#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANK2	287	genome.wustl.edu	37	4	114251449	114251449	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr4:114251449G>T	ENST00000357077.4	+	27	3001	c.2948G>T	c.(2947-2949)gGa>gTa	p.G983V	ANK2_ENST00000394537.3_Missense_Mutation_p.G983V|ANK2_ENST00000264366.6_Missense_Mutation_p.G983V|ANK2_ENST00000506722.1_Missense_Mutation_p.G974V|ANK2_ENST00000509550.1_Missense_Mutation_p.G192V	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	983	Interaction with SPTBN1.|ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCTATGCGAGGATGCAGACAC	0.463																																						dbGAP											0													70.0	66.0	67.0					4																	114251449		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2948G>T	4.37:g.114251449G>T	ENSP00000349588:p.Gly983Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.G983V	ENST00000357077.4	37	c.2948	CCDS3702.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.137505|5.137505	0.94517|0.94517	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550|ENST00000514960	T;T;T;T;T;T;T;D|T	0.83591|0.45668	-0.78;-0.66;-0.86;-0.82;-0.86;-0.89;-0.87;-1.74|0.89	5.93|5.93	5.93|5.93	0.95920|0.95920	ZU5 (3);|.	0.000000|.	0.56097|.	D|.	0.000036|.	T|T	0.56717|0.56717	0.2004|0.2004	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D;D;D;D;B;D|.	0.89917|.	0.995;1.0;0.998;0.996;1.0;0.126;1.0|.	D;D;P;D;D;B;D|.	0.91635|.	0.933;0.999;0.891;0.969;0.995;0.076;0.998|.	T|T	0.54964|0.54964	-0.8214|-0.8214	10|7	0.87932|0.87932	D|D	0|0	.|.	20.3437|20.3437	0.98782|0.98782	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	192;983;28;983;983;974;974|.	E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5;F8WEF9|.	.;ANK2_HUMAN;.;.;.;.;.|.	V|S	962;929;974;62;998;983;983;983;974;192|28	ENSP00000423799:G962V;ENSP00000421011:G929V;ENSP00000421067:G974V;ENSP00000424722:G998V;ENSP00000378044:G983V;ENSP00000349588:G983V;ENSP00000264366:G983V;ENSP00000426944:G192V|ENSP00000422853:R28S	ENSP00000264366:G983V|ENSP00000422853:R28S	G|R	+|+	2|3	0|2	ANK2|ANK2	114470898|114470898	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.979000|0.979000	0.70002|0.70002	9.864000|9.864000	0.99589|0.99589	2.802000|2.802000	0.96397|0.96397	0.563000|0.563000	0.77884|0.77884	GGA|AGG	ANK2	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000145362		0.463	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	83	0.00	0	G	NM_001148		114251449	114251449	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	45	10.00	5	SNP	1.000	T
ANKRD20A8P	729171	genome.wustl.edu	37	2	95480994	95480994	+	RNA	SNP	G	G	C			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr2:95480994G>C	ENST00000432432.2	-	0	2366					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		TCTTTCTGATGAACGTCATCT	0.388																																						dbGAP											0																																										-	-	-			0					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95480994G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC18	RNA	SNP	-	NULL	ENST00000432432.2	37	NULL		2																																																																																			ANKRD20A8P	-	-	ENSG00000229089		0.388	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20A8P	HGNC	pseudogene	OTTHUMT00000451404.1	139	0.71	1	G			95480994	95480994	-1	no_errors	ENST00000432432	ensembl	human	known	69_37n	rna	122	11.59	16	SNP	0.002	C
ARHGAP5	394	genome.wustl.edu	37	14	32561316	32561316	+	Nonsense_Mutation	SNP	G	G	T	rs200628183	byFrequency	TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr14:32561316G>T	ENST00000345122.3	+	2	1756	c.1441G>T	c.(1441-1443)Gaa>Taa	p.E481*	ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.E481*|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.E481*|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.E481*	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	481	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GCATCAGCGAGAAATAGTTGA	0.373																																					NSCLC(9;77 350 3443 29227 41353)	dbGAP											0													69.0	70.0	70.0					14																	32561316		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1441G>T	14.37:g.32561316G>T	ENSP00000371897:p.Glu481*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.E481*	ENST00000345122.3	37	c.1441	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	40	8.091676	0.98648	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	.	.	.	X	481	.	ENSP00000371897:E481X	E	+	1	0	ARHGAP5	31631067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAA	ARHGAP5	-	superfamily_FF_domain,smart_FF_domain	ENSG00000100852		0.373	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	85	0.00	0	G	NM_001030055		32561316	32561316	+1	no_errors	ENST00000345122	ensembl	human	known	69_37n	nonsense	55	11.29	7	SNP	1.000	T
ARMC9	80210	genome.wustl.edu	37	2	232220647	232220647	+	Splice_Site	SNP	G	G	A	rs566344934		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr2:232220647G>A	ENST00000483477.1	+	21	2131		c.e21+1					Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9							extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TCCTCTTCATGTAAGAATGTG	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		19501	0.001		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000483477.1:c.2131+1G>A	2.37:g.232220647G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Splice_Site	SNP	-	NULL	ENST00000483477.1	37	c.NULL		2	.	.	.	.	.	.	.	.	.	.	G	8.812	0.935550	0.18206	.	.	ENSG00000135931	ENST00000359743	.	.	.	4.06	1.12	0.20585	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.9821	0.05956	0.1039:0.1777:0.5354:0.1831	.	.	.	.	.	-1	.	.	.	+	.	.	ARMC9	231928891	0.935000	0.31712	0.000000	0.03702	0.117000	0.20001	1.454000	0.35178	0.090000	0.17273	-0.218000	0.12543	.	ARMC9	-	-	ENSG00000135931		0.612	ARMC9-003	KNOWN	basic	processed_transcript	ARMC9	HGNC	protein_coding	OTTHUMT00000332953.2	50	0.00	0	G	NM_025139	Intron	232220647	232220647	+1	no_errors	ENST00000483477	ensembl	human	known	69_37n	splice_site	26	13.33	4	SNP	0.001	A
ATP8A2	51761	genome.wustl.edu	37	13	26138117	26138117	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr13:26138117A>T	ENST00000381655.2	+	16	1563	c.1421A>T	c.(1420-1422)gAt>gTt	p.D474V	ATP8A2_ENST00000255283.8_Missense_Mutation_p.D434V	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	434					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CCCTGTAGTGATTCCTGTGAC	0.428																																						dbGAP											0													123.0	112.0	115.0					13																	26138117		1881	4114	5995	-	-	-	SO:0001583	missense	0			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1421A>T	13.37:g.26138117A>T	ENSP00000371070:p.Asp474Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.D474V	ENST00000381655.2	37	c.1421	CCDS41873.1	13	.	.	.	.	.	.	.	.	.	.	A	12.00	1.806754	0.31961	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.63417	-0.04;-0.04	4.87	4.87	0.63330	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	11.742700	0.00397	N	0.000048	T	0.63498	0.2516	L	0.31371	0.925	0.80722	D	1	B;P;B	0.37083	0.058;0.581;0.058	B;B;B	0.41571	0.099;0.36;0.152	T	0.46665	-0.9175	10	0.87932	D	0	.	14.5919	0.68371	1.0:0.0:0.0:0.0	.	434;434;434	B7Z880;Q9NTI2-3;Q9NTI2	.;.;AT8A2_HUMAN	V	474;434;254	ENSP00000371070:D474V;ENSP00000255283:D434V	ENSP00000255283:D434V	D	+	2	0	ATP8A2	25036117	1.000000	0.71417	0.500000	0.27589	0.257000	0.26127	7.424000	0.80242	2.182000	0.69389	0.528000	0.53228	GAT	ATP8A2	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000132932		0.428	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2	70	0.00	0	A	NM_016529		26138117	26138117	+1	no_errors	ENST00000381655	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.874	T
BHLHE22	27319	genome.wustl.edu	37	8	65494021	65494023	+	In_Frame_Del	DEL	GCA	GCA	-	rs62519837		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr8:65494021_65494023delGCA	ENST00000321870.1	+	1	1208_1210	c.674_676delGCA	c.(673-678)ggcagc>ggc	p.S234del	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	234	Ser-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S234delS(1)|p.S226G(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						ggcagcggcggcagcagcagcag	0.709																																					Colon(113;104 1586 2865 9855 18065)	dbGAP											2	Substitution - Missense(1)|Deletion - In frame(1)	central_nervous_system(1)|skin(1)																																								-	-	-	SO:0001651	inframe_deletion	0			U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.674_676delGCA	8.37:g.65494030_65494032delGCA	ENSP00000318799:p.Ser234del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S229in_frame_del	ENST00000321870.1	37	c.674_676	CCDS6179.1	8																																																																																			BHLHE22	-	NULL	ENSG00000180828		0.709	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHLHE22	HGNC	protein_coding	OTTHUMT00000378549.1	12	0.00	0	GCA	NM_152414		65494021	65494023	+1	no_errors	ENST00000321870	ensembl	human	known	69_37n	in_frame_del	9	25.00	3	DEL	0.703:0.675:0.587	-
CCDC15	80071	genome.wustl.edu	37	11	124862526	124862526	+	Frame_Shift_Del	DEL	G	G	-	rs567027603		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr11:124862526delG	ENST00000344762.5	+	10	2341	c.2082delG	c.(2080-2082)ctgfs	p.L694fs	CCDC15_ENST00000529051.1_Frame_Shift_Del_p.L694fs	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	694						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		AATTGCCTCTGGACTATCATC	0.373																																						dbGAP											0													68.0	62.0	64.0					11																	124862526		1836	4091	5927	-	-	-	SO:0001589	frameshift_variant	0			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.2082delG	11.37:g.124862526delG	ENSP00000341684:p.Leu694fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H8U7	Frame_Shift_Del	DEL	NULL	p.D695fs	ENST00000344762.5	37	c.2082	CCDS44756.1	11																																																																																			CCDC15	-	NULL	ENSG00000149548		0.373	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	HGNC	protein_coding	OTTHUMT00000387131.1	36	0.00	0	G	NM_025004		124862526	124862526	+1	no_errors	ENST00000344762	ensembl	human	known	69_37n	frame_shift_del	10	16.67	2	DEL	0.000	-
