#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD36C	400986	genome.wustl.edu	37	2	96624383	96624383	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr2:96624383G>A	ENST00000456556.1	-	12	1145	c.1061C>T	c.(1060-1062)tCg>tTg	p.S354L				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	354							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						GGCTGTGTTCGAAACAGAATC	0.323																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.1061C>T	2.37:g.96624383G>A	ENSP00000403302:p.Ser354Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S354L	ENST00000456556.1	37	c.1061		2	.	.	.	.	.	.	.	.	.	.	-	5.322	0.244696	0.10077	.	.	ENSG00000174501	ENST00000456556	T	0.80738	-1.41	0.856	0.856	0.19019	.	.	.	.	.	T	0.60586	0.2280	N	0.25332	0.735	0.09310	N	1	.	.	.	.	.	.	T	0.48186	-0.9057	7	0.05620	T	0.96	.	5.1513	0.15011	0.0:0.0:1.0:0.0	.	.	.	.	L	354	ENSP00000403302:S354L	ENSP00000403302:S354L	S	-	2	0	AC073995.2	95988110	0.001000	0.12720	0.012000	0.15200	0.003000	0.03518	0.454000	0.21827	0.776000	0.33473	0.430000	0.28490	TCG	ANKRD36C	-	NULL	ENSG00000174501		0.323	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	105	0.94	1	G	NM_001010914		96624383	96624383	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	101	33.99	52	SNP	0.018	A
ANKRD30BL	554226	genome.wustl.edu	37	2	133015299	133015299	+	5'UTR	SNP	C	C	T	rs79554046	byFrequency	TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr2:133015299C>T	ENST00000470729.1	-	0	243				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CCCGCAGAGGCGCTCAGGGAC	0.677																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1182G>A	2.37:g.133015299C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.677	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	36	0.00	0	C	NR_027019		133015299	133015299	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	27	17.65	6	SNP	0.007	T
ANKRD7	56311	genome.wustl.edu	37	7	117868028	117868028	+	Intron	SNP	G	G	A	rs567855021		TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr7:117868028G>A	ENST00000265224.4	+	1	334				ANKRD7_ENST00000417525.1_Intron|ANKRD7_ENST00000357099.4_Silent_p.P74P|ANKRD7_ENST00000433239.1_Intron|ANKRD7_ENST00000477532.1_Intron	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7						male gonad development (GO:0008584)	nucleus (GO:0005634)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						acaccactccgctgaatgact	0.328													g|||	1	0.000199681	0.0	0.0	5008	,	,		15638	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													71.0	64.0	66.0					7																	117868028		1820	4081	5901	-	-	-	SO:0001627	intron_variant	0			D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.179+2965G>A	7.37:g.117868028G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYF5|Q96QN1|Q9UDM3	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P74	ENST00000265224.4	37	c.222	CCDS43638.1	7																																																																																			ANKRD7	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000106013		0.328	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD7	HGNC	protein_coding	OTTHUMT00000346826.1	62	0.00	0	G	NM_001077708		117868028	117868028	+1	no_errors	ENST00000357099	ensembl	human	known	69_37n	silent	44	20.00	11	SNP	0.000	A
ARAP2	116984	genome.wustl.edu	37	4	36160390	36160390	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr4:36160390G>T	ENST00000303965.4	-	15	3203	c.2714C>A	c.(2713-2715)gCt>gAt	p.A905D		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	905	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTTAGAAGCAGCAGAAGGAGC	0.338																																						dbGAP											0													37.0	40.0	39.0					4																	36160390		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.2714C>A	4.37:g.36160390G>T	ENSP00000302895:p.Ala905Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.A905D	ENST00000303965.4	37	c.2714	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	G	10.85	1.468354	0.26335	.	.	ENSG00000047365	ENST00000303965	T	0.08370	3.1	6.17	4.14	0.48551	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.630629	0.16713	N	0.202568	T	0.05364	0.0142	L	0.29908	0.895	0.26632	N	0.972442	B	0.24317	0.101	B	0.22152	0.038	T	0.38650	-0.9651	10	0.12430	T	0.62	.	5.2477	0.15506	0.0785:0.2457:0.5338:0.142	.	905	Q8WZ64	ARAP2_HUMAN	D	905	ENSP00000302895:A905D	ENSP00000302895:A905D	A	-	2	0	ARAP2	35836785	0.969000	0.33509	0.983000	0.44433	0.598000	0.36846	1.061000	0.30542	1.612000	0.50221	0.655000	0.94253	GCT	ARAP2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000047365		0.338	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	HGNC	protein_coding	OTTHUMT00000215074.2	36	0.00	0	G	NM_015230		36160390	36160390	-1	no_errors	ENST00000303965	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.850	T
ATXN7	6314	genome.wustl.edu	37	3	63898572	63898572	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr3:63898572G>A	ENST00000295900.6	+	3	848	c.298G>A	c.(298-300)Gag>Aag	p.E100K	ATXN7_ENST00000538065.1_Missense_Mutation_p.E100K|ATXN7_ENST00000398590.3_Missense_Mutation_p.E100K|ATXN7_ENST00000487717.1_Missense_Mutation_p.E100K	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	100					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		TCTGTGGGTTGAGGCTTCCAA	0.687																																						dbGAP											0													55.0	60.0	58.0					3																	63898572		2026	4179	6205	-	-	-	SO:0001583	missense	0			AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.298G>A	3.37:g.63898572G>A	ENSP00000295900:p.Glu100Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	pfam_SCA7_dom	p.E100K	ENST00000295900.6	37	c.298	CCDS43102.1	3	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249151	0.80024	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000539129	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	4.16	4.16	0.48862	.	0.134986	0.48286	D	0.000189	T	0.36026	0.0952	L	0.54323	1.7	0.49915	D	0.999834	P;P	0.38922	0.557;0.651	B;B	0.39258	0.295;0.272	T	0.34775	-0.9815	10	0.59425	D	0.04	-8.9071	13.1243	0.59344	0.0:0.0:0.8394:0.1606	.	100;100	O15265-2;O15265	.;ATX7_HUMAN	K	100	ENSP00000381590:E100K;ENSP00000295900:E100K;ENSP00000420234:E100K;ENSP00000439585:E100K	ENSP00000295900:E100K	E	+	1	0	ATXN7	63873612	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	6.343000	0.72986	1.844000	0.53588	0.585000	0.79938	GAG	ATXN7	-	NULL	ENSG00000163635		0.687	ATXN7-001	KNOWN	basic|CCDS	protein_coding	ATXN7	HGNC	protein_coding	OTTHUMT00000352070.1	48	0.00	0	G	NM_000333		63898572	63898572	+1	no_errors	ENST00000398590	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	A
BORA	79866	genome.wustl.edu	37	13	73321197	73321197	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr13:73321197T>A	ENST00000390667.5	+	10	1527	c.1430T>A	c.(1429-1431)aTg>aAg	p.M477K	BORA_ENST00000377815.3_Missense_Mutation_p.M407K	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator	477					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)										CATATGTGCATGTCACCTCTT	0.423																																						dbGAP											0													216.0	200.0	205.0					13																	73321197		1919	4139	6058	-	-	-	SO:0001583	missense	0			BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.1430T>A	13.37:g.73321197T>A	ENSP00000375082:p.Met477Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Missense_Mutation	SNP	prints_Aurora_borealis_protien	p.M477K	ENST00000390667.5	37	c.1430	CCDS9446.1	13	.	.	.	.	.	.	.	.	.	.	T	20.7	4.030939	0.75504	.	.	ENSG00000136122	ENST00000377815;ENST00000390667	T;T	0.44881	0.91;0.91	5.7	5.7	0.88788	.	0.215999	0.56097	D	0.000029	T	0.53270	0.1786	M	0.63843	1.955	0.48511	D	0.999662	P;P;P;P	0.49559	0.779;0.874;0.925;0.874	B;P;P;P	0.50754	0.346;0.649;0.649;0.649	T	0.57980	-0.7717	10	0.87932	D	0	-10.8128	15.9662	0.79974	0.0:0.0:0.0:1.0	.	407;477;537;477	B4DQ30;A8K631;B5LMG6;Q6PGQ7	.;.;.;BORA_HUMAN	K	407;477	ENSP00000367046:M407K;ENSP00000375082:M477K	ENSP00000367046:M407K	M	+	2	0	BORA	72219198	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.745000	0.68672	2.170000	0.68504	0.533000	0.62120	ATG	BORA	-	NULL	ENSG00000136122		0.423	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BORA	HGNC	protein_coding	OTTHUMT00000045245.3	73	0.00	0	T	NM_024808		73321197	73321197	+1	no_errors	ENST00000390667	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	1.000	A
