#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC8	6833	genome.wustl.edu	37	11	17434216	17434216	+	Silent	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr11:17434216G>A	ENST00000389817.3	-	21	2621	c.2553C>T	c.(2551-2553)ttC>ttT	p.F851F	ABCC8_ENST00000302539.4_Silent_p.F852F			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	851	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.F851L(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CACTCACCAAGAAGACAACGT	0.597																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											162.0	97.0	119.0					11																	17434216		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2553C>T	11.37:g.17434216G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.F852	ENST00000389817.3	37	c.2556	CCDS31437.1	11																																																																																			ABCC8	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000006071		0.597	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	43	0.00	0	G	NM_000352		17434216	17434216	-1	no_errors	ENST00000302539	ensembl	human	known	69_37n	silent	20	31.03	9	SNP	1.000	A
ADAMTS13	11093	genome.wustl.edu	37	9	136324188	136324189	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr9:136324188_136324189insA	ENST00000371929.3	+	29	4614_4615	c.4170_4171insA	c.(4171-4173)agcfs	p.S1391fs	CACFD1_ENST00000542192.1_5'Flank|CACFD1_ENST00000540581.1_5'Flank|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000371910.1_Frame_Shift_Ins_p.S187fs|ADAMTS13_ENST00000356589.2_Frame_Shift_Ins_p.S1304fs|CACFD1_ENST00000316948.4_5'Flank|ADAMTS13_ENST00000355699.2_Frame_Shift_Ins_p.S1335fs|CACFD1_ENST00000291722.7_5'Flank	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	1391	CUB 2.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		AGATGGAGTTCAGCGAGGGCTT	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.4171dupA	9.37:g.136324189_136324189dupA	ENSP00000360997:p.Ser1391fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Frame_Shift_Ins	INS	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,superfamily_CUB,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.S1390fs	ENST00000371929.3	37	c.4170_4171	CCDS6970.1	9																																																																																			ADAMTS13	-	superfamily_CUB	ENSG00000160323		0.609	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1	19	0.00	0	-	NM_139025		136324188	136324189	+1	no_errors	ENST00000371929	ensembl	human	known	69_37n	frame_shift_ins	11	50.00	11	INS	0.518:0.519	A
ALMS1	7840	genome.wustl.edu	37	2	73635817	73635817	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr2:73635817C>G	ENST00000264448.6	+	2	503	c.392C>G	c.(391-393)tCt>tGt	p.S131C	ALMS1_ENST00000377715.1_Missense_Mutation_p.S131C|ALMS1_ENST00000409009.1_Intron	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	131					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ACACAAATTTCTGATACTAAT	0.373																																						dbGAP											0													138.0	128.0	131.0					2																	73635817		1859	4112	5971	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.392C>G	2.37:g.73635817C>G	ENSP00000264448:p.Ser131Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.S131C	ENST00000264448.6	37	c.392	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956264	0.34565	.	.	ENSG00000116127	ENST00000264448;ENST00000377715	T;T	0.23348	2.78;1.91	3.71	3.71	0.42584	.	0.220936	0.23325	N	0.049416	T	0.36991	0.0987	L	0.36672	1.1	0.19775	N	0.999953	D	0.89917	1.0	D	0.69479	0.964	T	0.05053	-1.0909	10	0.87932	D	0	.	11.2735	0.49153	0.0:1.0:0.0:0.0	.	131	Q8TCU4	ALMS1_HUMAN	C	131	ENSP00000264448:S131C;ENSP00000366944:S131C	ENSP00000264448:S131C	S	+	2	0	ALMS1	73489325	0.825000	0.29262	0.418000	0.26571	0.041000	0.13682	1.080000	0.30779	2.374000	0.81015	0.557000	0.71058	TCT	ALMS1	-	NULL	ENSG00000116127		0.373	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	148	0.00	0	C	NM_015120		73635817	73635817	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	72	30.10	31	SNP	0.535	G
APCDD1	147495	genome.wustl.edu	37	18	10487617	10487617	+	Nonsense_Mutation	SNP	C	C	A	rs148807402		TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr18:10487617C>A	ENST00000578882.1	+	5	516	c.516C>A	c.(514-516)tgC>tgA	p.C172*	APCDD1_ENST00000355285.5_Missense_Mutation_p.A376E					adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		CCCATGGATGCGGCCACAGCC	0.582																																						dbGAP											0													73.0	67.0	69.0					18																	10487617		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000578882.1:c.516C>A	18.37:g.10487617C>A	ENSP00000463104:p.Cys172*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.C172*	ENST00000578882.1	37	c.516		18	.	.	.	.	.	.	.	.	.	.	C	15.22	2.770185	0.49680	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.15718	2.4	5.06	4.19	0.49359	.	0.534882	0.20859	N	0.084387	T	0.08714	0.0216	N	0.21194	0.64	0.30602	N	0.760432	B	0.16166	0.016	B	0.20184	0.028	T	0.31943	-0.9925	10	0.02654	T	1	-27.1157	6.3144	0.21182	0.0:0.6756:0.0:0.3244	.	376	Q8J025	APCD1_HUMAN	E	376;427	ENSP00000347433:A376E	ENSP00000347433:A376E	A	+	2	0	APCDD1	10477617	0.002000	0.14202	0.687000	0.30102	0.944000	0.59088	1.437000	0.34991	1.251000	0.43983	0.561000	0.74099	GCG	APCDD1	-	NULL	ENSG00000154856		0.582	APCDD1-004	NOVEL	basic	protein_coding	APCDD1	HGNC	protein_coding	OTTHUMT00000444868.1	36	0.00	0	C	NM_153000		10487617	10487617	+1	no_errors	ENST00000578882	ensembl	human	novel	69_37n	nonsense	12	29.41	5	SNP	0.008	A
ATP10D	57205	genome.wustl.edu	37	4	47560135	47560135	+	Missense_Mutation	SNP	G	G	C	rs200095375		TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr4:47560135G>C	ENST00000273859.3	+	12	2548	c.2279G>C	c.(2278-2280)gGa>gCa	p.G760A	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	760					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GCTGCTTTGGGACCATTAACA	0.502																																						dbGAP											0													145.0	120.0	128.0					4																	47560135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2279G>C	4.37:g.47560135G>C	ENSP00000273859:p.Gly760Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.G760A	ENST00000273859.3	37	c.2279	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089693	0.55968	.	.	ENSG00000145246	ENST00000273859	D	0.81659	-1.52	5.14	5.14	0.70334	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.052326	0.85682	D	0.000000	D	0.84750	0.5541	L	0.41961	1.31	0.80722	D	1	D	0.56287	0.975	P	0.62184	0.899	T	0.82615	-0.0370	10	0.33141	T	0.24	-16.2113	17.7581	0.88456	0.0:0.0:1.0:0.0	.	760	Q9P241	AT10D_HUMAN	A	760	ENSP00000273859:G760A	ENSP00000273859:G760A	G	+	2	0	ATP10D	47254892	1.000000	0.71417	0.961000	0.40146	0.029000	0.11900	9.619000	0.98369	2.680000	0.91292	0.561000	0.74099	GGA	ATP10D	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000145246		0.502	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	84	0.00	0	G	NM_020453		47560135	47560135	+1	no_errors	ENST00000273859	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	0.998	C
ATR	545	genome.wustl.edu	37	3	142234359	142234359	+	Splice_Site	SNP	T	T	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr3:142234359T>C	ENST00000350721.4	-	25	4504		c.e25-2		ATR_ENST00000383101.3_Splice_Site	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTCTTGTATCTGTAATTTTGA	0.343								Other conserved DNA damage response genes																														dbGAP											0													41.0	41.0	41.0					3																	142234359		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.4383-2A>G	3.37:g.142234359T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Splice_Site	SNP	-	e25-2	ENST00000350721.4	37	c.4383-2	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	T	23.0	4.367034	0.82463	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2736	0.82632	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATR	143717049	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.967000	0.87967	2.247000	0.74100	0.477000	0.44152	.	ATR	-	-	ENSG00000175054		0.343	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	47	0.00	0	T	NM_001184	Intron	142234359	142234359	-1	no_errors	ENST00000350721	ensembl	human	known	69_37n	splice_site	51	21.54	14	SNP	1.000	C
C1QA	712	genome.wustl.edu	37	1	22965464	22965464	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr1:22965464G>A	ENST00000374642.3	+	3	506	c.302G>A	c.(301-303)gGc>gAc	p.G101D	C1QA_ENST00000402322.1_Missense_Mutation_p.G101D	NM_015991.2	NP_057075.1	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	101	Collagen-like.				cell-cell signaling (GO:0007267)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|liver(1)|lung(3)|skin(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GGAATTAAAGGCACCAAGGGC	0.672																																						dbGAP											0													19.0	25.0	23.0					1																	22965464		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF135157	CCDS226.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173372	ENSG00000173372		"""Complement system"""	1241	protein-coding gene	gene with protein product		120550	"""complement component 1, q subcomponent, alpha polypeptide"""			1537612	Standard	NM_015991		Approved		uc001bfy.3	P02745	OTTHUMG00000002893	ENST00000374642.3:c.302G>A	1.37:g.22965464G>A	ENSP00000363773:p.Gly101Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4X2|Q5T963	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.G101D	ENST00000374642.3	37	c.302	CCDS226.1	1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493538	0.64186	.	.	ENSG00000173372	ENST00000374642;ENST00000339353;ENST00000438241;ENST00000402322	D;D;D	0.99488	-6.0;-6.0;-6.0	5.48	5.48	0.80851	.	0.191927	0.25842	N	0.027955	D	0.99757	0.9902	H	0.98133	4.155	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.97207	0.9868	10	0.72032	D	0.01	-1.7488	17.9228	0.88972	0.0:0.0:1.0:0.0	.	101	P02745	C1QA_HUMAN	D	101;97;101;101	ENSP00000363773:G101D;ENSP00000416841:G101D;ENSP00000385564:G101D	ENSP00000341271:G97D	G	+	2	0	C1QA	22838051	1.000000	0.71417	0.140000	0.22221	0.031000	0.12232	6.809000	0.75211	2.584000	0.87258	0.561000	0.74099	GGC	C1QA	-	pfam_Collagen	ENSG00000173372		0.672	C1QA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QA	HGNC	protein_coding	OTTHUMT00000008087.2	34	0.00	0	G	NM_015991		22965464	22965464	+1	no_errors	ENST00000374642	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	0.997	A