CENPE	1062	genome.wustl.edu	37	4	104065751	104065751	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr4:104065751A>G	ENST00000265148.3	-	33	4971	c.4882T>C	c.(4882-4884)Tat>Cat	p.Y1628H	CENPE_ENST00000380026.3_Missense_Mutation_p.Y1603H	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1628					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AGAAACTGATATTCTTTTTCT	0.333																																						dbGAP											0													49.0	49.0	49.0					4																	104065751		2202	4298	6500	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4882T>C	4.37:g.104065751A>G	ENSP00000265148:p.Tyr1628His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.Y1628H	ENST00000265148.3	37	c.4882	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.320178	0.00232	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.70164	-0.46;-0.46	4.76	-4.95	0.03048	.	.	.	.	.	T	0.26484	0.0647	N	0.01624	-0.795	0.09310	N	1	B;B	0.12013	0.005;0.0	B;B	0.09377	0.004;0.0	T	0.19516	-1.0303	9	0.14656	T	0.56	.	1.1747	0.01832	0.4448:0.1926:0.1884:0.1742	.	1603;1628	Q02224-3;Q02224	.;CENPE_HUMAN	H	1628;1628;1603	ENSP00000265148:Y1628H;ENSP00000369365:Y1603H	ENSP00000265148:Y1628H	Y	-	1	0	CENPE	104285200	0.000000	0.05858	0.000000	0.03702	0.266000	0.26442	-1.116000	0.03286	-0.813000	0.04357	-0.656000	0.03901	TAT	CENPE	-	NULL	ENSG00000138778		0.333	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		69	0.00	0	A			104065751	104065751	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	0.001	G
CWF19L2	143884	genome.wustl.edu	37	11	107299906	107299906	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr11:107299906G>C	ENST00000282251.5	-	8	1079	c.1052C>G	c.(1051-1053)tCt>tGt	p.S351C	CWF19L2_ENST00000433523.1_Missense_Mutation_p.S351C	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	351							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		CCTTGGGTTAGATTCTCTTCT	0.358																																						dbGAP											0													102.0	106.0	105.0					11																	107299906		2201	4298	6499	-	-	-	SO:0001583	missense	0			AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.1052C>G	11.37:g.107299906G>C	ENSP00000282251:p.Ser351Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Missense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.S351C	ENST00000282251.5	37	c.1052	CCDS8336.2	11	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456822	0.26161	.	.	ENSG00000152404	ENST00000282251;ENST00000433523	T;T	0.24538	1.85;1.85	5.45	-2.94	0.05581	.	1.642270	0.02667	N	0.108140	T	0.30885	0.0779	M	0.73598	2.24	0.09310	N	1	D	0.53885	0.963	P	0.46320	0.512	T	0.35674	-0.9779	10	0.56958	D	0.05	1.8622	1.7361	0.02942	0.3316:0.2139:0.345:0.1094	.	351	Q2TBE0	C19L2_HUMAN	C	351	ENSP00000282251:S351C;ENSP00000387533:S351C	ENSP00000282251:S351C	S	-	2	0	CWF19L2	106805116	0.001000	0.12720	0.000000	0.03702	0.099000	0.18886	-0.043000	0.12043	-0.786000	0.04516	0.591000	0.81541	TCT	CWF19L2	-	NULL	ENSG00000152404		0.358	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L2	HGNC	protein_coding	OTTHUMT00000328825.2	100	0.00	0	G	NM_152434		107299906	107299906	-1	no_errors	ENST00000282251	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.000	C
CXorf22	170063	genome.wustl.edu	37	X	35969264	35969264	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chrX:35969264C>T	ENST00000297866.5	+	5	739	c.673C>T	c.(673-675)Caa>Taa	p.Q225*		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	225										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TTTGCAAGGTCAACCTGAGAT	0.348																																						dbGAP											0													119.0	103.0	108.0					X																	35969264		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.673C>T	X.37:g.35969264C>T	ENSP00000297866:p.Gln225*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRM8|Q8N6X8	Nonsense_Mutation	SNP	superfamily_PapD-like	p.Q225*	ENST00000297866.5	37	c.673	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	C	13.06	2.124550	0.37533	.	.	ENSG00000165164	ENST00000297866	.	.	.	5.75	2.85	0.33270	.	0.722220	0.14392	N	0.322427	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-8.6296	7.7377	0.28823	0.0:0.6344:0.1362:0.2294	.	.	.	.	X	225	.	ENSP00000297866:Q225X	Q	+	1	0	CXorf22	35879185	0.011000	0.17503	0.003000	0.11579	0.009000	0.06853	0.643000	0.24750	1.156000	0.42514	0.506000	0.49869	CAA	CXorf22	-	NULL	ENSG00000165164		0.348	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	42	0.00	0	C	NM_152632		35969264	35969264	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	nonsense	25	19.35	6	SNP	0.007	T
DCAF7	10238	genome.wustl.edu	37	17	61661011	61661011	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr17:61661011C>T	ENST00000310827.4	+	6	893	c.676C>T	c.(676-678)Cgc>Tgc	p.R226C	DCAF7_ENST00000577702.1_3'UTR|DCAF7_ENST00000431926.1_Intron|DCAF7_ENST00000415273.2_Intron	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7	226					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						CCCACTGCTTCGCCTCTGCTG	0.572																																						dbGAP											0													91.0	95.0	94.0					17																	61661011		2145	4250	6395	-	-	-	SO:0001583	missense	0			U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.676C>T	17.37:g.61661011C>T	ENSP00000308344:p.Arg226Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E039|D3DU14|O15491|Q9DAE4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R226C	ENST00000310827.4	37	c.676		17	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752429	0.89753	.	.	ENSG00000136485	ENST00000310827	T	0.61510	0.1	5.29	4.33	0.51752	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.73877	0.3643	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76817	-0.2819	9	0.87932	D	0	-24.3889	10.4638	0.44596	0.1332:0.7966:0.0:0.0702	.	226	P61962	DCAF7_HUMAN	C	226	ENSP00000308344:R226C	ENSP00000308344:R226C	R	+	1	0	DCAF7	59014743	1.000000	0.71417	0.901000	0.35422	0.996000	0.88848	4.709000	0.61867	1.474000	0.48178	0.655000	0.94253	CGC	DCAF7	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000136485		0.572	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	HGNC	protein_coding		108	0.00	0	C	NM_005828		61661011	61661011	+1	no_errors	ENST00000310827	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	0.996	T
MIR15A	406948	genome.wustl.edu	37	13	50618540	50618540	+	IGR	DEL	A	A	-			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr13:50618540delA								KCNRG (23482 upstream) : MIR16-1 (4568 downstream)																							ATAGGCTTAGAAAAAAAAAAG	0.264																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															13.37:g.50618540delA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL		37	NULL		13																																																																																			DLEU2	-	-	ENSG00000231607	0	0.264					DLEU2	HGNC			12	0.00	0	A			50618540	50618540	-1	no_errors	ENST00000235290	ensembl	human	known	69_37n	rna	3	40.00	2	DEL	0.001	-
DLL1	28514	genome.wustl.edu	37	6	170592883	170592883	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr6:170592883G>C	ENST00000366756.3	-	9	1817	c.1484C>G	c.(1483-1485)aCc>aGc	p.T495S		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	495	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CTCGTGGCAGGTGGCCCCATT	0.697																																						dbGAP											0													13.0	14.0	14.0					6																	170592883		2191	4280	6471	-	-	-	SO:0001583	missense	0			AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1484C>G	6.37:g.170592883G>C	ENSP00000355718:p.Thr495Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,smart_DSL,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_DSL,pfscan_EG-like_dom	p.T495S	ENST00000366756.3	37	c.1484	CCDS5313.1	6	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052670	0.75960	.	.	ENSG00000198719	ENST00000366756	T	0.44881	0.91	5.68	5.68	0.88126	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.56031	0.1958	L	0.60904	1.88	0.58432	D	0.999999	D	0.76494	0.999	D	0.91635	0.999	T	0.49476	-0.8936	10	0.40728	T	0.16	.	19.7959	0.96481	0.0:0.0:1.0:0.0	.	495	O00548	DLL1_HUMAN	S	495	ENSP00000355718:T495S	ENSP00000355718:T495S	T	-	2	0	DLL1	170434808	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.969000	0.87988	2.689000	0.91719	0.655000	0.94253	ACC	DLL1	-	pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000198719		0.697	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLL1	HGNC	protein_coding	OTTHUMT00000043254.1	32	0.00	0	G			170592883	170592883	-1	no_errors	ENST00000366756	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	C
DNAH12	201625	genome.wustl.edu	37	3	57327764	57327764	+	3'UTR	DEL	T	T	-	rs370335542		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr3:57327764delT	ENST00000351747.2	-	0	9504				DNAH12_ENST00000462713.1_5'UTR|ASB14_ENST00000487349.1_5'Flank|ASB14_ENST00000389601.3_5'Flank	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GTAGGACAGGTTTTTTTTTTT	0.328																																						dbGAP											0													11.0	13.0	13.0					3																	57327764		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.*45A>-	3.37:g.57327764delT		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	RNA	DEL	-	NULL	ENST00000351747.2	37	NULL		3																																																																																			DNAH12	-	-	ENSG00000174844		0.328	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		12	0.00	0	T	NM_178504		57327764	57327764	-1	no_errors	ENST00000462713	ensembl	human	known	69_37n	rna	7	36.36	4	DEL	0.000	-