BUB3	9184	genome.wustl.edu	37	10	124917337	124917337	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr10:124917337G>C	ENST00000368865.4	+	4	567	c.358G>C	c.(358-360)Gtt>Ctt	p.V120L	BUB3_ENST00000538238.1_Missense_Mutation_p.V40L|BUB3_ENST00000368858.5_Missense_Mutation_p.V120L|BUB3_ENST00000368859.2_Missense_Mutation_p.V120L	NM_004725.3	NP_004716.1	O43684	BUB3_HUMAN	BUB3 mitotic checkpoint protein	120					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|regulation of chromosome segregation (GO:0051983)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly checkpoint (GO:0071173)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)				GGATCAGACAGTTAAACTGTG	0.448																																					GBM(161;1111 1985 17553 20049 26037)	dbGAP											0													114.0	111.0	112.0					10																	124917337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF053304	CCDS7635.1, CCDS31306.1	10q24	2013-01-17	2013-01-17		ENSG00000154473	ENSG00000154473		"""WD repeat domain containing"""	1151	protein-coding gene	gene with protein product		603719	"""BUB3 (budding uninhibited by benzimidazoles 3, yeast) homolog"", ""budding uninhibited by benzimidazoles 3 homolog (yeast)"""			9660858	Standard	NM_004725		Approved	BUB3L	uc001lhe.2	O43684	OTTHUMG00000019197	ENST00000368865.4:c.358G>C	10.37:g.124917337G>C	ENSP00000357858:p.Val120Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ42|B2R6E7|D3DRE9|O43685	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V120L	ENST00000368865.4	37	c.358	CCDS7635.1	10	.	.	.	.	.	.	.	.	.	.	G	14.95	2.686991	0.48097	.	.	ENSG00000154473	ENST00000368865;ENST00000538238;ENST00000368859;ENST00000368858;ENST00000407911	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.190160	0.45361	D	0.000372	T	0.51941	0.1704	L	0.35854	1.095	0.80722	D	1	B;B	0.24721	0.024;0.11	B;B	0.24269	0.052;0.052	T	0.51325	-0.8720	10	0.05525	T	0.97	-8.6997	20.0118	0.97458	0.0:0.0:1.0:0.0	.	120;120	O43684;O43684-2	BUB3_HUMAN;.	L	120;40;120;120;120	ENSP00000357858:V120L;ENSP00000444354:V40L;ENSP00000357852:V120L;ENSP00000357851:V120L;ENSP00000383941:V120L	ENSP00000357851:V120L	V	+	1	0	BUB3	124907327	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.742000	0.94016	0.650000	0.86243	GTT	BUB3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000154473		0.448	BUB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BUB3	HGNC	protein_coding	OTTHUMT00000050835.1	105	0.00	0	G			124917337	124917337	+1	no_errors	ENST00000368865	ensembl	human	known	69_37n	missense	82	24.77	27	SNP	1.000	C
CRABP1	1381	genome.wustl.edu	37	15	78632841	78632841	+	Splice_Site	SNP	G	G	C			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr15:78632841G>C	ENST00000299529.6	+	1	175		c.e1+1			NM_004378.2	NP_004369.1	P29762	RABP1_HUMAN	cellular retinoic acid binding protein 1						multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoic acid binding (GO:0001972)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			breast(1)|lung(4)|skin(1)	6					Alitretinoin(DB00523)|Tretinoin(DB00755)	AAGGCACTGGGTAAGCTGGTG	0.697																																					Ovarian(146;578 3231 38536)	dbGAP											0													22.0	21.0	21.0					15																	78632841		2194	4289	6483	-	-	-	SO:0001630	splice_region_variant	0				CCDS10301.1	15q24	2013-03-01	2001-11-28		ENSG00000166426	ENSG00000166426		"""Fatty acid binding protein family"""	2338	protein-coding gene	gene with protein product		180230	"""cellular retinoic acid-binding protein 1"""	RBP5		9154115	Standard	NM_004378		Approved	CRABP, CRABP-I, CRABPI	uc002bdp.2	P29762	OTTHUMG00000143862	ENST00000299529.6:c.70+1G>C	15.37:g.78632841G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IAY7|Q8WTV5	Splice_Site	SNP	-	e1+1	ENST00000299529.6	37	c.70+1	CCDS10301.1	15	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362093	0.61403	.	.	ENSG00000166426	ENST00000299529	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5974	0.76595	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CRABP1	76419896	1.000000	0.71417	0.999000	0.59377	0.649000	0.38597	8.801000	0.91905	1.861000	0.53984	0.563000	0.77884	.	CRABP1	-	-	ENSG00000166426		0.697	CRABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRABP1	HGNC	protein_coding	OTTHUMT00000290110.2	117	0	0	G	NM_004378	Intron	78632841	78632841	+1	no_errors	ENST00000299529	ensembl	human	known	69_37n	splice_site	55	24.66	18	SNP	1.000	C
CRABP1	1381	genome.wustl.edu	37	15	78632841	78632841	+	Splice_Site	SNP	G	G	C			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr15:78632841G>C	ENST00000299529.6	+	1	175		c.e1+1			NM_004378.2	NP_004369.1	P29762	RABP1_HUMAN	cellular retinoic acid binding protein 1						multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoic acid binding (GO:0001972)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			breast(1)|lung(4)|skin(1)	6					Alitretinoin(DB00523)|Tretinoin(DB00755)	AAGGCACTGGGTAAGCTGGTG	0.697																																					Ovarian(146;578 3231 38536)	dbGAP											0													22.0	21.0	21.0					15																	78632841		2194	4289	6483	-	-	-	SO:0001630	splice_region_variant	0				CCDS10301.1	15q24	2013-03-01	2001-11-28		ENSG00000166426	ENSG00000166426		"""Fatty acid binding protein family"""	2338	protein-coding gene	gene with protein product		180230	"""cellular retinoic acid-binding protein 1"""	RBP5		9154115	Standard	NM_004378		Approved	CRABP, CRABP-I, CRABPI	uc002bdp.2	P29762	OTTHUMG00000143862	ENST00000299529.6:c.70+1G>C	15.37:g.78632841G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IAY7|Q8WTV5	Splice_Site	SNP	-	e1+1	ENST00000299529.6	37	c.70+1	CCDS10301.1	15	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362093	0.61403	.	.	ENSG00000166426	ENST00000299529	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5974	0.76595	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CRABP1	76419896	1.000000	0.71417	0.999000	0.59377	0.649000	0.38597	8.801000	0.91905	1.861000	0.53984	0.563000	0.77884	.	CRABP1	-	-	ENSG00000166426		0.697	CRABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRABP1	HGNC	protein_coding	OTTHUMT00000290110.2	117	0.00	0	G	NM_004378	Intron	78632841	78632841	+1	no_errors	ENST00000299529	ensembl	human	known	69_37n	splice_site	55	24.66	18	SNP	1.000	C
PRR32	100130613	genome.wustl.edu	37	X	125955311	125955311	+	Silent	SNP	G	G	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chrX:125955311G>T	ENST00000371125.3	+	2	770	c.690G>T	c.(688-690)ccG>ccT	p.P230P		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		230	Pro-rich.																GGCCTATCCCGTTGTCTTCCA	0.502																																						dbGAP											0													189.0	132.0	150.0					X																	125955311		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000371125.3:c.690G>T	X.37:g.125955311G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.P230	ENST00000371125.3	37	c.690	CCDS48163.1	X																																																																																			CXorf64	-	NULL	ENSG00000183631		0.502	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf64	HGNC	protein_coding	OTTHUMT00000058188.1	123	0.00	0	G			125955311	125955311	+1	no_errors	ENST00000371125	ensembl	human	known	69_37n	silent	74	16.85	15	SNP	0.000	T