CCDC168	643677	genome.wustl.edu	37	13	103382387	103382387	+	Missense_Mutation	SNP	G	G	C	rs183474409	byFrequency	TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr13:103382387G>C	ENST00000322527.2	-	1	6772	c.6773C>G	c.(6772-6774)gCg>gGg	p.A2258G		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2258	Ser-rich.																CTGAATTTCCGCAGTATTTGA	0.393																																						dbGAP											0													81.0	63.0	68.0					13																	103382387		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.6773C>G	13.37:g.103382387G>C	ENSP00000320232:p.Ala2258Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N800	Missense_Mutation	SNP	NULL	p.A2258G	ENST00000322527.2	37	c.6773		13	.	.	.	.	.	.	.	.	.	.	A	10.81	1.456361	0.26161	.	.	ENSG00000175820	ENST00000322527	T	0.03663	3.85	4.83	-0.165	0.13355	.	1.693490	0.04148	N	0.320709	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B	0.23490	0.086	B	0.19946	0.027	T	0.48779	-0.9005	10	0.72032	D	0.01	2.356	10.9449	0.47296	0.3095:0.0:0.6905:0.0	.	2258	Q8NDH2	CC168_HUMAN	G	2258	ENSP00000320232:A2258G	ENSP00000320232:A2258G	A	-	2	0	CCDC168	102180388	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.375000	0.07475	-0.396000	0.07703	-1.216000	0.01612	GCG	CCDC168	-	NULL	ENSG00000175820		0.393	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		56	0.00	0	G	NM_001146197		103382387	103382387	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	missense	27	40.00	18	SNP	0.000	C
CCDC171	203238	genome.wustl.edu	37	9	15571654	15571654	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr9:15571654delT	ENST00000380701.3	+	3	402	c.74delT	c.(73-75)atafs	p.I25fs	CCDC171_ENST00000535968.1_Frame_Shift_Del_p.I25fs|CCDC171_ENST00000297641.3_Frame_Shift_Del_p.I25fs	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	25																	GTAAAACAAATACTTAAAAAT	0.303																																						dbGAP											0													72.0	81.0	78.0					9																	15571654		2203	4292	6495	-	-	-	SO:0001589	frameshift_variant	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.74delT	9.37:g.15571654delT	ENSP00000370077:p.Ile25fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Frame_Shift_Del	DEL	superfamily_STAT_TF_coiled-coil	p.I25fs	ENST00000380701.3	37	c.74	CCDS6481.1	9																																																																																			CCDC171	-	NULL	ENSG00000164989		0.303	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	81	0.00	0	T	NM_173550		15571654	15571654	+1	no_errors	ENST00000380701	ensembl	human	known	69_37n	frame_shift_del	55	22.78	18	DEL	0.872	-
CDK2	1017	genome.wustl.edu	37	12	56362611	56362611	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr12:56362611delG	ENST00000266970.4	+	4	605	c.365delG	c.(364-366)cggfs	p.R122fs	PMEL_ENST00000550464.1_5'Flank|PMEL_ENST00000552882.1_5'Flank|CDK2_ENST00000553376.1_Frame_Shift_Del_p.R122fs|PMEL_ENST00000548747.1_5'Flank|CDK2_ENST00000440311.2_Frame_Shift_Del_p.R96fs|PMEL_ENST00000550447.1_5'Flank|PMEL_ENST00000548689.1_5'Flank|RP11-973D8.4_ENST00000554022.1_RNA|PMEL_ENST00000548493.1_5'Flank|PMEL_ENST00000539511.1_5'Flank|CDK2_ENST00000354056.4_Frame_Shift_Del_p.R122fs|CDK2_ENST00000556656.1_3'UTR|PMEL_ENST00000360714.4_5'Flank|PMEL_ENST00000449260.2_5'Flank|PMEL_ENST00000536427.1_5'Flank	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	122	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)	p.R122L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	CATTCTCATCGGGTCCTCCAC	0.502																																						dbGAP											1	Substitution - Missense(1)	lung(1)											133.0	121.0	125.0					12																	56362611		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.365delG	12.37:g.56362611delG	ENSP00000266970:p.Arg122fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C6|O75100	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V123fs	ENST00000266970.4	37	c.365	CCDS8898.1	12																																																																																			CDK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000123374		0.502	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK2	HGNC	protein_coding	OTTHUMT00000409650.1	112	0.00	0	G			56362611	56362611	+1	no_errors	ENST00000266970	ensembl	human	known	69_37n	frame_shift_del	78	25.00	26	DEL	1.000	-
CWC22	57703	genome.wustl.edu	37	2	180858042	180858042	+	Splice_Site	SNP	T	T	G			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr2:180858042T>G	ENST00000410053.3	-	2	326	c.27A>C	c.(25-27)aaA>aaC	p.K9N	CWC22_ENST00000295749.6_Splice_Site_p.K9N	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	9					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						AAACACTTACTTTTATCTGTG	0.333																																						dbGAP											0													135.0	127.0	129.0					2																	180858042		1843	4078	5921	-	-	-	SO:0001630	splice_region_variant	0				CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.27+1A>C	2.37:g.180858042T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.K9N	ENST00000410053.3	37	c.27	CCDS46465.1	2	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057599	0.36277	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.24350	2.19;2.19;1.86	5.19	1.42	0.22433	.	0.256767	0.39687	N	0.001284	T	0.17619	0.0423	L	0.42245	1.32	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09207	-1.0685	9	.	.	.	-22.6143	6.8981	0.24267	0.0:0.2912:0.0:0.7088	.	9	Q9HCG8	CWC22_HUMAN	N	9	ENSP00000387006:K9N;ENSP00000295749:K9N;ENSP00000384159:K9N	.	K	-	3	2	CWC22	180566287	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	0.568000	0.23623	0.060000	0.16281	0.528000	0.53228	AAA	CWC22	-	NULL	ENSG00000163510		0.333	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	HGNC	protein_coding	OTTHUMT00000334537.1	210	0.00	0	T	NM_020943	Missense_Mutation	180858042	180858042	-1	no_errors	ENST00000295749	ensembl	human	known	69_37n	missense	146	27.36	55	SNP	1.000	G
COL6A3	1293	genome.wustl.edu	37	2	238277616	238277616	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr2:238277616G>A	ENST00000295550.4	-	10	4942	c.4490C>T	c.(4489-4491)gCc>gTc	p.A1497V	COL6A3_ENST00000347401.3_Missense_Mutation_p.A1296V|COL6A3_ENST00000472056.1_Missense_Mutation_p.A890V|COL6A3_ENST00000346358.4_Missense_Mutation_p.A1297V|COL6A3_ENST00000409809.1_Missense_Mutation_p.A1291V|COL6A3_ENST00000353578.4_Missense_Mutation_p.A1291V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1497	Nonhelical region.|VWFA 8. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGCACCGGGGCCTGGGATCT	0.542																																						dbGAP											0													51.0	52.0	52.0					2																	238277616		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4490C>T	2.37:g.238277616G>A	ENSP00000295550:p.Ala1497Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.A1497V	ENST00000295550.4	37	c.4490	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	7.623	0.677166	0.14841	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.36	-2.84	0.05751	von Willebrand factor, type A (3);	1.958180	0.02482	N	0.088608	T	0.72350	0.3449	L	0.54908	1.71	0.09310	N	1	B;B;B	0.28208	0.182;0.203;0.096	B;B;B	0.33960	0.173;0.061;0.09	T	0.53012	-0.8498	10	0.31617	T	0.26	.	5.031	0.14409	0.0673:0.3685:0.2022:0.362	.	890;1291;1497	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	V	1497;1296;1291;890;1291;1297	ENSP00000295550:A1497V;ENSP00000315609:A1296V;ENSP00000315873:A1291V;ENSP00000418285:A890V;ENSP00000386844:A1291V;ENSP00000295546:A1297V	ENSP00000295550:A1497V	A	-	2	0	COL6A3	237942355	0.000000	0.05858	0.006000	0.13384	0.379000	0.30106	-0.637000	0.05459	-0.560000	0.06102	-0.137000	0.14449	GCC	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.542	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	56	0.00	0	G	NM_004369		238277616	238277616	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	0.000	A
CYSTM1	84418	genome.wustl.edu	37	5	139574060	139574060	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr5:139574060G>C	ENST00000261811.4	+	2	674	c.10G>C	c.(10-12)Gag>Cag	p.E4Q	CYSTM1_ENST00000509789.2_Intron|AC011379.1_ENST00000583981.1_RNA	NM_032412.3	NP_115788.1	Q9H1C7	CYTM1_HUMAN	cysteine-rich transmembrane module containing 1	4						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GATGAACCAAGAGAACCCTCC	0.488																																						dbGAP											0													126.0	125.0	125.0					5																	139574060		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245877	CCDS4221.1	5q31.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000120306	ENSG00000120306			30239	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 32"""	C5orf32		19933165	Standard	NM_032412		Approved	ORF1-FL49	uc003lfd.3	Q9H1C7	OTTHUMG00000129243	ENST00000261811.4:c.10G>C	5.37:g.139574060G>C	ENSP00000261811:p.Glu4Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBA5	Missense_Mutation	SNP	NULL	p.E4Q	ENST00000261811.4	37	c.10	CCDS4221.1	5	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606316	0.46527	.	.	ENSG00000120306	ENST00000261811	T	0.38560	1.13	5.27	5.27	0.74061	.	0.835031	0.10546	N	0.662004	T	0.36496	0.0969	.	.	.	0.34743	D	0.730976	B	0.20550	0.046	B	0.24541	0.054	T	0.33240	-0.9876	9	0.30078	T	0.28	0.403	15.811	0.78565	0.0:0.0:1.0:0.0	.	4	Q9H1C7	CE032_HUMAN	Q	4	ENSP00000261811:E4Q	ENSP00000261811:E4Q	E	+	1	0	C5orf32	139554244	1.000000	0.71417	0.980000	0.43619	0.492000	0.33523	4.297000	0.59061	2.477000	0.83638	0.655000	0.94253	GAG	CYSTM1	-	NULL	ENSG00000120306		0.488	CYSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSTM1	HGNC	protein_coding	OTTHUMT00000251342.2	70	0.00	0	G	NM_032412		139574060	139574060	+1	no_errors	ENST00000261811	ensembl	human	known	69_37n	missense	39	40.00	26	SNP	0.967	C