EIF2AK2	5610	genome.wustl.edu	37	2	37334464	37334464	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr2:37334464C>G	ENST00000233057.4	-	17	1930	c.1608G>C	c.(1606-1608)ttG>ttC	p.L536F	EIF2AK2_ENST00000405334.1_Missense_Mutation_p.L495F|EIF2AK2_ENST00000395127.2_Missense_Mutation_p.L536F	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	536	Interaction with TRAF5.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				TCCACACAGTCAAGGTCCTTA	0.383																																						dbGAP											0													160.0	148.0	152.0					2																	37334464		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.1608G>C	2.37:g.37334464C>G	ENSP00000233057:p.Leu536Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ds-RNA-bd,superfamily_Kinase-like_dom,smart_Ds-RNA-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ds-RNA-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L536F	ENST00000233057.4	37	c.1608	CCDS1786.1	2	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856601	0.71834	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334	T;T;T	0.50813	0.73;0.73;0.73	5.18	5.18	0.71444	Protein kinase, catalytic domain (1);	0.000000	0.45126	D	0.000388	T	0.67202	0.2868	M	0.72894	2.215	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69191	-0.5210	10	0.59425	D	0.04	-15.7724	14.534	0.67947	0.0:1.0:0.0:0.0	.	536;495	P19525;E9PC80	E2AK2_HUMAN;.	F	536;536;495	ENSP00000233057:L536F;ENSP00000378559:L536F;ENSP00000385014:L495F	ENSP00000233057:L536F	L	-	3	2	EIF2AK2	37187968	0.927000	0.31430	0.575000	0.28536	0.019000	0.09904	3.699000	0.54778	2.562000	0.86427	0.563000	0.77884	TTG	EIF2AK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000055332		0.383	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK2	HGNC	protein_coding	OTTHUMT00000218571.2	158	0.00	0	C	NM_002759		37334464	37334464	-1	no_errors	ENST00000233057	ensembl	human	known	69_37n	missense	113	15.04	20	SNP	0.815	G
ELMO1	9844	genome.wustl.edu	37	7	37053009	37053009	+	Missense_Mutation	SNP	C	C	A	rs149093668	byFrequency	TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr7:37053009C>A	ENST00000310758.4	-	16	1979	c.1332G>T	c.(1330-1332)atG>atT	p.M444I	ELMO1_ENST00000442504.1_Missense_Mutation_p.M444I|ELMO1_ENST00000341056.3_Missense_Mutation_p.M146I|ELMO1-AS1_ENST00000419535.1_RNA|ELMO1_ENST00000448602.1_Missense_Mutation_p.M444I	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	444	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.M444I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GGGTGAAGAACATCGGGTGGA	0.438																																						dbGAP											1	Substitution - Missense(1)	lung(1)											102.0	94.0	97.0					7																	37053009		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1332G>T	7.37:g.37053009C>A	ENSP00000312185:p.Met444Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.M444I	ENST00000310758.4	37	c.1332	CCDS5449.1	7	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176255	0.78564	.	.	ENSG00000155849	ENST00000341056;ENST00000310758;ENST00000361912;ENST00000442504;ENST00000448602	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	6.06	6.06	0.98353	Engulfment/cell motility, ELMO (2);	0.044191	0.85682	D	0.000000	T	0.32971	0.0847	L	0.33245	0.995	0.80722	D	1	B	0.17852	0.024	B	0.34931	0.192	T	0.07578	-1.0765	10	0.21014	T;T	0.42;0.42	.	20.2348	0.98355	0.0:1.0:0.0:0.0	.	444	Q92556	ELMO1_HUMAN	I	146;444;348;444;444	ENSP00000342142:M146I;ENSP00000312185:M444I;ENSP00000406952:M444I;ENSP00000394458:M444I	ENSP00000312185:M444I;ENSP00000312185:M444I	M	-	3	0	ELMO1	37019534	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.879000	0.98667	0.650000	0.86243	ATG	ELMO1	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000155849		0.438	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	34	0.00	0	C	NM_130442		37053009	37053009	-1	no_errors	ENST00000310758	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	1.000	A
FOXD4L6	653404	genome.wustl.edu	37	9	69200475	69200475	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr9:69200475G>C	ENST00000377473.1	-	1	1729	c.1138C>G	c.(1138-1140)Ctc>Gtc	p.L380V		NM_001085476.1	NP_001078945.1	Q3SYB3	FX4L6_HUMAN	forkhead box D4-like 6	380					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AATTGTCCGAGCAGCGGCGGC	0.672																																						dbGAP											0													1.0	2.0	2.0					9																	69200475		524	1511	2035	-	-	-	SO:0001583	missense	0				CCDS43826.1	9q12	2014-05-06			ENSG00000204793	ENSG00000273514			31986	protein-coding gene	gene with protein product							Standard	NM_001085476		Approved	OTTHUMG00000066822	uc004afi.2	Q3SYB3	OTTHUMG00000188618	ENST00000377473.1:c.1138C>G	9.37:g.69200475G>C	ENSP00000366693:p.Leu380Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPC4|Q4V336	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L380V	ENST00000377473.1	37	c.1138	CCDS43826.1	9	.	.	.	.	.	.	.	.	.	.	.	9.334	1.061202	0.19987	.	.	ENSG00000204793	ENST00000377473	D	0.93953	-3.32	2.35	2.35	0.29111	.	0.856510	0.09114	U	0.846680	D	0.85923	0.5810	N	0.14661	0.345	0.20403	N	0.999902	B	0.21071	0.051	B	0.09377	0.004	T	0.77879	-0.2423	10	0.87932	D	0	.	8.2319	0.31603	0.0:0.0:1.0:0.0	.	380	Q3SYB3	FX4L6_HUMAN	V	380	ENSP00000366693:L380V	ENSP00000366693:L380V	L	-	1	0	FOXD4L6	68490295	0.018000	0.18449	0.632000	0.29296	0.326000	0.28443	1.427000	0.34881	1.305000	0.44909	0.186000	0.17326	CTC	FOXD4L6	-	NULL	ENSG00000204793		0.672	FOXD4L6-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FOXD4L6	HGNC	protein_coding	OTTHUMT00000143174.1	55	0.00	0	G	NM_001085476		69200475	69200475	-1	no_errors	ENST00000377473	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.974	C
FSCN1	6624	genome.wustl.edu	37	7	5643182	5643182	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr7:5643182G>T	ENST00000382361.3	+	3	1159	c.1045G>T	c.(1045-1047)Gcg>Tcg	p.A349S	FSCN1_ENST00000340250.6_Missense_Mutation_p.A328S	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	349					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		CACACTGAGGGCGTCCAATGG	0.622																																						dbGAP											0													84.0	84.0	84.0					7																	5643182		2202	4300	6502	-	-	-	SO:0001583	missense	0			U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1045G>T	7.37:g.5643182G>T	ENSP00000371798:p.Ala349Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	pfam_Fascin-domain,superfamily_Actin_cross-linking	p.A349S	ENST00000382361.3	37	c.1045	CCDS5342.1	7	.	.	.	.	.	.	.	.	.	.	G	27.0	4.786738	0.90367	.	.	ENSG00000075618	ENST00000340250;ENST00000382361;ENST00000444748;ENST00000447103;ENST00000405801;ENST00000535097	T;T	0.51071	0.72;1.32	4.45	4.45	0.53987	Fascin domain (1);Actin cross-linking (1);	0.069450	0.56097	D	0.000029	T	0.71108	0.3301	M	0.82517	2.595	0.80722	D	1	D;P	0.61697	0.99;0.956	D;P	0.79108	0.992;0.902	T	0.77395	-0.2604	10	0.87932	D	0	-14.313	16.4319	0.83847	0.0:0.0:1.0:0.0	.	328;349	B3KTA3;Q16658	.;FSCN1_HUMAN	S	328;349;71;71;71;71	ENSP00000339729:A328S;ENSP00000371798:A349S	ENSP00000339729:A328S	A	+	1	0	FSCN1	5609708	1.000000	0.71417	0.091000	0.20842	0.903000	0.53119	7.420000	0.80191	2.173000	0.68751	0.561000	0.74099	GCG	FSCN1	-	pfam_Fascin-domain,superfamily_Actin_cross-linking	ENSG00000075618		0.622	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN1	HGNC	protein_coding	OTTHUMT00000207153.3	71	0.00	0	G	NM_003088		5643182	5643182	+1	no_errors	ENST00000382361	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.996	T
GIGYF1	64599	genome.wustl.edu	37	7	100281706	100281706	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr7:100281706G>A	ENST00000275732.5	-	15	3014	c.1805C>T	c.(1804-1806)cCa>cTa	p.P602L	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	602	Gln-rich.|Poly-Pro.				insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CTGCTGCTGTGGCGGCGGCGG	0.672																																						dbGAP											0													14.0	18.0	17.0					7																	100281706		2185	4271	6456	-	-	-	SO:0001583	missense	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.1805C>T	7.37:g.100281706G>A	ENSP00000275732:p.Pro602Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.P602L	ENST00000275732.5	37	c.1805	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.103827	0.00356	.	.	ENSG00000146830	ENST00000539430;ENST00000275732	D	0.83163	-1.69	0.158	-0.317	0.12736	.	.	.	.	.	T	0.57989	0.2091	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.04013	0.001	T	0.38542	-0.9656	8	0.10377	T	0.69	.	.	.	.	.	602	O75420	PERQ1_HUMAN	L	321;602	ENSP00000275732:P602L	ENSP00000275732:P602L	P	-	2	0	GIGYF1	100119642	0.981000	0.34729	0.004000	0.12327	0.004000	0.04260	0.359000	0.20233	-1.052000	0.03222	-1.038000	0.02383	CCA	GIGYF1	-	NULL	ENSG00000146830		0.672	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	36	0.00	0	G	NM_022574		100281706	100281706	-1	no_errors	ENST00000275732	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.121	A
GIMAP8	155038	genome.wustl.edu	37	7	150171141	150171141	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr7:150171141A>T	ENST00000307271.3	+	4	1298	c.724A>T	c.(724-726)Aat>Tat	p.N242Y		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	242						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		ACCCGAGCAGAATCCGGGGAC	0.557																																						dbGAP											0													79.0	82.0	81.0					7																	150171141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.724A>T	7.37:g.150171141A>T	ENSP00000305107:p.Asn242Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AIG1	p.N242Y	ENST00000307271.3	37	c.724	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	A	6.023	0.372690	0.11409	.	.	ENSG00000171115	ENST00000307271	T	0.62364	0.03	4.24	-1.48	0.08745	.	1.124900	0.06739	N	0.778137	T	0.58192	0.2105	L	0.37561	1.115	0.09310	N	1	D	0.53885	0.963	P	0.48901	0.594	T	0.55522	-0.8128	10	0.59425	D	0.04	.	9.9983	0.41913	0.3968:0.0:0.6032:0.0	.	242	Q8ND71	GIMA8_HUMAN	Y	242	ENSP00000305107:N242Y	ENSP00000305107:N242Y	N	+	1	0	GIMAP8	149802074	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.145000	0.16157	-0.501000	0.06605	-1.162000	0.01777	AAT	GIMAP8	-	NULL	ENSG00000171115		0.557	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	95	0.00	0	A	NM_175571		150171141	150171141	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	missense	72	10.00	8	SNP	0.000	T