DYSF	8291	genome.wustl.edu	37	2	71891438	71891438	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr2:71891438C>G	ENST00000258104.3	+	45	5204	c.4927C>G	c.(4927-4929)Cta>Gta	p.L1643V	DYSF_ENST00000410041.1_Missense_Mutation_p.L1661V|DYSF_ENST00000410020.3_Missense_Mutation_p.L1682V|DYSF_ENST00000413539.2_Missense_Mutation_p.L1674V|DYSF_ENST00000394120.2_Missense_Mutation_p.L1644V|DYSF_ENST00000409582.3_Missense_Mutation_p.L1681V|DYSF_ENST00000409651.1_Missense_Mutation_p.L1675V|DYSF_ENST00000409366.1_Missense_Mutation_p.L1665V|DYSF_ENST00000409762.1_Missense_Mutation_p.L1660V|DYSF_ENST00000429174.2_Missense_Mutation_p.L1664V|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409744.1_Missense_Mutation_p.L1651V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1643	C2 6. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGAGAAGGACCTAAAGATCAC	0.577																																						dbGAP											0													105.0	87.0	93.0					2																	71891438		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4927C>G	2.37:g.71891438C>G	ENSP00000258104:p.Leu1643Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_MFS_dom_general_subst_transpt,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.L1674V	ENST00000258104.3	37	c.5020	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073303	0.76415	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13	5.13	4.24	0.50183	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	M	0.84773	2.715	0.52099	D	0.999944	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.997;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.999;1.0;1.0;1.0;0.999;0.999;0.996;0.983;0.999;0.999;0.999	T	0.79766	-0.1665	10	0.72032	D	0.01	-14.5172	11.8068	0.52161	0.0:0.9122:0.0:0.0878	.	407;1675;1682;1665;1630;1661;1651;1660;1650;1674;1681;1664;1629;1644;1643	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	V	1674;1660;1681;1664;1643;1675;1644;1651;1665;1682;1661	ENSP00000407046:L1674V;ENSP00000387137:L1660V;ENSP00000386547:L1681V;ENSP00000398305:L1664V;ENSP00000258104:L1643V;ENSP00000386683:L1675V;ENSP00000377678:L1644V;ENSP00000386285:L1651V;ENSP00000386512:L1665V;ENSP00000386881:L1682V;ENSP00000386617:L1661V	ENSP00000258104:L1643V	L	+	1	2	DYSF	71744946	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.357000	0.52277	1.129000	0.42072	0.561000	0.74099	CTA	DYSF	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000135636		0.577	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	56	0.00	0	C	NM_003494		71891438	71891438	+1	no_errors	ENST00000413539	ensembl	human	known	69_37n	missense	32	31.91	15	SNP	1.000	G
ENAH	55740	genome.wustl.edu	37	1	225707103	225707103	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr1:225707103C>G	ENST00000366844.3	-	5	1050	c.599G>C	c.(598-600)cGg>cCg	p.R200P	ENAH_ENST00000366843.2_Missense_Mutation_p.R200P|ENAH_ENST00000391874.2_5'UTR|ENAH_ENST00000284563.6_Missense_Mutation_p.R219P	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	200	9 X 5 AA tandem repeats of [LMQ]-E-[QR]- E-[QR].				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)			NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		gcgttcctgccgttccCGTTC	0.582																																						dbGAP											0													72.0	64.0	67.0					1																	225707103		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.599G>C	1.37:g.225707103C>G	ENSP00000355809:p.Arg200Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Missense_Mutation	SNP	pfam_EVH1,pfam_VASP_tetra,smart_EVH1,pfscan_EVH1	p.R200P	ENST00000366844.3	37	c.599	CCDS31041.1	1	.	.	.	.	.	.	.	.	.	.	-	21.8	4.207170	0.79127	.	.	ENSG00000154380	ENST00000366844;ENST00000366843;ENST00000284563;ENST00000538194	T;T;T	0.46063	0.88;0.88;0.88	4.99	2.58	0.30949	.	0.000000	0.49916	D	0.000135	T	0.35537	0.0935	L	0.42245	1.32	0.21445	N	0.999686	P;P	0.46142	0.873;0.799	B;B	0.42882	0.401;0.226	T	0.14282	-1.0478	10	0.46703	T	0.11	.	10.6015	0.45369	0.0:0.8342:0.0:0.1658	.	200;200	Q8N8S7-2;Q8N8S7	.;ENAH_HUMAN	P	200;200;219;199	ENSP00000355809:R200P;ENSP00000355808:R200P;ENSP00000284563:R219P	ENSP00000284563:R219P	R	-	2	0	ENAH	223773726	0.969000	0.33509	0.003000	0.11579	0.990000	0.78478	2.580000	0.46068	0.343000	0.23821	0.650000	0.86243	CGG	ENAH	-	NULL	ENSG00000154380		0.582	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENAH	HGNC	protein_coding	OTTHUMT00000357426.2	179	0.00	0	C	NM_018212		225707103	225707103	-1	no_errors	ENST00000366844	ensembl	human	known	69_37n	missense	269	10.63	32	SNP	0.457	G
FAM19A4	151647	genome.wustl.edu	37	3	68788351	68788351	+	Splice_Site	SNP	C	C	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr3:68788351C>A	ENST00000295569.7	-	5	779		c.e5-1			NM_001005527.2|NM_182522.4	NP_001005527.1|NP_872328.1	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A4							extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(5)|skin(2)	10		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		ACAATGGAAGCTGGAAAACAA	0.403																																						dbGAP											0													132.0	117.0	122.0					3																	68788351		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY325117	CCDS2907.1	3p14.1	2014-08-14			ENSG00000163377	ENSG00000163377			21591	protein-coding gene	gene with protein product						15028294, 25109685	Standard	NM_182522		Approved	TAFA-4	uc021xah.1	Q96LR4	OTTHUMG00000158744	ENST00000295569.7:c.287-1G>T	3.37:g.68788351C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVT2	Splice_Site	SNP	-	e4-1	ENST00000295569.7	37	c.287-1	CCDS2907.1	3	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647590	0.87958	.	.	ENSG00000163377	ENST00000295569	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6763	0.95934	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM19A4	68871041	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.776000	0.85560	2.725000	0.93324	0.460000	0.39030	.	FAM19A4	-	-	ENSG00000163377		0.403	FAM19A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM19A4	HGNC	protein_coding	OTTHUMT00000352002.1	90	0.00	0	C	NM_182522	Intron	68788351	68788351	-1	no_errors	ENST00000295569	ensembl	human	known	69_37n	splice_site	56	18.84	13	SNP	1.000	A
GEN1	348654	genome.wustl.edu	37	2	17941357	17941357	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr2:17941357G>A	ENST00000381254.2	+	2	361	c.147G>A	c.(145-147)atG>atA	p.M49I	SMC6_ENST00000402989.1_Intron|GEN1_ENST00000317402.7_Missense_Mutation_p.M49I	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	49	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GCAGCGTCATGAAGCCCCACC	0.403								Homologous recombination																														dbGAP											0													86.0	84.0	85.0					2																	17941357		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.147G>A	2.37:g.17941357G>A	ENSP00000370653:p.Met49Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RS9|Q6ZN37	Missense_Mutation	SNP	pfam_XPG/RAD2_endonuclease,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.M49I	ENST00000381254.2	37	c.147	CCDS1691.1	2	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369755	0.24771	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000524465;ENST00000532257	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	5.48	4.58	0.56647	XPG N-terminal (2);	1.353330	0.04548	N	0.389306	T	0.50069	0.1594	N	0.17800	0.525	0.23747	N	0.996958	B	0.13145	0.007	B	0.17979	0.02	T	0.24728	-1.0152	10	0.42905	T	0.14	-14.4781	8.2606	0.31781	0.0894:0.2816:0.6289:0.0	.	49	Q17RS7	GEN_HUMAN	I	49	ENSP00000318977:M49I;ENSP00000370653:M49I;ENSP00000435143:M49I;ENSP00000433180:M49I	ENSP00000318977:M49I	M	+	3	0	GEN1	17804838	0.007000	0.16637	0.974000	0.42286	0.630000	0.37929	0.120000	0.15647	2.861000	0.98227	0.650000	0.86243	ATG	GEN1	-	pfam_XPG_DNA_repair_N,smart_XPG_DNA_repair_N	ENSG00000178295		0.403	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GEN1	HGNC	protein_coding	OTTHUMT00000241661.2	79	0.00	0	G	NM_182625		17941357	17941357	+1	no_errors	ENST00000317402	ensembl	human	known	69_37n	missense	57	14.93	10	SNP	0.953	A
HTR2C	3358	genome.wustl.edu	37	X	114141666	114141666	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chrX:114141666G>T	ENST00000276198.1	+	6	1793	c.1065G>T	c.(1063-1065)tgG>tgT	p.W355C	HTR2C_ENST00000371951.1_Missense_Mutation_p.W355C|HTR2C_ENST00000371950.3_3'UTR	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	355					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TGTTTGTTTGGATTGGCTATG	0.383																																						dbGAP											0													167.0	155.0	159.0					X																	114141666		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.1065G>T	X.37:g.114141666G>T	ENSP00000276198:p.Trp355Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT2C_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.W355C	ENST00000276198.1	37	c.1065	CCDS14564.1	X	.	.	.	.	.	.	.	.	.	.	G	15.93	2.976935	0.53720	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.73789	-0.78;-0.78	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.074989	0.56097	D	0.000026	D	0.89983	0.6873	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92913	0.6349	10	0.87932	D	0	.	14.9487	0.71054	0.0:0.0:1.0:0.0	.	355	P28335	5HT2C_HUMAN	C	355	ENSP00000276198:W355C;ENSP00000361019:W355C	ENSP00000276198:W355C	W	+	3	0	HTR2C	114047922	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	9.790000	0.99075	2.204000	0.70986	0.468000	0.43344	TGG	HTR2C	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000147246		0.383	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2C	HGNC	protein_coding	OTTHUMT00000057962.1	62	0.00	0	G	NM_000868		114141666	114141666	+1	no_errors	ENST00000276198	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	1.000	T