DDX24	57062	genome.wustl.edu	37	14	94524189	94524189	+	Silent	SNP	G	G	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr14:94524189G>T	ENST00000330836.5	-	6	2099	c.1968C>A	c.(1966-1968)gtC>gtA	p.V656V	DDX24_ENST00000555054.1_Silent_p.V613V|DDX24_ENST00000544005.1_Silent_p.V406V	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	656	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		TGACATGCTGGACTTTAGGAA	0.458																																						dbGAP											0													65.0	63.0	63.0					14																	94524189		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.1968C>A	14.37:g.94524189G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMJ4|Q4V9L5	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.V656	ENST00000330836.5	37	c.1968	CCDS9918.1	14																																																																																			DDX24	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000089737		0.458	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1	37	0.00	0	G	NM_020414		94524189	94524189	-1	no_errors	ENST00000330836	ensembl	human	known	69_37n	silent	22	26.67	8	SNP	0.977	T
DDX58	23586	genome.wustl.edu	37	9	32459494	32459494	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr9:32459494G>A	ENST00000379883.2	-	17	2513	c.2356C>T	c.(2356-2358)Cat>Tat	p.H786Y	DDX58_ENST00000379882.1_Missense_Mutation_p.H741Y|DDX58_ENST00000542096.1_Missense_Mutation_p.H715Y|DDX58_ENST00000379868.1_Missense_Mutation_p.H583Y	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	786	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		AATTTTTCATGAGTCTGTATA	0.343																																						dbGAP											0													139.0	125.0	130.0					9																	32459494		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2356C>T	9.37:g.32459494G>A	ENSP00000369213:p.His786Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_DEATH-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H786Y	ENST00000379883.2	37	c.2356	CCDS6526.1	9	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810148	0.32053	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096	T;T;T;T	0.05786	3.52;3.52;3.4;3.39	4.79	1.37	0.22104	.	1.197400	0.06101	N	0.665481	T	0.05044	0.0135	N	0.22421	0.69	0.09310	N	1	B;B	0.21606	0.056;0.058	B;B	0.19666	0.004;0.026	T	0.44742	-0.9308	10	0.07644	T	0.81	3.3157	10.6347	0.45558	0.0:0.5553:0.3112:0.1335	.	715;786	B3KWW1;O95786	.;DDX58_HUMAN	Y	741;786;583;715	ENSP00000369212:H741Y;ENSP00000369213:H786Y;ENSP00000369197:H583Y;ENSP00000442160:H715Y	ENSP00000369197:H583Y	H	-	1	0	DDX58	32449494	0.027000	0.19231	0.001000	0.08648	0.484000	0.33280	0.190000	0.17057	0.022000	0.15160	0.655000	0.94253	CAT	DDX58	-	NULL	ENSG00000107201		0.343	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	HGNC	protein_coding	OTTHUMT00000052011.1	254	0.00	0	G	NM_014314		32459494	32459494	-1	no_errors	ENST00000379883	ensembl	human	known	69_37n	missense	177	37.98	109	SNP	0.006	A
ELOVL5	60481	genome.wustl.edu	37	6	53133926	53133926	+	Silent	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr6:53133926C>T	ENST00000542638.1	-	8	1346	c.899G>A	c.(898-900)tGa>tAa	p.*300*	ELOVL5_ENST00000304434.6_Silent_p.*300*|ELOVL5_ENST00000541407.1_Silent_p.*327*|ELOVL5_ENST00000370918.4_Silent_p.*290*			Q9NYP7	ELOV5_HUMAN	ELOVL fatty acid elongase 5	0					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7	Lung NSC(77;0.116)					TCTTTGACTTCAATCCTTCCG	0.478																																						dbGAP											0													188.0	151.0	163.0					6																	53133926		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF052129	CCDS4951.1, CCDS56433.1, CCDS56434.1, CCDS75470.1	6p21.1-p12.1	2014-07-30	2011-05-25		ENSG00000012660	ENSG00000012660			21308	protein-coding gene	gene with protein product		611805	"""ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"", ""spinocerebellar ataxia 38"""	SCA38		10970790, 25065913	Standard	NM_021814		Approved	HELO1, dJ483K16.1	uc011dwx.2	Q9NYP7	OTTHUMG00000016249	ENST00000542638.1:c.899G>A	6.37:g.53133926C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZJ2|F6SH78|Q59EL3|Q5TGH5|Q6NXE7|Q7L2S5|Q8NCG4|Q9UI22	Silent	SNP	pfam_GNS1_SUR4	p.*327	ENST00000542638.1	37	c.980	CCDS4951.1	6																																																																																			ELOVL5	-	NULL	ENSG00000012660		0.478	ELOVL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL5	HGNC	protein_coding	OTTHUMT00000043566.1	119	0.00	0	C	NM_021814		53133926	53133926	-1	no_errors	ENST00000541407	ensembl	human	known	69_37n	silent	65	26.14	23	SNP	1.000	T
ENPP7	339221	genome.wustl.edu	37	17	77705092	77705092	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr17:77705092C>A	ENST00000328313.5	+	1	412	c.191C>A	c.(190-192)gCa>gAa	p.A64E		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GGGGTGAAGGCACGCTACATG	0.647																																						dbGAP											0													59.0	49.0	53.0					17																	77705092		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.191C>A	17.37:g.77705092C>A	ENSP00000332656:p.Ala64Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Metalloenzyme,superfamily_Alkaline_phosphatase_core	p.A64E	ENST00000328313.5	37	c.191	CCDS11763.1	17	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608839	0.87258	.	.	ENSG00000182156	ENST00000328313	T	0.75050	-0.9	4.36	4.36	0.52297	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.89532	0.6742	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92630	0.6115	10	0.87932	D	0	-30.6407	16.6799	0.85289	0.0:1.0:0.0:0.0	.	64	Q6UWV6	ENPP7_HUMAN	E	64	ENSP00000332656:A64E	ENSP00000332656:A64E	A	+	2	0	ENPP7	75319687	1.000000	0.71417	0.353000	0.25747	0.768000	0.43524	7.482000	0.81143	2.244000	0.73946	0.561000	0.74099	GCA	ENPP7	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000182156		0.647	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ENPP7	HGNC	protein_coding	OTTHUMT00000437038.1	23	0.00	0	C	NM_178543		77705092	77705092	+1	no_errors	ENST00000328313	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	A
ESPL1	9700	genome.wustl.edu	37	12	53670885	53670885	+	Silent	SNP	C	C	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr12:53670885C>A	ENST00000257934.4	+	9	2050	c.1959C>A	c.(1957-1959)atC>atA	p.I653I	ESPL1_ENST00000552462.1_Silent_p.I653I	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	653					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						TGGATGCTATCCGGGAAGCCC	0.567																																					Colon(53;1069 1201 2587 5382)	dbGAP											0													72.0	66.0	68.0					12																	53670885		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.1959C>A	12.37:g.53670885C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_C50	p.I653	ENST00000257934.4	37	c.1959	CCDS8852.1	12																																																																																			ESPL1	-	NULL	ENSG00000135476		0.567	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	22	0.00	0	C	NM_012291		53670885	53670885	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	silent	7	46.15	6	SNP	0.997	A
FBF1	85302	genome.wustl.edu	37	17	73924235	73924235	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr17:73924235T>C	ENST00000586717.1	-	7	550	c.277A>G	c.(277-279)Aaa>Gaa	p.K93E	FBF1_ENST00000319129.5_Missense_Mutation_p.K93E|FBF1_ENST00000389570.4_Missense_Mutation_p.K93E			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	93					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						GAATTAGATTTCTTCAGACCT	0.537																																						dbGAP											0													66.0	66.0	66.0					17																	73924235		1885	4104	5989	-	-	-	SO:0001583	missense	0			AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.277A>G	17.37:g.73924235T>C	ENSP00000465132:p.Lys93Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	superfamily_HRDC-like	p.K93E	ENST00000586717.1	37	c.277		17	.	.	.	.	.	.	.	.	.	.	T	14.26	2.483731	0.44147	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.32988	1.43;1.43	5.01	5.01	0.66863	.	.	.	.	.	T	0.35856	0.0946	L	0.56769	1.78	0.35797	D	0.822853	B;P;B	0.35575	0.277;0.51;0.277	B;B;B	0.40329	0.116;0.326;0.079	T	0.52147	-0.8614	9	0.72032	D	0.01	-15.471	12.2391	0.54532	0.0:0.0:0.0:1.0	.	107;93;93	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	E	93;93;93;106	ENSP00000374221:K93E;ENSP00000324292:K93E	ENSP00000324292:K93E	K	-	1	0	FBF1	71435830	1.000000	0.71417	0.894000	0.35097	0.407000	0.30961	4.590000	0.61013	1.889000	0.54706	0.533000	0.62120	AAA	FBF1	-	NULL	ENSG00000188878		0.537	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	FBF1	HGNC	protein_coding	OTTHUMT00000448945.2	86	0.00	0	T	NM_001080542		73924235	73924235	-1	no_errors	ENST00000389570	ensembl	human	known	69_37n	missense	70	22.22	20	SNP	0.975	C
GTF3C2	2976	genome.wustl.edu	37	2	27551716	27551716	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr2:27551716C>T	ENST00000359541.2	-	15	2551	c.2122G>A	c.(2122-2124)Gtt>Att	p.V708I	GTF3C2_ENST00000264720.3_Missense_Mutation_p.V708I			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	708					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCACCCAAACGGTGCCTTTT	0.423																																						dbGAP											0													55.0	56.0	55.0					2																	27551716		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.2122G>A	2.37:g.27551716C>T	ENSP00000352536:p.Val708Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V708I	ENST00000359541.2	37	c.2122	CCDS1749.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.37|16.37	3.103658|3.103658	0.56291|0.56291	.|.	.|.	ENSG00000115207|ENSG00000115207	ENST00000457098|ENST00000359541;ENST00000264720	.|T;T	.|0.74106	.|-0.81;-0.81	5.5|5.5	5.5|5.5	0.81552|0.81552	.|WD40 repeat-like-containing domain (1);	.|0.125660	.|0.53938	.|D	.|0.000050	T|T	0.72112|0.72112	0.3420|0.3420	N|N	0.17082|0.17082	0.46|0.46	0.39809|0.39809	D|D	0.972673|0.972673	.|D	.|0.71674	.|0.998	.|P	.|0.57911	.|0.829	T|T	0.69202|0.69202	-0.5207|-0.5207	5|10	.|0.20046	.|T	.|0.44	-16.2704|-16.2704	17.2462|17.2462	0.87029|0.87029	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|708	.|Q8WUA4	.|TF3C2_HUMAN	H|I	1|708	.|ENSP00000352536:V708I;ENSP00000264720:V708I	.|ENSP00000264720:V708I	R|V	-|-	2|1	0|0	GTF3C2|GTF3C2	27405220|27405220	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.843000|0.843000	0.47879|0.47879	3.927000|3.927000	0.56499|0.56499	2.758000|2.758000	0.94735|0.94735	0.561000|0.561000	0.74099|0.74099	CGT|GTT	GTF3C2	-	superfamily_WD40_repeat_dom	ENSG00000115207		0.423	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C2	HGNC	protein_coding	OTTHUMT00000215028.2	54	0.00	0	C			27551716	27551716	-1	no_errors	ENST00000264720	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	T
