#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA9	10350	genome.wustl.edu	37	17	66979929	66979929	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr17:66979929T>C	ENST00000340001.4	-	36	4772	c.4561A>G	c.(4561-4563)Aag>Gag	p.K1521E	ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000370732.2_3'UTR|ABCA9_ENST00000453985.2_Missense_Mutation_p.K1483E	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1521	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TTCTTCAGCTTCATCTCCAGC	0.468																																						dbGAP											0													119.0	106.0	110.0					17																	66979929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4561A>G	17.37:g.66979929T>C	ENSP00000342216:p.Lys1521Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K1521E	ENST00000340001.4	37	c.4561	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	T	20.3	3.962138	0.74016	.	.	ENSG00000154258	ENST00000340001;ENST00000453985	T	0.59638	0.25	4.77	3.66	0.41972	ABC transporter-like (1);	0.141093	0.31092	N	0.008269	T	0.80737	0.4680	H	0.95816	3.725	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	D	0.83942	0.0312	10	0.87932	D	0	.	10.9699	0.47434	0.0:0.0:0.1569:0.8431	.	1521	Q8IUA7	ABCA9_HUMAN	E	1521;1466	ENSP00000342216:K1521E	ENSP00000342216:K1521E	K	-	1	0	ABCA9	64491524	1.000000	0.71417	0.970000	0.41538	0.791000	0.44710	7.283000	0.78640	0.746000	0.32786	0.533000	0.62120	AAG	ABCA9	-	pfscan_ABC_transporter-like	ENSG00000154258		0.468	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	101	0.00	0	T	NM_172386		66979929	66979929	-1	no_errors	ENST00000340001	ensembl	human	known	69_37n	missense	101	14.41	17	SNP	1.000	C
ABCC6	368	genome.wustl.edu	37	16	16263518	16263518	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr16:16263518delG	ENST00000205557.7	-	22	3009	c.2980delC	c.(2980-2982)ctcfs	p.L994fs		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	994	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	AGACAGCCGAGGAGCCCGAAG	0.677																																						dbGAP											0													21.0	21.0	21.0					16																	16263518		2196	4296	6492	-	-	-	SO:0001589	frameshift_variant	0			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.2980delC	16.37:g.16263518delG	ENSP00000205557:p.Leu994fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Frame_Shift_Del	DEL	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.L994fs	ENST00000205557.7	37	c.2980	CCDS10568.1	16																																																																																			ABCC6	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000091262		0.677	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC6	HGNC	protein_coding	OTTHUMT00000252232.2	14	0.00	0	G			16263518	16263518	-1	no_errors	ENST00000205557	ensembl	human	known	69_37n	frame_shift_del	5	37.50	3	DEL	1.000	-
APOB	338	genome.wustl.edu	37	2	21232258	21232258	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:21232258A>C	ENST00000233242.1	-	26	7609	c.7482T>G	c.(7480-7482)aaT>aaG	p.N2494K		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2494					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGTAACCAATTGATGATTA	0.413																																						dbGAP											0													139.0	131.0	134.0					2																	21232258		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7482T>G	2.37:g.21232258A>C	ENSP00000233242:p.Asn2494Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.N2494K	ENST00000233242.1	37	c.7482	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	A	8.188	0.795306	0.16327	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00649	5.98	5.36	0.231	0.15377	.	0.204155	0.33732	N	0.004613	T	0.00440	0.0014	N	0.14661	0.345	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	T	0.63198	-0.6691	10	0.30854	T	0.27	.	6.0169	0.19608	0.2732:0.1916:0.5352:0.0	.	2494	P04114	APOB_HUMAN	K	2494	ENSP00000233242:N2494K	ENSP00000233242:N2494K	N	-	3	2	APOB	21085763	0.908000	0.30866	0.649000	0.29536	0.976000	0.68499	0.210000	0.17455	0.046000	0.15833	0.379000	0.24179	AAT	APOB	-	NULL	ENSG00000084674		0.413	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	136	0.73	1	A			21232258	21232258	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	61	19.74	15	SNP	0.888	C
AGBL5	60509	genome.wustl.edu	37	2	27275875	27275875	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:27275875G>C	ENST00000360131.4	+	2	208	c.49G>C	c.(49-51)Ggg>Cgg	p.G17R	AGBL5_ENST00000323064.8_Missense_Mutation_p.G17R|AGBL5-AS1_ENST00000444217.1_RNA|RP11-503P10.1_ENST00000607407.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	17					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTGATTCAGGGAATCTAGC	0.612																																						dbGAP											0													83.0	76.0	79.0					2																	27275875		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.49G>C	2.37:g.27275875G>C	ENSP00000353249:p.Gly17Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.G17R	ENST00000360131.4	37	c.49	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602214	0.87055	.	.	ENSG00000084693	ENST00000421915;ENST00000453161;ENST00000451003;ENST00000323064;ENST00000360131;ENST00000437006	D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.97294	0.9115	H	0.94264	3.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98519	1.0622	10	0.87932	D	0	-5.5756	18.0447	0.89328	0.0:0.0:1.0:0.0	.	17;17;17	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	R	17	ENSP00000395266:G17R;ENSP00000394730:G17R;ENSP00000407584:G17R;ENSP00000323681:G17R;ENSP00000353249:G17R	ENSP00000323681:G17R	G	+	1	0	AGBL5	27129379	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.959000	0.93110	2.342000	0.79632	0.561000	0.74099	GGG	AGBL5	-	NULL	ENSG00000084693		0.612	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	58	0.00	0	G	NM_021831		27275875	27275875	+1	no_errors	ENST00000360131	ensembl	human	known	69_37n	missense	20	56.52	26	SNP	1.000	C
ARHGAP31	57514	genome.wustl.edu	37	3	119134300	119134300	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr3:119134300G>A	ENST00000264245.4	+	12	4056	c.3524G>A	c.(3523-3525)cGc>cAc	p.R1175H		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	1175					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CTGACAGGCCGCCGTAACTCA	0.557																																					Pancreas(7;176 297 5394 51128 51241)	dbGAP											0													49.0	52.0	51.0					3																	119134300		2001	4174	6175	-	-	-	SO:0001583	missense	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.3524G>A	3.37:g.119134300G>A	ENSP00000264245:p.Arg1175His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R1175H	ENST00000264245.4	37	c.3524	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871994	0.91587	.	.	ENSG00000031081	ENST00000264245	T	0.27720	1.65	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000010	T	0.49712	0.1573	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.41270	-0.9518	10	0.87932	D	0	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	1175	Q2M1Z3	RHG31_HUMAN	H	1175	ENSP00000264245:R1175H	ENSP00000264245:R1175H	R	+	2	0	ARHGAP31	120616990	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CGC	ARHGAP31	-	NULL	ENSG00000031081		0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	42	0.00	0	G			119134300	119134300	+1	no_errors	ENST00000264245	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	A
ASNS	440	genome.wustl.edu	37	7	97481770	97481770	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr7:97481770G>A	ENST00000394309.3	-	13	1958	c.1487C>T	c.(1486-1488)gCa>gTa	p.A496V	ASNS_ENST00000444334.1_Missense_Mutation_p.A475V|ASNS_ENST00000437628.1_Missense_Mutation_p.A413V|ASNS_ENST00000422745.1_Missense_Mutation_p.A475V|ASNS_ENST00000455086.1_Missense_Mutation_p.A413V|ASNS_ENST00000175506.4_Missense_Mutation_p.A496V|ASNS_ENST00000394308.3_Missense_Mutation_p.A496V	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	496	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TGCCATCATTGCATCATCAAC	0.388																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	dbGAP											0													125.0	123.0	124.0					7																	97481770		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1487C>T	7.37:g.97481770G>A	ENSP00000377846:p.Ala496Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	pfam_Asn_synthase,pfam_GATase_dom,tigrfam_Asn_synth_AEB	p.A496V	ENST00000394309.3	37	c.1487	CCDS5652.1	7	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256396	0.39896	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.14	4.24	0.50183	Rossmann-like alpha/beta/alpha sandwich fold (1);	1.096640	0.06727	N	0.775993	T	0.35393	0.0930	L	0.37697	1.125	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26950	-1.0088	10	0.66056	D	0.02	-1.0295	7.0419	0.25025	0.0883:0.0:0.739:0.1727	.	496	P08243	ASNS_HUMAN	V	496;496;413;496;475;413;475	ENSP00000175506:A496V;ENSP00000377846:A496V;ENSP00000414379:A413V;ENSP00000377845:A496V;ENSP00000414901:A475V;ENSP00000408472:A413V;ENSP00000406994:A475V	ENSP00000175506:A496V	A	-	2	0	ASNS	97319706	0.015000	0.18098	0.928000	0.36995	0.992000	0.81027	2.064000	0.41432	1.276000	0.44395	0.561000	0.74099	GCA	ASNS	-	NULL	ENSG00000070669		0.388	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASNS	HGNC	protein_coding	OTTHUMT00000333645.1	79	0.00	0	G	NM_001673, NM_183356		97481770	97481770	-1	no_errors	ENST00000175506	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	0.134	A
ATP2A1	487	genome.wustl.edu	37	16	28899040	28899040	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr16:28899040G>A	ENST00000357084.3	+	8	1192	c.925G>A	c.(925-927)Gaa>Aaa	p.E309K	ATP2A1_ENST00000536376.1_Missense_Mutation_p.E184K|ATP2A1_ENST00000395503.4_Missense_Mutation_p.E309K	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	309					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						TGCCATCCCCGAAGGTATGAA	0.478																																						dbGAP											0													74.0	76.0	75.0					16																	28899040		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.925G>A	16.37:g.28899040G>A	ENSP00000349595:p.Glu309Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.E309K	ENST00000357084.3	37	c.925	CCDS10643.1	16	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003219	0.93287	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.92199	-2.91;-2.91;-2.99	5.27	5.27	0.74061	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.98102	0.9374	H	0.99516	4.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99834	1.1056	10	0.87932	D	0	.	17.6614	0.88193	0.0:0.0:1.0:0.0	.	184;309;309	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	K	309;309;346;184	ENSP00000349595:E309K;ENSP00000378879:E309K;ENSP00000443101:E184K	ENSP00000349595:E309K	E	+	1	0	ATP2A1	28806541	1.000000	0.71417	0.992000	0.48379	0.710000	0.40934	9.838000	0.99474	2.458000	0.83093	0.467000	0.42956	GAA	ATP2A1	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000196296		0.478	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	54	0.00	0	G	NM_004320		28899040	28899040	+1	no_errors	ENST00000357084	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	1.000	A
ATP2B3	492	genome.wustl.edu	37	X	152835130	152835130	+	Intron	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chrX:152835130C>A	ENST00000349466.2	+	20	3668				ATP2B3_ENST00000393842.1_Missense_Mutation_p.L1124I|ATP2B3_ENST00000359149.3_Missense_Mutation_p.L1138I|ATP2B3_ENST00000263519.4_Intron|ATP2B3_ENST00000370181.2_Missense_Mutation_p.L1124I|ATP2B3_ENST00000370186.1_Missense_Mutation_p.L1124I			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3						blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTCTTCGGTCCTCAGCCAGCT	0.522																																						dbGAP											0													274.0	225.0	242.0					X																	152835130		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3342+4569C>A	X.37:g.152835130C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_ATP_Ca_trans_C,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.L1138I	ENST00000349466.2	37	c.3412	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	C	12.40	1.927479	0.34002	.	.	ENSG00000067842	ENST00000370186;ENST00000393842;ENST00000359149;ENST00000370181	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.2	5.2	0.72013	.	.	.	.	.	T	0.69922	0.3165	.	.	.	0.22656	N	0.99889	P;B	0.39022	0.655;0.0	B;B	0.38264	0.269;0.003	T	0.60209	-0.7308	8	0.21540	T	0.41	.	16.6349	0.85050	0.0:1.0:0.0:0.0	.	1124;1138	Q16720-3;Q16720-2	.;.	I	1124;1124;1138;1124	ENSP00000359205:L1124I;ENSP00000377425:L1124I;ENSP00000352062:L1138I;ENSP00000359200:L1124I	ENSP00000352062:L1138I	L	+	1	0	ATP2B3	152488324	0.996000	0.38824	1.000000	0.80357	0.987000	0.75469	0.441000	0.21611	2.187000	0.69744	0.460000	0.39030	CTC	ATP2B3	-	pfam_ATP_Ca_trans_C	ENSG00000067842		0.522	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	126	0.00	0	C	NM_021949		152835130	152835130	+1	no_errors	ENST00000359149	ensembl	human	known	69_37n	missense	104	16.80	21	SNP	1.000	A
BLK	640	genome.wustl.edu	37	8	11412989	11412989	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:11412989G>T	ENST00000259089.4	+	8	1360	c.768G>T	c.(766-768)tgG>tgT	p.W256C	RP11-148O21.3_ENST00000527922.1_RNA|BLK_ENST00000529894.1_Missense_Mutation_p.W185C|RP11-148O21.2_ENST00000533322.1_RNA|RP11-148O21.6_ENST00000602626.1_lincRNA|RP11-148O21.4_ENST00000528629.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	256	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		GCGAAGTCTGGATGGGTGAGT	0.602																																						dbGAP											0													105.0	107.0	106.0					8																	11412989		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.768G>T	8.37:g.11412989G>T	ENSP00000259089:p.Trp256Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16291|Q96IN1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.W256C	ENST00000259089.4	37	c.768	CCDS5982.1	8	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315281	0.60524	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	T;T	0.11277	2.79;2.79	4.49	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41396	D	0.000892	T	0.17450	0.0419	N	0.11673	0.155	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.30416	-0.9979	10	0.87932	D	0	.	16.5258	0.84330	0.0:0.0:1.0:0.0	.	256	P51451	BLK_HUMAN	C	256;256;185	ENSP00000259089:W256C;ENSP00000433663:W185C	ENSP00000259089:W256C	W	+	3	0	BLK	11450398	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	9.531000	0.98054	2.209000	0.71365	0.462000	0.41574	TGG	BLK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000136573		0.602	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLK	HGNC	protein_coding	OTTHUMT00000207460.1	76	0.00	0	G			11412989	11412989	+1	no_errors	ENST00000259089	ensembl	human	known	69_37n	missense	21	65.57	40	SNP	1.000	T
BRCA1	672	genome.wustl.edu	37	17	41245390	41245390	+	Nonsense_Mutation	SNP	C	C	A	rs397508941|rs80356875|rs397508942|rs80357715		TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr17:41245390C>A	ENST00000357654.3	-	10	2276	c.2158G>T	c.(2158-2160)Gaa>Taa	p.E720*	BRCA1_ENST00000346315.3_Nonsense_Mutation_p.E720*|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000354071.3_Nonsense_Mutation_p.E720*|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Nonsense_Mutation_p.E673*|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000309486.4_Nonsense_Mutation_p.E424*|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Nonsense_Mutation_p.E720*	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	720					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TTGACAAATTCTTTAAGTTCA	0.363			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			GRCh37	CI962222|CM990288	BRCA1	I|M	rs80356875						85.0	84.0	84.0					17																	41245390		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2158G>T	17.37:g.41245390C>A	ENSP00000350283:p.Glu720*	Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Nonsense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.E720*	ENST00000357654.3	37	c.2158	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616517	0.87359	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	.	.	.	5.51	3.5	0.40072	.	0.607423	0.15798	N	0.244106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	9.1908	0.37197	0.0:0.7742:0.0:0.2258	.	.	.	.	X	720;720;720;720;424;720;673	.	ENSP00000310938:E424X	E	-	1	0	BRCA1	38498916	0.002000	0.14202	0.017000	0.16124	0.493000	0.33554	0.518000	0.22847	1.571000	0.49722	0.561000	0.74099	GAA	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.363	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	82	0.00	0	C	NM_007294		41245390	41245390	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	nonsense	9	78.57	33	SNP	0.008	A