INTS4L2	644619	genome.wustl.edu	37	7	65150713	65150714	+	RNA	INS	-	-	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr7:65150713_65150714insA	ENST00000430126.2	+	0	694_695							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		CATACCATGAGAAAATCTCTAA	0.436																																						dbGAP											0																																										-	-	-			0			BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65150717_65150717dupA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000430126.2	37	NULL		7																																																																																			INTS4L2	-	-	ENSG00000232270		0.436	INTS4L2-002	KNOWN	basic	processed_transcript	INTS4L2	HGNC	pseudogene	OTTHUMT00000345545.2	8	0.00	0	-	NR_027392		65150713	65150714	+1	no_errors	ENST00000430126	ensembl	human	known	69_37n	rna	3	57.14	4	INS	1.000:0.995	A
KIAA0196	9897	genome.wustl.edu	37	8	126073417	126073417	+	Silent	SNP	G	G	A	rs376926891		TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr8:126073417G>A	ENST00000318410.7	-	12	1777	c.1428C>T	c.(1426-1428)ttC>ttT	p.F476F	KIAA0196_ENST00000517845.1_Silent_p.F328F	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	476					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			AGATCTCTCTGAACCAAGCTT	0.333																																						dbGAP											0													49.0	47.0	48.0					8																	126073417		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1428C>T	8.37:g.126073417G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	pfam_WASH_strumpellin	p.S93L	ENST00000318410.7	37	c.278	CCDS6355.1	8	.	.	.	.	.	.	.	.	.	.	G	9.519	1.107715	0.20714	.	.	ENSG00000164961	ENST00000523273	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	T	0.74943	0.3783	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73649	-0.3916	4	.	.	.	-21.0069	19.066	0.93110	0.0:0.0:1.0:0.0	.	.	.	.	L	93	.	.	S	-	2	0	KIAA0196	126142599	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.716000	0.68437	2.573000	0.86826	0.563000	0.77884	TCA	KIAA0196	-	pfam_WASH_strumpellin	ENSG00000164961		0.333	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0196	HGNC	protein_coding	OTTHUMT00000381369.1	28	0.00	0	G	NM_014846		126073417	126073417	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000523273	ensembl	human	putative	69_37n	missense	24	63.08	41	SNP	1.000	A
KIAA1024	23251	genome.wustl.edu	37	15	79750273	79750273	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr15:79750273G>C	ENST00000305428.3	+	2	1859	c.1784G>C	c.(1783-1785)aGt>aCt	p.S595T		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	595						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CTGAAGACCAGTGTGTGCAAA	0.517																																						dbGAP											0													75.0	70.0	72.0					15																	79750273		2196	4293	6489	-	-	-	SO:0001583	missense	0			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1784G>C	15.37:g.79750273G>C	ENSP00000307461:p.Ser595Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD43	Missense_Mutation	SNP	pfam_UPF0258	p.S595T	ENST00000305428.3	37	c.1784	CCDS32306.1	15	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484671	0.84854	.	.	ENSG00000169330	ENST00000305428	T	0.52526	0.66	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.69324	0.3098	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.67806	-0.5575	9	.	.	.	.	19.5936	0.95526	0.0:0.0:1.0:0.0	.	595	Q9UPX6	K1024_HUMAN	T	595	ENSP00000307461:S595T	.	S	+	2	0	KIAA1024	77537328	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	9.353000	0.97080	2.627000	0.88993	0.591000	0.81541	AGT	KIAA1024	-	NULL	ENSG00000169330		0.517	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1024	HGNC	protein_coding	OTTHUMT00000416718.1	45	0.00	0	G	NM_015206		79750273	79750273	+1	no_errors	ENST00000305428	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	C
LINC00326	285735	genome.wustl.edu	37	6	133427343	133427343	+	lincRNA	SNP	T	T	G			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr6:133427343T>G	ENST00000457339.1	+	0	2141									long intergenic non-protein coding RNA 326																		CGAAGAAGTTTTTTACAATGA	0.423																																						dbGAP											0													103.0	86.0	91.0					6																	133427343		692	1591	2283	-	-	-			0					6q23.2	2012-10-12	2011-08-10	2011-08-10	ENSG00000231023	ENSG00000231023		"""Long non-coding RNAs"""	41926	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 326"""	NCRNA00326			Standard	NR_026969		Approved		uc003qdz.3		OTTHUMG00000015597		6.37:g.133427343T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000457339.1	37	NULL		6																																																																																			LINC00326	-	-	ENSG00000231023		0.423	LINC00326-002	KNOWN	basic	lincRNA	LINC00326	HGNC	lincRNA	OTTHUMT00000317882.1	41	0.00	0	T	NR_026969		133427343	133427343	+1	no_errors	ENST00000457339	ensembl	human	known	69_37n	rna	62	20.51	16	SNP	0.000	G
MUC16	94025	genome.wustl.edu	37	19	9027223	9027223	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr19:9027223G>T	ENST00000397910.4	-	13	36866	c.36663C>A	c.(36661-36663)agC>agA	p.S12221R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12223					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TACTCGTGGGGCTGGGGCTGG	0.473																																						dbGAP											0													59.0	58.0	58.0					19																	9027223		1917	4127	6044	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36663C>A	19.37:g.9027223G>T	ENSP00000381008:p.Ser12221Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S12221R	ENST00000397910.4	37	c.36663	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	7.255	0.604049	0.14002	.	.	ENSG00000181143	ENST00000397910	T	0.02916	4.11	1.39	-2.09	0.07232	.	.	.	.	.	T	0.04452	0.0122	M	0.75264	2.295	.	.	.	B	0.23540	0.087	B	0.21546	0.035	T	0.15665	-1.0429	8	0.87932	D	0	.	6.6064	0.22727	0.0:0.5959:0.4041:0.0	.	12221	B5ME49	.	R	12221	ENSP00000381008:S12221R	ENSP00000381008:S12221R	S	-	3	2	MUC16	8888223	0.000000	0.05858	0.002000	0.10522	0.470000	0.32858	-0.660000	0.05317	-0.395000	0.07715	0.196000	0.17591	AGC	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	77	0.00	0	G	NM_024690		9027223	9027223	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	48	22.58	14	SNP	0.003	T
NLRP4	147945	genome.wustl.edu	37	19	56370215	56370215	+	Missense_Mutation	SNP	G	G	T	rs200294507		TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr19:56370215G>T	ENST00000301295.6	+	3	1878	c.1456G>T	c.(1456-1458)Gcc>Tcc	p.A486S	NLRP4_ENST00000346986.5_Missense_Mutation_p.A486S|NLRP4_ENST00000587891.1_Missense_Mutation_p.A411S	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	486					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		ATTGCTAGTTGCCAATTTTGA	0.418																																						dbGAP											0													133.0	137.0	135.0					19																	56370215		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1456G>T	19.37:g.56370215G>T	ENSP00000301295:p.Ala486Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W87|Q96AY6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A486S	ENST00000301295.6	37	c.1456	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	G	4.280	0.051186	0.08243	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.83075	-1.68;-1.68	4.24	-4.05	0.03998	.	.	.	.	.	T	0.58466	0.2124	N	0.11698	0.16	0.09310	N	1	B;B;B	0.25105	0.118;0.029;0.009	B;B;B	0.28232	0.087;0.013;0.005	T	0.51779	-0.8662	9	0.09843	T	0.71	.	1.2001	0.01883	0.265:0.301:0.2869:0.1471	.	486;411;486	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	S	486	ENSP00000301295:A486S;ENSP00000344787:A486S	ENSP00000301295:A486S	A	+	1	0	NLRP4	61062027	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.172000	0.03112	-0.721000	0.04929	-1.105000	0.02106	GCC	NLRP4	-	NULL	ENSG00000160505		0.418	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	57	0.00	0	G	NM_134444		56370215	56370215	+1	no_errors	ENST00000301295	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	0.000	T