GUCY1B3	2983	genome.wustl.edu	37	4	156724917	156724917	+	Splice_Site	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr4:156724917G>A	ENST00000264424.8	+	11	1636		c.e11+1		GUCY1B3_ENST00000513437.1_Splice_Site|GUCY1B3_ENST00000505764.1_Splice_Site|GUCY1B3_ENST00000502959.1_Splice_Site|GUCY1B3_ENST00000505154.1_Splice_Site|GUCY1B3_ENST00000503520.1_Splice_Site|GUCY1B3_ENST00000507146.1_Splice_Site	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3						blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		ATCTGTTCAGGTTAGTAAATG	0.408																																						dbGAP											0													64.0	66.0	65.0					4																	156724917		1905	4137	6042	-	-	-	SO:0001630	splice_region_variant	0			AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.1554+1G>A	4.37:g.156724917G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z426|Q86WY5	Splice_Site	SNP	-	e11+1	ENST00000264424.8	37	c.1554+1	CCDS47154.1	4	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438704	0.83885	.	.	ENSG00000061918	ENST00000505154;ENST00000502959;ENST00000505764;ENST00000507146;ENST00000264424;ENST00000503520;ENST00000513437	.	.	.	5.61	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0797	0.80995	0.0:0.0:0.8648:0.1352	.	.	.	.	.	-1	.	.	.	+	.	.	GUCY1B3	156944367	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.805000	0.99149	1.463000	0.47967	0.655000	0.94253	.	GUCY1B3	-	-	ENSG00000061918		0.408	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY1B3	HGNC	protein_coding	OTTHUMT00000365770.2	44	0.00	0	G		Intron	156724917	156724917	+1	no_errors	ENST00000264424	ensembl	human	known	69_37n	splice_site	28	20.00	7	SNP	1.000	A
GZF1	64412	genome.wustl.edu	37	20	23345750	23345750	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr20:23345750C>A	ENST00000338121.5	+	2	807	c.730C>A	c.(730-732)Ctc>Atc	p.L244I	GZF1_ENST00000377051.2_Missense_Mutation_p.L244I|GZF1_ENST00000542987.1_Intron|GZF1_ENST00000544236.1_Intron			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	244					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TACGAGAAGACTCCGAGAGCA	0.537																																						dbGAP											0													45.0	53.0	50.0					20																	23345750		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.730C>A	20.37:g.23345750C>A	ENSP00000338290:p.Leu244Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L244I	ENST00000338121.5	37	c.730	CCDS13151.1	20	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491377	0.44249	.	.	ENSG00000125812	ENST00000338121;ENST00000377051	T;T	0.10763	2.84;2.84	4.55	3.59	0.41128	.	0.000000	0.50627	D	0.000108	T	0.20901	0.0503	L	0.36672	1.1	0.39457	D	0.967504	D	0.69078	0.997	D	0.78314	0.991	T	0.01238	-1.1409	10	0.59425	D	0.04	.	11.3958	0.49841	0.0:0.9114:0.0:0.0886	.	244	Q9H116	GZF1_HUMAN	I	244	ENSP00000338290:L244I;ENSP00000366250:L244I	ENSP00000338290:L244I	L	+	1	0	GZF1	23293750	0.979000	0.34478	0.892000	0.35008	0.584000	0.36387	2.409000	0.44583	2.245000	0.73994	0.544000	0.68410	CTC	GZF1	-	NULL	ENSG00000125812		0.537	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	HGNC	protein_coding	OTTHUMT00000078333.1	34	0.00	0	C	NM_022482		23345750	23345750	+1	no_errors	ENST00000338121	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	0.273	A
IGSF3	3321	genome.wustl.edu	37	1	117131545	117131545	+	Silent	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr1:117131545G>A	ENST00000369486.3	-	8	2976	c.2211C>T	c.(2209-2211)tcC>tcT	p.S737S	IGSF3_ENST00000369483.1_Silent_p.S757S|IGSF3_ENST00000318837.6_Silent_p.S757S	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	737	Ig-like C2-type 6.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		ATTCAAAGGCGGAGTTGTGGG	0.582																																						dbGAP											0													126.0	109.0	115.0					1																	117131545		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2211C>T	1.37:g.117131545G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJZ6|A6NMC7	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S757	ENST00000369486.3	37	c.2271	CCDS30813.1	1																																																																																			IGSF3	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143061		0.582	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1	53	0.00	0	G	NM_001542		117131545	117131545	-1	no_errors	ENST00000318837	ensembl	human	known	69_37n	silent	26	31.58	12	SNP	0.887	A
IQSEC3	440073	genome.wustl.edu	37	12	266274	266274	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr12:266274G>A	ENST00000538872.1	+	6	2355	c.2237G>A	c.(2236-2238)gGg>gAg	p.G746E	IQSEC3_ENST00000382841.2_Missense_Mutation_p.G443E|IQSEC3_ENST00000326261.4_Missense_Mutation_p.G746E			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	746	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CGTGTGCAGGGGGAGGCTCAG	0.657																																						dbGAP											0													39.0	35.0	36.0					12																	266274		2201	4300	6501	-	-	-	SO:0001583	missense	0			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2237G>A	12.37:g.266274G>A	ENSP00000437554:p.Gly746Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.G746E	ENST00000538872.1	37	c.2237	CCDS53728.1	12	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125455	0.56721	.	.	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.81330	-1.48;-1.48;-1.48	3.7	3.7	0.42460	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.052919	0.85682	D	0.000000	D	0.91912	0.7439	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94393	0.7616	10	0.87932	D	0	.	15.8141	0.78586	0.0:0.0:1.0:0.0	.	746;443	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	E	746;746;443	ENSP00000437554:G746E;ENSP00000315662:G746E;ENSP00000372292:G443E	ENSP00000315662:G746E	G	+	2	0	IQSEC3	136535	1.000000	0.71417	0.968000	0.41197	0.048000	0.14542	9.675000	0.98638	1.804000	0.52760	0.313000	0.20887	GGG	IQSEC3	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000120645		0.657	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC3	HGNC	protein_coding	OTTHUMT00000397382.3	30	0.00	0	G	XM_495902		266274	266274	+1	no_errors	ENST00000326261	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	A
ITPR2	3709	genome.wustl.edu	37	12	26755633	26755633	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr12:26755633T>C	ENST00000381340.3	-	27	3885	c.3469A>G	c.(3469-3471)Aac>Gac	p.N1157D		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1157					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CTTAAAATGTTTGATTCCTAA	0.308																																						dbGAP											0													100.0	86.0	90.0					12																	26755633		1835	4095	5930	-	-	-	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3469A>G	12.37:g.26755633T>C	ENSP00000370744:p.Asn1157Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.N1157D	ENST00000381340.3	37	c.3469	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	T	2.536	-0.307323	0.05458	.	.	ENSG00000123104	ENST00000381340	D	0.91686	-2.89	4.69	3.53	0.40419	.	0.524430	0.20445	N	0.092216	D	0.83529	0.5274	L	0.29908	0.895	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.72858	-0.4165	10	0.02654	T	1	.	10.5714	0.45202	0.0:0.0:0.162:0.838	.	1157	Q14571	ITPR2_HUMAN	D	1157	ENSP00000370744:N1157D	ENSP00000370744:N1157D	N	-	1	0	ITPR2	26646900	0.994000	0.37717	0.720000	0.30636	0.932000	0.56968	1.336000	0.33850	0.910000	0.36722	0.533000	0.62120	AAC	ITPR2	-	superfamily_ARM-type_fold	ENSG00000123104		0.308	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	170	0.00	0	T	NM_002223		26755633	26755633	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	missense	93	34.51	49	SNP	0.865	C
KIAA1755	85449	genome.wustl.edu	37	20	36841476	36841476	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr20:36841476A>G	ENST00000279024.4	-	14	3842	c.3571T>C	c.(3571-3573)Tca>Cca	p.S1191P		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1191										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GTCTGGGGTGAGTCCTCAAGG	0.657																																						dbGAP											0													37.0	36.0	36.0					20																	36841476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3571T>C	20.37:g.36841476A>G	ENSP00000279024:p.Ser1191Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9C0A8	Missense_Mutation	SNP	superfamily_CRAL-TRIO_dom	p.S1191P	ENST00000279024.4	37	c.3571	CCDS33467.1	20	.	.	.	.	.	.	.	.	.	.	A	15.90	2.969789	0.53614	.	.	ENSG00000149633	ENST00000279024	T	0.12147	2.71	4.88	4.88	0.63580	.	0.174561	0.27846	N	0.017606	T	0.30293	0.0760	L	0.54323	1.7	0.32917	D	0.515285	D	0.71674	0.998	D	0.78314	0.991	T	0.40194	-0.9576	10	0.87932	D	0	.	10.799	0.46476	1.0:0.0:0.0:0.0	.	1191	Q5JYT7	K1755_HUMAN	P	1191	ENSP00000279024:S1191P	ENSP00000279024:S1191P	S	-	1	0	KIAA1755	36274890	1.000000	0.71417	0.993000	0.49108	0.217000	0.24651	2.017000	0.40981	2.044000	0.60594	0.459000	0.35465	TCA	KIAA1755	-	NULL	ENSG00000149633		0.657	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	19	0.00	0	A	NM_001029864		36841476	36841476	-1	no_errors	ENST00000279024	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.998	G
LAMA1	284217	genome.wustl.edu	37	18	7042194	7042194	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr18:7042194G>A	ENST00000389658.3	-	9	1304	c.1211C>T	c.(1210-1212)tCc>tTc	p.S404F		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	404	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGAACTGAGGGACCCCACAGG	0.448																																						dbGAP											0													63.0	52.0	56.0					18																	7042194		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1211C>T	18.37:g.7042194G>A	ENSP00000374309:p.Ser404Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.S404F	ENST00000389658.3	37	c.1211	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910039	0.92107	.	.	ENSG00000101680	ENST00000389658	T	0.65732	-0.17	5.81	5.81	0.92471	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90361	0.4373	10	0.66056	D	0.02	.	18.2426	0.89973	0.0:0.0:1.0:0.0	.	404	P25391	LAMA1_HUMAN	F	404	ENSP00000374309:S404F	ENSP00000374309:S404F	S	-	2	0	LAMA1	7032194	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.508000	0.90525	2.750000	0.94351	0.655000	0.94253	TCC	LAMA1	-	pfam_EGF_laminin,smart_EGF-like,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000101680		0.448	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	25	0.00	0	G	NM_005559		7042194	7042194	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	19	28.57	8	SNP	1.000	A
