379000	0.46325	0.561000	0.74099	TCT	ULK2	-	superfamily_Kinase-like_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2	ENSG00000083290		0.418	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ULK2	HGNC	protein_coding	OTTHUMT00000132375.2	42	0.00	0	G	NM_014683		19728468	19728468	-1	no_errors	ENST00000361658	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.871	T
WDPCP	51057	genome.wustl.edu	37	2	63631316	63631316	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr2:63631316G>T	ENST00000272321.7	-	10	1829	c.1302C>A	c.(1300-1302)gcC>gcA	p.A434A	WDPCP_ENST00000398544.3_Silent_p.A275A|WDPCP_ENST00000409199.1_Silent_p.A242A|WDPCP_ENST00000409562.3_Silent_p.A434A|WDPCP_ENST00000409120.1_Silent_p.A242A|WDPCP_ENST00000409835.1_5'UTR	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	434					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GACTGCTGGAGGCATCAAATA	0.423																																						dbGAP											0													99.0	95.0	96.0					2																	63631316		1922	4130	6052	-	-	-	SO:0001819	synonymous_variant	0				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1302C>A	2.37:g.63631316G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53RW4|Q7Z2Z3	Silent	SNP	pfam_DUF3312,superfamily_WD40_repeat_dom	p.A434	ENST00000272321.7	37	c.1302	CCDS42688.1	2																																																																																			WDPCP	-	pfam_DUF3312	ENSG00000143951		0.423	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDPCP	HGNC	protein_coding	OTTHUMT00000326820.1	30	0.00	0	G	NM_015910		63631316	63631316	-1	no_errors	ENST00000272321	ensembl	human	known	69_37n	silent	62	12.68	9	SNP	0.998	T
USP40	55230	genome.wustl.edu	37	2	234429703	234429703	+	Missense_Mutation	SNP	G	G	T	rs148095295	byFrequency	TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr2:234429703G>T	ENST00000427112.2	-	16	2291	c.2256C>A	c.(2254-2256)caC>caA	p.H752Q	USP40_ENST00000251722.6_Missense_Mutation_p.H752Q|USP40_ENST00000450966.1_Missense_Mutation_p.H764Q			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	752					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		AATTTTTAACGTGGAGCCAGT	0.343																																						dbGAP											0													107.0	99.0	101.0					2																	234429703		1824	4069	5893	-	-	-	SO:0001583	missense	0			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2256C>A	2.37:g.234429703G>T	ENSP00000387898:p.His752Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX38|Q70EL0	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.H764Q	ENST00000427112.2	37	c.2292	CCDS46547.1	2	.	.	.	.	.	.	.	.	.	.	G	0.457	-0.890991	0.02491	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000452724	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.43	-3.13	0.05266	.	2.555070	0.01075	N	0.004887	T	0.06645	0.0170	N	0.00146	-1.995	0.22156	N	0.999324	B;B	0.09022	0.001;0.002	B;B	0.01281	0.0;0.0	T	0.40905	-0.9538	10	0.02654	T	1	.	2.4575	0.04533	0.1199:0.3004:0.1148:0.4648	.	752;764	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	Q	764;752;752;47	ENSP00000415434:H764Q;ENSP00000251722:H752Q;ENSP00000387898:H752Q;ENSP00000408853:H47Q	ENSP00000251722:H752Q	H	-	3	2	USP40	234094442	0.962000	0.33011	0.960000	0.40013	0.805000	0.45488	-0.239000	0.08965	-0.451000	0.07097	-2.110000	0.00354	CAC	USP40	-	NULL	ENSG00000085982		0.343	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	USP40	HGNC	protein_coding	OTTHUMT00000397235.1	120	0.00	0	G	XM_114294		234429703	234429703	-1	no_errors	ENST00000450966	ensembl	human	known	69_37n	missense	191	10.33	22	SNP	0.930	T