GNS	2799	genome.wustl.edu	37	12	65116868	65116868	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr12:65116868C>T	ENST00000258145.3	-	11	1396	c.1226G>A	c.(1225-1227)cGa>cAa	p.R409Q	GNS_ENST00000542058.1_Missense_Mutation_p.R389Q|GNS_ENST00000543646.1_Missense_Mutation_p.R441Q|GNS_ENST00000418919.2_Missense_Mutation_p.R353Q	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	409					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		GACATCTGATCGCCAGGTCAA	0.453																																						dbGAP											0													160.0	134.0	143.0					12																	65116868		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.1226G>A	12.37:g.65116868C>T	ENSP00000258145:p.Arg409Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYH8|Q53F05	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	p.R409Q	ENST00000258145.3	37	c.1226	CCDS8970.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.733626	0.96865	.	.	ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825	D;D;D;D	0.97404	-4.37;-4.37;-4.37;-4.37	5.06	5.06	0.68205	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98595	0.9530	M	0.86651	2.83	0.58432	D	0.999998	D;D;D;D	0.89917	0.977;1.0;0.995;1.0	P;D;D;D	0.79784	0.73;0.993;0.934;0.993	D	0.99123	1.0850	9	.	.	.	-12.7857	18.8212	0.92097	0.0:1.0:0.0:0.0	.	389;441;409;353	B4DYH8;F6S8M0;P15586;Q7Z3X3	.;.;GNS_HUMAN;.	Q	353;409;441;389;326	ENSP00000413130:R353Q;ENSP00000258145:R409Q;ENSP00000438497:R441Q;ENSP00000444819:R389Q	.	R	-	2	0	GNS	63403135	1.000000	0.71417	0.931000	0.37212	0.955000	0.61496	7.028000	0.76470	2.543000	0.85770	0.491000	0.48974	CGA	GNS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	ENSG00000135677		0.453	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	HGNC	protein_coding	OTTHUMT00000401195.2	75	0.00	0	C			65116868	65116868	-1	no_errors	ENST00000258145	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	T
GOLGA7	51125	genome.wustl.edu	37	8	41367260	41367260	+	3'UTR	SNP	C	C	G			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr8:41367260C>G	ENST00000357743.4	+	0	788				GOLGA7_ENST00000520817.1_3'UTR|GOLGA7_ENST00000518270.1_3'UTR|GOLGA7_ENST00000405786.2_3'UTR|GOLGA7_ENST00000521417.1_3'UTR	NM_001002296.1	NP_001002296.1	Q7Z5G4	GOGA7_HUMAN	golgin A7						Golgi to plasma membrane protein transport (GO:0043001)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)				breast(1)|large_intestine(1)	2	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			GGAGTGACCTCTAGTCGCTCA	0.433																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF125102	CCDS34887.1, CCDS55226.1	8p11.21	2011-10-25	2010-02-12		ENSG00000147533	ENSG00000147533			24876	protein-coding gene	gene with protein product		609453	"""golgi autoantigen, golgin subfamily a, 7"""			11042152	Standard	NM_001174124		Approved	GCP16, HSPC041, GOLGA3AP1, GOLGA7A	uc003xnu.3	Q7Z5G4	OTTHUMG00000164077	ENST00000357743.4:c.*173C>G	8.37:g.41367260C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSX9|J3KQ24|Q96EQ4|Q9P1S0|Q9Y5U7	RNA	SNP	-	NULL	ENST00000357743.4	37	NULL	CCDS34887.1	8																																																																																			GOLGA7	-	-	ENSG00000147533		0.433	GOLGA7-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GOLGA7	HGNC	protein_coding	OTTHUMT00000377142.1	58	0.00	0	C	NM_016099		41367260	41367260	+1	no_errors	ENST00000521417	ensembl	human	known	69_37n	rna	33	15.38	6	SNP	0.104	G
GPR113	165082	genome.wustl.edu	37	2	26534175	26534175	+	Silent	SNP	G	G	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr2:26534175G>A	ENST00000311519.1	-	11	2420	c.2421C>T	c.(2419-2421)ttC>ttT	p.F807F	GPR113_ENST00000421160.2_Silent_p.F738F|GPR113_ENST00000541401.1_Silent_p.F410F|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Silent_p.F608F	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	807					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGCGTGGCGGAAATAGGAGA	0.617																																						dbGAP											0													72.0	59.0	63.0					2																	26534175		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2421C>T	2.37:g.26534175G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.F608	ENST00000311519.1	37	c.1824	CCDS46239.1	2																																																																																			GPR113	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000173567		0.617	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	HGNC	protein_coding	OTTHUMT00000316892.1	32	0.00	0	G	NM_153835		26534175	26534175	-1	no_errors	ENST00000333478	ensembl	human	known	69_37n	silent	18	28.00	7	SNP	0.994	A
GPRC5D	55507	genome.wustl.edu	37	12	13102974	13102974	+	Silent	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr12:13102974C>T	ENST00000228887.1	-	1	344	c.345G>A	c.(343-345)gtG>gtA	p.V115V	GPRC5D_ENST00000396333.3_Silent_p.V115V|RP11-392P7.6_ENST00000394742.3_RNA|RP11-392P7.6_ENST00000545914.1_RNA|RP11-392P7.6_ENST00000542078.1_RNA|RP11-392P7.6_ENST00000540198.1_RNA|RP11-392P7.6_ENST00000538231.1_RNA|RP11-392P7.6_ENST00000543515.2_RNA|RP11-392P7.6_ENST00000536029.1_RNA	NM_018654.1	NP_061124.1	Q9NZD1	GPC5D_HUMAN	G protein-coupled receptor, class C, group 5, member D	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			kidney(2)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		GAACCAGCTTCACTAGATTGG	0.473																																						dbGAP											0													101.0	88.0	93.0					12																	13102974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF209923	CCDS8658.1	12p13.3	2014-01-30	2014-01-30		ENSG00000111291	ENSG00000111291		"""GPCR / Class C : Orphans"""	13310	protein-coding gene	gene with protein product		607437	"""G protein-coupled receptor, family C, group 5, member D"""				Standard	XM_005253421		Approved		uc010shp.2	Q9NZD1	OTTHUMG00000168711	ENST00000228887.1:c.345G>A	12.37:g.13102974C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KNV3|Q7Z5J9|Q8TDS6	Silent	SNP	pfam_GPCR_3_C	p.V115	ENST00000228887.1	37	c.345	CCDS8658.1	12																																																																																			GPRC5D	-	pfam_GPCR_3_C	ENSG00000111291		0.473	GPRC5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5D	HGNC	protein_coding	OTTHUMT00000400687.1	92	0.00	0	C			13102974	13102974	-1	no_errors	ENST00000228887	ensembl	human	known	69_37n	silent	52	13.33	8	SNP	0.933	T
GRN	2896	genome.wustl.edu	37	17	42427675	42427675	+	Silent	SNP	C	C	A	rs369649646		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr17:42427675C>A	ENST00000053867.3	+	5	491	c.429C>A	c.(427-429)gtC>gtA	p.V143V	GRN_ENST00000589265.1_Silent_p.V143V	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	143					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GTGTTATGGTCGATGGCTCCT	0.612																																						dbGAP											0													201.0	179.0	187.0					17																	42427675		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.429C>A	17.37:g.42427675C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Silent	SNP	pfam_Granulin,smart_Granulin	p.V143	ENST00000053867.3	37	c.429	CCDS11483.1	17	.	.	.	.	.	.	.	.	.	.	C	10.49	1.366134	0.24684	.	.	ENSG00000030582	ENST00000393566	.	.	.	4.22	-8.45	0.00946	.	.	.	.	.	.	.	.	.	.	.	0.34886	D	0.745074	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-0.0416	1.9805	0.03425	0.3557:0.3273:0.1956:0.1214	.	.	.	.	X	50	.	ENSP00000377196:S50X	S	+	2	0	GRN	39783201	0.000000	0.05858	0.001000	0.08648	0.630000	0.37929	-5.034000	0.00158	-2.776000	0.00362	-0.672000	0.03802	TCG	GRN	-	pfam_Granulin,smart_Granulin	ENSG00000030582		0.612	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRN	HGNC	protein_coding	OTTHUMT00000457766.1	89	0.00	0	C	NM_002087		42427675	42427675	+1	no_errors	ENST00000053867	ensembl	human	known	69_37n	silent	55	12.70	8	SNP	0.000	A
HERC2P2	400322	genome.wustl.edu	37	15	23282925	23282925	+	RNA	SNP	G	G	T	rs148730893		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr15:23282925G>T	ENST00000560464.1	-	0	5325									hect domain and RLD 2 pseudogene 2																		GTGGATGAAAGCTTTAAAACT	0.443																																						dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23282925G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.443	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	31	0.00	0	G			23282925	23282925	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	19	17.39	4	SNP	0.971	T
ICA1L	130026	genome.wustl.edu	37	2	203693719	203693719	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr2:203693719C>G	ENST00000392237.2	-	3	171	c.14G>C	c.(13-15)gGg>gCg	p.G5A	ICA1L_ENST00000425178.1_Missense_Mutation_p.G5A|ICA1L_ENST00000418208.1_Missense_Mutation_p.G5A|ICA1L_ENST00000358299.2_Missense_Mutation_p.G5A	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	5										breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCTGGGTTGCCCAAAGGAATC	0.378																																						dbGAP											0													132.0	117.0	123.0					2																	203693719		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.14G>C	2.37:g.203693719C>G	ENSP00000376070:p.Gly5Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Missense_Mutation	SNP	pfam_Islet_autoAg_Ica1_C,pfam_Arfaptin_homology_dom,pfscan_Arfaptin_homology_dom	p.G5A	ENST00000392237.2	37	c.14	CCDS2354.1	2	.	.	.	.	.	.	.	.	.	.	C	10.11	1.260388	0.23051	.	.	ENSG00000163596	ENST00000392237;ENST00000358299;ENST00000420558;ENST00000425178;ENST00000418208;ENST00000450143;ENST00000435143;ENST00000419460;ENST00000441547;ENST00000412210;ENST00000457524;ENST00000432273;ENST00000416760;ENST00000454326;ENST00000411681;ENST00000421334	.	.	.	5.91	2.11	0.27256	.	0.163853	0.53938	D	0.000057	T	0.20210	0.0486	L	0.35414	1.06	0.20926	N	0.99983	B;B	0.24768	0.0;0.111	B;B	0.28916	0.001;0.096	T	0.22347	-1.0219	9	0.10111	T	0.7	.	2.5334	0.04709	0.1435:0.4246:0.2779:0.154	.	5;5	Q96Q33;Q8NDH6	.;ICA1L_HUMAN	A	5	.	ENSP00000351047:G5A	G	-	2	0	ICA1L	203401964	0.028000	0.19301	0.994000	0.49952	0.978000	0.69477	0.321000	0.19558	0.109000	0.17891	-0.156000	0.13503	GGG	ICA1L	-	NULL	ENSG00000163596		0.378	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICA1L	HGNC	protein_coding	OTTHUMT00000256330.1	99	0.00	0	C	NM_138468		203693719	203693719	-1	no_errors	ENST00000358299	ensembl	human	known	69_37n	missense	52	23.19	16	SNP	0.909	G