LBR	3930	genome.wustl.edu	37	1	225609856	225609856	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr1:225609856A>C	ENST00000338179.2	-	3	414	c.289T>G	c.(289-291)Tct>Gct	p.S97A	LBR_ENST00000487054.1_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.S97A	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	97					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		GCAGAAGCAGATCGGCGGGCA	0.532																																						dbGAP											0													83.0	80.0	81.0					1																	225609856		2203	4300	6503	-	-	-	SO:0001583	missense	0			L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.289T>G	1.37:g.225609856A>C	ENSP00000339883:p.Ser97Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	pfam_Ergosterol_biosynth_ERG4_ERG24,pfam_Lamin-B_rcpt_of_tudor,pfam_DUF1295,smart_Tudor	p.S97A	ENST00000338179.2	37	c.289	CCDS1545.1	1	.	.	.	.	.	.	.	.	.	.	A	16.61	3.171652	0.57584	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000425080	D;D;T	0.97041	-4.22;-4.22;0.4	5.83	3.5	0.40072	.	0.218757	0.39544	N	0.001332	D	0.94437	0.8210	M	0.72118	2.19	0.09310	N	1	B;P	0.48089	0.435;0.905	B;B	0.41894	0.115;0.369	D	0.87787	0.2616	10	0.25751	T	0.34	-29.7081	4.2154	0.10531	0.6342:0.0:0.2234:0.1424	.	97;97	C9JXK0;Q14739	.;LBR_HUMAN	A	97	ENSP00000272163:S97A;ENSP00000339883:S97A;ENSP00000388059:S97A	ENSP00000272163:S97A	S	-	1	0	LBR	223676479	0.957000	0.32711	0.031000	0.17742	0.383000	0.30230	2.138000	0.42140	1.040000	0.40099	0.533000	0.62120	TCT	LBR	-	NULL	ENSG00000143815		0.532	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LBR	HGNC	protein_coding	OTTHUMT00000091398.1	35	0.00	0	A	NM_002296		225609856	225609856	-1	no_errors	ENST00000272163	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	0.000	C
LPPR2	64748	genome.wustl.edu	37	19	11470279	11470279	+	Silent	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr19:11470279C>T	ENST00000251473.5	+	4	514	c.138C>T	c.(136-138)acC>acT	p.T46T	DKFZP761J1410_ENST00000591608.1_Intron|DKFZP761J1410_ENST00000586431.1_3'UTR	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CTGTGCACACCCAGGGATTCT	0.617																																						dbGAP											0													124.0	92.0	103.0					19																	11470279		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000251473.5:c.138C>T	19.37:g.11470279C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.T46	ENST00000251473.5	37	c.138	CCDS12258.1	19																																																																																			LPPR2	-	NULL	ENSG00000105520		0.617	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR2	Clone_based_vega_gene	protein_coding	OTTHUMT00000458779.1	48	0.00	0	C			11470279	11470279	+1	no_errors	ENST00000251473	ensembl	human	known	69_37n	silent	23	29.41	10	SNP	0.974	T
LTBP1	4052	genome.wustl.edu	37	2	33585833	33585833	+	Silent	SNP	G	G	T	rs376638313	byFrequency	TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr2:33585833G>T	ENST00000404816.2	+	27	4523	c.4170G>T	c.(4168-4170)ccG>ccT	p.P1390P	LTBP1_ENST00000402934.1_Silent_p.P1009P|LTBP1_ENST00000354476.3_Silent_p.P1391P|LTBP1_ENST00000390003.4_Silent_p.P1065P|LTBP1_ENST00000418533.2_Silent_p.P1022P|LTBP1_ENST00000407925.1_Silent_p.P1064P|LTBP1_ENST00000272273.5_Silent_p.P288P|LTBP1_ENST00000404525.1_Silent_p.P1011P			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1390	TB 3.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCCCCTGCCCGGTCTTGGGAA	0.502																																						dbGAP											0													86.0	80.0	82.0					2																	33585833		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4170G>T	2.37:g.33585833G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.P1391	ENST00000404816.2	37	c.4173	CCDS33177.2	2																																																																																			LTBP1	-	pfam_TB_dom,superfamily_TB_dom	ENSG00000049323		0.502	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	45	0.00	0	G	NM_206943		33585833	33585833	+1	no_errors	ENST00000354476	ensembl	human	known	69_37n	silent	29	30.95	13	SNP	0.005	T
MMP28	79148	genome.wustl.edu	37	17	34105965	34105965	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr17:34105965C>A	ENST00000250144.8	-	3	635	c.306G>T	c.(304-306)tgG>tgT	p.W102C		NM_001032278.1	NP_001027449.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 28	102					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|skin(5)	16		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	Marimastat(DB00786)	TCCTCTCAGCCCAGGCCGCAT	0.567																																						dbGAP											0													87.0	91.0	90.0					17																	34105965		2098	4221	6319	-	-	-	SO:0001583	missense	0			AF315683	CCDS45651.1, CCDS74036.1	17q12	2014-08-12	2005-08-08		ENSG00000271447	ENSG00000271447			14366	protein-coding gene	gene with protein product		608417	"""matrix metalloproteinase 28"""			11121398, 11255011	Standard	NM_024302		Approved	MMP-25, MM28, EPILYSIN, MMP-28	uc002hjy.1	Q9H239	OTTHUMG00000188387	ENST00000250144.8:c.306G>T	17.37:g.34105965C>A	ENSP00000250144:p.Trp102Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96F04|Q96TE2	Missense_Mutation	SNP	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like	p.W102C	ENST00000250144.8	37	c.306	CCDS45651.1	17	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177591	0.57692	.	.	ENSG00000129270	ENST00000338839;ENST00000538544;ENST00000250144	T	0.64260	-0.09	5.47	4.49	0.54785	Metallopeptidase, catalytic domain (1);	2.028160	0.02679	N	0.109414	T	0.80412	0.4618	.	.	.	0.49213	D	0.999763	D;D	0.76494	0.999;0.979	D;P	0.65874	0.939;0.514	T	0.60510	-0.7249	9	0.72032	D	0.01	.	12.7837	0.57491	0.1639:0.8361:0.0:0.0	.	102;102	Q9H239-2;Q9H239	.;MMP28_HUMAN	C	102	ENSP00000250144:W102C	ENSP00000250144:W102C	W	-	3	0	MMP28	31130078	1.000000	0.71417	0.321000	0.25320	0.588000	0.36517	6.516000	0.73755	1.294000	0.44707	0.655000	0.94253	TGG	MMP28	-	NULL	ENSG00000129270		0.567	MMP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP28	HGNC	protein_coding	OTTHUMT00000449269.1	72	0.00	0	C	NM_024302		34105965	34105965	-1	no_errors	ENST00000587639	ensembl	human	known	69_37n	missense	45	18.18	10	SNP	0.997	A
UQCC2	84300	genome.wustl.edu	37	6	33679361	33679361	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr6:33679361C>A	ENST00000607484.1	-	1	143	c.103G>T	c.(103-105)Gta>Tta	p.V35L	UQCC2_ENST00000374214.3_Missense_Mutation_p.V35L	NM_032340.3	NP_115716.1	Q9BRT2	UQCC2_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 2	35					regulation of insulin secretion (GO:0050796)|regulation of oxidative phosphorylation (GO:0002082)|regulation of skeletal muscle cell differentiation (GO:2001014)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											GCCTGTGCTACCCGCTGTCGC	0.672																																						dbGAP											0													44.0	48.0	47.0					6																	33679361		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4784.1	6p21.31	2013-09-20	2013-09-20	2013-09-20	ENSG00000137288	ENSG00000137288		"""Mitochondrial respiratory chain complex assembly factors"""	21237	protein-coding gene	gene with protein product	"""cytochrome B protein synthesis 6 homolog (S. cerevisiae)"""	614461	"""chromosome 6 open reading frame 125"", ""mitochondrial nucleoid factor 1"""	C6orf125, MNF1		19643811	Standard	NM_032340		Approved	MGC14833, bA6B20.2, M19, Cbp6	uc003ofa.2	Q9BRT2	OTTHUMG00000014534	ENST00000607484.1:c.103G>T	6.37:g.33679361C>A	ENSP00000476140:p.Val35Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4I0	Missense_Mutation	SNP	NULL	p.V35L	ENST00000607484.1	37	c.103	CCDS4784.1	6	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869594	0.72065	.	.	ENSG00000137288	ENST00000374231;ENST00000374214	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.67562	0.2906	L	0.48642	1.525	0.54753	D	0.999986	D	0.67145	0.996	D	0.77557	0.99	T	0.61637	-0.7022	9	0.26408	T	0.33	.	18.92	0.92521	0.0:1.0:0.0:0.0	.	35	Q9BRT2	CF125_HUMAN	L	35	.	ENSP00000363331:V35L	V	-	1	0	C6orf125	33787339	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	6.861000	0.75478	2.567000	0.86603	0.561000	0.74099	GTA	MNF1	-	NULL	ENSG00000137288		0.672	UQCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNF1	HGNC	protein_coding	OTTHUMT00000040207.2	46	0.00	0	C	NM_032340		33679361	33679361	-1	no_errors	ENST00000374231	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9060763	9060763	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr19:9060763T>G	ENST00000397910.4	-	3	26886	c.26683A>C	c.(26683-26685)Aca>Cca	p.T8895P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8897	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACATGTCTGTGGTCTTCATC	0.493																																						dbGAP											0													144.0	138.0	140.0					19																	9060763		2003	4173	6176	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26683A>C	19.37:g.9060763T>G	ENSP00000381008:p.Thr8895Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T8895P	ENST00000397910.4	37	c.26683	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	-	1.353	-0.590834	0.03799	.	.	ENSG00000181143	ENST00000397910	T	0.26518	1.73	2.02	-0.335	0.12662	.	.	.	.	.	T	0.28632	0.0709	L	0.46157	1.445	.	.	.	P	0.39131	0.661	P	0.49421	0.61	T	0.39603	-0.9606	8	0.87932	D	0	.	4.1364	0.10172	0.0:0.1443:0.2037:0.6521	.	8895	B5ME49	.	P	8895	ENSP00000381008:T8895P	ENSP00000381008:T8895P	T	-	1	0	MUC16	8921763	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.299000	0.08254	-0.603000	0.05767	-1.939000	0.00497	ACA	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	110	0.90	1	T	NM_024690		9060763	9060763	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	37	39.34	24	SNP	0.000	G
Unknown	0	genome.wustl.edu	37	3	195346312	195346312	+	IGR	SNP	C	C	T	rs369994739		TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr3:195346312C>T								APOD (35236 upstream) : RP11-141C7.4 (20548 downstream)																							TCCGACGGCCCCCATCCAGTC	0.622																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															3.37:g.195346312C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P205L		37	c.614		3	.	.	.	.	.	.	.	.	.	.	.	9.559	1.117882	0.20877	.	.	ENSG00000176945	ENST00000381954	.	.	.	.	.	.	.	.	.	.	.	T	0.35595	0.0937	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.31971	-0.9924	3	0.46703	T	0.11	.	.	.	.	.	.	.	.	L	205	.	ENSP00000371380:P205L	P	+	2	0	MUC20	196827601	0.000000	0.05858	0.122000	0.21767	0.237000	0.25408	-0.301000	0.08232	0.149000	0.19098	0.152000	0.16155	CCC	MUC20	-	NULL	ENSG00000176945	0	0.622					MUC20	HGNC			20	0.00	0	C			195346312	195346312	+1	no_errors	ENST00000381954	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.132	T