CARD17	440068	genome.wustl.edu	37	11	104971500	104971500	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr11:104971500A>T	ENST00000375707.1	-	2	30	c.14T>A	c.(13-15)gTc>gAc	p.V5D	CARD16_ENST00000525374.1_Intron|CASP1_ENST00000593315.1_Intron|CASP1_ENST00000598974.1_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000415981.2_Intron	NM_001007232.1	NP_001007233.1	Q5XLA6	CAR17_HUMAN	caspase recruitment domain family, member 17	5	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	6						CTCCTTCAGGACCTTGTCTGT	0.443																																						dbGAP											0													198.0	186.0	190.0					11																	104971500		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS31662.1	11q22.3	2009-01-13				ENSG00000255221			33827	protein-coding gene	gene with protein product	"""Inhibitory CARD"""	609490				15383541	Standard	NM_001007232		Approved	INCA	uc001pir.1	Q5XLA6		ENST00000375707.1:c.14T>A	11.37:g.104971500A>T	ENSP00000364859:p.Val5Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.V5D	ENST00000375707.1	37	c.14	CCDS31662.1	11	.	.	.	.	.	.	.	.	.	.	.	10.13	1.266237	0.23136	.	.	ENSG00000255221	ENST00000375707	T	0.21191	2.02	2.8	2.8	0.32819	DEATH-like (2);Caspase Recruitment (3);	.	.	.	.	T	0.19248	0.0462	L	0.49350	1.555	0.09310	N	0.999998	B	0.21309	0.054	B	0.27262	0.078	T	0.21586	-1.0241	9	0.25751	T	0.34	.	7.3129	0.26485	1.0:0.0:0.0:0.0	.	5	Q5XLA6	CAR17_HUMAN	D	5	ENSP00000364859:V5D	ENSP00000364859:V5D	V	-	2	0	CARD17	104476710	0.001000	0.12720	0.045000	0.18777	0.120000	0.20174	0.577000	0.23758	1.263000	0.44181	0.418000	0.28097	GTC	CARD17	-	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	ENSG00000255221		0.443	CARD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD17	HGNC	protein_coding	OTTHUMT00000388181.1	137	0.00	0	A	NM_001007232		104971500	104971500	-1	no_errors	ENST00000375707	ensembl	human	known	69_37n	missense	61	20.78	16	SNP	0.090	T
CD9	928	genome.wustl.edu	37	12	6344725	6344725	+	Silent	SNP	C	C	G	rs80271009	byFrequency	TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr12:6344725C>G	ENST00000382518.1	+	7	967	c.531C>G	c.(529-531)acC>acG	p.T177T	Y_RNA_ENST00000365448.1_RNA|CD9_ENST00000382515.2_Silent_p.T108T|CD9_ENST00000481267.1_3'UTR|CD9_ENST00000009180.4_Silent_p.T177T			P21926	CD9_HUMAN	CD9 molecule	177					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						AAACCTTCACCGTGAAGGTAA	0.542																																						dbGAP											0													123.0	105.0	111.0					12																	6344725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.531C>G	12.37:g.6344725C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUQ9|Q5J7W6|Q96ES4	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T177	ENST00000382518.1	37	c.531	CCDS8540.1	12	.	.	.	.	.	.	.	.	.	.	C	4.495	0.091866	0.08632	.	.	ENSG00000010278	ENST00000425469	.	.	.	5.39	-10.8	0.00216	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10894	-1.0610	7	0.22109	T	0.4	.	3.0663	0.06215	0.1762:0.4518:0.2142:0.1578	.	227	B4DK09	.	G	177	.	ENSP00000388933:R177G	R	+	1	0	CD9	6214986	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.283000	0.00527	-1.414000	0.02025	-0.182000	0.12963	CGT	CD9	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000010278		0.542	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	CD9	HGNC	protein_coding	OTTHUMT00000103348.1	84	0.00	0	C			6344725	6344725	+1	no_errors	ENST00000009180	ensembl	human	known	69_37n	silent	37	26.00	13	SNP	0.000	G
CHST9	83539	genome.wustl.edu	37	18	24497140	24497140	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr18:24497140C>A	ENST00000284224.8	-	6	692	c.415G>T	c.(415-417)Gct>Tct	p.A139S	AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|CHST9_ENST00000581714.1_Missense_Mutation_p.A139S|CHST9_ENST00000580774.1_3'UTR|AQP4-AS1_ENST00000578701.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	139					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					ACAGTCTTAGCTCCTTGACGT	0.383																																						dbGAP											0													267.0	244.0	251.0					18																	24497140		1877	4103	5980	-	-	-	SO:0001583	missense	0			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.415G>T	18.37:g.24497140C>A	ENSP00000284224:p.Ala139Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	pfam_Sulfotransferase	p.A139S	ENST00000284224.8	37	c.415	CCDS42422.1	18	.	.	.	.	.	.	.	.	.	.	C	7.171	0.587622	0.13812	.	.	ENSG00000154080	ENST00000284224	T	0.64991	-0.13	6.17	-1.74	0.08056	.	2.079840	0.01891	N	0.038525	T	0.34948	0.0915	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26360	-1.0105	10	0.10111	T	0.7	0.8854	6.8635	0.24079	0.0:0.219:0.1126:0.6684	.	139	Q7L1S5	CHST9_HUMAN	S	139	ENSP00000284224:A139S	ENSP00000284224:A139S	A	-	1	0	CHST9	22751138	0.001000	0.12720	0.020000	0.16555	0.005000	0.04900	0.288000	0.18939	-0.498000	0.06632	-0.136000	0.14681	GCT	CHST9	-	NULL	ENSG00000154080		0.383	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST9	HGNC	protein_coding	OTTHUMT00000446549.1	105	0.94	1	C	NM_031422		24497140	24497140	-1	no_errors	ENST00000284224	ensembl	human	known	69_37n	missense	86	25.86	30	SNP	0.000	A
COL6A6	131873	genome.wustl.edu	37	3	130380981	130380981	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr3:130380981C>G	ENST00000358511.6	+	34	6362	c.6331C>G	c.(6331-6333)Cag>Gag	p.Q2111E	COL6A6_ENST00000453409.2_Missense_Mutation_p.Q2111E	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	2111	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AGCCAAATGTCAGGGATATGC	0.468																																						dbGAP											0													140.0	140.0	140.0					3																	130380981		1912	4131	6043	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.6331C>G	3.37:g.130380981C>G	ENSP00000351310:p.Gln2111Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.Q2111E	ENST00000358511.6	37	c.6331	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307445	0.40795	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.13420	2.59;2.59	5.88	5.88	0.94601	von Willebrand factor, type A (3);	.	.	.	.	T	0.26122	0.0637	M	0.78916	2.43	0.23827	N	0.996738	B;P	0.42010	0.027;0.768	B;P	0.46419	0.078;0.516	T	0.26326	-1.0106	9	0.15499	T	0.54	.	15.6916	0.77457	0.0:0.8639:0.1361:0.0	.	2111;2111	A6NMZ7;F8W6Y7	CO6A6_HUMAN;.	E	2111	ENSP00000351310:Q2111E;ENSP00000399236:Q2111E	ENSP00000351310:Q2111E	Q	+	1	0	COL6A6	131863671	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	2.976000	0.49289	2.797000	0.96272	0.561000	0.74099	CAG	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.468	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	98	0.00	0	C	NM_001102608		130380981	130380981	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	52	25.71	18	SNP	1.000	G
CRAT	1384	genome.wustl.edu	37	9	131860611	131860611	+	Silent	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr9:131860611G>A	ENST00000318080.2	-	10	1539	c.1245C>T	c.(1243-1245)caC>caT	p.H415H	RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	415					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	TTCCAAAATGGTGGAACACCA	0.597																																						dbGAP											0													85.0	84.0	85.0					9																	131860611		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.1245C>T	9.37:g.131860611G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T952|Q9BW16	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.P14S	ENST00000318080.2	37	c.40	CCDS6919.1	9	.	.	.	.	.	.	.	.	.	.	G	8.169	0.791315	0.16258	.	.	ENSG00000095321	ENST00000455396	.	.	.	5.13	-0.282	0.12878	.	.	.	.	.	T	0.55705	0.1937	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48725	-0.9010	4	.	.	.	-49.6135	9.4457	0.38695	0.5859:0.0:0.4141:0.0	.	.	.	.	S	14	.	.	P	-	1	0	CRAT	130900432	0.999000	0.42202	0.994000	0.49952	0.913000	0.54294	0.564000	0.23563	-0.138000	0.11434	-1.134000	0.01955	CCA	CRAT	-	pfam_Carn_acyl_trans	ENSG00000095321		0.597	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	HGNC	protein_coding	OTTHUMT00000253700.1	40	0.00	0	G			131860611	131860611	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000455396	ensembl	human	novel	69_37n	missense	27	18.18	6	SNP	0.782	A
CRCP	27297	genome.wustl.edu	37	7	65579837	65579837	+	5'UTR	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr7:65579837G>T	ENST00000395326.3	+	0	246				CRCP_ENST00000398684.2_5'UTR|CRCP_ENST00000431089.2_Nonsense_Mutation_p.E8*|AC068533.7_ENST00000450043.1_Intron|CRCP_ENST00000338592.5_5'UTR	NM_014478.4	NP_055293.1	O75575	RPC9_HUMAN	CGRP receptor component						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|neuropeptide signaling pathway (GO:0007218)|transcription from RNA polymerase III promoter (GO:0006383)	acrosomal vesicle (GO:0001669)|DNA polymerase III complex (GO:0009360)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcitonin gene-related polypeptide receptor activity (GO:0001635)|DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)			cervix(1)|kidney(1)|lung(4)	6						CGATCCCGGCGAGCACCTTGG	0.692																																						dbGAP											0													51.0	45.0	47.0					7																	65579837		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF073792	CCDS5532.1, CCDS47599.1, CCDS47600.1, CCDS55116.1	7q11.1	2009-01-14			ENSG00000241258	ENSG00000241258			17888	protein-coding gene	gene with protein product	"""calcitonin gene-related peptide-receptor component protein"""	606121				8622957, 10067875, 12482973	Standard	NM_014478		Approved	CGRP-RCP, RCP, RCP9	uc011kdw.2	O75575	OTTHUMG00000129519	ENST00000395326.3:c.-113G>T	7.37:g.65579837G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUZ4|A8MW23|B2R4H4|B4E198|Q3KRA3|Q5HYF1|Q8IXL4	Nonsense_Mutation	SNP	pfam_RNA_pol_II_Rpb4,superfamily_HRDC-like,smart_RNA_pol_II_Rpb4_core	p.E8*	ENST00000395326.3	37	c.22	CCDS5532.1	7	.	.	.	.	.	.	.	.	.	.	g	19.13	3.768758	0.69878	.	.	ENSG00000241258	ENST00000431089	.	.	.	3.19	1.24	0.21308	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	3.8038	0.08768	0.1506:0.2579:0.5915:0.0	.	.	.	.	X	8	.	ENSP00000388653:E8X	E	+	1	0	CRCP	65217272	0.003000	0.15002	0.990000	0.47175	0.106000	0.19336	-1.118000	0.03280	0.316000	0.23135	0.393000	0.25936	GAG	CRCP	-	NULL	ENSG00000241258		0.692	CRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRCP	HGNC	protein_coding	OTTHUMT00000251697.2	38	0.00	0	G	NM_014478		65579837	65579837	+1	no_errors	ENST00000431089	ensembl	human	putative	69_37n	nonsense	28	22.22	8	SNP	0.993	T
CYP1B1-AS1	285154	genome.wustl.edu	37	2	38407861	38407861	+	RNA	SNP	A	A	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:38407861A>T	ENST00000413828.2	+	0	621					NR_027252.1				CYP1B1 antisense RNA 1																		tctgctgtggatgaatctcat	0.463																																						dbGAP											0													244.0	203.0	215.0					2																	38407861		692	1591	2283	-	-	-			0			BC031410		2p22.2	2012-10-12	2012-08-15	2011-04-28	ENSG00000232973	ENSG00000232973		"""Long non-coding RNAs"""	28543	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 58"", ""CYP1B1 antisense RNA 1 (non-protein coding)"""	C2orf58		12477932	Standard	NR_027252		Approved	MGC34824	uc010faj.2		OTTHUMG00000128569		2.37:g.38407861A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000413828.2	37	NULL		2																																																																																			CYP1B1-AS1	-	-	ENSG00000232973		0.463	CYP1B1-AS1-001	KNOWN	basic	antisense	CYP1B1-AS1	HGNC	antisense	OTTHUMT00000250420.2	91	0.00	0	A			38407861	38407861	+1	no_errors	ENST00000413828	ensembl	human	known	69_37n	rna	63	24.10	20	SNP	0.001	T
DNAH5	1767	genome.wustl.edu	37	5	13700790	13700790	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr5:13700790A>T	ENST00000265104.4	-	78	13786	c.13682T>A	c.(13681-13683)tTt>tAt	p.F4561Y		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4561					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CATCAACTCAAAGAGCACTTT	0.418									Kartagener syndrome																													dbGAP											0													188.0	181.0	183.0					5																	13700790		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13682T>A	5.37:g.13700790A>T	ENSP00000265104:p.Phe4561Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.F4561Y	ENST00000265104.4	37	c.13682	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	14.14	2.446450	0.43429	.	.	ENSG00000039139	ENST00000265104	T	0.09723	2.95	5.95	5.95	0.96441	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.10937	0.0267	L	0.31845	0.965	0.80722	D	1	B	0.20164	0.042	B	0.29785	0.107	T	0.15983	-1.0418	10	0.10377	T	0.69	.	16.4323	0.83853	1.0:0.0:0.0:0.0	.	4561	Q8TE73	DYH5_HUMAN	Y	4561	ENSP00000265104:F4561Y	ENSP00000265104:F4561Y	F	-	2	0	DNAH5	13753790	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	7.314000	0.78988	2.281000	0.76405	0.528000	0.53228	TTT	DNAH5	-	pfam_Dynein_heavy	ENSG00000039139		0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	79	0.00	0	A	NM_001369		13700790	13700790	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	missense	85	11.46	11	SNP	1.000	T
DNMT1	1786	genome.wustl.edu	37	19	10291057	10291057	+	Silent	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr19:10291057G>A	ENST00000340748.4	-	4	649	c.414C>T	c.(412-414)ccC>ccT	p.P138P	DNMT1_ENST00000359526.4_Silent_p.P138P|DNMT1_ENST00000540357.1_Silent_p.P138P			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	138	Interaction with DNMT3A.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	TGCTCCTCCTGGGCGTGCGAG	0.507																																						dbGAP											0													79.0	79.0	79.0					19																	10291057		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.414C>T	19.37:g.10291057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Nonsense_Mutation	SNP	NULL	p.Q1*	ENST00000340748.4	37	c.1	CCDS12228.1	19																																																																																			DNMT1	-	NULL	ENSG00000130816		0.507	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1	93	0.00	0	G	NM_001379		10291057	10291057	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000590619	ensembl	human	novel	69_37n	nonsense	39	30.36	17	SNP	0.013	A
DOCK6	57572	genome.wustl.edu	37	19	11313275	11313275	+	Silent	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr19:11313275G>A	ENST00000294618.7	-	42	5357	c.5346C>T	c.(5344-5346)atC>atT	p.I1782I	CTC-510F12.2_ENST00000588634.1_RNA|DOCK6_ENST00000319867.7_Silent_p.I1121I|DOCK6_ENST00000586702.1_5'UTR	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1782	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCCGGTGTGAGATCTCTGCCA	0.632																																						dbGAP											0													141.0	147.0	145.0					19																	11313275		2099	4228	6327	-	-	-	SO:0001819	synonymous_variant	0				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5346C>T	19.37:g.11313275G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	pfam_DOCK	p.L1071F	ENST00000294618.7	37	c.3211	CCDS45975.1	19																																																																																			DOCK6	-	NULL	ENSG00000130158		0.632	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	36	0.00	0	G	NM_020812		11313275	11313275	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000587656	ensembl	human	novel	69_37n	missense	14	30.00	6	SNP	0.988	A
DTX4	23220	genome.wustl.edu	37	11	58949292	58949292	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr11:58949292G>A	ENST00000227451.3	+	2	396	c.292G>A	c.(292-294)Gac>Aac	p.D98N	DTX4_ENST00000532982.1_5'UTR	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	98	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				GTGGGAGAACGACAATGGCTC	0.617																																						dbGAP											0													111.0	119.0	117.0					11																	58949292		2188	4294	6482	-	-	-	SO:0001583	missense	0			AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.292G>A	11.37:g.58949292G>A	ENSP00000227451:p.Asp98Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VF38	Missense_Mutation	SNP	pfam_WWE-dom,pfam_Znf_C3HC4_RING-type,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.D98N	ENST00000227451.3	37	c.292	CCDS44612.1	11	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861272	0.91433	.	.	ENSG00000110042	ENST00000227451	T	0.33654	1.4	4.74	3.83	0.44106	WWE domain (2);WWE domain, subgroup (1);	.	.	.	.	T	0.54447	0.1859	M	0.76727	2.345	0.49389	D	0.999781	D	0.71674	0.998	D	0.64506	0.926	T	0.53975	-0.8362	9	0.33141	T	0.24	.	11.8967	0.52659	0.0852:0.0:0.9148:0.0	.	98	Q9Y2E6	DTX4_HUMAN	N	98	ENSP00000227451:D98N	ENSP00000227451:D98N	D	+	1	0	DTX4	58705868	1.000000	0.71417	0.976000	0.42696	0.993000	0.82548	9.222000	0.95196	1.240000	0.43803	0.655000	0.94253	GAC	DTX4	-	pfam_WWE-dom,smart_WWE-dom_subgr,pfscan_WWE-dom	ENSG00000110042		0.617	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX4	HGNC	protein_coding	OTTHUMT00000394228.1	37	0.00	0	G	XM_166213		58949292	58949292	+1	no_errors	ENST00000227451	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	A