IFT27	11020	genome.wustl.edu	37	22	37157021	37157021	+	Intron	SNP	G	G	A	rs571515526		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr22:37157021G>A	ENST00000433985.2	-	6	883				IFT27_ENST00000340630.5_Intron|IFT27_ENST00000453009.2_Intron	NM_001177701.2	NP_001171172.1	Q9BW83	IFT27_HUMAN	intraflagellar transport 27						small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	GTP binding (GO:0005525)			endometrium(3)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CCTTGGCTGCGTCTCAAGCTG	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20319	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			Z80897	CCDS13932.1, CCDS54523.1	22q13.1	2014-07-03	2014-07-03	2010-04-22	ENSG00000100360	ENSG00000100360		"""Intraflagellar transport homologs"", ""RAB, member RAS oncogene"""	18626	protein-coding gene	gene with protein product		615870	"""RAB, member of RAS oncogene family-like 4"", ""intraflagellar transport 27 homolog (Chlamydomonas)"""	RABL4		12529303, 17276912	Standard	NM_001177701		Approved	RAYL, BBS19	uc003apv.3	Q9BW83	OTTHUMG00000150544	ENST00000433985.2:c.462+1926C>T	22.37:g.37157021G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60897	RNA	SNP	-	NULL	ENST00000433985.2	37	NULL	CCDS54523.1	22																																																																																			IFT27	-	-	ENSG00000100360		0.522	IFT27-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT27	HGNC	protein_coding		152	0.00	0	G	NM_006860		37157021	37157021	-1	no_errors	ENST00000474616	ensembl	human	known	69_37n	rna	73	16.09	14	SNP	0.000	A
KAT2B	8850	genome.wustl.edu	37	3	20168950	20168950	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr3:20168950G>A	ENST00000263754.4	+	11	2113	c.1658G>A	c.(1657-1659)cGt>cAt	p.R553H		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	553	N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						AAAGATGGCCGTGTTATTGGT	0.368																																						dbGAP											0													217.0	195.0	203.0					3																	20168950		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1658G>A	3.37:g.20168950G>A	ENSP00000263754:p.Arg553His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSK1	Missense_Mutation	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.R553H	ENST00000263754.4	37	c.1658	CCDS2634.1	3	.	.	.	.	.	.	.	.	.	.	G	25.0	4.597186	0.87055	.	.	ENSG00000114166	ENST00000263754	T	0.23147	1.92	5.89	5.89	0.94794	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.30386	0.0763	L	0.43554	1.36	0.80722	D	1	P	0.51449	0.945	B	0.43754	0.43	T	0.01652	-1.1303	10	0.54805	T	0.06	-13.5765	20.2566	0.98424	0.0:0.0:1.0:0.0	.	553	Q92831	KAT2B_HUMAN	H	553	ENSP00000263754:R553H	ENSP00000263754:R553H	R	+	2	0	KAT2B	20143954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.793000	0.96121	0.561000	0.74099	CGT	KAT2B	-	pirsf_Hist_acetylase_PCAF,pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000114166		0.368	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	107	0.00	0	G	NM_003884		20168950	20168950	+1	no_errors	ENST00000263754	ensembl	human	known	69_37n	missense	84	16.00	16	SNP	1.000	A
KLHL14	57565	genome.wustl.edu	37	18	30260203	30260203	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr18:30260203G>T	ENST00000359358.4	-	7	1955	c.1517C>A	c.(1516-1518)aCa>aAa	p.T506K		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	506						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						TGCACGTTTTGTGTTCATATC	0.373																																						dbGAP											0													162.0	140.0	147.0					18																	30260203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1517C>A	18.37:g.30260203G>T	ENSP00000352314:p.Thr506Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T506K	ENST00000359358.4	37	c.1517	CCDS32813.1	18	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542087	0.85917	.	.	ENSG00000197705	ENST00000359358	T	0.67698	-0.28	5.87	5.87	0.94306	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.78929	0.4361	L	0.60957	1.885	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.71397	-0.4605	10	0.18276	T	0.48	.	20.2033	0.98269	0.0:0.0:1.0:0.0	.	506	Q9P2G3	KLH14_HUMAN	K	506	ENSP00000352314:T506K	ENSP00000352314:T506K	T	-	2	0	KLHL14	28514201	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.444000	0.97578	2.779000	0.95612	0.655000	0.94253	ACA	KLHL14	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197705		0.373	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	70	0.00	0	G			30260203	30260203	-1	no_errors	ENST00000359358	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	1.000	T
KLHL8	57563	genome.wustl.edu	37	4	88099658	88099658	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr4:88099658C>T	ENST00000273963.5	-	5	1408	c.1067G>A	c.(1066-1068)aGg>aAg	p.R356K	KLHL8_ENST00000545252.1_Missense_Mutation_p.R5K|KLHL8_ENST00000512111.1_Missense_Mutation_p.R356K|KLHL8_ENST00000425278.2_Missense_Mutation_p.R173K|KLHL8_ENST00000498875.2_Missense_Mutation_p.R280K	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	356					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CACATGTCGCCTTCGACTATT	0.408																																						dbGAP											0													177.0	165.0	169.0					4																	88099658		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1067G>A	4.37:g.88099658C>T	ENSP00000273963:p.Arg356Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XA3|Q6N018	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_Kelch_2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R356K	ENST00000273963.5	37	c.1067	CCDS3617.1	4	.	.	.	.	.	.	.	.	.	.	C	36	5.631339	0.96682	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000425278;ENST00000545252;ENST00000512111	D;T;T;D;D	0.85258	-1.96;-1.24;-1.24;-1.96;-1.96	5.67	5.67	0.87782	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.94974	0.8374	H	0.94306	3.52	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.999	D	0.95792	0.8825	10	0.87932	D	0	.	19.7635	0.96333	0.0:1.0:0.0:0.0	.	173;280;356	Q68DU9;Q6N018;Q9P2G9	.;.;KLHL8_HUMAN	K	356;280;173;5;356	ENSP00000273963:R356K;ENSP00000426451:R280K;ENSP00000408854:R173K;ENSP00000439514:R5K;ENSP00000424131:R356K	ENSP00000273963:R356K	R	-	2	0	KLHL8	88318682	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.639000	0.83342	2.669000	0.90835	0.655000	0.94253	AGG	KLHL8	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000145332		0.408	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL8	HGNC	protein_coding	OTTHUMT00000253040.1	57	0.00	0	C			88099658	88099658	-1	no_errors	ENST00000273963	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	1.000	T
LATS2	26524	genome.wustl.edu	37	13	21563388	21563388	+	Silent	SNP	G	G	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr13:21563388G>T	ENST00000382592.4	-	4	936	c.531C>A	c.(529-531)ggC>ggA	p.G177G	LATS2_ENST00000542899.1_Silent_p.G177G|LATS2_ENST00000472754.1_5'UTR	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CAAACGAATCGCCGGTTCCTT	0.637																																						dbGAP											0													102.0	81.0	88.0					13																	21563388		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.531C>A	13.37:g.21563388G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.G177	ENST00000382592.4	37	c.531	CCDS9294.1	13																																																																																			LATS2	-	NULL	ENSG00000150457		0.637	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1	90	0.00	0	G			21563388	21563388	-1	no_errors	ENST00000382592	ensembl	human	known	69_37n	silent	55	15.38	10	SNP	0.000	T
LINC00032	158035	genome.wustl.edu	37	9	27258725	27258725	+	lincRNA	SNP	A	A	T	rs10967818	byFrequency	TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr9:27258725A>T	ENST00000425633.1	-	0	2572					NR_026679.1		P0C843	CI014_HUMAN	long intergenic non-protein coding RNA 32																		GATCCAAGGAAACCTCCACAA	0.478													A|||	557	0.111222	0.0726	0.2248	5008	,	,		15269	0.002		0.1899	False		,,,				2504	0.1145					dbGAP											0																																										-	-	-			0			AF418573		9p21	2012-10-12	2011-08-10	2011-08-10	ENSG00000231459	ENSG00000231459		"""Long non-coding RNAs"""	16506	non-coding RNA	RNA, long non-coding			"""chromosome 9 open reading frame 14"", ""non-protein coding RNA 32"""	C9orf14, NCRNA00032			Standard	NR_026679		Approved		uc010mjd.2	P0C843	OTTHUMG00000019711		9.37:g.27258725A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425633.1	37	NULL		9																																																																																			LINC00032	-	-	ENSG00000231459		0.478	LINC00032-001	KNOWN	basic	lincRNA	LINC00032	HGNC	lincRNA	OTTHUMT00000051963.1	54	0.00	0	A	NR_026679		27258725	27258725	-1	no_errors	ENST00000425633	ensembl	human	known	69_37n	rna	44	10.20	5	SNP	0.014	T
LINGO4	339398	genome.wustl.edu	37	1	151774341	151774341	+	Silent	SNP	G	G	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr1:151774341G>T	ENST00000368820.3	-	2	1777	c.840C>A	c.(838-840)gtC>gtA	p.V280V		NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	280						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACAGATCCAGGACCCTGAGGA	0.627																																						dbGAP											0													63.0	69.0	67.0					1																	151774341		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.840C>A	1.37:g.151774341G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V280	ENST00000368820.3	37	c.840	CCDS30855.1	1																																																																																			LINGO4	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000213171		0.627	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO4	HGNC	protein_coding	OTTHUMT00000036639.1	83	0.00	0	G	XM_291387		151774341	151774341	-1	no_errors	ENST00000368820	ensembl	human	known	69_37n	silent	38	38.71	24	SNP	1.000	T