ZFHX4	79776	genome.wustl.edu	37	8	77765961	77765961	+	Silent	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr8:77765961G>T	ENST00000521891.2	+	10	7252	c.6804G>T	c.(6802-6804)cgG>cgT	p.R2268R	ZFHX4_ENST00000518282.1_Silent_p.R2242R|ZFHX4_ENST00000050961.6_Silent_p.R2223R|ZFHX4_ENST00000455469.2_Silent_p.R2223R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGCCTACCCGGGTTATTGTTG	0.393										HNSCC(33;0.089)																												dbGAP											0													89.0	83.0	85.0					8																	77765961		1870	4109	5979	-	-	-	SO:0001819	synonymous_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6804G>T	8.37:g.77765961G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.R2268	ENST00000521891.2	37	c.6804	CCDS47878.2	8																																																																																			ZFHX4	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000091656		0.393	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	65	0.00	0	G	NM_024721		77765961	77765961	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	silent	112	15.15	20	SNP	0.997	T
TBC1D31	93594	genome.wustl.edu	37	8	124154635	124154635	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr8:124154635G>T	ENST00000287380.1	+	19	2864	c.2774G>T	c.(2773-2775)aGg>aTg	p.R925M	TBC1D31_ENST00000518805.1_Missense_Mutation_p.R479M|TBC1D31_ENST00000309336.3_Intron|TBC1D31_ENST00000378080.2_Intron|TBC1D31_ENST00000522420.1_Missense_Mutation_p.R820M|TBC1D31_ENST00000327098.5_Intron|TBC1D31_ENST00000521676.1_Missense_Mutation_p.R802M	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	925						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										AAACTCCTTAGGGAAAACAGA	0.348																																						dbGAP											0													58.0	59.0	59.0					8																	124154635		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.2774G>T	8.37:g.124154635G>T	ENSP00000287380:p.Arg925Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.R925M	ENST00000287380.1	37	c.2774	CCDS6338.1	8	.	.	.	.	.	.	.	.	.	.	G	8.873	0.949817	0.18431	.	.	ENSG00000156787	ENST00000287380;ENST00000522420;ENST00000521676;ENST00000518805	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.36	0.217	0.15264	.	0.708126	0.14177	N	0.336308	T	0.80628	0.4659	N	0.24115	0.695	0.29175	N	0.876882	P;B	0.45283	0.855;0.291	P;B	0.46718	0.525;0.125	T	0.73688	-0.3904	10	0.49607	T	0.09	-4.5471	9.209	0.37306	0.4944:0.0:0.5056:0.0	.	820;925	E7ERK7;Q96DN5	.;WDR67_HUMAN	M	925;820;802;479	ENSP00000287380:R925M;ENSP00000429334:R820M;ENSP00000430628:R802M;ENSP00000429494:R479M	ENSP00000287380:R925M	R	+	2	0	WDR67	124223816	0.915000	0.31059	0.296000	0.24974	0.424000	0.31475	0.201000	0.17276	-0.016000	0.14127	0.471000	0.43371	AGG	WDR67	-	NULL	ENSG00000156787		0.348	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	HGNC	protein_coding	OTTHUMT00000381721.1	54	0.00	0	G	NM_145647		124154635	124154635	+1	no_errors	ENST00000287380	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	0.073	T
ZNF554	115196	genome.wustl.edu	37	19	2834252	2834252	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:2834252G>T	ENST00000317243.5	+	5	1217	c.1019G>T	c.(1018-1020)aGc>aTc	p.S340I		NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATTCTTTGAGCGAACATCAA	0.537																																						dbGAP											0													67.0	74.0	72.0					19																	2834252		2067	4237	6304	-	-	-	SO:0001583	missense	0			AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.1019G>T	19.37:g.2834252G>T	ENSP00000321132:p.Ser340Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAT3|Q9BWN3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S340I	ENST00000317243.5	37	c.1019	CCDS42462.1	19	.	.	.	.	.	.	.	.	.	.	G	4.056	0.008119	0.07912	.	.	