DUSP19	142679	genome.wustl.edu	37	2	183943850	183943850	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:183943850C>A	ENST00000354221.4	+	1	364	c.189C>A	c.(187-189)gaC>gaA	p.D63E	DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Missense_Mutation_p.D63E	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	63					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)			breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						TTAGCTCGGACCTGCAAGTTG	0.448																																						dbGAP											0													176.0	176.0	176.0					2																	183943850		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.189C>A	2.37:g.183943850C>A	ENSP00000346160:p.Asp63Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP	p.D63E	ENST00000354221.4	37	c.189	CCDS2289.1	2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622807	0.87460	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	T;T	0.20332	2.08;3.7	6.17	5.3	0.74995	.	0.042869	0.85682	D	0.000000	T	0.43077	0.1231	M	0.71581	2.175	0.58432	D	0.999999	D;D	0.56287	0.975;0.972	P;P	0.59948	0.647;0.866	T	0.40701	-0.9549	10	0.66056	D	0.02	.	15.1298	0.72514	0.0:0.932:0.0:0.068	.	63;63	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	E	63	ENSP00000343905:D63E;ENSP00000346160:D63E	ENSP00000343905:D63E	D	+	3	2	DUSP19	183652095	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.575000	0.36493	1.616000	0.50265	0.655000	0.94253	GAC	DUSP19	-	NULL	ENSG00000162999		0.448	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP19	HGNC	protein_coding	OTTHUMT00000255866.1	126	0.00	0	C			183943850	183943850	+1	no_errors	ENST00000354221	ensembl	human	known	69_37n	missense	87	23.68	27	SNP	1.000	A
ENPP1	5167	genome.wustl.edu	37	6	132206110	132206110	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr6:132206110A>G	ENST00000360971.2	+	23	2371	c.2351A>G	c.(2350-2352)tAt>tGt	p.Y784C		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	784	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	CTGCGAAAGTATGCTGAAGAA	0.413																																					Colon(104;336 1535 5856 11019 33782)	dbGAP											0													233.0	212.0	219.0					6																	132206110		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2351A>G	6.37:g.132206110A>G	ENSP00000354238:p.Tyr784Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.Y784C	ENST00000360971.2	37	c.2351	CCDS5150.2	6	.	.	.	.	.	.	.	.	.	.	A	16.55	3.153585	0.57259	.	.	ENSG00000197594	ENST00000360971	T	0.67698	-0.28	5.91	3.44	0.39384	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.359145	0.30159	N	0.010273	T	0.75280	0.3828	M	0.83953	2.67	0.58432	D	0.999997	D	0.89917	1.0	D	0.79108	0.992	T	0.78388	-0.2223	10	0.87932	D	0	-11.1589	10.9231	0.47176	0.7493:0.0:0.0:0.2507	.	784	P22413	ENPP1_HUMAN	C	784	ENSP00000354238:Y784C	ENSP00000354238:Y784C	Y	+	2	0	ENPP1	132247803	1.000000	0.71417	0.067000	0.19924	0.812000	0.45895	3.825000	0.55730	0.445000	0.26639	0.533000	0.62120	TAT	ENPP1	-	pfam_DNA/RNA_non-sp_Endonuclease,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A	ENSG00000197594		0.413	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	HGNC	protein_coding	OTTHUMT00000042238.2	132	0.00	0	A			132206110	132206110	+1	no_errors	ENST00000360971	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	0.996	G
EPHB1	2047	genome.wustl.edu	37	3	134884889	134884889	+	Silent	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr3:134884889C>A	ENST00000398015.3	+	8	2035	c.1665C>A	c.(1663-1665)tcC>tcA	p.S555S	EPHB1_ENST00000493838.1_Silent_p.S116S	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	555					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TCGTTGTGTCCTTGGTGGCCA	0.577																																						dbGAP											0													131.0	148.0	142.0					3																	134884889		2138	4257	6395	-	-	-	SO:0001819	synonymous_variant	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1665C>A	3.37:g.134884889C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.S555	ENST00000398015.3	37	c.1665	CCDS46921.1	3																																																																																			EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000154928		0.577	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	42	0.00	0	C	NM_004441		134884889	134884889	+1	no_errors	ENST00000398015	ensembl	human	known	69_37n	silent	24	41.46	17	SNP	0.133	A
ERC1	23085	genome.wustl.edu	37	12	1137553	1137553	+	Silent	SNP	T	T	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr12:1137553T>C	ENST00000397203.2	+	2	890	c.484T>C	c.(484-486)Tta>Cta	p.L162L	ERC1_ENST00000355446.5_Silent_p.L162L|ERC1_ENST00000546231.2_Silent_p.L162L|ERC1_ENST00000543086.3_Silent_p.L162L|ERC1_ENST00000589028.1_Silent_p.L162L|ERC1_ENST00000360905.4_Silent_p.L162L			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	162					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GAAGGAAGTATTAAGAGAAAA	0.463																																						dbGAP											0													120.0	110.0	114.0					12																	1137553		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.484T>C	12.37:g.1137553T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Silent	SNP	pfam_CAZ_cplx_RIM-bd_prot,pfam_Rab-bd_FIP-RBD,superfamily_Prefoldin	p.L162	ENST00000397203.2	37	c.484	CCDS8508.1	12																																																																																			ERC1	-	pfam_CAZ_cplx_RIM-bd_prot	ENSG00000082805		0.463	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC1	HGNC	protein_coding	OTTHUMT00000398380.2	50	0.00	0	T	NM_015064		1137553	1137553	+1	no_errors	ENST00000360905	ensembl	human	known	69_37n	silent	19	26.92	7	SNP	0.000	C
FAM13C	220965	genome.wustl.edu	37	10	61023859	61023859	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr10:61023859C>G	ENST00000373868.2	-	9	1097	c.1010G>C	c.(1009-1011)cGt>cCt	p.R337P	FAM13C_ENST00000277705.6_Missense_Mutation_p.R358P|FAM13C_ENST00000435852.2_Missense_Mutation_p.R337P|FAM13C_ENST00000442566.3_Missense_Mutation_p.R358P|FAM13C_ENST00000468840.2_Missense_Mutation_p.R254P|FAM13C_ENST00000419214.2_Intron|FAM13C_ENST00000422313.2_Missense_Mutation_p.R337P|FAM13C_ENST00000373867.3_Missense_Mutation_p.R254P	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	337										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GAGCTGTTTACGACCTTTAGC	0.408																																						dbGAP											0													153.0	138.0	143.0					10																	61023859		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.1010G>C	10.37:g.61023859C>G	ENSP00000362975:p.Arg337Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.R337P	ENST00000373868.2	37	c.1010	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	C	29.7	5.032383	0.93575	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000001	D	0.89767	0.6810	M	0.82517	2.595	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	D	0.90086	0.4174	10	0.87932	D	0	-5.6476	20.3368	0.98748	0.0:1.0:0.0:0.0	.	337;254;337;337	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31	.;.;.;FA13C_HUMAN	P	254;337;358;358;254;337;337;115	ENSP00000362974:R254P;ENSP00000362975:R337P;ENSP00000395661:R358P;ENSP00000277705:R358P;ENSP00000423896:R254P;ENSP00000392302:R337P;ENSP00000400241:R337P;ENSP00000445068:R115P	ENSP00000277705:R358P	R	-	2	0	FAM13C	60693865	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.056000	0.64287	2.805000	0.96524	0.655000	0.94253	CGT	FAM13C	-	NULL	ENSG00000148541		0.408	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	101	0.00	0	C			61023859	61023859	-1	no_errors	ENST00000373868	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	G
FAP	2191	genome.wustl.edu	37	2	163083083	163083083	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:163083083A>T	ENST00000188790.4	-	3	347	c.140T>A	c.(139-141)aTt>aAt	p.I47N	FAP_ENST00000443424.1_Missense_Mutation_p.I47N	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						TCCATTTAAAATATCCTTCAG	0.299																																						dbGAP											0													50.0	54.0	52.0					2																	163083083		2201	4292	6493	-	-	-	SO:0001583	missense	0			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.140T>A	2.37:g.163083083A>T	ENSP00000188790:p.Ile47Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.I47N	ENST00000188790.4	37	c.140	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	A	14.42	2.531313	0.45073	.	.	ENSG00000078098	ENST00000188790;ENST00000443424;ENST00000447386	D;T	0.96619	-4.07;1.3	5.48	5.48	0.80851	.	0.428751	0.23688	N	0.045544	D	0.94165	0.8128	L	0.57536	1.79	0.32850	D	0.506551	P;P	0.43938	0.74;0.822	B;B	0.39590	0.304;0.254	D	0.96409	0.9303	10	0.72032	D	0.01	-3.1749	10.6051	0.45390	0.8207:0.0:0.0:0.1793	.	47;47	B4DLR2;Q12884	.;SEPR_HUMAN	N	47;47;26	ENSP00000188790:I47N;ENSP00000411391:I47N	ENSP00000188790:I47N	I	-	2	0	FAP	162791329	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.967000	0.49216	2.202000	0.70862	0.477000	0.44152	ATT	FAP	-	NULL	ENSG00000078098		0.299	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	HGNC	protein_coding	OTTHUMT00000332852.2	107	0.00	0	A			163083083	163083083	-1	no_errors	ENST00000188790	ensembl	human	known	69_37n	missense	49	36.36	28	SNP	1.000	T
FAT3	120114	genome.wustl.edu	37	11	92614034	92614034	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr11:92614034delG	ENST00000298047.6	+	22	12282	c.12265delG	c.(12265-12267)gggfs	p.G4089fs	FAT3_ENST00000409404.2_Frame_Shift_Del_p.G4089fs|FAT3_ENST00000533797.1_Frame_Shift_Del_p.G424fs|FAT3_ENST00000525166.1_Frame_Shift_Del_p.G3939fs			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4089	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTGTAAAGCTGGGCTCACTGG	0.418										TCGA Ovarian(4;0.039)																												dbGAP											0													200.0	198.0	198.0					11																	92614034		1906	4126	6032	-	-	-	SO:0001589	frameshift_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12265delG	11.37:g.92614034delG	ENSP00000298047:p.Gly4089fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L4090fs	ENST00000298047.6	37	c.12265		11																																																																																			FAT3	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000165323		0.418	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		51	0.00	0	G	NM_001008781		92614034	92614034	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	frame_shift_del	13	12.50	2	DEL	1.000	-
FHL1	2273	genome.wustl.edu	37	X	135288738	135288738	+	Silent	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chrX:135288738G>A	ENST00000345434.3	+	2	228	c.147G>A	c.(145-147)gcG>gcA	p.A49A	FHL1_ENST00000543669.1_Silent_p.A49A|FHL1_ENST00000370690.3_Silent_p.A49A|FHL1_ENST00000370683.1_Silent_p.A65A|FHL1_ENST00000535737.1_Silent_p.A49A|FHL1_ENST00000539015.1_Silent_p.A78A|FHL1_ENST00000477080.1_3'UTR|FHL1_ENST00000370676.3_Silent_p.A65A|FHL1_ENST00000394153.2_Silent_p.A49A|FHL1_ENST00000394155.2_Silent_p.A49A			Q13642	FHL1_HUMAN	four and a half LIM domains 1	49	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					CCATCGGTGCGGACTCCAAGG	0.552																																						dbGAP											0													147.0	133.0	138.0					X																	135288738		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.147G>A	X.37:g.135288738G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A49	ENST00000345434.3	37	c.147	CCDS55507.1	X																																																																																			FHL1	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000022267		0.552	FHL1-002	KNOWN	basic|CCDS	protein_coding	FHL1	HGNC	protein_coding	OTTHUMT00000058461.1	32	0.00	0	G	NM_001449		135288738	135288738	+1	no_errors	ENST00000345434	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.084	A
FRY	10129	genome.wustl.edu	37	13	32863812	32863812	+	Silent	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr13:32863812C>T	ENST00000380250.3	+	59	9008	c.8512C>T	c.(8512-8514)Ctg>Ttg	p.L2838L	FRY_ENST00000542859.1_Silent_p.L208L|FRY_ENST00000380217.1_Silent_p.L20L	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2838						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ACACTTCCAGCTGCTATTGCT	0.443																																						dbGAP											0													101.0	97.0	98.0					13																	32863812		1962	4153	6115	-	-	-	SO:0001819	synonymous_variant	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.8512C>T	13.37:g.32863812C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y3N6	Silent	SNP	superfamily_ARM-type_fold	p.L2838	ENST00000380250.3	37	c.8512	CCDS41875.1	13																																																																																			FRY	-	NULL	ENSG00000073910		0.443	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	60	0.00	0	C	NM_023037		32863812	32863812	+1	no_errors	ENST00000380250	ensembl	human	known	69_37n	silent	40	18.37	9	SNP	1.000	T
GAPDH	2597	genome.wustl.edu	37	12	6646882	6646882	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr12:6646882G>C	ENST00000229239.5	+	8	1324	c.658G>C	c.(658-660)Gtc>Ctc	p.V220L	GAPDH_ENST00000396859.1_Missense_Mutation_p.V220L|GAPDH_ENST00000396856.1_Missense_Mutation_p.V145L|RP5-940J5.9_ENST00000602946.1_RNA|GAPDH_ENST00000396861.1_Missense_Mutation_p.V220L|GAPDH_ENST00000396858.1_Missense_Mutation_p.V178L	NM_002046.4	NP_002037.2	P04406	G3P_HUMAN	glyceraldehyde-3-phosphate dehydrogenase	220					carbohydrate metabolic process (GO:0005975)|cellular response to interferon-gamma (GO:0071346)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of translation (GO:0017148)|neuron apoptotic process (GO:0051402)|peptidyl-cysteine S-trans-nitrosylation (GO:0035606)|protein stabilization (GO:0050821)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GAIT complex (GO:0097452)|lipid particle (GO:0005811)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|identical protein binding (GO:0042802)|microtubule binding (GO:0008017)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|peptidyl-cysteine S-nitrosylase activity (GO:0035605)			central_nervous_system(1)|cervix(1)|endometrium(1)|lung(4)	7						TGTGGGCAAGGTCATCCCTGA	0.622											OREG0021628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													29.0	28.0	28.0					12																	6646882		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF261085	CCDS8549.1, CCDS58201.1	12p13.31	2012-10-02		2005-05-06	ENSG00000111640	ENSG00000111640	1.2.1.12		4141	protein-coding gene	gene with protein product		138400		GAPD		3170585	Standard	NM_002046		Approved		uc001qop.2	P04406	OTTHUMG00000137379	ENST00000229239.5:c.658G>C	12.37:g.6646882G>C	ENSP00000229239:p.Val220Leu	Somatic	635	WXS	Illumina GAIIx	Phase_IV	E7EUT4|P00354|Q53X65	Missense_Mutation	SNP	pfam_GlycerAld_3-P_DH_cat,pfam_GlycerAld_3-P_DH_NAD(P)-bd,smart_GlycerAld_3-P_DH_NAD(P)-bd,pirsf_GlycerAld/Erythrose_P_DH,prints_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	p.V220L	ENST00000229239.5	37	c.658	CCDS8549.1	12	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423798	0.83667	.	.	ENSG00000111640	ENST00000229239;ENST00000396856;ENST00000396861;ENST00000396859;ENST00000396858	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	4.77	4.77	0.60923	Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80894	0.4711	H	0.98256	4.185	0.48632	D	0.999686	B;B;B;B;P	0.39157	0.34;0.157;0.249;0.44;0.662	B;B;B;B;B	0.43536	0.112;0.112;0.112;0.423;0.305	D	0.87960	0.2729	10	0.87932	D	0	.	17.8775	0.88829	0.0:0.0:1.0:0.0	.	178;195;220;145;220	E7EUT4;Q0QET7;Q2TSD0;E7EUT5;P04406	.;.;.;.;G3P_HUMAN	L	220;145;220;220;178	ENSP00000229239:V220L;ENSP00000380065:V145L;ENSP00000380070:V220L;ENSP00000380068:V220L;ENSP00000380067:V178L	ENSP00000229239:V220L	V	+	1	0	GAPDH	6517143	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.687000	0.98667	2.221000	0.72209	0.505000	0.49811	GTC	GAPDH	-	pfam_GlycerAld_3-P_DH_cat,pirsf_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	ENSG00000111640		0.622	GAPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAPDH	HGNC	protein_coding	OTTHUMT00000268059.1	20	0.00	0	G	NM_002046		6646882	6646882	+1	no_errors	ENST00000229239	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	C
GATA3	2625	genome.wustl.edu	37	10	8115852	8115853	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr10:8115852_8115853delAT	ENST00000346208.3	+	6	1653_1654	c.1198_1199delAT	c.(1198-1200)atgfs	p.M400fs	GATA3_ENST00000379328.3_Frame_Shift_Del_p.M401fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	400					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M401fs*>45(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CTCCAGACACATGTCCTCCCTG	0.559			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1198_1199delAT	10.37:g.8115852_8115853delAT	ENSP00000341619:p.Met400fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Del	DEL	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.M401fs	ENST00000346208.3	37	c.1201_1202	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.559	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	70	0.00	0	AT	NM_001002295		8115852	8115853	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_del	34	26.53	13	DEL	1.000:1.000	-