ABHD16A	7920	genome.wustl.edu	37	6	31654914	31654914	+	3'UTR	SNP	G	G	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr6:31654914G>A	ENST00000395952.3	-	0	1914				ABHD16A_ENST00000471644.1_5'Flank|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000375842.4_3'UTR	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A							integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CATGAACACAGAGAATCACAA	0.493																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.*75C>T	6.37:g.31654914G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	RNA	SNP	-	NULL	ENST00000395952.3	37	NULL	CCDS4713.1	6																																																																																			LY6G6E	-	-	ENSG00000204422		0.493	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6G6E	HGNC	protein_coding	OTTHUMT00000076342.4	86	0.00	0	G			31654914	31654914	-1	no_errors	ENST00000461287	ensembl	human	known	69_37n	rna	39	13.04	6	SNP	0.062	A
MSN	4478	genome.wustl.edu	37	X	64959699	64959699	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chrX:64959699C>T	ENST00000360270.5	+	13	1850	c.1678C>T	c.(1678-1680)Cgc>Tgc	p.R560C		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	560					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						CAAGACCCTGCGCCAGATCCG	0.542			T	ALK	ALCL																																	dbGAP		Dom	yes		X	Xq11.2-q12	4478	moesin		L	0													123.0	98.0	106.0					X																	64959699		2203	4300	6503	-	-	-	SO:0001583	missense	0			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1678C>T	X.37:g.64959699C>T	ENSP00000353408:p.Arg560Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin,smart_Band_41_domain,prints_Ez/rad/moesin,prints_Band_41_fam,pfscan_FERM_domain	p.R560C	ENST00000360270.5	37	c.1678	CCDS14382.1	X	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297814	0.81025	.	.	ENSG00000147065	ENST00000360270	D	0.88277	-2.36	5.67	5.67	0.87782	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95551	0.8554	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96138	0.9098	10	0.66056	D	0.02	.	17.135	0.86737	0.0:1.0:0.0:0.0	.	560	P26038	MOES_HUMAN	C	560	ENSP00000353408:R560C	ENSP00000353408:R560C	R	+	1	0	MSN	64876424	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.847000	0.62867	2.368000	0.80403	0.594000	0.82650	CGC	MSN	-	pirsf_ERM,pfam_ERM_C,superfamily_Moesin,prints_Ez/rad/moesin	ENSG00000147065		0.542	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSN	HGNC	protein_coding	OTTHUMT00000056981.1	82	0.00	0	C	NM_002444		64959699	64959699	+1	no_errors	ENST00000360270	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152507221	152507221	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr2:152507221C>G	ENST00000172853.10	-	53	7241	c.7094G>C	c.(7093-7095)gGa>gCa	p.G2365A	NEB_ENST00000397345.3_Missense_Mutation_p.G2365A|NEB_ENST00000604864.1_Missense_Mutation_p.G2365A|NEB_ENST00000409198.1_Missense_Mutation_p.G2365A|NEB_ENST00000427231.2_Missense_Mutation_p.G2365A|NEB_ENST00000603639.1_Missense_Mutation_p.G2365A			P20929	NEBU_HUMAN	nebulin	2365					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CAGTACCACTCCCAACATGTC	0.463																																						dbGAP											0													294.0	294.0	294.0					2																	152507221		2018	4176	6194	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7094G>C	2.37:g.152507221C>G	ENSP00000172853:p.Gly2365Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.G2365A	ENST00000172853.10	37	c.7094		2	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017693	0.54576	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.47	4.58	0.56647	.	0.309039	0.31268	N	0.007954	T	0.26268	0.0641	L	0.52266	1.64	0.80722	D	1	P	0.46327	0.876	B	0.37091	0.241	T	0.05084	-1.0907	10	0.15499	T	0.54	.	16.2184	0.82243	0.0:0.8668:0.1332:0.0	.	2365	P20929	NEBU_HUMAN	A	2365	ENSP00000386259:G2365A;ENSP00000380505:G2365A;ENSP00000416578:G2365A;ENSP00000172853:G2365A	ENSP00000172853:G2365A	G	-	2	0	NEB	152215467	0.997000	0.39634	0.860000	0.33809	0.907000	0.53573	3.240000	0.51368	1.302000	0.44855	0.650000	0.86243	GGA	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.463	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		108	0.00	0	C	NM_004543		152507221	152507221	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	65	27.78	25	SNP	0.987	G
NR2E1	7101	genome.wustl.edu	37	6	108497706	108497706	+	Splice_Site	SNP	G	G	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr6:108497706G>A	ENST00000368986.4	+	4	967		c.e4-1		NR2E1_ENST00000484978.1_Splice_Site|NR2E1_ENST00000368983.3_Splice_Site	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1						aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		TGCCTCTGCAGCCGTGCAGCA	0.662																																						dbGAP											0													23.0	25.0	24.0					6																	108497706		2200	4296	6496	-	-	-	SO:0001630	splice_region_variant	0			Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.260-1G>A	6.37:g.108497706G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMP8	Splice_Site	SNP	-	e4-1	ENST00000368986.4	37	c.260-1	CCDS5063.1	6	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104521	0.77096	.	.	ENSG00000112333	ENST00000368986;ENST00000368983;ENST00000426403	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9534	0.64133	0.075:0.0:0.925:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NR2E1	108604399	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.600000	0.82769	2.655000	0.90218	0.655000	0.94253	.	NR2E1	-	-	ENSG00000112333		0.662	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2E1	HGNC	protein_coding	OTTHUMT00000041712.2	69	0.00	0	G		Intron	108497706	108497706	+1	no_errors	ENST00000368986	ensembl	human	known	69_37n	splice_site	30	16.67	6	SNP	1.000	A
PCYT1B	9468	genome.wustl.edu	37	X	24625919	24625919	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chrX:24625919C>T	ENST00000379144.2	-	3	407	c.277G>A	c.(277-279)Gca>Aca	p.A93T	PCYT1B_ENST00000379145.1_Missense_Mutation_p.A75T|PCYT1B_ENST00000356768.4_Missense_Mutation_p.A93T	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	93					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	AGGGCTCTTGCATGACCTGAG	0.423																																						dbGAP											0													95.0	87.0	90.0					X																	24625919		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.277G>A	X.37:g.24625919C>T	ENSP00000368439:p.Ala93Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	p.A93T	ENST00000379144.2	37	c.277	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743987	0.89663	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.96856	-4.15;-4.15;-4.15	5.19	5.19	0.71726	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.000000	0.85682	D	0.000000	D	0.98432	0.9478	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.79784	0.992;0.993;0.989	D	0.99537	1.0962	10	0.72032	D	0.01	-20.9368	17.8268	0.88668	0.0:1.0:0.0:0.0	.	93;75;93	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	T	75;93;93	ENSP00000368440:A75T;ENSP00000368439:A93T;ENSP00000349211:A93T	ENSP00000349211:A93T	A	-	1	0	PCYT1B	24535840	1.000000	0.71417	0.978000	0.43139	0.709000	0.40893	7.320000	0.79064	2.398000	0.81561	0.544000	0.68410	GCA	PCYT1B	-	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	ENSG00000102230		0.423	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	63	0.00	0	C	NM_004845		24625919	24625919	-1	no_errors	ENST00000379144	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	1.000	T
PPIL4	85313	genome.wustl.edu	37	6	149867100	149867100	+	Silent	SNP	G	G	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr6:149867100G>A	ENST00000253329.2	-	1	74	c.42C>T	c.(40-42)atC>atT	p.I14I		NM_139126.3	NP_624311.1	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 4	14	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	13		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		TGTACAAGTCGATGACGACGT	0.657																																						dbGAP											0													36.0	30.0	32.0					6																	149867100		2201	4287	6488	-	-	-	SO:0001819	synonymous_variant	0				CCDS34550.1	6q25.1	2013-02-12			ENSG00000131013	ENSG00000131013		"""RNA binding motif (RRM) containing"""	15702	protein-coding gene	gene with protein product		607609					Standard	NM_139126		Approved		uc003qmo.2	Q8WUA2	OTTHUMG00000015788	ENST00000253329.2:c.42C>T	6.37:g.149867100G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD34|Q7Z3Q5	Silent	SNP	pfam_Cyclophilin-like_PPIase_dom,pfam_RRM_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.I14	ENST00000253329.2	37	c.42	CCDS34550.1	6																																																																																			PPIL4	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom	ENSG00000131013		0.657	PPIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL4	HGNC	protein_coding	OTTHUMT00000042642.1	101	0.00	0	G			149867100	149867100	-1	no_errors	ENST00000253329	ensembl	human	known	69_37n	silent	65	14.47	11	SNP	1.000	A
RBM5	10181	genome.wustl.edu	37	3	50152930	50152930	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr3:50152930G>A	ENST00000347869.3	+	21	2084	c.1909G>A	c.(1909-1911)Gag>Aag	p.E637K	RP11-493K19.3_ENST00000425674.1_RNA|RP11-493K19.3_ENST00000437204.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	637	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACTTGAGAGTGAGGAAGAGAA	0.547																																						dbGAP											0													129.0	128.0	128.0					3																	50152930		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1909G>A	3.37:g.50152930G>A	ENSP00000343054:p.Glu637Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.E637K	ENST00000347869.3	37	c.1909	CCDS2810.1	3	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664878	0.88251	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	T	0.14516	2.5	5.7	5.7	0.88788	.	0.263836	0.41001	D	0.000979	T	0.12305	0.0299	N	0.25647	0.755	0.80722	D	1	B;B	0.21688	0.059;0.004	B;B	0.23419	0.046;0.012	T	0.17198	-1.0377	10	0.13108	T	0.6	-20.1428	19.8411	0.96685	0.0:0.0:1.0:0.0	.	327;637	Q59HE6;P52756	.;RBM5_HUMAN	K	637;636;327	ENSP00000343054:E637K	ENSP00000343054:E637K	E	+	1	0	RBM5	50127934	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.636000	0.83301	2.683000	0.91414	0.655000	0.94253	GAG	RBM5	-	NULL	ENSG00000003756		0.547	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3	121	0.00	0	G	NM_005778		50152930	50152930	+1	no_errors	ENST00000347869	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	1.000	A