OR5K4	403278	genome.wustl.edu	37	3	98072873	98072873	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr3:98072873T>A	ENST00000354924.2	+	1	176	c.176T>A	c.(175-177)aTg>aAg	p.M59K	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						CTCACACCAATGTACATCTTT	0.448																																						dbGAP											0													305.0	298.0	301.0					3																	98072873		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.176T>A	3.37:g.98072873T>A	ENSP00000347003:p.Met59Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.M59K	ENST00000354924.2	37	c.176	CCDS33802.1	3	.	.	.	.	.	.	.	.	.	.	T	22.7	4.322717	0.81580	.	.	ENSG00000196098	ENST00000354924	T	0.09911	2.93	4.63	4.63	0.57726	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39274	U	0.001416	T	0.42810	0.1219	H	0.97707	4.06	0.46416	D	0.999033	D	0.60575	0.988	P	0.59825	0.864	T	0.61783	-0.6992	10	0.87932	D	0	-53.9794	12.2978	0.54859	0.0:0.0:0.0:1.0	.	59	A6NMS3	OR5K4_HUMAN	K	59	ENSP00000347003:M59K	ENSP00000347003:M59K	M	+	2	0	OR5K4	99555563	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	2.637000	0.46553	2.061000	0.61500	0.413000	0.27773	ATG	OR5K4	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196098		0.448	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K4	HGNC	protein_coding	OTTHUMT00000359114.1	93	0.00	0	T			98072873	98072873	+1	no_errors	ENST00000354924	ensembl	human	known	69_37n	missense	38	55.81	48	SNP	1.000	A
OTOA	146183	genome.wustl.edu	37	16	21771829	21771830	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C|T	C|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr16:21771829_21771830CT>TG	ENST00000286149.4	+	28	3431_3432	c.3430_3431CT>TG	c.(3430-3432)CTg>TGg	p.L1144W	OTOA_ENST00000388958.3_Missense_Mutation_p.L1130W|OTOA_ENST00000388956.4_Missense_Mutation_p.L1051W|OTOA_ENST00000388957.3_Missense_Mutation_p.L806W			Q7RTW8	OTOAN_HUMAN	otoancorin	1144					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TGGTTGTCCCCTGCTGGTTCTA	0.525																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	Exception_encountered	16.37:g.21771829_21771830delinsTG	ENSP00000286149:p.Leu1144Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Silent|Missense_Mutation	SNP	NULL	p.L1144|p.L1144R	ENST00000286149.4	37	c.3430|c.3431		16																																																																																			OTOA	-	NULL	ENSG00000155719		0.525	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	125	0.00	0	C|T			21771829|21771830	21771829|21771830	+1	no_errors	ENST00000286149	ensembl	human	known	69_37n	silent|missense	98|97	28.99|28.68	40|39	SNP	0.750|0.836	T|G
PCDHB12	56124	genome.wustl.edu	37	5	140590534	140590534	+	Silent	SNP	G	G	A	rs543195348		TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr5:140590534G>A	ENST00000239450.2	+	1	2244	c.2055G>A	c.(2053-2055)tcG>tcA	p.S685S	PCDHB13_ENST00000341948.4_5'Flank|PCDHB12_ENST00000541609.1_Silent_p.S348S	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	685					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S685S(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCCGACTCGCTCACTGTCT	0.701																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											70.0	75.0	74.0					5																	140590534		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.2055G>A	5.37:g.140590534G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S685	ENST00000239450.2	37	c.2055	CCDS4254.1	5																																																																																			PCDHB12	-	NULL	ENSG00000120328		0.701	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	216	0.00	0	G	NM_018932		140590534	140590534	+1	no_errors	ENST00000239450	ensembl	human	known	69_37n	silent	100	35.90	56	SNP	0.012	A
CFAP221	200373	genome.wustl.edu	37	2	120303820	120303820	+	Missense_Mutation	SNP	A	A	T	rs2579624	byFrequency	TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr2:120303820A>T	ENST00000413369.3	+	2	200	c.113A>T	c.(112-114)gAa>gTa	p.E38V	PCDP1_ENST00000598644.1_Missense_Mutation_p.E38V|PCDP1_ENST00000602047.1_De_novo_Start_InFrame	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					AAAAGAAAAGAAGTACCTAAT	0.433													A|||	2959	0.590855	0.5794	0.5533	5008	,	,		17439	0.7272		0.508	False		,,,				2504	0.5777					dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000413369.3:c.113A>T	2.37:g.120303820A>T	ENSP00000393222:p.Glu38Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E38V	ENST00000413369.3	37	c.113	CCDS33282.2	2	1265	0.5792124542124543	292	0.5934959349593496	180	0.4972375690607735	414	0.7237762237762237	379	0.5	A	13.77	2.337382	0.41398	.	.	ENSG00000163075	ENST00000413369;ENST00000442513	T;T	0.17213	2.29;2.29	4.8	3.62	0.41486	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.40933	P	0.01559900000000003	.	.	.	.	.	.	T	0.04153	-1.0973	5	0.34782	T	0.22	.	8.6929	0.34278	0.8074:0.1926:0.0:0.0	rs2579624;rs61055493;rs2579624	.	.	.	V	38	ENSP00000393222:E38V;ENSP00000409912:E38V	ENSP00000393222:E38V	E	+	2	0	AC069154.2	120020290	0.007000	0.16637	0.995000	0.50966	0.801000	0.45260	0.097000	0.15168	0.945000	0.37605	0.533000	0.62120	GAA	AC069154.2	-	NULL	ENSG00000163075		0.433	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCDP1	Clone_based_vega_gene	protein_coding	OTTHUMT00000464236.1	12	0.00	0	A			120303820	120303820	+1	no_errors	ENST00000413369	ensembl	human	known	69_37n	missense	5	54.55	6	SNP	0.996	T
PDCD11	22984	genome.wustl.edu	37	10	105173781	105173781	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr10:105173781A>G	ENST00000369797.3	+	10	1338	c.1244A>G	c.(1243-1245)aAc>aGc	p.N415S		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	415	S1 motif 4. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AAGCCAGGGAACACTCACAAG	0.463																																						dbGAP											0													131.0	116.0	121.0					10																	105173781		2203	4300	6503	-	-	-	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1244A>G	10.37:g.105173781A>G	ENSP00000358812:p.Asn415Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.N415S	ENST00000369797.3	37	c.1244	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	A	10.98	1.505508	0.26949	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.16073	2.37	5.55	4.42	0.53409	Nucleic acid-binding, OB-fold-like (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.299895	0.39544	N	0.001334	T	0.06280	0.0162	N	0.04746	-0.17	0.19300	N	0.999971	B	0.06786	0.001	B	0.04013	0.001	T	0.41233	-0.9520	10	0.02654	T	1	-22.3636	7.4167	0.27048	0.8127:0.0:0.1873:0.0	.	415	Q14690	RRP5_HUMAN	S	415	ENSP00000358812:N415S	ENSP00000358812:N415S	N	+	2	0	PDCD11	105163771	0.996000	0.38824	1.000000	0.80357	0.950000	0.60333	1.075000	0.30716	0.962000	0.38057	0.459000	0.35465	AAC	PDCD11	-	superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.463	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	95	0.00	0	A			105173781	105173781	+1	no_errors	ENST00000369797	ensembl	human	known	69_37n	missense	62	36.73	36	SNP	0.689	G
PI16	221476	genome.wustl.edu	37	6	36930968	36930968	+	Missense_Mutation	SNP	G	G	A	rs199875004		TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr6:36930968G>A	ENST00000373674.3	+	5	1178	c.850G>A	c.(850-852)Gta>Ata	p.V284I	PI16_ENST00000491324.1_Intron	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	284					negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)	p.V284I(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCCACCTTGCGTAACAACTGA	0.567																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											86.0	71.0	76.0					6																	36930968		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.850G>A	6.37:g.36930968G>A	ENSP00000362778:p.Val284Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.V284I	ENST00000373674.3	37	c.850	CCDS34440.1	6	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235618	0.22626	.	.	ENSG00000164530	ENST00000373674;ENST00000539035	T	0.06933	3.24	5.8	-7.55	0.01327	.	1.505140	0.04117	N	0.315674	T	0.00875	0.0029	N	0.08118	0	0.09310	N	0.999999	B	0.30211	0.273	B	0.17722	0.019	T	0.41052	-0.9530	10	0.66056	D	0.02	.	1.6949	0.02859	0.1826:0.2985:0.3241:0.1948	.	284	Q6UXB8	PI16_HUMAN	I	284;136	ENSP00000362778:V284I	ENSP00000362778:V284I	V	+	1	0	PI16	37038946	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.569000	0.05902	-1.245000	0.02513	-0.127000	0.14921	GTA	PI16	-	NULL	ENSG00000164530		0.567	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI16	HGNC	protein_coding	OTTHUMT00000040380.1	84	0.00	0	G	NM_153370		36930968	36930968	+1	no_errors	ENST00000373674	ensembl	human	known	69_37n	missense	91	19.47	22	SNP	0.000	A