GLDC	2731	genome.wustl.edu	37	9	6533047	6533048	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr9:6533047_6533048insGG	ENST00000321612.6	-	25	3182_3183	c.3032_3033insCC	c.(3031-3033)ccafs	p.P1011fs		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	1011					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)	p.P1011L(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	GTTCAGAAAATGGAGACTCATA	0.446																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)																																								-	-	-	SO:0001589	frameshift_variant	0			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.3031_3032dupCC	9.37:g.6533048_6533049dupGG	ENSP00000370737:p.Pro1011fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2F8	Frame_Shift_Ins	INS	pfam_GDC-P_N,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	p.F1012fs	ENST00000321612.6	37	c.3033_3032	CCDS34987.1	9																																																																																			GLDC	-	NULL	ENSG00000178445		0.446	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	HGNC	protein_coding	OTTHUMT00000051674.2	79	0.00	0	-	NM_000170		6533047	6533048	-1	no_errors	ENST00000321612	ensembl	human	known	69_37n	frame_shift_ins	39	13.33	6	INS	0.009:1.000	GG
HCRTR1	3061	genome.wustl.edu	37	1	32089153	32089153	+	Silent	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr1:32089153G>A	ENST00000373706.5	+	5	921	c.768G>A	c.(766-768)cgG>cgA	p.R256R	HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000373705.1_Silent_p.R256R|HCRTR1_ENST00000403528.2_Silent_p.R256R			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	256					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CACTGGTGCGGAACTGGAAGC	0.657																																						dbGAP											0													23.0	26.0	25.0					1																	32089153		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.768G>A	1.37:g.32089153G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3A6|Q9HBV6	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Orexin_rcpt_1,prints_NPY_rcpt	p.R256	ENST00000373706.5	37	c.768	CCDS344.1	1																																																																																			HCRTR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt,prints_Orexin_rcpt_1	ENSG00000121764		0.657	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR1	HGNC	protein_coding	OTTHUMT00000011042.1	13	0.00	0	G	NM_001525		32089153	32089153	+1	no_errors	ENST00000373706	ensembl	human	known	69_37n	silent	7	46.15	6	SNP	0.995	A
HIST1H2BJ	8970	genome.wustl.edu	37	6	27100352	27100352	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr6:27100352T>G	ENST00000607124.1	-	1	177	c.178A>C	c.(178-180)Atg>Ctg	p.M60L	HIST1H2BJ_ENST00000339812.2_Missense_Mutation_p.M60L|HIST1H2BJ_ENST00000541790.1_Missense_Mutation_p.M60L|HIST1H2AG_ENST00000359193.2_5'Flank			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	60					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						ATGATGCCCATGGCCTTGGAC	0.557																																						dbGAP											0													197.0	187.0	190.0					6																	27100352		2203	4300	6503	-	-	-	SO:0001583	missense	0			X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.178A>C	6.37:g.27100352T>G	ENSP00000476136:p.Met60Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4J4|O60816	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.M60L	ENST00000607124.1	37	c.178	CCDS4618.1	6	.	.	.	.	.	.	.	.	.	.	T	14.76	2.630589	0.46944	.	.	ENSG00000124635	ENST00000541790;ENST00000339812	T;T	0.66815	-0.23;-0.23	4.17	4.17	0.49024	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.58047	0.2095	M	0.83118	2.625	0.53005	D	0.999967	B	0.20780	0.048	B	0.24155	0.051	T	0.67480	-0.5660	9	0.72032	D	0.01	.	11.8274	0.52275	0.0:0.0:0.0:1.0	.	60	P06899	H2B1J_HUMAN	L	60	ENSP00000445633:M60L;ENSP00000342886:M60L	ENSP00000342886:M60L	M	-	1	0	HIST1H2BJ	27208331	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	7.212000	0.77941	1.844000	0.53588	0.482000	0.46254	ATG	HIST1H2BJ	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000124635		0.557	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BJ	HGNC	protein_coding	OTTHUMT00000040138.2	88	0.00	0	T	NM_021058		27100352	27100352	-1	no_errors	ENST00000339812	ensembl	human	known	69_37n	missense	88	19.27	21	SNP	1.000	G
HNRNPKP3	399881	genome.wustl.edu	37	11	43283619	43283619	+	RNA	DEL	G	G	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr11:43283619delG	ENST00000511537.1	-	0	1316					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		AAAAAAAAAAGATGCAGGACT	0.393																																						dbGAP											0																																										-	-	-			0					11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43283619delG		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000511537.1	37	NULL		11																																																																																			HNRNPKP3	-	-	ENSG00000251557		0.393	HNRNPKP3-003	KNOWN	basic	processed_transcript	HNRNPKP3	HGNC	pseudogene	OTTHUMT00000390385.1	14	0.00	0	G	NR_033868		43283619	43283619	-1	no_errors	ENST00000511537	ensembl	human	known	69_37n	rna	4	33.33	2	DEL	0.995	-
HYDIN	54768	genome.wustl.edu	37	16	70954761	70954761	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr16:70954761C>A	ENST00000393567.2	-	46	7668	c.7518G>T	c.(7516-7518)agG>agT	p.R2506S		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2506					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCTTGCGGCCCCTGCGCCCAC	0.697																																						dbGAP											0													15.0	16.0	16.0					16																	70954761		1929	4102	6031	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7518G>T	16.37:g.70954761C>A	ENSP00000377197:p.Arg2506Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.R2505S	ENST00000393567.2	37	c.7515	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	13.97	2.394981	0.42512	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00949	5.51	5.89	2.64	0.31445	.	0.220675	0.20809	U	0.085294	T	0.00666	0.0022	N	0.22421	0.69	0.49687	D	0.999816	P	0.41848	0.763	B	0.30855	0.121	T	0.78186	-0.2302	10	0.30078	T	0.28	.	8.0935	0.30813	0.0:0.5814:0.0:0.4186	.	2505	F8WD23	.	S	2506;2505	ENSP00000377197:R2506S	ENSP00000313052:R2505S	R	-	3	2	HYDIN	69512262	0.079000	0.21365	0.843000	0.33291	0.798000	0.45092	0.149000	0.16243	0.685000	0.31468	0.609000	0.83330	AGG	HYDIN	-	NULL	ENSG00000157423		0.697	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	50	0.00	0	C			70954761	70954761	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.422	A
KALRN	8997	genome.wustl.edu	37	3	124174098	124174098	+	Silent	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr3:124174098G>A	ENST00000240874.3	+	22	3778	c.3621G>A	c.(3619-3621)acG>acA	p.T1207T	KALRN_ENST00000360013.3_Silent_p.T1207T|KALRN_ENST00000460856.1_Silent_p.T1198T	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1207					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T1207T(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TTCATGCCACGGAGATAAGGA	0.488																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(2)											143.0	132.0	135.0					3																	124174098		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3621G>A	3.37:g.124174098G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.R1176Q	ENST00000240874.3	37	c.3527	CCDS3027.1	3	.	.	.	.	.	.	.	.	.	.	G	9.751	1.167560	0.21621	.	.	ENSG00000160145	ENST00000354186	.	.	.	4.71	-2.29	0.06805	.	.	.	.	.	T	0.38825	0.1055	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33189	-0.9878	4	.	.	.	.	1.2277	0.01937	0.3933:0.108:0.3117:0.1869	.	.	.	.	Q	1176	.	.	R	+	2	0	KALRN	125656788	0.541000	0.26417	0.998000	0.56505	0.996000	0.88848	-0.159000	0.10056	-0.127000	0.11661	0.446000	0.29264	CGG	KALRN	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000160145		0.488	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258843.4	43	0.00	0	G	NM_003947		124174098	124174098	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000354186	ensembl	human	novel	69_37n	missense	18	25.00	6	SNP	0.964	A
C2CD5	9847	genome.wustl.edu	37	12	22627752	22627752	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr12:22627752G>C	ENST00000333957.4	-	16	2231	c.1976C>G	c.(1975-1977)tCa>tGa	p.S659*	C2CD5_ENST00000544930.1_Nonsense_Mutation_p.S474*|C2CD5_ENST00000446597.1_Nonsense_Mutation_p.S659*|C2CD5_ENST00000396028.2_Nonsense_Mutation_p.S650*|C2CD5_ENST00000542676.1_Nonsense_Mutation_p.S659*|C2CD5_ENST00000545552.1_Nonsense_Mutation_p.S672*|C2CD5_ENST00000536386.1_Nonsense_Mutation_p.S661*	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	659					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CGAGCTTTCTGATTGAGATCT	0.358																																						dbGAP											0													107.0	100.0	102.0					12																	22627752		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.1976C>G	12.37:g.22627752G>C	ENSP00000334229:p.Ser659*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.S659*	ENST00000333957.4	37	c.1976	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	G	41	8.936122	0.99008	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930	.	.	.	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-14.5443	16.9375	0.86207	0.0:0.0:1.0:0.0	.	.	.	.	X	659;659;661;650;659;672;474	.	ENSP00000334229:S659X	S	-	2	0	KIAA0528	22519019	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	8.977000	0.93446	2.433000	0.82419	0.650000	0.86243	TCA	KIAA0528	-	NULL	ENSG00000111731		0.358	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0528	HGNC	protein_coding	OTTHUMT00000402257.1	112	0.00	0	G	NM_014802		22627752	22627752	-1	no_errors	ENST00000333957	ensembl	human	known	69_37n	nonsense	53	32.05	25	SNP	1.000	C
KIAA1217	56243	genome.wustl.edu	37	10	24833030	24833030	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr10:24833030G>T	ENST00000376454.3	+	19	4861	c.4831G>T	c.(4831-4833)Gat>Tat	p.D1611Y	KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.D1294Y|KIAA1217_ENST00000396445.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1611					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AGAGGAAGAGGATGGCACCCT	0.512																																						dbGAP											0													109.0	109.0	109.0					10																	24833030		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4831G>T	10.37:g.24833030G>T	ENSP00000365637:p.Asp1611Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	pfam_AIP3_C	p.D1611Y	ENST00000376454.3	37	c.4831	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	G	14.98	2.698255	0.48307	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	T;T	0.39056	1.54;1.1	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.65291	0.2677	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.68104	-0.5497	10	0.87932	D	0	.	19.0404	0.92997	0.0:0.0:1.0:0.0	.	1294;1294;1611	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	Y	1294;1611;1294;1294	ENSP00000365637:D1611Y;ENSP00000365634:D1294Y	ENSP00000365634:D1294Y	D	+	1	0	KIAA1217	24873036	1.000000	0.71417	0.972000	0.41901	0.047000	0.14425	9.406000	0.97321	2.495000	0.84180	0.561000	0.74099	GAT	KIAA1217	-	NULL	ENSG00000120549		0.512	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	49	0.00	0	G	NM_019590		24833030	24833030	+1	no_errors	ENST00000376454	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
KIAA1328	57536	genome.wustl.edu	37	18	34646885	34646885	+	Silent	SNP	A	A	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr18:34646885A>C	ENST00000280020.5	+	7	631	c.609A>C	c.(607-609)tcA>tcC	p.S203S	KIAA1328_ENST00000586135.1_5'UTR|KIAA1328_ENST00000591619.1_Silent_p.S199S|KIAA1328_ENST00000586501.1_5'UTR|KIAA1328_ENST00000435985.2_5'UTR|KIAA1328_ENST00000543923.1_Silent_p.S95S	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	203										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		TCCAGTGTTCATCTGTGGAAC	0.423																																						dbGAP											0													67.0	64.0	65.0					18																	34646885		1879	4104	5983	-	-	-	SO:0001819	synonymous_variant	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.609A>C	18.37:g.34646885A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	NULL	p.H191P	ENST00000280020.5	37	c.572	CCDS45855.1	18																																																																																			KIAA1328	-	NULL	ENSG00000150477		0.423	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	HGNC	protein_coding	OTTHUMT00000440455.1	70	0.00	0	A	NM_020776		34646885	34646885	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000587139	ensembl	human	putative	69_37n	missense	31	26.19	11	SNP	0.000	C
LAMA4	3910	genome.wustl.edu	37	6	112575076	112575077	+	Intron	DEL	GA	GA	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr6:112575076_112575077delGA	ENST00000230538.7	-	2	593				RP11-506B6.6_ENST00000585504.1_RNA|RP11-506B6.6_ENST00000590293.1_RNA|RP11-506B6.6_ENST00000585450.1_RNA|RP11-506B6.6_ENST00000590804.1_RNA|RP11-506B6.6_ENST00000587816.1_RNA|LAMA4_ENST00000389463.4_Intron|LAMA4_ENST00000368638.4_Frame_Shift_Del_p.P94fs|RP11-506B6.6_ENST00000590673.1_RNA|LAMA4_ENST00000453937.2_Frame_Shift_Del_p.P94fs|RP11-506B6.6_ENST00000590584.1_RNA|RP11-506B6.6_ENST00000588837.1_RNA|LAMA4_ENST00000424408.2_Intron|LAMA4_ENST00000522006.1_Intron|LAMA4_ENST00000431543.2_Intron|RP11-506B6.6_ENST00000433684.3_RNA|RP11-506B6.6_ENST00000585611.1_RNA	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4						blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GAAAGAGGCGGAGAGAGAGAGA	0.584																																						dbGAP											0									,,,,	55,4183		5,45,2069					,,,,	0.8	0.0			42	97,8157		13,71,4043	no	intron,frameshift,frameshift,intron,intron	LAMA4	NM_002290.3,NM_001105209.1,NM_001105208.1,NM_001105207.1,NM_001105206.1	,,,,	18,116,6112	A1A1,A1R,RR		1.1752,1.2978,1.2168	,,,,	,,,,		152,12340				-	-	-	SO:0001627	intron_variant	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.195+80TC>-	6.37:g.112575086_112575087delGA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Frame_Shift_Del	DEL	NULL	p.P93fs	ENST00000230538.7	37	c.277_276	CCDS43491.1	6																																																																																			LAMA4	-	NULL	ENSG00000112769		0.584	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	52	0.00	0	GA	NM_001105206		112575076	112575077	-1	no_errors	ENST00000368638	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.000:0.000	-
MAN1A2	10905	genome.wustl.edu	37	1	118039456	118039456	+	Silent	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr1:118039456C>T	ENST00000356554.3	+	10	2091	c.1356C>T	c.(1354-1356)caC>caT	p.H452H		NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	452					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		AGAATGGGCACTTGGAAAAAA	0.403																																					Ovarian(33;199 881 8228 13687 31538)	dbGAP											0													105.0	107.0	106.0					1																	118039456		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.1356C>T	1.37:g.118039456C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H510	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.T185I	ENST00000356554.3	37	c.554	CCDS895.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.412|9.412	1.080739|1.080739	0.20309|0.20309	.|.	.|.	ENSG00000198162|ENSG00000198162	ENST00000421535|ENST00000449370	.|.	.|.	.|.	5.59|5.59	4.66|4.66	0.58398|0.58398	.|.	.|.	.|.	.|.	.|.	T|T	0.55673|0.55673	0.1935|0.1935	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.52275|0.52275	-0.8597|-0.8597	4|4	.|.	.|.	.|.	-12.5132|-12.5132	13.0469|13.0469	0.58931|0.58931	0.0:0.9172:0.0:0.0828|0.0:0.9172:0.0:0.0828	.|.	.|.	.|.	.|.	F|I	19|185	.|.	.|.	L|T	+|+	1|2	0|0	MAN1A2|MAN1A2	117840979|117840979	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	1.589000|1.589000	0.36644|0.36644	2.788000|2.788000	0.95919|0.95919	0.557000|0.557000	0.71058|0.71058	CTT|ACT	MAN1A2	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47	ENSG00000198162		0.403	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A2	HGNC	protein_coding	OTTHUMT00000033593.1	68	0.00	0	C	NM_006699		118039456	118039456	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000449370	ensembl	human	known	69_37n	missense	42	31.15	19	SNP	1.000	T
NPAS2	4862	genome.wustl.edu	37	2	101594255	101594255	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:101594255G>C	ENST00000335681.5	+	15	1761	c.1476G>C	c.(1474-1476)atG>atC	p.M492I	NPAS2_ENST00000542504.1_Missense_Mutation_p.M557I|AC016738.3_ENST00000446644.1_RNA|AC016738.3_ENST00000433012.1_RNA|AC016738.3_ENST00000439150.1_RNA	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	492					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCGCTCCCATGGCACAGGTGA	0.622																																						dbGAP											0													73.0	71.0	72.0					2																	101594255		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.1476G>C	2.37:g.101594255G>C	ENSP00000338283:p.Met492Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.M557I	ENST00000335681.5	37	c.1671	CCDS2048.1	2	.	.	.	.	.	.	.	.	.	.	G	15.22	2.767638	0.49574	.	.	ENSG00000170485	ENST00000335681;ENST00000542504;ENST00000450763	T;T;T	0.31769	3.5;3.47;1.48	5.69	4.81	0.61882	.	1.494920	0.03741	N	0.254922	T	0.32496	0.0831	L	0.43152	1.355	0.32069	N	0.594678	B;B;B	0.21821	0.061;0.002;0.007	B;B;B	0.22152	0.038;0.002;0.017	T	0.24621	-1.0155	10	0.23891	T	0.37	.	12.0601	0.53559	0.0792:0.0:0.9208:0.0	.	557;492;492	F5H027;A0PJF9;Q99743	.;.;NPAS2_HUMAN	I	492;557;91	ENSP00000338283:M492I;ENSP00000438428:M557I;ENSP00000392125:M91I	ENSP00000338283:M492I	M	+	3	0	NPAS2	100960687	1.000000	0.71417	0.152000	0.22495	0.829000	0.46940	5.500000	0.66943	1.401000	0.46761	0.655000	0.94253	ATG	NPAS2	-	NULL	ENSG00000170485		0.622	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	36	0.00	0	G			101594255	101594255	+1	no_errors	ENST00000542504	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.826	C