MYH6	4624	genome.wustl.edu	37	14	23858706	23858706	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr14:23858706G>A	ENST00000356287.3	-	27	3903	c.3874C>T	c.(3874-3876)Cag>Tag	p.Q1292*	MIR208A_ENST00000362287.1_RNA|MYH6_ENST00000405093.3_Nonsense_Mutation_p.Q1292*			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1292					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCCTCTAGCTGCCGGGCCAAC	0.587																																						dbGAP											0													60.0	62.0	61.0					14																	23858706		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.3874C>T	14.37:g.23858706G>A	ENSP00000348634:p.Gln1292*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1292*	ENST00000356287.3	37	c.3874	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	g	43	9.959393	0.99304	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	12.9167	0.58211	0.0:0.0:0.8377:0.1623	.	.	.	.	X	1292	.	ENSP00000348634:Q1292X	Q	-	1	0	MYH6	22928546	1.000000	0.71417	0.987000	0.45799	0.799000	0.45148	6.283000	0.72646	2.280000	0.76307	0.655000	0.94253	CAG	MYH6	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000197616		0.587	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	62	0.00	0	G			23858706	23858706	-1	no_errors	ENST00000356287	ensembl	human	known	69_37n	nonsense	51	22.73	15	SNP	1.000	A
NEUROG2	63973	genome.wustl.edu	37	4	113436099	113436099	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr4:113436099delC	ENST00000313341.3	-	2	859	c.533delG	c.(532-534)ggcfs	p.G180fs	RP11-402J6.1_ENST00000506057.1_RNA|RP11-402J6.1_ENST00000504009.1_RNA	NM_024019.3	NP_076924.1	Q9H2A3	NGN2_HUMAN	neurogenin 2	180					axon guidance (GO:0007411)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(6)|skin(2)	12		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00168)		caggcccccgccgccgccccc	0.721																																						dbGAP											0													10.0	13.0	12.0					4																	113436099		2132	4241	6373	-	-	-	SO:0001589	frameshift_variant	0			AF303002	CCDS3698.1	4q25	2013-05-21			ENSG00000178403	ENSG00000178403		"""Basic helix-loop-helix proteins"""	13805	protein-coding gene	gene with protein product		606624					Standard	NM_024019		Approved	Atoh4, Math4A, ngn-2, bHLHa8, NGN2	uc003ias.3	Q9H2A3	OTTHUMG00000132907	ENST00000313341.3:c.533delG	4.37:g.113436099delC	ENSP00000317333:p.Gly180fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N416	Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.G178fs	ENST00000313341.3	37	c.533	CCDS3698.1	4																																																																																			NEUROG2	-	superfamily_HLH_DNA-bd	ENSG00000178403		0.721	NEUROG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROG2	HGNC	protein_coding	OTTHUMT00000256414.1	17	0.00	0	C	NM_024019		113436099	113436099	-1	no_errors	ENST00000313341	ensembl	human	known	69_37n	frame_shift_del	7	30.77	4	DEL	0.949	-
OR2AG2	338755	genome.wustl.edu	37	11	6789589	6789589	+	Silent	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr11:6789589G>A	ENST00000338569.2	-	1	697	c.600C>T	c.(598-600)taC>taT	p.Y200Y		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CACCTGTCACGTATATTATAA	0.493																																						dbGAP											0													95.0	86.0	89.0					11																	6789589		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.600C>T	11.37:g.6789589G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y200	ENST00000338569.2	37	c.600	CCDS31413.1	11																																																																																			OR2AG2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000188124		0.493	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AG2	HGNC	protein_coding	OTTHUMT00000386775.1	71	0.00	0	G	NM_001004490		6789589	6789589	-1	no_errors	ENST00000338569	ensembl	human	novel	69_37n	silent	34	27.66	13	SNP	0.018	A
OR5H1	26341	genome.wustl.edu	37	3	97852403	97852403	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr3:97852403A>G	ENST00000354565.2	+	1	862	c.862A>G	c.(862-864)Atc>Gtc	p.I288V	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	288						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						GTTAAATCCTATCATCTACAG	0.358																																						dbGAP											0													89.0	95.0	93.0					3																	97852403		2203	4299	6502	-	-	-	SO:0001583	missense	0			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.862A>G	3.37:g.97852403A>G	ENSP00000346575:p.Ile288Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I288V	ENST00000354565.2	37	c.862	CCDS33797.1	3	.	.	.	.	.	.	.	.	.	.	A	0.299	-0.974885	0.02215	.	.	ENSG00000231192	ENST00000354565	T	0.40756	1.02	3.38	-1.31	0.09230	GPCR, rhodopsin-like superfamily (1);	0.469726	0.18008	N	0.154660	T	0.24928	0.0605	L	0.39147	1.195	0.09310	N	1	B	0.18013	0.025	B	0.17722	0.019	T	0.15037	-1.0451	10	0.48119	T	0.1	.	0.5577	0.00673	0.2969:0.1545:0.1279:0.4207	.	288	A6NKK0	OR5H1_HUMAN	V	288	ENSP00000346575:I288V	ENSP00000346575:I288V	I	+	1	0	OR5H1	99335093	0.000000	0.05858	0.110000	0.21437	0.002000	0.02628	-1.495000	0.02294	-0.344000	0.08338	0.164000	0.16699	ATC	OR5H1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000231192		0.358	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H1	HGNC	protein_coding	OTTHUMT00000359100.2	120	0.00	0	A	NM_001005338		97852403	97852403	+1	no_errors	ENST00000354565	ensembl	human	known	69_37n	missense	72	32.08	34	SNP	0.002	G
PCDHA12	56137	genome.wustl.edu	37	5	140255068	140255068	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr5:140255068T>C	ENST00000398631.2	+	1	11	c.11T>C	c.(10-12)aTc>aCc	p.I4T	PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	4					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGGTGATTATCGGACCAAGA	0.547																																					Pancreas(113;759 1672 13322 24104 50104)	dbGAP											0													34.0	37.0	36.0					5																	140255068		2164	4291	6455	-	-	-	SO:0001583	missense	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.11T>C	5.37:g.140255068T>C	ENSP00000381628:p.Ile4Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I4T	ENST00000398631.2	37	c.11	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	T	6.224	0.409462	0.11812	.	.	ENSG00000251664	ENST00000398631	T	0.49139	0.79	4.84	0.655	0.17839	.	.	.	.	.	T	0.15825	0.0381	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.19451	-1.0305	9	0.19590	T	0.45	.	0.9581	0.01390	0.1556:0.4403:0.154:0.2501	.	4;4	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	4	ENSP00000381628:I4T	ENSP00000381628:I4T	I	+	2	0	PCDHA12	140235252	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.095000	0.11077	-0.083000	0.12618	0.533000	0.62120	ATC	PCDHA12	-	NULL	ENSG00000251664		0.547	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	65	0.00	0	T	NM_018903		140255068	140255068	+1	no_errors	ENST00000398631	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.000	C
PIEZO2	63895	genome.wustl.edu	37	18	10761023	10761023	+	Silent	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr18:10761023C>T	ENST00000503781.3	-	22	3260	c.3261G>A	c.(3259-3261)acG>acA	p.T1087T	PIEZO2_ENST00000580640.1_Silent_p.T1112T|PIEZO2_ENST00000302079.6_Silent_p.T1087T|PIEZO2_ENST00000383408.2_Silent_p.T375T	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	1087					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										ACACAGGGGCCGTCAGGTTAT	0.393																																						dbGAP											0													78.0	66.0	70.0					18																	10761023		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.3261G>A	18.37:g.10761023C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	NULL	p.T1101	ENST00000503781.3	37	c.3303		18																																																																																			PIEZO2	-	NULL	ENSG00000154864		0.393	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	54	0.00	0	C	NM_022068		10761023	10761023	-1	no_errors	ENST00000582913	ensembl	human	known	69_37n	silent	28	30.00	12	SNP	0.846	T
PIK3CA	5290	genome.wustl.edu	37	3	178916938	178916940	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr3:178916938_178916940delGAA	ENST00000263967.3	+	2	482_484	c.325_327delGAA	c.(325-327)gaadel	p.E110del		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	110					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E109del(3)|p.G106_R108del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGGCAACCGTGAAGAAAAGATCC	0.34		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Deletion - In frame(4)	endometrium(2)|large_intestine(1)|lung(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.325_327delGAA	3.37:g.178916941_178916943delGAA	ENSP00000263967:p.Glu110del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	In_Frame_Del	DEL	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E110in_frame_del	ENST00000263967.3	37	c.325_327	CCDS43171.1	3																																																																																			PIK3CA	-	NULL	ENSG00000121879		0.340	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	47	0.00	0	GAA			178916938	178916940	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	in_frame_del	34	35.85	19	DEL	1.000:1.000:1.000	-