PPM1N	147699	genome.wustl.edu	37	19	46002919	46002919	+	Intron	SNP	G	G	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr19:46002919G>T	ENST00000451287.2	+	1	939				PPM1N_ENST00000324688.4_Missense_Mutation_p.G319W|PPM1N_ENST00000396736.2_5'Flank|RTN2_ENST00000590526.1_5'Flank|RTN2_ENST00000344680.4_5'Flank|PPM1N_ENST00000396735.2_5'UTR|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000589384.1_5'Flank|RTN2_ENST00000245923.4_5'Flank|PPM1N_ENST00000396737.2_Intron|PPM1N_ENST00000456399.2_Intron|PPM1N_ENST00000401593.1_5'Flank	NM_001080401.1	NP_001073870.1	Q8N819	PPM1N_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)								magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)	9						TTTTGGAAAGGGGCGATTCTG	0.562																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK097444	CCDS46115.1	19q13.32	2012-04-17			ENSG00000213889	ENSG00000213889		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26845	protein-coding gene	gene with protein product							Standard	NM_001080401		Approved	FLJ40125	uc002pce.3	Q8N819	OTTHUMG00000140397	ENST00000451287.2:c.939+250G>T	19.37:g.46002919G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P662	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.G319W	ENST00000451287.2	37	c.955	CCDS46115.1	19	.	.	.	.	.	.	.	.	.	.	G	13.25	2.180389	0.38511	.	.	ENSG00000213889	ENST00000324688	T	0.42131	0.98	2.66	1.56	0.23342	.	.	.	.	.	T	0.40423	0.1116	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35450	-0.9788	6	0.87932	D	0	.	6.575	0.22560	0.0:0.0:0.7145:0.2855	.	.	.	.	W	319	ENSP00000321761:G319W	ENSP00000321761:G319W	G	+	1	0	PPM1N	50694759	0.000000	0.05858	0.006000	0.13384	0.011000	0.07611	-0.254000	0.08781	0.642000	0.30620	0.467000	0.42956	GGG	PPM1N	-	NULL	ENSG00000213889		0.562	PPM1N-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PPM1N	HGNC	protein_coding	OTTHUMT00000326517.2	93	0.00	0	G	NM_001080401		46002919	46002919	+1	no_errors	ENST00000324688	ensembl	human	known	69_37n	missense	96	18.64	22	SNP	0.006	T
PRPF31	26121	genome.wustl.edu	37	19	54627965	54627965	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr19:54627965T>A	ENST00000321030.4	+	8	1134	c.785T>A	c.(784-786)tTc>tAc	p.F262Y	PRPF31_ENST00000391755.1_Missense_Mutation_p.F262Y|AC012314.8_ENST00000452097.1_RNA|PRPF31_ENST00000419967.1_Missense_Mutation_p.F262Y|PRPF31_ENST00000498612.1_3'UTR	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	262	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTGTCGGGCTTCTCGTCTACC	0.667																																						dbGAP											0													84.0	70.0	75.0					19																	54627965		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.785T>A	19.37:g.54627965T>A	ENSP00000324122:p.Phe262Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Missense_Mutation	SNP	pfam_SnoRNA-bd_dom,pfam_Prp31_C,pfam_NOSIC,smart_NOSIC	p.F262Y	ENST00000321030.4	37	c.785	CCDS12879.1	19	.	.	.	.	.	.	.	.	.	.	T	19.68	3.871941	0.72180	.	.	ENSG00000105618	ENST00000321030;ENST00000445811;ENST00000263436;ENST00000419967;ENST00000445124;ENST00000391755	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	4.81	4.81	0.61882	Pre-mRNA processing ribonucleoprotein, snoRNA-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.80854	0.4703	M	0.89904	3.07	0.80722	D	1	D;D	0.67145	0.996;0.972	D;D	0.63957	0.92;0.914	D	0.85399	0.1130	10	0.87932	D	0	-28.1058	14.0213	0.64558	0.0:0.0:0.0:1.0	.	262;262	E7ESA8;Q8WWY3	.;PRP31_HUMAN	Y	262	ENSP00000324122:F262Y;ENSP00000395894:F262Y;ENSP00000405166:F262Y;ENSP00000408980:F262Y;ENSP00000375635:F262Y	ENSP00000263436:F262Y	F	+	2	0	PRPF31	59319777	1.000000	0.71417	1.000000	0.80357	0.154000	0.21943	7.083000	0.76859	2.102000	0.63906	0.459000	0.35465	TTC	PRPF31	-	pfam_SnoRNA-bd_dom	ENSG00000105618		0.667	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF31	HGNC	protein_coding	OTTHUMT00000141417.2	176	0.00	0	T			54627965	54627965	+1	no_errors	ENST00000321030	ensembl	human	known	69_37n	missense	52	39.53	34	SNP	1.000	A
PTPRT	11122	genome.wustl.edu	37	20	41306714	41306714	+	Silent	SNP	G	G	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr20:41306714G>A	ENST00000373187.1	-	7	944	c.945C>T	c.(943-945)atC>atT	p.I315I	PTPRT_ENST00000356100.2_Silent_p.I315I|PTPRT_ENST00000373201.1_Silent_p.I315I|PTPRT_ENST00000373184.1_Silent_p.I315I|PTPRT_ENST00000373190.1_Silent_p.I315I|PTPRT_ENST00000373198.4_Silent_p.I315I|PTPRT_ENST00000373193.3_Silent_p.I315I			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	315	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGCCATCCCCGATGATGGAGT	0.572																																						dbGAP											0													101.0	104.0	103.0					20																	41306714		2017	4191	6208	-	-	-	SO:0001819	synonymous_variant	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.945C>T	20.37:g.41306714G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.I315	ENST00000373187.1	37	c.945	CCDS42874.1	20																																																																																			PTPRT	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196090		0.572	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	116	0.00	0	G			41306714	41306714	-1	no_errors	ENST00000373198	ensembl	human	known	69_37n	silent	103	15.57	19	SNP	0.209	A
REXO1	57455	genome.wustl.edu	37	19	1827048	1827050	+	In_Frame_Del	DEL	TGG	TGG	-	rs200463277		TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr19:1827048_1827050delTGG	ENST00000170168.4	-	2	1832_1834	c.1738_1740delCCA	c.(1738-1740)ccadel	p.P580del	CTB-31O20.4_ENST00000593201.1_RNA|CTB-31O20.4_ENST00000587741.1_RNA|REXO1_ENST00000587524.1_5'Flank	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	580	Ser-rich.					nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aggaggaggatggggcgggggag	0.704																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1738_1740delCCA	19.37:g.1827048_1827050delTGG	ENSP00000170168:p.Pro580del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULT2	In_Frame_Del	DEL	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.P580in_frame_del	ENST00000170168.4	37	c.1740_1738	CCDS32866.1	19																																																																																			REXO1	-	NULL	ENSG00000079313		0.704	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	11	0.00	0	TGG	NM_020695		1827048	1827050	-1	no_errors	ENST00000170168	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	0.000:0.001:0.001	-
RHNO1	83695	genome.wustl.edu	37	12	2997172	2997172	+	Silent	SNP	C	C	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr12:2997172C>T	ENST00000489288.2	+	3	416	c.264C>T	c.(262-264)acC>acT	p.T88T	TULP3_ENST00000448120.2_5'Flank|TULP3_ENST00000397132.2_5'Flank|RHNO1_ENST00000461997.2_Silent_p.T74T|RHNO1_ENST00000464682.2_3'UTR	NM_001252499.2|NM_001257097.1|NM_001257098.1	NP_001239428.1|NP_001244026.1|NP_001244027.1	Q9BSD3	RHNO1_HUMAN	RAD9-HUS1-RAD1 interacting nuclear orphan 1	88					cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|positive regulation of G0 to G1 transition (GO:0070318)|recombinational repair (GO:0000725)	chromosome (GO:0005694)|nucleus (GO:0005634)											AACCTACCACCTCCAAGTTTC	0.478																																						dbGAP											0													100.0	90.0	93.0					12																	2997172		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK021945	CCDS8518.1, CCDS58199.1	12p13.33	2012-08-23	2012-08-23	2012-08-23	ENSG00000171792	ENSG00000171792			28206	protein-coding gene	gene with protein product	"""Rad9, Rad1, Hus1 interacting nuclear orphan"""	614085	"""chromosome 12 open reading frame 32"""	C12orf32		20811708, 21659603	Standard	NM_001252499		Approved	HKMT1188, MGC13204, RHINO	uc031qfq.1	Q9BSD3	OTTHUMG00000158557	ENST00000489288.2:c.264C>T	12.37:g.2997172C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z989	Silent	SNP	NULL	p.T88	ENST00000489288.2	37	c.264	CCDS8518.1	12																																																																																			RHNO1	-	NULL	ENSG00000171792		0.478	RHNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHNO1	HGNC	protein_coding	OTTHUMT00000351286.2	56	0.00	0	C	NM_031465		2997172	2997172	+1	no_errors	ENST00000489288	ensembl	human	known	69_37n	silent	42	12.50	6	SNP	0.000	T