MGAT5	4249	genome.wustl.edu	37	2	135206253	135206253	+	Silent	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:135206253C>T	ENST00000409645.1	+	17	2313	c.2061C>T	c.(2059-2061)gcC>gcT	p.A687A	MGAT5_ENST00000281923.2_Silent_p.A687A			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	687					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CAGAGCTGGCCAAGGACATCC	0.562																																						dbGAP											0													212.0	205.0	207.0					2																	135206253		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.2061C>T	2.37:g.135206253C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP70	Silent	SNP	NULL	p.A687	ENST00000409645.1	37	c.2061	CCDS2171.1	2																																																																																			MGAT5	-	NULL	ENSG00000152127		0.562	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT5	HGNC	protein_coding	OTTHUMT00000254584.3	58	0.00	0	C	NM_002410		135206253	135206253	+1	no_errors	ENST00000281923	ensembl	human	known	69_37n	silent	32	27.27	12	SNP	1.000	T
NRK	203447	genome.wustl.edu	37	X	105168991	105168991	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chrX:105168991C>A	ENST00000243300.9	+	19	3583	c.3280C>A	c.(3280-3282)Cct>Act	p.P1094T	NRK_ENST00000428173.2_Missense_Mutation_p.P1095T	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1094					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						ATTGAAGAGACCTGCGTCTCA	0.458										HNSCC(51;0.14)																												dbGAP											0													98.0	91.0	93.0					X																	105168991		1931	4124	6055	-	-	-	SO:0001583	missense	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3280C>A	X.37:g.105168991C>A	ENSP00000434830:p.Pro1094Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.P1095T	ENST00000243300.9	37	c.3283		X	.	.	.	.	.	.	.	.	.	.	C	9.795	1.179069	0.21787	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.80393	-1.36;-1.37	5.06	-0.097	0.13635	.	1.799950	0.03037	N	0.152911	T	0.67249	0.2873	N	0.24115	0.695	0.09310	N	1	B;B	0.13145	0.007;0.001	B;B	0.14023	0.01;0.003	T	0.49437	-0.8940	10	0.45353	T	0.12	.	2.2699	0.04088	0.1334:0.4744:0.1306:0.2616	.	762;1094	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	T	1094;1095	ENSP00000434830:P1094T;ENSP00000438378:P1095T	ENSP00000434830:P1094T	P	+	1	0	NRK	105055647	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.071000	0.11505	-0.352000	0.08237	-0.903000	0.02851	CCT	NRK	-	NULL	ENSG00000123572		0.458	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	38	0.00	0	C	NM_198465		105168991	105168991	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.000	A
NUP54	53371	genome.wustl.edu	37	4	77038880	77038881	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr4:77038880_77038881delAA	ENST00000264883.3	-	11	1471_1472	c.1331_1332delTT	c.(1330-1332)tttfs	p.F444fs	NUP54_ENST00000342467.6_Frame_Shift_Del_p.F228fs|NUP54_ENST00000514987.1_Frame_Shift_Del_p.F396fs|NUP54_ENST00000458189.2_Frame_Shift_Del_p.F264fs	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	444	9 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						TGACTGCTCCAAAATGATTCTG	0.386																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.1331_1332delTT	4.37:g.77038882_77038883delAA	ENSP00000264883:p.Phe444fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Frame_Shift_Del	DEL	NULL	p.F444fs	ENST00000264883.3	37	c.1332_1331	CCDS3576.1	4																																																																																			NUP54	-	NULL	ENSG00000138750		0.386	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP54	HGNC	protein_coding	OTTHUMT00000252402.3	60	0.00	0	AA			77038880	77038881	-1	no_errors	ENST00000264883	ensembl	human	known	69_37n	frame_shift_del	34	27.66	13	DEL	1.000:1.000	-
TENM4	26011	genome.wustl.edu	37	11	78381001	78381001	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr11:78381001A>G	ENST00000278550.7	-	32	6851	c.6389T>C	c.(6388-6390)aTt>aCt	p.I2130T		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2130					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GATCTGGTTAATGTCATAGTA	0.468																																						dbGAP											0													65.0	63.0	64.0					11																	78381001		2108	4227	6335	-	-	-	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6389T>C	11.37:g.78381001A>G	ENSP00000278550:p.Ile2130Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.I2130T	ENST00000278550.7	37	c.6389	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	A	17.06	3.293569	0.60086	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89810	-2.57;0.9	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.93298	0.7864	M	0.71581	2.175	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	D	0.93210	0.6599	9	.	.	.	.	14.6241	0.68608	1.0:0.0:0.0:0.0	.	2130	Q6N022	TEN4_HUMAN	T	2130;594	ENSP00000278550:I2130T;ENSP00000431711:I594T	.	I	-	2	0	ODZ4	78058649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.087000	0.94110	2.100000	0.63781	0.533000	0.62120	ATT	ODZ4	-	NULL	ENSG00000149256		0.468	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ4	HGNC	protein_coding	OTTHUMT00000391406.2	39	0.00	0	A			78381001	78381001	-1	no_errors	ENST00000278550	ensembl	human	known	69_37n	missense	19	31.03	9	SNP	1.000	G
OR4N5	390437	genome.wustl.edu	37	14	20612251	20612251	+	Silent	SNP	C	C	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr14:20612251C>G	ENST00000333629.1	+	1	357	c.357C>G	c.(355-357)gcC>gcG	p.A119A	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TTGTGATGGCCTTTGACCGCT	0.488																																						dbGAP											0													152.0	149.0	150.0					14																	20612251		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.357C>G	14.37:g.20612251C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF11	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A119	ENST00000333629.1	37	c.357	CCDS32031.1	14																																																																																			OR4N5	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184394		0.488	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N5	HGNC	protein_coding	OTTHUMT00000410347.1	80	0.00	0	C			20612251	20612251	+1	no_errors	ENST00000333629	ensembl	human	known	69_37n	silent	54	12.90	8	SNP	0.984	G
PCDHGA1	56114	genome.wustl.edu	37	5	140712271	140712271	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr5:140712271G>A	ENST00000517417.1	+	1	2020	c.2020G>A	c.(2020-2022)Gac>Aac	p.D674N	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.D674N	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	674	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATCCTGGCCGACCTGGGCAG	0.692																																						dbGAP											0													54.0	65.0	61.0					5																	140712271		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2020G>A	5.37:g.140712271G>A	ENSP00000431083:p.Asp674Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M273|Q9Y5D6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D674N	ENST00000517417.1	37	c.2020	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045103	0.75846	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.49720	0.77;0.77	3.87	3.87	0.44632	Cadherin (1);	0.000000	0.51477	D	0.000091	T	0.45034	0.1322	M	0.68952	2.095	0.36155	D	0.847738	P;P	0.43633	0.813;0.716	B;B	0.36808	0.233;0.117	T	0.65512	-0.6150	10	0.87932	D	0	.	14.1628	0.65457	0.0:0.0:1.0:0.0	.	674;674	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	N	674	ENSP00000431083:D674N;ENSP00000367345:D674N	ENSP00000367345:D674N	D	+	1	0	PCDHGA1	140692455	0.997000	0.39634	0.280000	0.24747	0.023000	0.10783	3.513000	0.53414	2.162000	0.67917	0.585000	0.79938	GAC	PCDHGA1	-	pfscan_Cadherin	ENSG00000204956		0.692	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	34	0.00	0	G	NM_018912		140712271	140712271	+1	no_errors	ENST00000517417	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.981	A
PDCL	5082	genome.wustl.edu	37	9	125588988	125588988	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr9:125588988G>T	ENST00000259467.4	-	2	244	c.79C>A	c.(79-81)Cac>Aac	p.H27N		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	27					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						TTGTCCTCGTGGTCACTGTCC	0.532																																						dbGAP											0													157.0	125.0	136.0					9																	125588988		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.79C>A	9.37:g.125588988G>T	ENSP00000259467:p.His27Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,prints_Phosducin	p.H27N	ENST00000259467.4	37	c.79	CCDS6845.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.458|8.458	0.854727|0.854727	0.17106|0.17106	.|.	.|.	ENSG00000136940|ENSG00000136940	ENST00000259467|ENST00000394285	T|.	0.40476|.	1.03|.	5.7|5.7	3.65|3.65	0.41850|0.41850	.|.	0.857327|.	0.10904|.	N|.	0.621277|.	T|T	0.29817|0.29817	0.0745|0.0745	N|N	0.14661|0.14661	0.345|0.345	0.24151|0.24151	N|N	0.995697|0.995697	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.18777|0.18777	-1.0326|-1.0326	9|5	.|.	.|.	.|.	-1.2998|-1.2998	12.8617|12.8617	0.57918|0.57918	0.0:0.0:0.6191:0.3809|0.0:0.0:0.6191:0.3809	.|.	27;27|.	Q4VXB6;Q13371|.	.;PHLP_HUMAN|.	N|Q	27|15	ENSP00000259467:H27N|.	.|.	H|P	-|-	1|2	0|0	PDCL|PDCL	124628809|124628809	0.990000|0.990000	0.36364|0.36364	0.842000|0.842000	0.33263|0.33263	0.874000|0.874000	0.50279|0.50279	2.163000|2.163000	0.42377|0.42377	1.356000|1.356000	0.45884|0.45884	0.655000|0.655000	0.94253|0.94253	CAC|CCA	PDCL	-	NULL	ENSG00000136940		0.532	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCL	HGNC	protein_coding	OTTHUMT00000053956.1	96	0.00	0	G	NM_005388		125588988	125588988	-1	no_errors	ENST00000259467	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	0.461	T
PLA2G4D	283748	genome.wustl.edu	37	15	42379619	42379619	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr15:42379619G>T	ENST00000290472.3	-	3	228	c.134C>A	c.(133-135)cCt>cAt	p.P45H		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	45	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		GATCACGTAAGGGTCGGCCTC	0.552																																						dbGAP											0													202.0	179.0	187.0					15																	42379619		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.134C>A	15.37:g.42379619G>T	ENSP00000290472:p.Pro45His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N176	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.P45H	ENST00000290472.3	37	c.134	CCDS32203.1	15	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042541	0.35989	.	.	ENSG00000159337	ENST00000290472	T	0.78003	-1.14	5.39	5.39	0.77823	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.269330	0.32161	N	0.006491	D	0.92227	0.7535	H	0.98333	4.205	0.33596	D	0.601655	D	0.76494	0.999	D	0.76575	0.988	D	0.96109	0.9075	10	0.72032	D	0.01	-15.3368	12.772	0.57426	0.0:0.1646:0.8354:0.0	.	45	Q86XP0	PA24D_HUMAN	H	45	ENSP00000290472:P45H	ENSP00000290472:P45H	P	-	2	0	PLA2G4D	40166911	0.988000	0.35896	0.557000	0.28306	0.054000	0.15201	2.541000	0.45735	2.691000	0.91804	0.655000	0.94253	CCT	PLA2G4D	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000159337		0.552	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4D	HGNC	protein_coding	OTTHUMT00000419317.1	54	0.00	0	G	NM_178034		42379619	42379619	-1	no_errors	ENST00000290472	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	0.860	T
PMP2	5375	genome.wustl.edu	37	8	82355662	82355662	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:82355662C>A	ENST00000256103.2	-	4	506	c.370G>T	c.(370-372)Gtg>Ttg	p.V124L	PMP2_ENST00000519260.1_3'UTR|RP11-157I4.4_ENST00000524085.2_RNA	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	124					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			CTGGTGCACACCACGCCCTTC	0.318																																						dbGAP											0													102.0	103.0	103.0					8																	82355662		2203	4297	6500	-	-	-	SO:0001583	missense	0			X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.370G>T	8.37:g.82355662C>A	ENSP00000256103:p.Val124Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHL4	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.V124L	ENST00000256103.2	37	c.370	CCDS6229.1	8	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666469	0.47677	.	.	ENSG00000147588	ENST00000256103	T	0.08634	3.07	5.29	3.49	0.39957	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.328595	0.32041	N	0.006677	T	0.10121	0.0248	L	0.58925	1.835	0.58432	D	0.999995	B	0.13145	0.007	B	0.17098	0.017	T	0.05225	-1.0898	10	0.72032	D	0.01	.	8.7117	0.34387	0.0:0.7711:0.0:0.2289	.	124	P02689	MYP2_HUMAN	L	124	ENSP00000256103:V124L	ENSP00000256103:V124L	V	-	1	0	PMP2	82518217	0.005000	0.15991	0.995000	0.50966	0.982000	0.71751	0.406000	0.21032	0.734000	0.32515	0.585000	0.79938	GTG	PMP2	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	ENSG00000147588		0.318	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP2	HGNC	protein_coding	OTTHUMT00000379365.1	95	0.00	0	C	NM_002677		82355662	82355662	-1	no_errors	ENST00000256103	ensembl	human	known	69_37n	missense	111	20.14	28	SNP	0.900	A
PRAMEF11	440560	genome.wustl.edu	37	1	12888424	12888424	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr1:12888424A>G	ENST00000535591.1	-	2	295	c.100T>C	c.(100-102)Tgt>Cgt	p.C34R		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	34					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GCCTCCAGACAAGGCATCTTT	0.637																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.100T>C	1.37:g.12888424A>G	ENSP00000439551:p.Cys34Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C34R	ENST00000535591.1	37	c.100	CCDS53268.1	1	.	.	.	.	.	.	.	.	.	.	.	8.305	0.820779	0.16678	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.04015	3.73;3.73	1.45	-2.91	0.05631	.	2.215510	0.01786	N	0.032054	T	0.06826	0.0174	L	0.34521	1.04	0.09310	N	1	P	0.44627	0.839	P	0.48488	0.579	T	0.18777	-1.0326	10	0.54805	T	0.06	.	4.07	0.09877	0.2001:0.5006:0.2992:0.0	.	34	O60813	PRA11_HUMAN	R	34;75;34	ENSP00000439551:C34R;ENSP00000391839:C34R	ENSP00000328783:C75R	C	-	1	0	PRAMEF11	12811011	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.399000	0.07250	-0.828000	0.04273	-0.939000	0.02691	TGT	PRAMEF11	-	NULL	ENSG00000204513		0.637	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		36	0.00	0	A	XM_496341		12888424	12888424	-1	no_errors	ENST00000535591	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.000	G
PRKCE	5581	genome.wustl.edu	37	2	46313346	46313346	+	Splice_Site	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:46313346G>A	ENST00000306156.3	+	11	1764		c.e11-1			NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TCTCCTTTCAGGACCGCCTCT	0.483																																						dbGAP											0													130.0	118.0	122.0					2																	46313346		1773	3761	5534	-	-	-	SO:0001630	splice_region_variant	0				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.1438-1G>A	2.37:g.46313346G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Splice_Site	SNP	-	e11-1	ENST00000306156.3	37	c.1438-1	CCDS1824.1	2	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248016	0.80024	.	.	ENSG00000171132	ENST00000306156	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.85	0.92224	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRKCE	46166850	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.750000	0.94351	0.655000	0.94253	.	PRKCE	-	-	ENSG00000171132		0.483	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	HGNC	protein_coding	OTTHUMT00000250751.2	87	0.00	0	G		Intron	46313346	46313346	+1	no_errors	ENST00000306156	ensembl	human	known	69_37n	splice_site	57	18.57	13	SNP	1.000	A
PRPF8	10594	genome.wustl.edu	37	17	1582137	1582137	+	Silent	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr17:1582137C>T	ENST00000572621.1	-	11	1903	c.1638G>A	c.(1636-1638)ctG>ctA	p.L546L	PRPF8_ENST00000304992.6_Silent_p.L546L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	546					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CTTCCCGACACAGGTGGAAAG	0.478																																						dbGAP											0													71.0	64.0	66.0					17																	1582137		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1638G>A	17.37:g.1582137C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O14547|O75965	Silent	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.L546	ENST00000572621.1	37	c.1638	CCDS11010.1	17																																																																																			PRPF8	-	pfam_PROCN,superfamily_Histone-fold	ENSG00000174231		0.478	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	47	0.00	0	C			1582137	1582137	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	silent	25	32.43	12	SNP	0.994	T