PLD1	5337	genome.wustl.edu	37	3	171406629	171406629	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr3:171406629T>C	ENST00000351298.4	-	14	1502	c.1376A>G	c.(1375-1377)tAt>tGt	p.Y459C	PLD1_ENST00000342215.6_Missense_Mutation_p.Y459C|PLD1_ENST00000356327.5_Missense_Mutation_p.Y459C|PLD1_ENST00000340989.4_Missense_Mutation_p.Y459C	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	459	PLD phosphodiesterase 1. {ECO:0000255|PROSITE-ProRule:PRU00153}.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	AGCCCACAAATAGACGGTGGA	0.478																																					NSCLC(149;2174 3517 34058)	dbGAP											0													110.0	91.0	97.0					3																	171406629		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1376A>G	3.37:g.171406629T>C	ENSP00000342793:p.Tyr459Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.Y459C	ENST00000351298.4	37	c.1376	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	T	16.74	3.206328	0.58343	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.2	5.2	0.72013	Phospholipase D/Transphosphatidylase (3);	0.121019	0.64402	D	0.000019	T	0.53997	0.1831	M	0.83483	2.645	0.58432	D	0.999999	D;D	0.76494	0.997;0.999	D;D	0.73708	0.962;0.981	T	0.59762	-0.7393	10	0.54805	T	0.06	-17.5475	15.3579	0.74443	0.0:0.0:0.0:1.0	.	482;459	Q59EA4;Q13393	.;PLD1_HUMAN	C	459	ENSP00000348681:Y459C;ENSP00000342793:Y459C;ENSP00000339936:Y459C;ENSP00000340326:Y459C	ENSP00000340326:Y459C	Y	-	2	0	PLD1	172889323	1.000000	0.71417	0.558000	0.28319	0.444000	0.32077	6.075000	0.71261	2.084000	0.62774	0.533000	0.62120	TAT	PLD1	-	pfam_PLipase_D/transphosphatidylase,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_PLipase_D/transphosphatidylase	ENSG00000075651		0.478	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	49	0.00	0	T	NM_002662		171406629	171406629	-1	no_errors	ENST00000351298	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.996	C
PRLR	5618	genome.wustl.edu	37	5	35072754	35072754	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr5:35072754delG	ENST00000382002.5	-	6	892	c.466delC	c.(466-468)ctgfs	p.L156fs	PRLR_ENST00000542609.1_Frame_Shift_Del_p.L156fs|PRLR_ENST00000310101.5_Frame_Shift_Del_p.L156fs|PRLR_ENST00000231423.3_Frame_Shift_Del_p.L156fs|PRLR_ENST00000397391.3_Frame_Shift_Del_p.L85fs|PRLR_ENST00000511486.1_Frame_Shift_Del_p.L55fs|PRLR_ENST00000348262.3_Frame_Shift_Del_p.L156fs|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000342362.5_Frame_Shift_Del_p.L55fs|PRLR_ENST00000513753.1_Frame_Shift_Del_p.L156fs	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	156	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)	p.L156M(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	AAGTCAATCAGGGTAGGTGGA	0.463																																						dbGAP											1	Substitution - Missense(1)	lung(1)											161.0	154.0	156.0					5																	35072754		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.466delC	5.37:g.35072754delG	ENSP00000371432:p.Leu156fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Frame_Shift_Del	DEL	pfam_Growth/epo_recpt_lig-bind,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L156fs	ENST00000382002.5	37	c.466	CCDS3909.1	5																																																																																			PRLR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113494		0.463	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	119	0.00	0	G			35072754	35072754	-1	no_errors	ENST00000382002	ensembl	human	known	69_37n	frame_shift_del	73	30.19	32	DEL	0.018	-
PROKR1	10887	genome.wustl.edu	37	2	68882542	68882542	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr2:68882542C>T	ENST00000303786.3	+	3	1436	c.1016C>T	c.(1015-1017)aCt>aTt	p.T339I	PROKR1_ENST00000394342.2_Missense_Mutation_p.T339I			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	339					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						ATGATCAACACTCTGTGCTTC	0.507																																						dbGAP											0													195.0	140.0	159.0					2																	68882542		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.1016C>T	2.37:g.68882542C>T	ENSP00000303775:p.Thr339Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.T339I	ENST00000303786.3	37	c.1016	CCDS1889.1	2	.	.	.	.	.	.	.	.	.	.	C	16.73	3.205483	0.58234	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.36878	1.23;1.23	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63414	0.2509	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67968	-0.5533	10	0.87932	D	0	.	15.9178	0.79535	0.0:1.0:0.0:0.0	.	339	Q8TCW9	PKR1_HUMAN	I	339	ENSP00000303775:T339I;ENSP00000377874:T339I	ENSP00000303775:T339I	T	+	2	0	PROKR1	68736046	1.000000	0.71417	0.980000	0.43619	0.528000	0.34623	7.374000	0.79633	2.884000	0.98904	0.655000	0.94253	ACT	PROKR1	-	prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169618		0.507	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR1	HGNC	protein_coding	OTTHUMT00000251760.2	83	0.00	0	C			68882542	68882542	+1	no_errors	ENST00000303786	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	0.997	T
PSD2	84249	genome.wustl.edu	37	5	139193009	139193009	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr5:139193009G>A	ENST00000274710.3	+	3	692	c.487G>A	c.(487-489)Ggg>Agg	p.G163R		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	163					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCCTAGACGGGCTGAGCCT	0.657																																						dbGAP											0													41.0	43.0	42.0					5																	139193009		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.487G>A	5.37:g.139193009G>A	ENSP00000274710:p.Gly163Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQD3|Q8N3J8	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_Pleckstrin_homology,pfscan_Sec7	p.G163R	ENST00000274710.3	37	c.487	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165405	0.38217	.	.	ENSG00000146005	ENST00000274710	T	0.29917	1.55	4.52	4.52	0.55395	.	0.174810	0.36482	N	0.002574	T	0.15565	0.0375	N	0.08118	0	0.32852	D	0.506802	P	0.39131	0.661	B	0.28916	0.096	T	0.23440	-1.0188	10	0.62326	D	0.03	.	15.7681	0.78143	0.0:0.0:1.0:0.0	.	163	Q9BQI7	PSD2_HUMAN	R	163	ENSP00000274710:G163R	ENSP00000274710:G163R	G	+	1	0	PSD2	139173193	1.000000	0.71417	0.992000	0.48379	0.136000	0.21042	5.720000	0.68470	2.214000	0.71695	0.462000	0.41574	GGG	PSD2	-	NULL	ENSG00000146005		0.657	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	20	0.00	0	G	NM_032289		139193009	139193009	+1	no_errors	ENST00000274710	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	A
PTCHD4	442213	genome.wustl.edu	37	6	47846156	47846156	+	Silent	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr6:47846156C>T	ENST00000339488.4	-	3	2457	c.2424G>A	c.(2422-2424)acG>acA	p.T808T		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	808						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GGGGGAAAAACGTTAGGAACA	0.448																																						dbGAP											0													100.0	100.0	100.0					6																	47846156		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2424G>A	6.37:g.47846156C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ29|B4DRK3|Q5T884	Silent	SNP	pfam_Patched,pfscan_SSD	p.T808	ENST00000339488.4	37	c.2424	CCDS34473.2	6																																																																																			PTCHD4	-	pfam_Patched	ENSG00000244694		0.448	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	88	0.00	0	C	NM_001013732		47846156	47846156	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	silent	63	22.89	19	SNP	0.997	T
SEMG2	6407	genome.wustl.edu	37	20	43851070	43851070	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr20:43851070A>T	ENST00000372769.3	+	2	887	c.797A>T	c.(796-798)aAt>aTt	p.N266I		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	266	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				TATAACAAGAATCAACACCAG	0.408																																						dbGAP											0													98.0	98.0	98.0					20																	43851070		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.797A>T	20.37:g.43851070A>T	ENSP00000361855:p.Asn266Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	pfam_Semenogelin	p.N266I	ENST00000372769.3	37	c.797	CCDS13346.1	20	.	.	.	.	.	.	.	.	.	.	A	10.99	1.508506	0.27036	.	.	ENSG00000124157	ENST00000372769	T	0.12569	2.67	1.72	0.526	0.17078	.	.	.	.	.	T	0.29389	0.0732	M	0.69823	2.125	0.09310	N	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.09773	-1.0659	9	0.87932	D	0	.	3.7373	0.08515	0.6629:0.0:0.0:0.3371	.	266;266;266	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	I	266	ENSP00000361855:N266I	ENSP00000361855:N266I	N	+	2	0	SEMG2	43284484	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.456000	0.21859	0.107000	0.17824	-0.333000	0.08304	AAT	SEMG2	-	pfam_Semenogelin	ENSG00000124157		0.408	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	HGNC	protein_coding	OTTHUMT00000079417.1	74	0.00	0	A	NM_003008		43851070	43851070	+1	no_errors	ENST00000372769	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.001	T
SEPT12	124404	genome.wustl.edu	37	16	4835875	4835875	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr16:4835875C>T	ENST00000268231.8	-	4	570	c.307G>A	c.(307-309)Ggt>Agt	p.G103S	SMIM22_ENST00000589327.1_5'Flank|SEPT12_ENST00000396693.5_Missense_Mutation_p.G103S|SMIM22_ENST00000589721.1_5'Flank|SEPT12_ENST00000591861.1_5'UTR	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	103	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						AGCTTCACACCCTTCTCCTCT	0.572																																						dbGAP											0													80.0	77.0	78.0					16																	4835875		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.307G>A	16.37:g.4835875C>T	ENSP00000268231:p.Gly103Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6B0|Q1PBH0|Q96LL0	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_AIG1,pirsf_Septin	p.G103S	ENST00000268231.8	37	c.307	CCDS10522.1	16	.	.	.	.	.	.	.	.	.	.	C	20.5	3.994685	0.74703	.	.	ENSG00000140623	ENST00000396693;ENST00000268231	D;T	0.83335	-1.71;1.11	4.61	3.66	0.41972	.	0.049982	0.85682	N	0.000000	D	0.86460	0.5938	M	0.74467	2.265	0.58432	D	0.999991	P;P	0.47841	0.901;0.86	P;P	0.51999	0.559;0.687	D	0.87312	0.2312	10	0.72032	D	0.01	.	11.5385	0.50653	0.0:0.912:0.0:0.088	.	103;103	Q8IYM1-2;Q8IYM1	.;SEP12_HUMAN	S	103	ENSP00000379922:G103S;ENSP00000268231:G103S	ENSP00000268231:G103S	G	-	1	0	SEPT12	4775876	1.000000	0.71417	0.836000	0.33094	0.596000	0.36781	5.826000	0.69293	1.164000	0.42652	0.453000	0.30009	GGT	SEPT12	-	pfam_Cell_div_GTP-bd,pfam_AIG1,pirsf_Septin	ENSG00000140623		0.572	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT12	HGNC	protein_coding	OTTHUMT00000251645.2	65	0.00	0	C	NM_144605		4835875	4835875	-1	no_errors	ENST00000268231	ensembl	human	known	69_37n	missense	37	22.45	11	SNP	0.999	T