RECK	8434	genome.wustl.edu	37	9	36087761	36087761	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr9:36087761G>T	ENST00000377966.3	+	9	1274	c.708G>T	c.(706-708)aaG>aaT	p.K236N		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	236	5 X Knot repeats.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TGATGTCCAAGAAAACGGAAA	0.418																																						dbGAP											0													123.0	113.0	116.0					9																	36087761		2203	4300	6503	-	-	-	SO:0001583	missense	0			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.708G>T	9.37:g.36087761G>T	ENSP00000367202:p.Lys236Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Prot_inh_PMP,smart_Prot_inh_Kazal	p.K236N	ENST00000377966.3	37	c.708	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031696	0.35797	.	.	ENSG00000122707	ENST00000377966	T	0.44482	0.92	5.37	5.37	0.77165	.	0.052506	0.64402	D	0.000001	T	0.23330	0.0564	N	0.05078	-0.115	0.37059	D	0.897997	B;B	0.31730	0.337;0.337	B;B	0.25614	0.062;0.062	T	0.20009	-1.0288	10	0.31617	T	0.26	-15.7606	16.6059	0.84828	0.0:0.0:1.0:0.0	.	236;236	A8K9D8;O95980	.;RECK_HUMAN	N	236	ENSP00000367202:K236N	ENSP00000367202:K236N	K	+	3	2	RECK	36077761	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.999000	0.70665	2.517000	0.84864	0.591000	0.81541	AAG	RECK	-	NULL	ENSG00000122707		0.418	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	HGNC	protein_coding	OTTHUMT00000052409.1	133	0.00	0	G			36087761	36087761	+1	no_errors	ENST00000377966	ensembl	human	known	69_37n	missense	72	13.25	11	SNP	1.000	T
RUFY4	285180	genome.wustl.edu	37	2	218940228	218940228	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr2:218940228A>T	ENST00000344321.7	+	9	1531	c.1013A>T	c.(1012-1014)gAg>gTg	p.E338V	RUFY4_ENST00000374155.3_Missense_Mutation_p.E358V|RUFY4_ENST00000463872.1_3'UTR|RUFY4_ENST00000441828.2_3'UTR	NM_198483.3	NP_940885.2	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	338							metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(1)	10		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		AAGGAAGCAGAGTGGAGTCAC	0.597																																						dbGAP											0													38.0	43.0	42.0					2																	218940228		2053	4218	6271	-	-	-	SO:0001583	missense	0			AK128393		2q35	2007-01-29			ENSG00000188282	ENSG00000188282		"""Zinc fingers, FYVE domain containing"""	24804	protein-coding gene	gene with protein product							Standard	NM_198483		Approved	FLJ46536	uc010fvl.2	Q6ZNE9	OTTHUMG00000155235	ENST00000344321.7:c.1013A>T	2.37:g.218940228A>T	ENSP00000345900:p.Glu338Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZR96	Missense_Mutation	SNP	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,pfscan_Run	p.E358V	ENST00000344321.7	37	c.1073		2	.	.	.	.	.	.	.	.	.	.	A	12.33	1.904361	0.33628	.	.	ENSG00000188282	ENST00000344321;ENST00000374155	T;T	0.52057	1.34;0.68	4.57	2.15	0.27550	.	0.502867	0.16412	N	0.215543	T	0.37348	0.1000	N	0.24115	0.695	0.09310	N	0.999997	D	0.58268	0.982	P	0.50231	0.635	T	0.17198	-1.0377	10	0.66056	D	0.02	-7.6507	4.5043	0.11879	0.6984:0.1985:0.1031:0.0	.	338	Q6ZNE9	RUFY4_HUMAN	V	338;358	ENSP00000345900:E338V;ENSP00000363270:E358V	ENSP00000345900:E338V	E	+	2	0	RUFY4	218648473	0.451000	0.25705	0.027000	0.17364	0.034000	0.12701	1.607000	0.36836	0.267000	0.21916	0.383000	0.25322	GAG	RUFY4	-	NULL	ENSG00000188282		0.597	RUFY4-201	KNOWN	basic|appris_principal	protein_coding	RUFY4	HGNC	protein_coding		61	0.00	0	A	NM_198483		218940228	218940228	+1	no_errors	ENST00000374155	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.043	T
SEMA6C	10500	genome.wustl.edu	37	1	151107088	151107088	+	Intron	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr1:151107088C>T	ENST00000341697.3	-	17	3406				SEMA6C_ENST00000479820.1_5'Flank			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C						axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCTGCCTCTTCTGTTTACCTT	0.527																																						dbGAP											0													82.0	82.0	82.0					1																	151107088		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.1714+7G>A	1.37:g.151107088C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	RNA	SNP	-	NULL	ENST00000341697.3	37	NULL	CCDS984.1	1																																																																																			SEMA6C	-	-	ENSG00000143434		0.527	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	SEMA6C	HGNC	protein_coding	OTTHUMT00000034074.1	42	0.00	0	C	NM_030913		151107088	151107088	-1	no_errors	ENST00000489944	ensembl	human	known	69_37n	rna	25	16.67	5	SNP	0.001	T
SH2D3C	10044	genome.wustl.edu	37	9	130500738	130500738	+	3'UTR	SNP	T	T	C			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr9:130500738T>C	ENST00000314830.8	-	0	2983				SH2D3C_ENST00000429553.1_3'UTR|SH2D3C_ENST00000373274.3_3'UTR|SH2D3C_ENST00000420366.1_3'UTR|SH2D3C_ENST00000373277.4_3'UTR|SH2D3C_ENST00000373276.3_3'UTR	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C						JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GTGAGCAGCCTGCCTCCCATG	0.542																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.*287A>G	9.37:g.130500738T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	RNA	SNP	-	NULL	ENST00000314830.8	37	NULL	CCDS6877.1	9																																																																																			SH2D3C	-	-	ENSG00000095370		0.542	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH2D3C	HGNC	protein_coding	OTTHUMT00000054264.1	71	0.00	0	T	NM_005489		130500738	130500738	-1	no_errors	ENST00000473535	ensembl	human	known	69_37n	rna	44	20.00	11	SNP	0.004	C
SIGLEC10	89790	genome.wustl.edu	37	19	51920149	51920149	+	Silent	SNP	C	C	T	rs557043006		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr19:51920149C>T	ENST00000339313.5	-	3	593	c.477G>A	c.(475-477)ccG>ccA	p.P159P	SIGLEC10_ENST00000436984.2_Intron|SIGLEC10_ENST00000353836.5_Silent_p.P159P|SIGLEC10_ENST00000439889.2_Intron|CTD-2616J11.3_ENST00000532473.1_RNA|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000356298.5_Silent_p.P159P|SIGLEC10_ENST00000441969.3_Intron|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000525998.1_Silent_p.P159P|SIGLEC10_ENST00000442846.3_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	159	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		TGACCGTCACCGGCTGCCCGG	0.602																																						dbGAP											0													79.0	88.0	85.0					19																	51920149		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.477G>A	19.37:g.51920149C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P159	ENST00000339313.5	37	c.477	CCDS12832.1	19																																																																																			SIGLEC10	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000142512		0.602	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC10	HGNC	protein_coding	OTTHUMT00000384620.2	201	0.50	1	C	NM_033130		51920149	51920149	-1	no_errors	ENST00000339313	ensembl	human	known	69_37n	silent	106	13.11	16	SNP	0.000	T
SLC43A2	124935	genome.wustl.edu	37	17	1486601	1486601	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr17:1486601C>T	ENST00000301335.5	-	11	1335	c.1247G>A	c.(1246-1248)cGg>cAg	p.R416Q	SLC43A2_ENST00000571650.1_Missense_Mutation_p.R420Q|SLC43A2_ENST00000412517.3_Missense_Mutation_p.R279Q|SLC43A2_ENST00000382147.4_Missense_Mutation_p.R420Q	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2	416					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)			endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		CTGGATCTGCCGGTCCCGCTT	0.607																																						dbGAP											0													105.0	102.0	103.0					17																	1486601		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.1247G>A	17.37:g.1486601C>T	ENSP00000301335:p.Arg416Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.R420Q	ENST00000301335.5	37	c.1259	CCDS11006.1	17	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763141	0.89932	.	.	ENSG00000167703	ENST00000301335;ENST00000382147;ENST00000412517	T;T;T	0.35236	1.79;1.79;1.32	5.67	5.67	0.87782	Major facilitator superfamily domain, general substrate transporter (1);	0.093092	0.64402	D	0.000001	T	0.50650	0.1628	M	0.77103	2.36	0.44380	D	0.997288	D;D	0.56968	0.963;0.978	B;P	0.48873	0.389;0.593	T	0.45323	-0.9269	10	0.25106	T	0.35	-16.1327	20.1313	0.98000	0.0:1.0:0.0:0.0	.	416;420	Q8N370;Q8N370-3	LAT4_HUMAN;.	Q	416;420;279	ENSP00000301335:R416Q;ENSP00000371582:R420Q;ENSP00000408284:R279Q	ENSP00000301335:R416Q	R	-	2	0	SLC43A2	1433351	0.997000	0.39634	1.000000	0.80357	0.986000	0.74619	3.582000	0.53921	2.837000	0.97791	0.655000	0.94253	CGG	SLC43A2	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000167703		0.607	SLC43A2-001	KNOWN	basic|CCDS	protein_coding	SLC43A2	HGNC	protein_coding	OTTHUMT00000206717.4	136	0.00	0	C	NM_152346		1486601	1486601	-1	no_errors	ENST00000382147	ensembl	human	known	69_37n	missense	52	28.77	21	SNP	1.000	T