PRSS55	203074	genome.wustl.edu	37	8	10383206	10383206	+	Silent	SNP	A	A	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:10383206A>G	ENST00000328655.3	+	1	151	c.111A>G	c.(109-111)ggA>ggG	p.G37G	PRSS55_ENST00000522210.1_Silent_p.G37G|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	37						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						GGGCTAGGGGAGCCCACCGCC	0.652																																						dbGAP											0													48.0	40.0	43.0					8																	10383206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.111A>G	8.37:g.10383206A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E5RJX5	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G37	ENST00000328655.3	37	c.111	CCDS5976.1	8																																																																																			PRSS55	-	NULL	ENSG00000184647		0.652	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS55	HGNC	protein_coding	OTTHUMT00000251493.3	23	0.00	0	A	NM_198464		10383206	10383206	+1	no_errors	ENST00000328655	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	0.000	G
PSD3	23362	genome.wustl.edu	37	8	18457916	18457916	+	Silent	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:18457916G>T	ENST00000327040.8	-	12	2541	c.2439C>A	c.(2437-2439)acC>acA	p.T813T	PSD3_ENST00000286485.8_Silent_p.T279T|PSD3_ENST00000428502.2_Silent_p.T142T|PSD3_ENST00000440756.2_Silent_p.T815T|PSD3_ENST00000523619.1_Silent_p.T748T	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	814	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CAGCATAAAAGGTTTTCCATC	0.333																																						dbGAP											0													154.0	153.0	153.0					8																	18457916		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2439C>A	8.37:g.18457916G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.T815	ENST00000327040.8	37	c.2445	CCDS43720.1	8																																																																																			PSD3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000156011		0.333	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSD3	HGNC	protein_coding	OTTHUMT00000374867.1	154	0.65	1	G	NM_015310		18457916	18457916	-1	no_errors	ENST00000440756	ensembl	human	known	69_37n	silent	69	28.12	27	SNP	0.994	T
PSG2	5670	genome.wustl.edu	37	19	43585335	43585335	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr19:43585335G>A	ENST00000406487.1	-	2	226	c.128C>T	c.(127-129)cCa>cTa	p.P43L	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	43	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				GGAAACTTTTGGTGGCTGGGC	0.488																																						dbGAP											0													171.0	168.0	169.0					19																	43585335		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.128C>T	19.37:g.43585335G>A	ENSP00000385706:p.Pro43Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P43L	ENST00000406487.1	37	c.128	CCDS12616.1	19	.	.	.	.	.	.	.	.	.	.	N	7.589	0.670412	0.14776	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.61627	0.09	0.569	0.569	0.17340	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57198	0.2037	M	0.61703	1.905	0.09310	N	1	B;P	0.35307	0.228;0.494	B;B	0.43155	0.236;0.41	T	0.52366	-0.8585	8	0.45353	T	0.12	.	.	.	.	.	43;43	B5MCM8;P11465	.;PSG2_HUMAN	L	43	ENSP00000385706:P43L	ENSP00000332984:P43L	P	-	2	0	PSG2	48277175	0.000000	0.05858	0.004000	0.12327	0.018000	0.09664	-0.700000	0.05081	0.567000	0.29293	0.184000	0.17185	CCA	PSG2	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000242221		0.488	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG2	HGNC	protein_coding	OTTHUMT00000323083.1	204	0.00	0	G	NM_031246		43585335	43585335	-1	no_errors	ENST00000329509	ensembl	human	known	69_37n	missense	180	13.88	29	SNP	0.005	A
RAB33A	9363	genome.wustl.edu	37	X	129318289	129318289	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chrX:129318289C>A	ENST00000257017.4	+	2	703	c.289C>A	c.(289-291)Cgt>Agt	p.R97S		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	97					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11						AGGTCAGGAACGTTTCCGCAA	0.473																																						dbGAP											0													131.0	106.0	114.0					X																	129318289		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594		"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333				7688322, 9512502	Standard	NM_004794		Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.289C>A	X.37:g.129318289C>A	ENSP00000257017:p.Arg97Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JUZ6|Q92465	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R97S	ENST00000257017.4	37	c.289	CCDS14621.1	X	.	.	.	.	.	.	.	.	.	.	C	18.90	3.722556	0.68959	.	.	ENSG00000134594	ENST00000257017	T	0.78364	-1.17	4.71	3.77	0.43336	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.87059	0.6083	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88600	0.3149	10	0.87932	D	0	-9.5364	12.0543	0.53524	0.3738:0.6262:0.0:0.0	.	97	Q14088	RB33A_HUMAN	S	97	ENSP00000257017:R97S	ENSP00000257017:R97S	R	+	1	0	RAB33A	129145970	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.554000	0.45845	2.072000	0.62099	0.429000	0.28392	CGT	RAB33A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000134594		0.473	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB33A	HGNC	protein_coding	OTTHUMT00000058246.1	55	0.00	0	C	NM_004794		129318289	129318289	+1	no_errors	ENST00000257017	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	1.000	A
RBM27	54439	genome.wustl.edu	37	5	145651050	145651050	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr5:145651050C>T	ENST00000265271.5	+	19	2967	c.2801C>T	c.(2800-2802)gCa>gTa	p.A934V	RBM27_ENST00000506502.1_Missense_Mutation_p.A879V	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	934					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATTCAGGCTGCACGGTTAGGT	0.403																																						dbGAP											0													114.0	104.0	107.0					5																	145651050		1568	3582	5150	-	-	-	SO:0001583	missense	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2801C>T	5.37:g.145651050C>T	ENSP00000265271:p.Ala934Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYW9	Missense_Mutation	SNP	pfam_PWI,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.A934V	ENST00000265271.5	37	c.2801	CCDS43378.1	5	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591977	0.86953	.	.	ENSG00000091009	ENST00000265271	T	0.54675	0.56	5.05	4.18	0.49190	.	0.075250	0.56097	N	0.000037	T	0.49440	0.1557	M	0.64997	1.995	0.46317	D	0.998981	P	0.42692	0.787	B	0.38056	0.264	T	0.55431	-0.8142	10	0.54805	T	0.06	-7.1219	13.6358	0.62221	0.0:0.9248:0.0:0.0752	.	934	Q9P2N5	RBM27_HUMAN	V	934	ENSP00000265271:A934V	ENSP00000265271:A934V	A	+	2	0	RBM27	145631243	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	3.915000	0.56409	1.259000	0.44117	0.655000	0.94253	GCA	RBM27	-	NULL	ENSG00000091009		0.403	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1	120	0.00	0	C	XM_291128		145651050	145651050	+1	no_errors	ENST00000265271	ensembl	human	known	69_37n	missense	74	12.94	11	SNP	1.000	T
RBMS1	5937	genome.wustl.edu	37	2	161159925	161159925	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:161159925delT	ENST00000348849.3	-	5	906	c.476delA	c.(475-477)aatfs	p.N159fs	RBMS1_ENST00000392753.3_Frame_Shift_Del_p.N159fs|RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000409075.1_Frame_Shift_Del_p.N126fs|RBMS1_ENST00000409289.2_Frame_Shift_Del_p.N126fs|RBMS1_ENST00000409972.1_Frame_Shift_Del_p.N126fs	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	159	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								TTTGAGCATATTTTCTAGTTC	0.418																																						dbGAP											0													153.0	136.0	142.0					2																	161159925		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.476delA	2.37:g.161159925delT	ENSP00000294904:p.Asn159fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.N159fs	ENST00000348849.3	37	c.476	CCDS2213.1	2																																																																																			RBMS1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	ENSG00000153250		0.418	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS1	HGNC	protein_coding	OTTHUMT00000255043.4	77	0.00	0	T	NM_016836		161159925	161159925	-1	no_errors	ENST00000392753	ensembl	human	known	69_37n	frame_shift_del	57	25.00	19	DEL	1.000	-
RFPL1	5988	genome.wustl.edu	37	22	29833558	29833558	+	5'Flank	SNP	T	T	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr22:29833558T>C	ENST00000354373.2	+	0	0				RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1								zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						AATTCCCTGTTATAATTAAAT	0.398																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516		22.37:g.29833558T>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IC06|Q9UJ97	RNA	SNP	-	NULL	ENST00000354373.2	37	NULL	CCDS13857.2	22																																																																																			RFPL1-AS1	-	-	ENSG00000225465		0.398	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFPL1-AS1	HGNC	protein_coding	OTTHUMT00000318719.1	40	0.00	0	T	NM_021026		29833558	29833558	-1	no_errors	ENST00000461286	ensembl	human	known	69_37n	rna	9	52.63	10	SNP	0.000	C
RIPK2	8767	genome.wustl.edu	37	8	90777697	90777697	+	Silent	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:90777697C>T	ENST00000220751.4	+	3	770	c.456C>T	c.(454-456)atC>atT	p.I152I	RIPK2_ENST00000540020.1_Silent_p.I15I	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			CTCAGAATATCTTATTGGACA	0.308																																						dbGAP											0													95.0	91.0	92.0					8																	90777697		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.456C>T	8.37:g.90777697C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z748|Q6UWF0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CARD,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Rcpt-int_Ser/Thr_kinase-2,pfscan_CARD,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I152	ENST00000220751.4	37	c.456	CCDS6247.1	8																																																																																			RIPK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Rcpt-int_Ser/Thr_kinase-2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000104312		0.308	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK2	HGNC	protein_coding	OTTHUMT00000375686.1	61	0.00	0	C			90777697	90777697	+1	no_errors	ENST00000220751	ensembl	human	known	69_37n	silent	49	30.99	22	SNP	1.000	T
RPA2	6118	genome.wustl.edu	37	1	28233517	28233517	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr1:28233517C>A	ENST00000373912.3	-	4	554	c.255G>T	c.(253-255)aaG>aaT	p.K85N	RPA2_ENST00000373909.3_Missense_Mutation_p.K93N|RPA2_ENST00000313433.7_Missense_Mutation_p.K173N	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa	85					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTTGGAGCCTTCTCTGCAT	0.428								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													81.0	72.0	75.0					1																	28233517		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.255G>T	1.37:g.28233517C>A	ENSP00000363021:p.Lys85Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52II0|Q5TEI9|Q5TEJ5	Missense_Mutation	SNP	pfam_RPA_C,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like	p.K173N	ENST00000373912.3	37	c.519	CCDS314.1	1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.870006	0.72065	.	.	ENSG00000117748	ENST00000373912;ENST00000373909;ENST00000313433;ENST00000444045	T;T;T;T	0.21191	2.02;2.02;2.02;2.02	6.08	2.15	0.27550	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.000000	0.85682	D	0.000000	T	0.14227	0.0344	L	0.28504	0.86	0.49389	D	0.999787	B;P	0.41524	0.288;0.753	B;B	0.40565	0.168;0.333	T	0.05273	-1.0895	10	0.37606	T	0.19	-12.0656	7.5805	0.27961	0.0:0.5475:0.0:0.4525	.	85;93	P15927;P15927-2	RFA2_HUMAN;.	N	85;93;173;89	ENSP00000363021:K85N;ENSP00000363017:K93N;ENSP00000363015:K173N;ENSP00000387649:K89N	ENSP00000363015:K173N	K	-	3	2	RPA2	28106104	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	0.761000	0.26489	0.449000	0.26747	0.591000	0.81541	AAG	RPA2	-	pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like	ENSG00000117748		0.428	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA2	HGNC	protein_coding	OTTHUMT00000011179.1	78	0.00	0	C	NM_002946		28233517	28233517	-1	no_errors	ENST00000313433	ensembl	human	known	69_37n	missense	26	49.02	25	SNP	1.000	A
SHISA7	729956	genome.wustl.edu	37	19	55952073	55952073	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr19:55952073C>T	ENST00000376325.4	-	2	730	c.731G>A	c.(730-732)cGa>cAa	p.R244Q		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	244						integral component of membrane (GO:0016021)				skin(1)	1						GGAGCTGCTTCGGGCCCGGTC	0.667																																						dbGAP											0													15.0	20.0	19.0					19																	55952073		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.731G>A	19.37:g.55952073C>T	ENSP00000365503:p.Arg244Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R244Q	ENST00000376325.4	37	c.731	CCDS46193.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.430778|4.430778	0.83776|0.83776	.|.	.|.	ENSG00000187902|ENSG00000187902	ENST00000416792|ENST00000376325;ENST00000432840	.|.	.|.	.|.	4.18|4.18	4.18|4.18	0.49190|0.49190	.|.	.|0.146453	.|0.43919	.|U	.|0.000507	T|T	0.27313|0.27313	0.0670|0.0670	L|L	0.40543|0.40543	1.245|1.245	0.25986|0.25986	N|N	0.982305|0.982305	.|D	.|0.59357	.|0.985	.|B	.|0.41571	.|0.36	T|T	0.23226|0.23226	-1.0194|-1.0194	5|9	.|0.49607	.|T	.|0.09	.|.	8.5924|8.5924	0.33695|0.33695	0.0:0.8893:0.0:0.1107|0.0:0.8893:0.0:0.1107	.|.	.|244	.|A6NL88	.|SHSA7_HUMAN	K|Q	69|244;91	.|.	.|ENSP00000365503:R244Q	E|R	-|-	1|2	0|0	SHISA7|SHISA7	60643885|60643885	0.936000|0.936000	0.31750|0.31750	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.001000|3.001000	0.49488|0.49488	2.262000|2.262000	0.75019|0.75019	0.561000|0.561000	0.74099|0.74099	GAA|CGA	SHISA7	-	NULL	ENSG00000187902		0.667	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA7	HGNC	protein_coding	OTTHUMT00000334533.2	29	0.00	0	C	NM_001145176		55952073	55952073	-1	no_errors	ENST00000376325	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.999	T
SLC22A14	9389	genome.wustl.edu	37	3	38347782	38347782	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr3:38347782T>A	ENST00000273173.4	+	1	356	c.265T>A	c.(265-267)Ttc>Atc	p.F89I	RNU6-235P_ENST00000362644.1_RNA|SLC22A14_ENST00000448498.1_Missense_Mutation_p.F89I	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	89					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		TGCTGACCACTTCGTGTTCAC	0.562																																						dbGAP											0													129.0	109.0	116.0					3																	38347782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.265T>A	3.37:g.38347782T>A	ENSP00000273173:p.Phe89Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F89I	ENST00000273173.4	37	c.265	CCDS2677.1	3	.	.	.	.	.	.	.	.	.	.	T	14.76	2.631811	0.46944	.	.	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.37411	1.2;1.2	5.62	2.97	0.34412	.	0.095444	0.64402	D	0.000001	T	0.62563	0.2438	M	0.91140	3.18	0.20638	N	0.999874	D	0.76494	0.999	D	0.72625	0.978	T	0.56792	-0.7920	10	0.87932	D	0	.	8.1446	0.31104	0.0:0.176:0.0:0.824	.	89	Q9Y267	S22AE_HUMAN	I	89	ENSP00000396283:F89I;ENSP00000273173:F89I	ENSP00000273173:F89I	F	+	1	0	SLC22A14	38322786	0.999000	0.42202	0.002000	0.10522	0.004000	0.04260	3.305000	0.51873	0.408000	0.25621	0.533000	0.62120	TTC	SLC22A14	-	NULL	ENSG00000144671		0.562	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A14	HGNC	protein_coding	OTTHUMT00000253742.3	54	0.00	0	T	NM_004803		38347782	38347782	+1	no_errors	ENST00000273173	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.207	A
SLC2A2	6514	genome.wustl.edu	37	3	170736404	170736404	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr3:170736404delC	ENST00000314251.3	-	2	103	c.24delG	c.(22-24)gggfs	p.G8fs	SLC2A2_ENST00000382808.4_5'UTR	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	8					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	AAACCAGGGTCCCAGTGACCT	0.493											OREG0015920	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													104.0	91.0	96.0					3																	170736404		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.24delG	3.37:g.170736404delC	ENSP00000323568:p.Gly8fs	Somatic	1887	WXS	Illumina GAIIx	Phase_IV	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Frame_Shift_Del	DEL	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,prints_Glc_transpt_2,tigrfam_Sugar/inositol_transpt	p.T9fs	ENST00000314251.3	37	c.24	CCDS3215.1	3																																																																																			SLC2A2	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_Sugar/inositol_transpt	ENSG00000163581		0.493	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A2	HGNC	protein_coding	OTTHUMT00000352834.1	39	0.00	0	C	NM_000340		170736404	170736404	-1	no_errors	ENST00000314251	ensembl	human	known	69_37n	frame_shift_del	42	33.33	22	DEL	0.760	-