SKIV2L2	23517	genome.wustl.edu	37	5	54642950	54642950	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr5:54642950G>A	ENST00000230640.5	+	11	1472	c.1218G>A	c.(1216-1218)atG>atA	p.M406I	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.M305I	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	406	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				CACTTCAAATGACCAAATTAG	0.274																																					Melanoma(2;92 134 23744 29976 33782)	dbGAP											0													86.0	92.0	90.0					5																	54642950		2203	4296	6499	-	-	-	SO:0001583	missense	0			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1218G>A	5.37:g.54642950G>A	ENSP00000230640:p.Met406Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M406I	ENST00000230640.5	37	c.1218	CCDS3967.1	5	.	.	.	.	.	.	.	.	.	.	G	15.96	2.987354	0.53934	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.69806	-0.43;-0.43	5.73	5.73	0.89815	Helicase, C-terminal (1);	0.042158	0.85682	D	0.000000	T	0.57301	0.2044	N	0.17345	0.48	0.50171	D	0.999858	B;B	0.20052	0.041;0.003	B;B	0.26202	0.067;0.016	T	0.53865	-0.8378	10	0.56958	D	0.05	-7.0781	19.8949	0.96954	0.0:0.0:1.0:0.0	.	305;406	F5H7E2;P42285	.;SK2L2_HUMAN	I	406;305	ENSP00000230640:M406I;ENSP00000442583:M305I	ENSP00000230640:M406I	M	+	3	0	SKIV2L2	54678707	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.195000	0.65131	2.704000	0.92352	0.650000	0.86243	ATG	SKIV2L2	-	pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_C	ENSG00000039123		0.274	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	HGNC	protein_coding	OTTHUMT00000214108.1	41	0.00	0	G			54642950	54642950	+1	no_errors	ENST00000230640	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	A
SLC4A11	83959	genome.wustl.edu	37	20	3209991	3209991	+	Splice_Site	SNP	C	C	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr20:3209991C>T	ENST00000380056.3	-	14	1945		c.e14+1		SLC4A11_ENST00000488544.1_5'UTR|SLC4A11_ENST00000539553.2_Splice_Site|SLC4A11_ENST00000380059.3_Splice_Site	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11						bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CCCCAACTCACTCTCGATTTC	0.647																																					NSCLC(190;922 2139 10266 10292 38692)	dbGAP											0													54.0	56.0	55.0					20																	3209991		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1897+1G>A	20.37:g.3209991C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Splice_Site	SNP	-	e15+1	ENST00000380056.3	37	c.1978+1	CCDS13052.1	20	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679765	0.47886	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2754	0.90081	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC4A11	3157991	1.000000	0.71417	1.000000	0.80357	0.368000	0.29767	7.770000	0.85390	2.297000	0.77311	0.462000	0.41574	.	SLC4A11	-	-	ENSG00000088836		0.647	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	73	0.00	0	C		Intron	3209991	3209991	-1	no_errors	ENST00000380059	ensembl	human	known	69_37n	splice_site	37	48.65	36	SNP	1.000	T
SYNDIG1	79953	genome.wustl.edu	37	20	24524032	24524032	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr20:24524032G>A	ENST00000376862.3	+	2	932	c.299G>A	c.(298-300)cGc>cAc	p.R100H		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	100					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						GGCGTGCTGCGCTCCTGGGGG	0.642																																						dbGAP											0													58.0	58.0	58.0					20																	24524032		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.299G>A	20.37:g.24524032G>A	ENSP00000366058:p.Arg100His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IA30|Q9H514	Missense_Mutation	SNP	pfam_Interferon-induced_TM_protein	p.R100H	ENST00000376862.3	37	c.299	CCDS13164.1	20	.	.	.	.	.	.	.	.	.	.	G	16.04	3.008898	0.54361	.	.	ENSG00000101463	ENST00000376862	D	0.90732	-2.72	5.95	1.9	0.25705	.	0.202216	0.44688	N	0.000425	D	0.91553	0.7332	L	0.60455	1.87	0.24069	N	0.995989	D	0.71674	0.998	P	0.58970	0.849	D	0.84614	0.0680	10	0.66056	D	0.02	-24.5667	9.1826	0.37152	0.2954:0.0:0.7046:0.0	.	100	Q9H7V2	SYNG1_HUMAN	H	100	ENSP00000366058:R100H	ENSP00000366058:R100H	R	+	2	0	SYNDIG1	24472032	0.985000	0.35326	0.937000	0.37676	0.482000	0.33219	1.781000	0.38644	0.139000	0.18822	0.655000	0.94253	CGC	SYNDIG1	-	NULL	ENSG00000101463		0.642	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNDIG1	HGNC	protein_coding	OTTHUMT00000078376.1	69	0.00	0	G	NM_024893		24524032	24524032	+1	no_errors	ENST00000376862	ensembl	human	known	69_37n	missense	50	12.28	7	SNP	0.155	A
TMEM132C	92293	genome.wustl.edu	37	12	129180412	129180412	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr12:129180412C>T	ENST00000435159.2	+	7	1693	c.1693C>T	c.(1693-1695)Cgg>Tgg	p.R565W	TMEM132C_ENST00000537538.1_5'UTR|TMEM132C_ENST00000315208.8_Missense_Mutation_p.R181W	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	565						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CGAGGAGGAGCGGCGGGGCCG	0.632																																						dbGAP											0													9.0	18.0	15.0					12																	129180412		689	1587	2276	-	-	-	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1693C>T	12.37:g.129180412C>T	ENSP00000410852:p.Arg565Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX8	Missense_Mutation	SNP	NULL	p.R565W	ENST00000435159.2	37	c.1693		12	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110455	0.56398	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.52295	0.67;0.67	4.82	2.76	0.32466	.	0.098661	0.41712	D	0.000838	T	0.66703	0.2816	M	0.79011	2.435	0.40514	D	0.980769	D	0.89917	1.0	D	0.67103	0.949	T	0.74303	-0.3709	10	0.87932	D	0	.	14.4411	0.67318	0.3094:0.6906:0.0:0.0	.	565	Q8N3T6	T132C_HUMAN	W	565;181	ENSP00000410852:R565W;ENSP00000324458:R181W	ENSP00000324458:R181W	R	+	1	2	TMEM132C	127746365	1.000000	0.71417	0.896000	0.35187	0.397000	0.30659	2.199000	0.42715	1.000000	0.39049	-0.169000	0.13324	CGG	TMEM132C	-	NULL	ENSG00000181234		0.632	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		87	0.00	0	C	XM_044062		129180412	129180412	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	0.828	T
TP53	7157	genome.wustl.edu	37	17	7579355	7579355	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr17:7579355A>G	ENST00000269305.4	-	4	521	c.332T>C	c.(331-333)cTg>cCg	p.L111P	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.L111P|TP53_ENST00000359597.4_Missense_Mutation_p.L111P|TP53_ENST00000420246.2_Missense_Mutation_p.L111P|TP53_ENST00000413465.2_Missense_Mutation_p.L111P|TP53_ENST00000455263.2_Missense_Mutation_p.L111P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	111	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> M (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L111R(11)|p.0?(8)|p.L111Q(7)|p.L111P(6)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.L111fs*10(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAGAAGCCCAGACGGAAACC	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	43	Substitution - Missense(24)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(2)|Deletion - In frame(1)|Complex - frameshift(1)	lung(9)|upper_aerodigestive_tract(7)|liver(6)|large_intestine(5)|central_nervous_system(4)|bone(4)|breast(4)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|urinary_tract(1)	GRCh37	CX942126	TP53	X							64.0	60.0	61.0					17																	7579355		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.332T>C	17.37:g.7579355A>G	ENSP00000269305:p.Leu111Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L111P	ENST00000269305.4	37	c.332	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	19.91	3.915273	0.73098	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99837	-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.64402	D	0.000001	D	0.99760	0.9903	M	0.81942	2.565	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.994;0.992;1.0;0.997;1.0;1.0;0.996	D	0.96946	0.9691	10	0.87932	D	0	-10.3745	12.5363	0.56144	1.0:0.0:0.0:0.0	.	72;111;111;111;111;111;111	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	111	ENSP00000410739:L111P;ENSP00000352610:L111P;ENSP00000269305:L111P;ENSP00000398846:L111P;ENSP00000391127:L111P;ENSP00000391478:L111P;ENSP00000424104:L111P;ENSP00000426252:L111P	ENSP00000269305:L111P	L	-	2	0	TP53	7520080	0.739000	0.28196	0.244000	0.24202	0.958000	0.62258	7.389000	0.79806	2.125000	0.65367	0.533000	0.62120	CTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	80	0.00	0	A	NM_000546		7579355	7579355	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	20	67.21	41	SNP	0.684	G