TOMM34	10953	genome.wustl.edu	37	20	43577409	43577409	+	Silent	SNP	G	G	C			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr20:43577409G>C	ENST00000372813.3	-	5	812	c.660C>G	c.(658-660)ctC>ctG	p.L220L	PABPC1L_ENST00000490798.1_Intron|PABPC1L_ENST00000372819.1_Intron	NM_006809.4	NP_006800.2	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	220					protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	11		Myeloproliferative disorder(115;0.0122)				TACTACACAAGAGGCTTTCAC	0.458																																						dbGAP											0													258.0	216.0	230.0					20																	43577409		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U58970	CCDS13340.1	20q12-q13.1	2013-01-10			ENSG00000025772	ENSG00000025772		"""Tetratricopeptide (TTC) repeat domain containing"""	15746	protein-coding gene	gene with protein product	"""outer mitochondrial membrane translocase (34kD)"""					9324309	Standard	NM_006809		Approved	TOM34, HTOM34P	uc002xmy.3	Q15785	OTTHUMG00000032552	ENST00000372813.3:c.660C>G	20.37:g.43577409G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GH9|Q6IBN7|Q9NTZ3	Silent	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L220	ENST00000372813.3	37	c.660	CCDS13340.1	20																																																																																			TOMM34	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000025772		0.458	TOMM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM34	HGNC	protein_coding	OTTHUMT00000079390.3	122	0.00	0	G	NM_006809		43577409	43577409	-1	no_errors	ENST00000372813	ensembl	human	known	69_37n	silent	88	10.20	10	SNP	0.980	C
UBR5	51366	genome.wustl.edu	37	8	103291367	103291367	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr8:103291367C>T	ENST00000520539.1	-	43	6677	c.6071G>A	c.(6070-6072)cGa>cAa	p.R2024Q	UBR5_ENST00000220959.4_Missense_Mutation_p.R2024Q|UBR5_ENST00000521922.1_Missense_Mutation_p.R2018Q	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2024					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GTCTGAACGTCGGAAAAATGG	0.428																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											0													110.0	110.0	110.0					8																	103291367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.6071G>A	8.37:g.103291367C>T	ENSP00000429084:p.Arg2024Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.R2024Q	ENST00000520539.1	37	c.6071	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427688	0.43122	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.38722	1.12;1.12;1.12	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.39835	0.1093	N	0.05177	-0.1	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.64042	0.921;0.921	T	0.13124	-1.0521	10	0.05620	T	0.96	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	2018;2024	E7EMW7;O95071	.;UBR5_HUMAN	Q	2024;2024;2018	ENSP00000429084:R2024Q;ENSP00000220959:R2024Q;ENSP00000427819:R2018Q	ENSP00000220959:R2024Q	R	-	2	0	UBR5	103360543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.941000	0.99782	0.655000	0.94253	CGA	UBR5	-	NULL	ENSG00000104517		0.428	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	56	0.00	0	C	NM_015902		103291367	103291367	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
UCP2	7351	genome.wustl.edu	37	11	73689402	73689402	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr11:73689402C>T	ENST00000310473.3	-	3	864	c.22G>A	c.(22-24)Gat>Aat	p.D8N	UCP2_ENST00000536983.1_Missense_Mutation_p.D8N|UCP2_ENST00000542615.1_5'Flank	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	8					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					GGGGGCACATCTGTGGCCTTG	0.522																																					Colon(191;388 2040 43557 45622 48925)	dbGAP											0													71.0	67.0	68.0					11																	73689402		2200	4293	6493	-	-	-	SO:0001583	missense	0			U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.22G>A	11.37:g.73689402C>T	ENSP00000312029:p.Asp8Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4PJH8|Q53HM3	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.D8N	ENST00000310473.3	37	c.22	CCDS8228.1	11	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822890	0.71028	.	.	ENSG00000175567	ENST00000310473;ENST00000536983;ENST00000539764	T;T;T	0.79352	-1.21;-1.26;0.24	6.07	5.13	0.70059	Mitochondrial carrier domain (1);	0.135676	0.64402	D	0.000005	T	0.69691	0.3139	L	0.34521	1.04	0.58432	D	0.999993	B;B	0.11235	0.004;0.001	B;B	0.15052	0.012;0.003	T	0.65516	-0.6149	10	0.52906	T	0.07	-1.195	15.5664	0.76298	0.1381:0.8619:0.0:0.0	.	8;8	F5GX45;P55851	.;UCP2_HUMAN	N	8	ENSP00000312029:D8N;ENSP00000441147:D8N;ENSP00000438230:D8N	ENSP00000312029:D8N	D	-	1	0	UCP2	73367050	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	5.913000	0.69957	2.884000	0.98904	0.655000	0.94253	GAT	UCP2	-	superfamily_Mt_carrier_dom	ENSG00000175567		0.522	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP2	HGNC	protein_coding	OTTHUMT00000398108.1	49	0.00	0	C	NM_003355		73689402	73689402	-1	no_errors	ENST00000310473	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	1.000	T
USP46	64854	genome.wustl.edu	37	4	53468094	53468094	+	Silent	SNP	G	G	A	rs189746044		TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr4:53468094G>A	ENST00000441222.3	-	7	1033	c.849C>T	c.(847-849)ttC>ttT	p.F283F	USP46_ENST00000451218.2_Silent_p.F256F|USP46_ENST00000508499.1_Silent_p.F276F	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	283	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TGGAGGTGTTGAAGAGCCGGA	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		19483	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													116.0	115.0	115.0					4																	53468094		2083	4214	6297	-	-	-	SO:0001819	synonymous_variant	0			AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.849C>T	4.37:g.53468094G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.F283	ENST00000441222.3	37	c.849	CCDS47053.1	4																																																																																			USP46	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000109189		0.537	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	HGNC	protein_coding	OTTHUMT00000361516.2	159	0.00	0	G	NM_022832		53468094	53468094	-1	no_errors	ENST00000441222	ensembl	human	known	69_37n	silent	78	16.13	15	SNP	1.000	A
XPA	7507	genome.wustl.edu	37	9	100449497	100449497	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr9:100449497G>T	ENST00000375128.4	-	4	500	c.436C>A	c.(436-438)Caa>Aaa	p.Q146K		NM_000380.3	NP_000371.1	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A	146					DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|large_intestine(1)|lung(4)|prostate(1)	11		Acute lymphoblastic leukemia(62;0.158)				AGATATTCTTGTTTTGCCTCT	0.303			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (A)	9	9q22.3	7507	"""xeroderma pigmentosum, complementation group A"""		E	0													99.0	98.0	99.0					9																	100449497		2203	4298	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	D14533	CCDS6729.1	9q22.3	2014-09-17			ENSG00000136936	ENSG00000136936			12814	protein-coding gene	gene with protein product		611153					Standard	NM_000380		Approved	XPAC, XP1	uc004axr.4	P23025	OTTHUMG00000020330	ENST00000375128.4:c.436C>A	9.37:g.100449497G>T	ENSP00000364270:p.Gln146Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1U9|Q6LCW7|Q6LD02	Missense_Mutation	SNP	pfam_XPA_C,pfam_Znf_XPA_CS,superfamily_DNA-bd_dom_put,tigrfam_XPA	p.Q146K	ENST00000375128.4	37	c.436	CCDS6729.1	9	.	.	.	.	.	.	.	.	.	.	G	12.45	1.943116	0.34283	.	.	ENSG00000136936	ENST00000375128	T	0.60299	0.2	5.34	4.43	0.53597	DNA binding domain, putative (1);XPA C- terminal (1);XPA, conserved site (1);	0.218016	0.49305	D	0.000160	T	0.45296	0.1335	L	0.27944	0.81	0.52099	D	0.999949	B	0.22983	0.078	B	0.23419	0.046	T	0.35968	-0.9767	10	0.38643	T	0.18	.	13.6959	0.62580	0.0:0.1549:0.8451:0.0	.	146	P23025	XPA_HUMAN	K	146	ENSP00000364270:Q146K	ENSP00000364270:Q146K	Q	-	1	0	XPA	99489318	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.243000	0.51392	1.393000	0.46605	-0.165000	0.13383	CAA	XPA	-	pfam_XPA_C,superfamily_DNA-bd_dom_put,tigrfam_XPA	ENSG00000136936		0.303	XPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPA	HGNC	protein_coding	OTTHUMT00000053332.1	31	0.00	0	G	NM_000380		100449497	100449497	-1	no_errors	ENST00000375128	ensembl	human	known	69_37n	missense	18	14.29	3	SNP	1.000	T
ZNF83	55769	genome.wustl.edu	37	19	53117169	53117169	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XZ-01A-42D-A23C-09	TCGA-A2-A3XZ-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c2a05d-7caa-4362-9be1-17ac4bbeb721	7bcc1bd0-f9a3-4d1c-ba0d-1cc038653aae	g.chr19:53117169T>A	ENST00000597597.1	-	2	2902	c.649A>T	c.(649-651)Att>Ttt	p.I217F	ZNF83_ENST00000544146.1_Missense_Mutation_p.I217F|ZNF83_ENST00000536937.1_Missense_Mutation_p.I217F|ZNF83_ENST00000545872.1_Missense_Mutation_p.I217F|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000541777.2_Missense_Mutation_p.I217F|ZNF83_ENST00000391789.4_Missense_Mutation_p.I217F|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000301096.3_Missense_Mutation_p.I217F			P51522	ZNF83_HUMAN	zinc finger protein 83	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		AGGTGTGAAATTTGATGGAAG	0.378																																						dbGAP											0													94.0	88.0	90.0					19																	53117169		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.649A>T	19.37:g.53117169T>A	ENSP00000472619:p.Ile217Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I217F	ENST00000597597.1	37	c.649	CCDS12854.1	19	.	.	.	.	.	.	.	.	.	.	t	5.392	0.257530	0.10239	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.37235	5.45;5.45;5.45;5.45;5.45;1.21	1.7	0.589	0.17452	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13798	0.0334	N	0.08118	0	0.09310	N	1	B;P	0.39809	0.379;0.689	B;B	0.34385	0.059;0.181	T	0.17228	-1.0376	9	0.11794	T	0.64	.	6.8801	0.24168	0.0:0.0:0.2366:0.7633	.	217;217	P51522-2;P51522	.;ZNF83_HUMAN	F	217	ENSP00000445993:I217F;ENSP00000301096:I217F;ENSP00000445470:I217F;ENSP00000440713:I217F;ENSP00000439681:I217F;ENSP00000375666:I217F	ENSP00000301096:I217F	I	-	1	0	ZNF83	57808981	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.132000	0.10467	0.099000	0.17552	0.383000	0.25322	ATT	ZNF83	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167766		0.378	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	41	0.00	0	T	NM_018300		53117169	53117169	-1	no_errors	ENST00000301096	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.001	A