SEPT1	1731	genome.wustl.edu	37	16	30393472	30393472	+	Silent	SNP	G	G	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr16:30393472G>C	ENST00000571393.1	-	4	309	c.123C>G	c.(121-123)ctC>ctG	p.L41L	SEPT1_ENST00000605106.1_Silent_p.L46L|SEPT1_ENST00000321367.3_Silent_p.L88L|SEPT1_ENST00000570039.1_5'Flank			Q8WYJ6	SEPT1_HUMAN	septin 1	41	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			GGCTGTTGATGAGGGTGGATT	0.622																																						dbGAP											0													36.0	29.0	31.0					16																	30393472		2195	4300	6495	-	-	-	SO:0001819	synonymous_variant	0			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.123C>G	16.37:g.30393472G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Silent	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pirsf_Septin	p.L46	ENST00000571393.1	37	c.138		16																																																																																			SEPT1	-	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pirsf_Septin	ENSG00000180096		0.622	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	HGNC	protein_coding		41	0.00	0	G	NM_052838		30393472	30393472	-1	no_errors	ENST00000321367	ensembl	human	known	69_37n	silent	16	38.46	10	SNP	1.000	C
SLC38A2	54407	genome.wustl.edu	37	12	46754960	46754960	+	Silent	SNP	C	C	T			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr12:46754960C>T	ENST00000256689.5	-	16	1899	c.1455G>A	c.(1453-1455)gtG>gtA	p.V485V	SLC38A2_ENST00000551374.1_Silent_p.V323V	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	485					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		TTCCGGTCATCACCAGTACAC	0.408																																					Ovarian(9;448 492 8335 28722 40361)	dbGAP											0													97.0	83.0	87.0					12																	46754960		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.1455G>A	12.37:g.46754960C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Silent	SNP	pfam_AA_transpt_TM	p.V485	ENST00000256689.5	37	c.1455	CCDS8749.1	12																																																																																			SLC38A2	-	pfam_AA_transpt_TM	ENSG00000134294		0.408	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A2	HGNC	protein_coding	OTTHUMT00000404226.1	69	0.00	0	C			46754960	46754960	-1	no_errors	ENST00000256689	ensembl	human	known	69_37n	silent	44	31.25	20	SNP	1.000	T
SRRM1	10250	genome.wustl.edu	37	1	24972547	24972547	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr1:24972547G>A	ENST00000323848.9	+	2	409	c.94G>A	c.(94-96)Gaa>Aaa	p.E32K	SRRM1_ENST00000374389.4_Missense_Mutation_p.E32K|SRRM1_ENST00000537199.1_5'Flank|SRRM1_ENST00000447431.2_Missense_Mutation_p.E32K|SRRM1_ENST00000479034.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	32	Necessary for DNA and RNA-binding.|Necessary for mRNA 3'-end cleavage and cytoplasmic accumulation.|PWI. {ECO:0000255|PROSITE- ProRule:PRU00627}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GAAATTTGCAGAATGCCTAGA	0.408																																					Ovarian(68;897 1494 3282 17478)	dbGAP											0													108.0	106.0	107.0					1																	24972547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.94G>A	1.37:g.24972547G>A	ENSP00000326261:p.Glu32Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60585|Q5VVN4	Missense_Mutation	SNP	pfam_PWI,superfamily_PWI,smart_PWI	p.E32K	ENST00000323848.9	37	c.94	CCDS255.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531578	0.85706	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.44083	0.93;0.93;0.93	5.22	5.22	0.72569	Splicing factor PWI (3);	0.000000	0.64402	D	0.000004	T	0.54679	0.1873	L	0.28556	0.865	0.80722	D	1	D;D	0.57899	0.981;0.968	D;D	0.72075	0.976;0.947	T	0.55101	-0.8193	10	0.51188	T	0.08	.	19.1319	0.93412	0.0:0.0:1.0:0.0	.	32;32	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	K	32	ENSP00000326261:E32K;ENSP00000391430:E32K;ENSP00000363510:E32K	ENSP00000326261:E32K	E	+	1	0	SRRM1	24845134	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.785000	0.99042	2.599000	0.87857	0.655000	0.94253	GAA	SRRM1	-	superfamily_PWI	ENSG00000133226		0.408	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2	77	0.00	0	G	NM_005839		24972547	24972547	+1	no_errors	ENST00000447431	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	1.000	A
TRAPPC8	22878	genome.wustl.edu	37	18	29480941	29480941	+	Silent	SNP	T	T	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr18:29480941T>C	ENST00000283351.4	-	10	1772	c.1437A>G	c.(1435-1437)ccA>ccG	p.P479P	TRAPPC8_ENST00000582539.1_Silent_p.P425P|TRAPPC8_ENST00000582513.1_Silent_p.P479P	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	479					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAGCAGGATATGGCCTAGGTG	0.358																																						dbGAP											0													96.0	92.0	93.0					18																	29480941		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1437A>G	18.37:g.29480941T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP15|B3KME5|Q9H0L2	Silent	SNP	NULL	p.P479	ENST00000283351.4	37	c.1437	CCDS11901.1	18																																																																																			TRAPPC8	-	NULL	ENSG00000153339		0.358	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	78	0.00	0	T	NM_014939		29480941	29480941	-1	no_errors	ENST00000283351	ensembl	human	known	69_37n	silent	29	40.00	20	SNP	0.243	C
UBR4	23352	genome.wustl.edu	37	1	19518987	19518987	+	Silent	SNP	C	C	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr1:19518987C>A	ENST00000375254.3	-	10	1218	c.1191G>T	c.(1189-1191)cgG>cgT	p.R397R	UBR4_ENST00000375217.2_Silent_p.R397R|UBR4_ENST00000375267.2_Silent_p.R397R|UBR4_ENST00000375226.2_Silent_p.R397R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	397					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CACCACCAGCCCGGCGAGAAC	0.393																																						dbGAP											0													91.0	81.0	85.0					1																	19518987		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1191G>T	1.37:g.19518987C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R397	ENST00000375254.3	37	c.1191	CCDS189.1	1																																																																																			UBR4	-	NULL	ENSG00000127481		0.393	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	64	0.00	0	C	NM_020765		19518987	19518987	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	silent	9	57.14	12	SNP	1.000	A
ZNF106	64397	genome.wustl.edu	37	15	42743987	42743987	+	Silent	SNP	G	G	A			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr15:42743987G>A	ENST00000263805.4	-	2	740	c.414C>T	c.(412-414)ggC>ggT	p.G138G	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	138					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TATTATTAAAGCCATCTTTTT	0.488																																						dbGAP											0													111.0	102.0	105.0					15																	42743987		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.414C>T	15.37:g.42743987G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G138	ENST00000263805.4	37	c.414	CCDS32208.1	15																																																																																			ZFP106	-	NULL	ENSG00000103994		0.488	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP106	HGNC	protein_coding	OTTHUMT00000422587.1	70	0.00	0	G	NM_022473		42743987	42743987	-1	no_errors	ENST00000263805	ensembl	human	known	69_37n	silent	68	13.92	11	SNP	1.000	A
ZNF208	7757	genome.wustl.edu	37	19	22154320	22154320	+	Missense_Mutation	SNP	T	T	G	rs566600277		TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr19:22154320T>G	ENST00000397126.4	-	4	3664	c.3516A>C	c.(3514-3516)gaA>gaC	p.E1172D	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGCCACATTCTTCACATTTGT	0.373																																						dbGAP											0													32.0	35.0	34.0					19																	22154320		2090	4232	6322	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3516A>C	19.37:g.22154320T>G	ENSP00000380315:p.Glu1172Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E1172D	ENST00000397126.4	37	c.3516	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	10.89	1.477316	0.26511	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.16897	2.31	3.12	-6.25	0.02039	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05686	0.0149	.	.	.	0.09310	N	1	B	0.21071	0.051	B	0.14578	0.011	T	0.40924	-0.9537	8	0.09843	T	0.71	.	5.1197	0.14854	0.2018:0.3578:0.0:0.4403	.	1044	O43345	ZN208_HUMAN	D	1172;1044	ENSP00000380315:E1172D	ENSP00000380315:E1172D	E	-	3	2	ZNF208	21946160	0.000000	0.05858	0.000000	0.03702	0.700000	0.40528	-7.332000	0.00038	-1.410000	0.02035	0.254000	0.18369	GAA	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	16	0.00	0	T	NM_007153		22154320	22154320	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.000	G
ZNF780A	284323	genome.wustl.edu	37	19	40581727	40581727	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A25D-01A-12D-A16D-09	TCGA-A2-A25D-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	56b152c3-9de5-4b1c-b6b4-0116cb7ce097	a65719dd-2213-43c2-9f5b-1e82632009dc	g.chr19:40581727A>C	ENST00000595687.2	-	6	831	c.622T>G	c.(622-624)Ttt>Gtt	p.F208V	ZNF780A_ENST00000455521.1_Missense_Mutation_p.F209V|ZNF780A_ENST00000450241.2_Missense_Mutation_p.F174V|ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000340963.5_Missense_Mutation_p.F208V|ZNF780A_ENST00000594395.1_Missense_Mutation_p.F209V|AC005614.5_ENST00000595508.1_RNA	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGTCGAGTAAATTGTATGTGA	0.388																																						dbGAP											0													80.0	80.0	80.0					19																	40581727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.622T>G	19.37:g.40581727A>C	ENSP00000472189:p.Phe208Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PB48|Q6ZN87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F209V	ENST00000595687.2	37	c.625	CCDS33026.2	19	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399699	0.42512	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.18338	2.22;2.22	2.03	-1.63	0.08345	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12603	0.0306	L	0.37466	1.105	0.09310	N	1	B;B	0.17268	0.008;0.021	B;B	0.17433	0.018;0.016	T	0.30679	-0.9970	9	0.66056	D	0.02	.	7.0801	0.25227	0.3079:0.0:0.6921:0.0	.	209;208	E9PB48;O75290	.;Z780A_HUMAN	V	208;209;208	ENSP00000400997:F209V;ENSP00000341507:F208V	ENSP00000341507:F208V	F	-	1	0	ZNF780A	45273567	0.000000	0.05858	0.000000	0.03702	0.975000	0.68041	-0.333000	0.07894	-0.387000	0.07809	0.254000	0.18369	TTT	ZNF780A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197782		0.388	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF780A	HGNC	protein_coding	OTTHUMT00000470066.1	102	0.00	0	A	NM_001010880		40581727	40581727	-1	no_errors	ENST00000455521	ensembl	human	known	69_37n	missense	73	25.51	25	SNP	0.000	C