TRPV5	56302	genome.wustl.edu	37	7	142605793	142605793	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr7:142605793A>T	ENST00000265310.1	-	15	2425	c.2077T>A	c.(2077-2079)Tcc>Acc	p.S693T		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	693					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CTGCTCTGGGACGCGGTCCGG	0.587																																						dbGAP											0													86.0	80.0	82.0					7																	142605793		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.2077T>A	7.37:g.142605793A>T	ENSP00000265310:p.Ser693Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6_channel,prints_TRPV5_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.S693T	ENST00000265310.1	37	c.2077	CCDS5875.1	7	.	.	.	.	.	.	.	.	.	.	A	14.62	2.590377	0.46214	.	.	ENSG00000127412	ENST00000265310;ENST00000439304	T;T	0.80824	-1.42;-1.42	4.99	4.99	0.66335	.	0.556041	0.19650	N	0.109257	T	0.78233	0.4251	M	0.67953	2.075	0.80722	D	1	B	0.24258	0.1	B	0.22152	0.038	T	0.75499	-0.3296	10	0.40728	T	0.16	-18.4271	12.5653	0.56306	1.0:0.0:0.0:0.0	.	693	Q9NQA5	TRPV5_HUMAN	T	693;638	ENSP00000265310:S693T;ENSP00000406361:S638T	ENSP00000265310:S693T	S	-	1	0	TRPV5	142315915	0.998000	0.40836	0.959000	0.39883	0.713000	0.41058	4.382000	0.59594	2.113000	0.64589	0.533000	0.62120	TCC	TRPV5	-	prints_TRPV5_channel,tigrfam_TRP_channel	ENSG00000127412		0.587	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV5	HGNC	protein_coding	OTTHUMT00000347660.1	71	0.00	0	A	NM_019841		142605793	142605793	-1	no_errors	ENST00000265310	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	0.993	T
TTC28	23331	genome.wustl.edu	37	22	28378267	28378267	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr22:28378267G>A	ENST00000397906.2	-	23	7529	c.7388C>T	c.(7387-7389)tCt>tTt	p.S2463F	TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000454741.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2463					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GCCATTTCCAGAAGGAAGCCT	0.597																																						dbGAP											0													13.0	15.0	15.0					22																	28378267		692	1588	2280	-	-	-	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.7388C>T	22.37:g.28378267G>A	ENSP00000381003:p.Ser2463Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S2463F	ENST00000397906.2	37	c.7388	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	G	14.51	2.558355	0.45590	.	.	ENSG00000100154	ENST00000397906	D	0.89485	-2.52	5.09	4.07	0.47477	.	0.144240	0.48767	D	0.000178	T	0.82263	0.4999	L	0.27053	0.805	0.42455	D	0.992765	B	0.26400	0.148	B	0.27500	0.08	T	0.80171	-0.1493	10	0.59425	D	0.04	-5.4132	12.0894	0.53717	0.0845:0.0:0.9155:0.0	.	2463	Q96AY4	TTC28_HUMAN	F	2463	ENSP00000381003:S2463F	ENSP00000381003:S2463F	S	-	2	0	TTC28	26708267	1.000000	0.71417	0.098000	0.21074	0.879000	0.50718	7.181000	0.77682	1.256000	0.44068	0.655000	0.94253	TCT	TTC28	-	NULL	ENSG00000100154		0.597	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	93	0.00	0	G	XM_929318		28378267	28378267	-1	no_errors	ENST00000397906	ensembl	human	novel	69_37n	missense	47	37.66	29	SNP	0.944	A
TUBGCP2	10844	genome.wustl.edu	37	10	135113636	135113636	+	Intron	SNP	A	A	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr10:135113636A>T	ENST00000252936.3	-	2	190				TUBGCP2_ENST00000543663.1_Intron|TUBGCP2_ENST00000368563.2_Intron|TUBGCP2_ENST00000470829.1_Intron|TUBGCP2_ENST00000417178.2_Intron			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CACAAACATGAGTGATTTAAT	0.299																																						dbGAP											0													76.0	78.0	77.0					10																	135113636		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.151-19T>A	10.37:g.135113636A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	RNA	SNP	-	NULL	ENST00000252936.3	37	NULL	CCDS7676.1	10																																																																																			TUBGCP2	-	-	ENSG00000130640		0.299	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	28	0.00	0	A			135113636	135113636	-1	no_errors	ENST00000487796	ensembl	human	known	69_37n	rna	45	25.00	15	SNP	0.002	T
ZNF536	9745	genome.wustl.edu	37	19	30935398	30935398	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr19:30935398C>T	ENST00000355537.3	+	2	1076	c.929C>T	c.(928-930)tCg>tTg	p.S310L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	310					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TTCGCGGCTTCGCAGGAGGAG	0.642																																						dbGAP											0													79.0	88.0	85.0					19																	30935398		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.929C>T	19.37:g.30935398C>T	ENSP00000347730:p.Ser310Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S310L	ENST00000355537.3	37	c.929	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140475	0.37825	.	.	ENSG00000198597	ENST00000355537	T	0.28454	1.61	5.59	5.59	0.84812	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.47229	0.1434	L	0.28649	0.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.989	T	0.46289	-0.9202	10	0.72032	D	0.01	-14.1385	19.5661	0.95393	0.0:1.0:0.0:0.0	.	310;310	A7E228;O15090	.;ZN536_HUMAN	L	310	ENSP00000347730:S310L	ENSP00000347730:S310L	S	+	2	0	ZNF536	35627238	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.788000	0.85771	2.631000	0.89168	0.491000	0.48974	TCG	ZNF536	-	smart_Znf_C2H2-like	ENSG00000198597		0.642	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	87	0.00	0	C	NM_014717		30935398	30935398	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	missense	51	40.00	34	SNP	1.000	T
ZNF784	147808	genome.wustl.edu	37	19	56133136	56133136	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A3XX-01A-21D-A23C-09	TCGA-A2-A3XX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c67409b2-ac25-42a0-8543-4636ef132fe4	e96d5811-4736-40dd-966d-e0e172aeb0af	g.chr19:56133136delT	ENST00000325351.4	-	2	992	c.953delA	c.(952-954)aagfs	p.K318fs	ZNF784_ENST00000591479.1_3'UTR	NM_203374.1	NP_976308.1	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	318					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			upper_aerodigestive_tract(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GGCCTCCACCTTCACCTTCGC	0.711																																						dbGAP											0													31.0	31.0	31.0					19																	56133136		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK074859	CCDS12930.1	19q13.42	2013-01-08			ENSG00000179922	ENSG00000179922		"""Zinc fingers, C2H2-type"""	33111	protein-coding gene	gene with protein product							Standard	NM_203374		Approved	MGC75238	uc002qll.1	Q8NCA9	OTTHUMG00000180860	ENST00000325351.4:c.953delA	19.37:g.56133136delT	ENSP00000320096:p.Lys318fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K318fs	ENST00000325351.4	37	c.953	CCDS12930.1	19																																																																																			ZNF784	-	NULL	ENSG00000179922		0.711	ZNF784-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF784	HGNC	protein_coding	OTTHUMT00000453355.2	42	0.00	0	T	NM_203374		56133136	56133136	-1	no_errors	ENST00000325351	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.113	-