SLC30A8	169026	genome.wustl.edu	37	8	118165274	118165274	+	Silent	SNP	G	G	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:118165274G>C	ENST00000456015.2	+	3	363	c.363G>C	c.(361-363)ctG>ctC	p.L121L	SLC30A8_ENST00000427715.2_Silent_p.L72L|SLC30A8_ENST00000519688.1_Silent_p.L72L|SLC30A8_ENST00000521243.1_Silent_p.L72L	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	121					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TCTTCTCCCTGTGGTTGTCAT	0.522																																					Ovarian(162;1202 1922 6011 16223 52092)	dbGAP											0													162.0	118.0	133.0					8																	118165274		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.363G>C	8.37:g.118165274G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.L121	ENST00000456015.2	37	c.363	CCDS6322.1	8																																																																																			SLC30A8	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000164756		0.522	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	HGNC	protein_coding	OTTHUMT00000381205.1	80	0.00	0	G	NM_173851		118165274	118165274	+1	no_errors	ENST00000456015	ensembl	human	known	69_37n	silent	85	14.14	14	SNP	1.000	C
SLC9C1	285335	genome.wustl.edu	37	3	111983118	111983118	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr3:111983118A>T	ENST00000305815.5	-	9	1203	c.951T>A	c.(949-951)caT>caA	p.H317Q	SLC9C1_ENST00000487372.1_Intron	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	317					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										ACAAATATGTATGTGCAGGAA	0.249																																						dbGAP											0													25.0	27.0	26.0					3																	111983118		2157	4244	6401	-	-	-	SO:0001583	missense	0			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.951T>A	3.37:g.111983118A>T	ENSP00000306627:p.His317Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.H317Q	ENST00000305815.5	37	c.951	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	A	3.630	-0.075692	0.07184	.	.	ENSG00000172139	ENST00000305815	T	0.08807	3.05	5.96	0.825	0.18824	Cation/H+ exchanger (1);	0.485871	0.20952	N	0.082721	T	0.06371	0.0164	L	0.53249	1.67	0.09310	N	1	B	0.33940	0.433	B	0.34536	0.185	T	0.35226	-0.9797	10	0.11182	T	0.66	-6.4503	3.1222	0.06395	0.4771:0.0:0.1778:0.3451	.	317	Q4G0N8	S9A10_HUMAN	Q	317	ENSP00000306627:H317Q	ENSP00000306627:H317Q	H	-	3	2	SLC9A10	113465808	0.009000	0.17119	0.158000	0.22627	0.047000	0.14425	-0.056000	0.11787	-0.082000	0.12640	0.496000	0.49642	CAT	SLC9C1	-	pfam_Cation/H_exchanger	ENSG00000172139		0.249	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1	64	0.00	0	A	NM_183061		111983118	111983118	-1	no_errors	ENST00000305815	ensembl	human	known	69_37n	missense	60	16.67	12	SNP	0.042	T
SLFN12L	100506736	genome.wustl.edu	37	17	33802086	33802086	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr17:33802086G>T	ENST00000260908.7	-	4	1740	c.1623C>A	c.(1621-1623)taC>taA	p.Y541*	SLFN12L_ENST00000449046.1_Nonsense_Mutation_p.Y572*|RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000361112.4_Nonsense_Mutation_p.Y570*	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	541						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)			breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						TTGTCCAATAGTAGGATTCAG	0.368																																						dbGAP											0													278.0	223.0	240.0					17																	33802086		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.1623C>A	17.37:g.33802086G>T	ENSP00000437635:p.Tyr541*	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H6G3	Nonsense_Mutation	SNP	pfam_ATPase_AAA-4	p.Y572*	ENST00000260908.7	37	c.1716	CCDS56026.1	17	.	.	.	.	.	.	.	.	.	.	G	42	9.181304	0.99092	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	.	.	.	2.37	0.148	0.14843	.	.	.	.	.	.	.	.	.	.	.	0.53005	D	0.999962	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.3108	0.10969	0.4014:0.0:0.5986:0.0	.	.	.	.	X	541;570;572	.	ENSP00000437635:Y541X	Y	-	3	2	SLFN12L	30826199	0.000000	0.05858	0.005000	0.12908	0.282000	0.26991	-1.320000	0.02700	-0.076000	0.12775	0.195000	0.17529	TAC	SLFN12L	-	NULL	ENSG00000205045		0.368	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	SLFN12L	HGNC	protein_coding	OTTHUMT00000395748.2	166	0.00	0	G	XM_496206		33802086	33802086	-1	no_errors	ENST00000449046	ensembl	human	known	69_37n	nonsense	204	10.13	23	SNP	0.010	T
SMAD4	4089	genome.wustl.edu	37	18	48575132	48575132	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr18:48575132T>G	ENST00000342988.3	+	3	864	c.326T>G	c.(325-327)cTa>cGa	p.L109R	SMAD4_ENST00000398417.2_Missense_Mutation_p.L109R|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000452201.2_Missense_Mutation_p.L109R|SMAD4_ENST00000588745.1_Missense_Mutation_p.L109R	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	109	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		AAAAATGAACTAAAACATGTT	0.393																																						dbGAP											40	Whole gene deletion(36)|Unknown(4)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)											165.0	150.0	155.0					18																	48575132		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.326T>G	18.37:g.48575132T>G	ENSP00000341551:p.Leu109Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K405	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.L109R	ENST00000342988.3	37	c.326	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	T	28.3	4.909722	0.92107	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	D;D;D	0.82803	-1.65;-1.65;-1.65	5.48	5.48	0.80851	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.64402	D	0.000001	D	0.92163	0.7515	M	0.89095	3.005	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.93562	0.6896	10	0.87932	D	0	.	14.5339	0.67947	0.0:0.0:0.0:1.0	.	109	Q13485	SMAD4_HUMAN	R	109	ENSP00000409551:L109R;ENSP00000341551:L109R;ENSP00000381452:L109R	ENSP00000341551:L109R	L	+	2	0	SMAD4	46829130	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	8.014000	0.88676	2.053000	0.61076	0.477000	0.44152	CTA	SMAD4	-	pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_MAD_homology_MH1	ENSG00000141646		0.393	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	80	0.00	0	T	NM_005359		48575132	48575132	+1	no_errors	ENST00000342988	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	G
SMARCA1	6594	genome.wustl.edu	37	X	128641922	128641922	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chrX:128641922G>T	ENST00000371122.4	-	7	1091	c.962C>A	c.(961-963)tCt>tAt	p.S321Y	SMARCA1_ENST00000371121.3_Missense_Mutation_p.S321Y|SMARCA1_ENST00000478420.1_5'Flank|SMARCA1_ENST00000371123.1_Missense_Mutation_p.S321Y	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	321	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						ACTTACCTTAGATTTTTCATT	0.303																																						dbGAP											0													38.0	34.0	36.0					X																	128641922		2202	4299	6501	-	-	-	SO:0001583	missense	0			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.962C>A	X.37:g.128641922G>T	ENSP00000360163:p.Ser321Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JV41|Q5JV42	Missense_Mutation	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ATPase_nucl-remodel_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Homeodomain-like,superfamily_ATPase_nucl-remodel_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S321Y	ENST00000371122.4	37	c.962	CCDS14612.1	X	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639811	0.87760	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46	5.53	5.53	0.82687	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000009	D	0.98510	0.9503	H	0.97918	4.105	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.997;0.996;0.997	D	0.99755	1.1019	10	0.87932	D	0	-13.4328	18.7153	0.91672	0.0:0.0:1.0:0.0	.	300;321;321;321	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	Y	321;321;321;300	ENSP00000360162:S321Y;ENSP00000360164:S321Y;ENSP00000360163:S321Y;ENSP00000404275:S300Y	ENSP00000360162:S321Y	S	-	2	0	SMARCA1	128469603	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.813000	0.99286	2.451000	0.82905	0.544000	0.68410	TCT	SMARCA1	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000102038		0.303	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCA1	HGNC	protein_coding	OTTHUMT00000058206.1	72	0.00	0	G	NM_003069		128641922	128641922	-1	no_errors	ENST00000371122	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	T
SORL1	6653	genome.wustl.edu	37	11	121458742	121458742	+	Silent	SNP	G	G	A	rs536340053		TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr11:121458742G>A	ENST00000260197.7	+	28	3957	c.3828G>A	c.(3826-3828)acG>acA	p.T1276T	SORL1_ENST00000532694.1_Silent_p.T122T|SORL1_ENST00000525532.1_Silent_p.T220T|SORL1_ENST00000527934.1_5'Flank|SORL1_ENST00000534286.1_Silent_p.T186T	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1276	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CCCTCTGTACGCACTTCATGG	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		18033	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													129.0	108.0	115.0					11																	121458742		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3828G>A	11.37:g.121458742G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX7|Q92856	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_Fibronectin_type3,pfam_LDLR_classB_rpt,superfamily_Fibronectin_type3,superfamily_LDrepeatLR_classA_rpt,smart_VPS10,smart_LDLR_classB_rpt,smart_LDrepeatLR_classA_rpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.T1276	ENST00000260197.7	37	c.3828	CCDS8436.1	11																																																																																			SORL1	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000137642		0.587	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	HGNC	protein_coding	OTTHUMT00000387626.2	81	0.00	0	G	NM_003105		121458742	121458742	+1	no_errors	ENST00000260197	ensembl	human	known	69_37n	silent	42	14.29	7	SNP	0.000	A
SSFA2	6744	genome.wustl.edu	37	2	182766619	182766619	+	Missense_Mutation	SNP	C	C	A	rs370097897		TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:182766619C>A	ENST00000431877.2	+	8	1018	c.839C>A	c.(838-840)aCa>aAa	p.T280K	SSFA2_ENST00000409001.1_Missense_Mutation_p.T280K|SSFA2_ENST00000428267.2_Missense_Mutation_p.T127K|SSFA2_ENST00000320370.7_Missense_Mutation_p.T280K	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	280						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			AACAAGGAGACAGACCCACCT	0.418																																						dbGAP											0													72.0	72.0	72.0					2																	182766619		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.839C>A	2.37:g.182766619C>A	ENSP00000388731:p.Thr280Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.T280K	ENST00000431877.2	37	c.839	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	C	16.91	3.251557	0.59212	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267	T;T;T;T	0.16073	2.6;2.37;2.6;2.6	5.42	4.55	0.56014	.	0.485483	0.23504	N	0.047473	T	0.22360	0.0539	M	0.66939	2.045	0.33766	D	0.622507	P;P;P;P	0.39480	0.675;0.675;0.675;0.675	B;B;B;B	0.41988	0.372;0.202;0.202;0.295	T	0.36601	-0.9741	10	0.54805	T	0.06	-1.2929	9.5636	0.39385	0.1406:0.7877:0.0:0.0717	.	127;280;280;280	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	K	280;280;280;127	ENSP00000388731:T280K;ENSP00000314669:T280K;ENSP00000387319:T280K;ENSP00000409867:T127K	ENSP00000314669:T280K	T	+	2	0	SSFA2	182474864	0.990000	0.36364	1.000000	0.80357	0.993000	0.82548	1.849000	0.39318	1.434000	0.47414	0.650000	0.86243	ACA	SSFA2	-	NULL	ENSG00000138434		0.418	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2	47	0.00	0	C	NM_006751		182766619	182766619	+1	no_errors	ENST00000431877	ensembl	human	known	69_37n	missense	27	37.78	17	SNP	1.000	A
TARS2	80222	genome.wustl.edu	37	1	150469022	150469022	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr1:150469022C>T	ENST00000369064.3	+	8	873	c.839C>T	c.(838-840)tCc>tTc	p.S280F	TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Intron|TARS2_ENST00000369054.2_Intron|TARS2_ENST00000463555.1_Intron	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	280					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TCAGGGATTTCCTTCCCCACA	0.532																																						dbGAP											0													122.0	117.0	118.0					1																	150469022		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.839C>T	1.37:g.150469022C>T	ENSP00000358060:p.Ser280Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-synth_IIa,tigrfam_Thr-tRNA-synth_IIa	p.S280F	ENST00000369064.3	37	c.839	CCDS952.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.295972	0.95574	.	.	ENSG00000143374	ENST00000369064	.	.	.	4.92	4.92	0.64577	Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.404113	0.24996	N	0.033957	D	0.84915	0.5578	H	0.95470	3.675	0.80722	D	1	D	0.71674	0.998	D	0.64776	0.929	D	0.89395	0.3691	9	0.87932	D	0	-0.9043	17.9122	0.88937	0.0:1.0:0.0:0.0	.	280	Q9BW92	SYTM_HUMAN	F	280	.	ENSP00000358060:S280F	S	+	2	0	TARS2	148735646	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.306000	0.78905	2.548000	0.85928	0.655000	0.94253	TCC	TARS2	-	superfamily_Thr/Ala-tRNA-synth_IIc_edit,tigrfam_Thr-tRNA-synth_IIa	ENSG00000143374		0.532	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS2	HGNC	protein_coding	OTTHUMT00000035847.1	69	0.00	0	C	NM_025150		150469022	150469022	+1	no_errors	ENST00000369064	ensembl	human	known	69_37n	missense	87	17.14	18	SNP	1.000	T
TBC1D4	9882	genome.wustl.edu	37	13	75936460	75936460	+	Missense_Mutation	SNP	C	C	T	rs544873334		TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr13:75936460C>T	ENST00000377636.3	-	2	1128	c.782G>A	c.(781-783)gGg>gAg	p.G261E	TBC1D4_ENST00000431480.2_Missense_Mutation_p.G261E|TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000377625.2_Missense_Mutation_p.G261E	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	261					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		TCCGGGGGACCCGGGCACCAC	0.687																																						dbGAP											0													28.0	32.0	31.0					13																	75936460		2041	4177	6218	-	-	-	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.782G>A	13.37:g.75936460C>T	ENSP00000366863:p.Gly261Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.G261E	ENST00000377636.3	37	c.782	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	C	5.476	0.272928	0.10349	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.03004	4.1;4.1;4.08	5.18	-1.07	0.09968	Phosphotyrosine interaction domain (1);	1.008340	0.07986	N	0.986403	T	0.02342	0.0072	N	0.19112	0.55	0.09310	N	0.999999	B;B;B	0.33266	0.404;0.098;0.054	B;B;B	0.31869	0.137;0.049;0.021	T	0.38628	-0.9652	10	0.02654	T	1	1.8144	10.0425	0.42166	0.2406:0.3069:0.4525:0.0	.	261;261;261	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	E	261	ENSP00000366863:G261E;ENSP00000395986:G261E;ENSP00000366852:G261E	ENSP00000366852:G261E	G	-	2	0	TBC1D4	74834461	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	0.102000	0.15272	-0.101000	0.12219	0.563000	0.77884	GGG	TBC1D4	-	smart_PTyr_interaction_dom	ENSG00000136111		0.687	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	27	0.00	0	C	NM_014832		75936460	75936460	-1	no_errors	ENST00000377636	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.000	T
TG	7038	genome.wustl.edu	37	8	133910025	133910025	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:133910025G>A	ENST00000220616.4	+	12	3173	c.3133G>A	c.(3133-3135)Ggg>Agg	p.G1045R	TG_ENST00000377869.1_Missense_Mutation_p.G1045R	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1045	Thyroglobulin type-1 8. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GTGCCACGCTGGGACTGGTAA	0.597																																						dbGAP											0													53.0	51.0	52.0					8																	133910025		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3133G>A	8.37:g.133910025G>A	ENSP00000220616:p.Gly1045Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.W31*	ENST00000220616.4	37	c.92	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695780	0.30052	.	.	ENSG00000042832	ENST00000377869;ENST00000220616	T;T	0.62105	0.05;0.05	5.48	-0.685	0.11328	Thyroglobulin type-1 (6);	2.013450	0.01838	N	0.035147	T	0.47911	0.1471	L	0.28054	0.825	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.28202	-1.0051	10	0.42905	T	0.14	.	4.5387	0.12047	0.4696:0.3382:0.1922:0.0	.	1045	P01266	THYG_HUMAN	R	1045	ENSP00000367100:G1045R;ENSP00000220616:G1045R	ENSP00000220616:G1045R	G	+	1	0	TG	133979207	0.001000	0.12720	0.000000	0.03702	0.102000	0.19082	0.426000	0.21363	-0.048000	0.13401	0.655000	0.94253	GGG	TG	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	ENSG00000042832		0.597	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	27	0.00	0	G	NM_003235		133910025	133910025	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000523756	ensembl	human	known	69_37n	nonsense	31	38.00	19	SNP	0.005	A