ENSG00000172006	ENST00000317243	T	0.07908	3.15	2.65	0.0559	0.14317	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04634	0.0126	N	0.25426	0.745	0.09310	N	1	B	0.25272	0.122	B	0.21546	0.035	T	0.46091	-0.9216	9	0.11485	T	0.65	.	4.7922	0.13254	0.0:0.2057:0.3758:0.4185	.	340	Q86TJ5	ZN554_HUMAN	I	340	ENSP00000321132:S340I	ENSP00000321132:S340I	S	+	2	0	ZNF554	2785252	0.000000	0.05858	0.070000	0.20053	0.472000	0.32918	-1.746000	0.01829	0.437000	0.26423	0.573000	0.79308	AGC	ZNF554	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000172006		0.537	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF554	HGNC	protein_coding	OTTHUMT00000451598.3	37	0.00	0	G	NM_152303		2834252	2834252	+1	no_errors	ENST00000317243	ensembl	human	known	69_37n	missense	58	13.43	9	SNP	0.000	T
ZNF791	163049	genome.wustl.edu	37	19	12738936	12738936	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr19:12738936G>T	ENST00000343325.4	+	4	755	c.593G>T	c.(592-594)aGt>aTt	p.S198I	AC010422.1_ENST00000408416.1_RNA|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000446165.1_3'UTR|ZNF791_ENST00000540038.1_Missense_Mutation_p.S89I|ZNF791_ENST00000458122.3_Missense_Mutation_p.S166I	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						AAAGCTCTTAGTTGTTCCAGT	0.408																																						dbGAP											0													64.0	66.0	65.0					19																	12738936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.593G>T	19.37:g.12738936G>T	ENSP00000342974:p.Ser198Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z586|Q8NC99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S198I	ENST00000343325.4	37	c.593	CCDS12273.1	19	.	.	.	.	.	.	.	.	.	.	G	0.743	-0.775803	0.02951	.	.	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.05025	3.51;3.51;3.51	1.83	1.83	0.25207	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.17278	0.47	0.09310	N	0.999999	P	0.37864	0.61	B	0.31686	0.134	T	0.44620	-0.9316	9	0.27082	T	0.32	.	9.2247	0.37398	0.0:0.0:1.0:0.0	.	198	Q3KP31	ZN791_HUMAN	I	198;180;166;89	ENSP00000342974:S198I;ENSP00000441761:S166I;ENSP00000441038:S89I	ENSP00000342974:S198I	S	+	2	0	ZNF791	12599936	0.000000	0.05858	0.067000	0.19924	0.531000	0.34715	-0.369000	0.07533	1.007000	0.39238	0.491000	0.48974	AGT	ZNF791	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173875		0.408	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF791	HGNC	protein_coding	OTTHUMT00000344140.1	65	0.00	0	G	NM_153358		12738936	12738936	+1	no_errors	ENST00000343325	ensembl	human	known	69_37n	missense	100	11.40	13	SNP	0.009	T
ZNFX1	57169	genome.wustl.edu	37	20	47865238	47865238	+	Silent	SNP	G	G	A			TCGA-A2-A25A-01A-12D-A16D-09	TCGA-A2-A25A-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5739a7e1-7fa3-434c-b1c3-c0a9e570c858	ad66f1d8-3521-4acf-a50f-76c6842df466	g.chr20:47865238G>A	ENST00000396105.1	-	14	4569	c.4323C>T	c.(4321-4323)tgC>tgT	p.C1441C	ZNFX1_ENST00000371752.1_Silent_p.C1441C|ZNFX1_ENST00000371754.4_Intron	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1441							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AAGGATGCCCGCAGTCCAAGA	0.557																																						dbGAP											0													55.0	54.0	54.0					20																	47865238		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.4323C>T	20.37:g.47865238G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent	SNP	superfamily_ARM-type_fold,smart_Znf_NFX1	p.C1441	ENST00000396105.1	37	c.4323	CCDS13417.1	20																																																																																			ZNFX1	-	NULL	ENSG00000124201		0.557	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	HGNC	protein_coding	OTTHUMT00000079647.2	30	0.00	0	G	NM_021035		47865238	47865238	-1	no_errors	ENST00000371752	ensembl	human	known	69_37n	silent	41	17.31	9	SNP	0.268	A