TG	7038	genome.wustl.edu	37	8	133953777	133953777	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:133953777G>C	ENST00000220616.4	+	26	5263	c.5223G>C	c.(5221-5223)caG>caC	p.Q1741H	TG_ENST00000377869.1_Missense_Mutation_p.Q1684H|TG_ENST00000542445.1_Intron	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1741					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TCCTCACACAGGTTCAAGGAG	0.547																																						dbGAP											0													125.0	100.0	109.0					8																	133953777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.5223G>C	8.37:g.133953777G>C	ENSP00000220616:p.Gln1741His	Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.Q1741H	ENST00000220616.4	37	c.5223	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005640	0.35415	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	T;T	0.69561	-0.41;-0.41	5.61	3.83	0.44106	.	0.807702	0.11043	N	0.605853	T	0.80460	0.4627	M	0.77103	2.36	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.65948	-0.6044	10	0.87932	D	0	.	8.6953	0.34291	0.1754:0.0:0.8246:0.0	.	1741	P01266	THYG_HUMAN	H	1684;547;1741	ENSP00000367100:Q1684H;ENSP00000220616:Q1741H	ENSP00000220616:Q1741H	Q	+	3	2	TG	134022959	0.934000	0.31675	0.040000	0.18447	0.345000	0.29048	1.346000	0.33964	0.741000	0.32674	0.462000	0.41574	CAG	TG	-	pirsf_Thyroglobulin	ENSG00000042832		0.547	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	44	0.00	0	G	NM_003235		133953777	133953777	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	41	38.81	26	SNP	0.200	C
TMED2	10959	genome.wustl.edu	37	12	124074976	124074976	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr12:124074976G>A	ENST00000262225.3	+	3	567	c.461G>A	c.(460-462)cGg>cAg	p.R154Q	TMED2_ENST00000509052.2_Missense_Mutation_p.R69Q	NM_006815.3	NP_006806.1	Q15363	TMED2_HUMAN	transmembrane emp24 domain trafficking protein 2	154	Interaction with F2RL1.|Required for TMED10 and TMED2 cis-Golgi network localization.				cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPII vesicle coating (GO:0048208)|embryonic morphogenesis (GO:0048598)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|maternal placenta development (GO:0001893)|negative regulation of GTPase activity (GO:0034260)|protein targeting to plasma membrane (GO:0072661)	COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|zymogen granule membrane (GO:0042589)				kidney(1)|large_intestine(4)|lung(1)|prostate(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000138)|Epithelial(86;0.000613)|all cancers(50;0.00745)		ATGGAAGTCCGGGAGAGAATA	0.448																																						dbGAP											0													115.0	112.0	113.0					12																	124074976		2203	4300	6503	-	-	-	SO:0001583	missense	0			X92098	CCDS9250.1	12q24.31	2006-03-27			ENSG00000086598	ENSG00000086598			16996	protein-coding gene	gene with protein product						8663407	Standard	NM_006815		Approved	RNP24, P24A	uc001ufg.3	Q15363	OTTHUMG00000168694	ENST00000262225.3:c.461G>A	12.37:g.124074976G>A	ENSP00000262225:p.Arg154Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	p.R154Q	ENST00000262225.3	37	c.461	CCDS9250.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.141758	0.97320	.	.	ENSG00000086598	ENST00000262225;ENST00000438031;ENST00000432022;ENST00000541504;ENST00000509052	T;T;T	0.22743	1.94;1.94;1.94	5.5	5.5	0.81552	GOLD (1);	0.000000	0.85682	D	0.000000	T	0.43122	0.1233	H	0.94306	3.52	0.80722	D	1	P	0.42908	0.793	B	0.40101	0.319	T	0.61691	-0.7011	10	0.72032	D	0.01	0.1612	19.7532	0.96277	0.0:0.0:1.0:0.0	.	154	Q15363	TMED2_HUMAN	Q	154;161;122;104;69	ENSP00000262225:R154Q;ENSP00000405845:R161Q;ENSP00000441161:R69Q	ENSP00000262225:R154Q	R	+	2	0	TMED2	122640929	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.851000	0.99511	2.738000	0.93877	0.555000	0.69702	CGG	TMED2	-	pfam_GOLD	ENSG00000086598		0.448	TMED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED2	HGNC	protein_coding	OTTHUMT00000400606.1	76	0.00	0	G	NM_006815		124074976	124074976	+1	no_errors	ENST00000262225	ensembl	human	known	69_37n	missense	50	19.35	12	SNP	1.000	A
TMEM87A	25963	genome.wustl.edu	37	15	42531871	42531871	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr15:42531871C>T	ENST00000389834.4	-	8	945	c.681G>A	c.(679-681)atG>atA	p.M227I	TMEM87A_ENST00000448392.1_Missense_Mutation_p.M166I	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	227						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		CACTTACAATCATCAAGGGAT	0.368																																						dbGAP											0													127.0	127.0	127.0					15																	42531871		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.681G>A	15.37:g.42531871C>T	ENSP00000374484:p.Met227Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	pfam_TM_rcpt_euk	p.M227I	ENST00000389834.4	37	c.681	CCDS32205.1	15	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973284	0.92919	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.83225	0.5208	M	0.83223	2.63	0.80722	D	1	D;P	0.69078	0.997;0.937	D;P	0.79108	0.992;0.748	D	0.83524	0.0087	9	0.44086	T	0.13	-18.5618	18.7724	0.91898	0.0:1.0:0.0:0.0	.	227;166	Q8NBN3;Q8NBN3-3	TM87A_HUMAN;.	I	227;166;203	.	ENSP00000374484:M227I	M	-	3	0	TMEM87A	40319163	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.154000	0.77437	2.649000	0.89929	0.591000	0.81541	ATG	TMEM87A	-	pfam_TM_rcpt_euk	ENSG00000103978		0.368	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TMEM87A	HGNC	protein_coding	OTTHUMT00000420482.2	80	0.00	0	C	NM_015497		42531871	42531871	-1	no_errors	ENST00000389834	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	1.000	T
TMOD3	29766	genome.wustl.edu	37	15	52181319	52181319	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr15:52181319G>A	ENST00000308580.7	+	5	754	c.473G>A	c.(472-474)gGt>gAt	p.G158D	RP11-56B16.5_ENST00000558142.1_RNA|TMOD3_ENST00000544199.1_Missense_Mutation_p.G158D	NM_014547.4	NP_055362.1	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	158						striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|stomach(1)	14				all cancers(107;0.00194)		AGTAGTAATGGTGTTGACCAA	0.289																																					Colon(122;1837 2251 18387 22826)	dbGAP											0													73.0	75.0	74.0					15																	52181319		2194	4280	6474	-	-	-	SO:0001583	missense	0			AF177171	CCDS10145.1	15q21.1-q21.2	2008-05-14			ENSG00000138594	ENSG00000138594			11873	protein-coding gene	gene with protein product		605112				10662549	Standard	NM_014547		Approved	UTMOD	uc002abn.3	Q9NYL9	OTTHUMG00000131803	ENST00000308580.7:c.473G>A	15.37:g.52181319G>A	ENSP00000308753:p.Gly158Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6G7|Q9NT43|Q9NZR0	Missense_Mutation	SNP	pfam_Tropomodulin	p.G158D	ENST00000308580.7	37	c.473	CCDS10145.1	15	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298419	0.23650	.	.	ENSG00000138594	ENST00000308580;ENST00000544199	T;T	0.14144	2.53;2.53	5.68	5.68	0.88126	.	0.114043	0.64402	D	0.000020	T	0.18800	0.0451	M	0.72479	2.2	0.80722	D	1	B	0.12630	0.006	B	0.12837	0.008	T	0.09530	-1.0670	10	0.12766	T	0.61	-18.5261	17.9557	0.89068	0.0:0.0:1.0:0.0	.	158	Q9NYL9	TMOD3_HUMAN	D	158	ENSP00000308753:G158D;ENSP00000438909:G158D	ENSP00000308753:G158D	G	+	2	0	TMOD3	49968611	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.014000	0.49590	2.664000	0.90586	0.655000	0.94253	GGT	TMOD3	-	NULL	ENSG00000138594		0.289	TMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMOD3	HGNC	protein_coding	OTTHUMT00000254740.3	66	0.00	0	G			52181319	52181319	+1	no_errors	ENST00000308580	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179408789	179408789	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr2:179408789C>A	ENST00000591111.1	-	296	91383	c.91159G>T	c.(91159-91161)Gct>Tct	p.A30387S	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A23088S|TTN_ENST00000460472.2_Missense_Mutation_p.A22963S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A23155S|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A32028S|TTN_ENST00000342992.6_Missense_Mutation_p.A29460S|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30387	Ig-like 137.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGGCCCCAGCCCTGATGGTC	0.463																																						dbGAP											0													141.0	140.0	141.0					2																	179408789		1931	4126	6057	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.91159G>T	2.37:g.179408789C>A	ENSP00000465570:p.Ala30387Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A29460S	ENST00000591111.1	37	c.88378		2	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879641	0.72294	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	6.04	6.04	0.98038	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50786	0.1636	L	0.55481	1.735	0.54753	D	0.999989	P;P;P;D	0.52996	0.79;0.79;0.916;0.957	B;B;B;P	0.47376	0.391;0.391;0.391;0.545	T	0.51718	-0.8670	9	0.87932	D	0	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	22963;23088;23155;30387	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	29460;22963;23155;23088;22960	ENSP00000343764:A29460S;ENSP00000434586:A22963S;ENSP00000340554:A23155S;ENSP00000352154:A23088S	ENSP00000340554:A23155S	A	-	1	0	TTN	179117035	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	GCT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	75	0.00	0	C	NM_133378		179408789	179408789	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	1.000	A
UGDH	7358	genome.wustl.edu	37	4	39505533	39505533	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr4:39505533C>T	ENST00000316423.6	-	11	1678	c.1336G>A	c.(1336-1338)Gat>Aat	p.D446N	UGDH_ENST00000507089.1_Missense_Mutation_p.D349N|UGDH_ENST00000501493.2_Missense_Mutation_p.D379N|UGDH_ENST00000506179.1_Missense_Mutation_p.D446N	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	446					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)			breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						TGGAGCCCATCCAGGACACGC	0.383																																						dbGAP											0													99.0	95.0	96.0					4																	39505533		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.1336G>A	4.37:g.39505533C>T	ENSP00000319501:p.Asp446Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	pfam_UDP-Glc/GDP-Man_DH_N,pfam_UDP-Glc/GDP-Man_DH_C,pfam_UDP-Glc/GDP-Man_DH_dimer,superfamily_UDP-Glc/GDP-Man_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Nucleotide_sugar_DH	p.D446N	ENST00000316423.6	37	c.1336	CCDS3455.1	4	.	.	.	.	.	.	.	.	.	.	C	16.54	3.150565	0.57151	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000507089	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.62	4.77	0.60923	UDP-glucose/GDP-mannose dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	L	0.34521	1.04	0.80722	D	1	B;B	0.20164	0.042;0.002	B;B	0.29176	0.099;0.022	T	0.63664	-0.6586	10	0.21540	T	0.41	-11.0958	15.6228	0.76820	0.0:0.8624:0.1376:0.0	.	379;446	B3KUU2;O60701	.;UGDH_HUMAN	N	446;379;446;349	ENSP00000319501:D446N;ENSP00000422909:D379N;ENSP00000421757:D446N;ENSP00000426560:D349N	ENSP00000319501:D446N	D	-	1	0	UGDH	39181928	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.741000	0.84997	1.355000	0.45865	0.650000	0.86243	GAT	UGDH	-	pfam_UDP-Glc/GDP-Man_DH_C,superfamily_UDP-Glc/GDP-Man_DH_C	ENSG00000109814		0.383	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGDH	HGNC	protein_coding	OTTHUMT00000216818.3	69	0.00	0	C	NM_003359		39505533	39505533	-1	no_errors	ENST00000316423	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	1.000	T
USP32P2	220594	genome.wustl.edu	37	17	18422903	18422903	+	RNA	SNP	G	G	C			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr17:18422903G>C	ENST00000425211.1	-	0	1582				USP32P2_ENST00000412260.1_RNA																							TTCCTCACTGGTGAAAGCACG	0.517																																						dbGAP											0																																										-	-	-			0																															17.37:g.18422903G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			USP32P2	-	-	ENSG00000233327		0.517	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1	53	0.00	0	G			18422903	18422903	-1	no_errors	ENST00000412260	ensembl	human	known	69_37n	rna	25	51.92	27	SNP	1.000	C
WISP1	8840	genome.wustl.edu	37	8	134237778	134237778	+	Silent	SNP	C	C	A			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr8:134237778C>A	ENST00000250160.6	+	4	862	c.756C>A	c.(754-756)cgC>cgA	p.R252R	WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Silent_p.R165R|WISP1_ENST00000517423.1_Intron|WISP1_ENST00000377863.2_Silent_p.R80R	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	252	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			AAGAGAGCCGCCTCTGCAACT	0.572																																						dbGAP											0													52.0	54.0	54.0					8																	134237778		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.756C>A	8.37:g.134237778C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Silent	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Cys_knot,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.R252	ENST00000250160.6	37	c.756	CCDS6371.1	8																																																																																			WISP1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pirsf_IGFBP_CNN,pfscan_Thrombospondin_1_rpt	ENSG00000104415		0.572	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP1	HGNC	protein_coding	OTTHUMT00000378794.2	32	0.00	0	C	NM_003882		134237778	134237778	+1	no_errors	ENST00000250160	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	1.000	A
ZFYVE19	84936	genome.wustl.edu	37	15	41099910	41099910	+	Silent	SNP	A	A	G	rs62018606		TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr15:41099910A>G	ENST00000355341.4	+	1	624	c.123A>G	c.(121-123)gcA>gcG	p.A41A	ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000563530.1_3'UTR|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000299173.10_Silent_p.A41A|ZFYVE19_ENST00000564258.1_Intron	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	41					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		Ggggcggggcagggcagggaa	0.716																																						dbGAP											0													16.0	22.0	20.0					15																	41099910		1992	4147	6139	-	-	-	SO:0001819	synonymous_variant	0			AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.123A>G	15.37:g.41099910A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.Q24R	ENST00000355341.4	37	c.71	CCDS42025.1	15																																																																																			ZFYVE19	-	NULL	ENSG00000166140		0.716	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	HGNC	protein_coding	OTTHUMT00000418996.1	20	0.00	0	A	NM_032850		41099910	41099910	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000568062	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.000	G
ZNF544	27300	genome.wustl.edu	37	19	58773419	58773419	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A25B-01A-11D-A167-09	TCGA-A2-A25B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6e839eaf-1dbb-43f5-8846-c980e05540c7	c16cf182-b4b2-42c0-a2b1-ce071638de2f	g.chr19:58773419A>G	ENST00000596652.1	+	6	1681	c.1447A>G	c.(1447-1449)Aaa>Gaa	p.K483E	ZNF544_ENST00000600044.1_Missense_Mutation_p.K455E|CTD-3138B18.5_ENST00000597230.1_RNA|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000415203.2_Missense_Mutation_p.K455E|ZNF544_ENST00000599953.1_Missense_Mutation_p.K341E|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000269829.4_Missense_Mutation_p.K483E|ZNF544_ENST00000600220.1_Missense_Mutation_p.K455E|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000599227.1_3'UTR			Q6NX49	ZN544_HUMAN	zinc finger protein 544	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		AGTTACACATAAAAGAACGCA	0.423																																						dbGAP											0													83.0	86.0	85.0					19																	58773419		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.1447A>G	19.37:g.58773419A>G	ENSP00000469635:p.Lys483Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J1|Q9UEX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K483E	ENST00000596652.1	37	c.1447	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	A	8.681	0.905189	0.17760	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.68903	-0.36;-0.36	2.34	-4.06	0.03986	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40473	0.1118	N	0.16098	0.37	0.09310	N	1	B;B;B	0.12630	0.001;0.006;0.006	B;B;B	0.15484	0.001;0.013;0.013	T	0.18618	-1.0331	9	0.51188	T	0.08	.	2.0379	0.03544	0.2333:0.4686:0.1346:0.1634	.	455;455;483	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	E	483;455	ENSP00000269829:K483E;ENSP00000394341:K455E	ENSP00000269829:K483E	K	+	1	0	ZNF544	63465231	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.151000	0.10175	-0.797000	0.04450	-0.534000	0.04291	AAA	ZNF544	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198131		0.423	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	64	0.00	0	A	NM_014480		58773419	58773419	+1	no_errors	ENST00000269829	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	0.001	G
