#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA12	26154	genome.wustl.edu	37	2	215896643	215896643	+	Intron	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr2:215896643G>A	ENST00000272895.7	-	9	1205				ABCA12_ENST00000389661.4_Silent_p.T3T|AC072062.3_ENST00000437897.3_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12						cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTTTTATATAGGTAAACATTT	0.368																																					Ovarian(66;664 1488 5121 34295)	dbGAP											0													88.0	92.0	91.0					2																	215896643		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.986-23C>T	2.37:g.215896643G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T3	ENST00000272895.7	37	c.9	CCDS33372.1	2																																																																																			ABCA12	-	NULL	ENSG00000144452		0.368	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	54	0.00	0	G	NM_173076		215896643	215896643	-1	no_errors	ENST00000389661	ensembl	human	known	69_37n	silent	47	12.96	7	SNP	0.000	A
ACSM5	54988	genome.wustl.edu	37	16	20442356	20442356	+	Silent	SNP	T	T	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr16:20442356T>A	ENST00000331849.4	+	9	1314	c.1167T>A	c.(1165-1167)tcT>tcA	p.S389S		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	389					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						AAATCAAGTCTGGATCCATGG	0.542																																						dbGAP											0													224.0	209.0	214.0					16																	20442356		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1167T>A	16.37:g.20442356T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.S389	ENST00000331849.4	37	c.1167	CCDS10585.1	16																																																																																			ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.542	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	92	0.00	0	T	NM_017888		20442356	20442356	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	silent	84	17.65	18	SNP	0.991	A
ABCC12	94160	genome.wustl.edu	37	16	48138177	48138177	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr16:48138177G>T	ENST00000311303.3	-	20	3121	c.2776C>A	c.(2776-2778)Cac>Aac	p.H926N	ABCC12_ENST00000448542.1_Intron|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	926	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TTCTCTGCGTGAAACGGCAGC	0.488																																						dbGAP											0													171.0	161.0	165.0					16																	48138177		2201	4300	6501	-	-	-	SO:0001583	missense	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2776C>A	16.37:g.48138177G>T	ENSP00000311030:p.His926Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.H926N	ENST00000311303.3	37	c.2776	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486704	0.26686	.	.	ENSG00000140798	ENST00000311303;ENST00000449939	D	0.88431	-2.38	5.55	5.55	0.83447	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.234363	0.44483	D	0.000443	T	0.80132	0.4567	N	0.16368	0.405	0.80722	D	1	B	0.02656	0.0	B	0.17098	0.017	T	0.73984	-0.3810	10	0.27785	T	0.31	.	12.0474	0.53487	0.0:0.0:0.8279:0.1721	.	926	Q96J65	MRP9_HUMAN	N	926;844	ENSP00000311030:H926N	ENSP00000311030:H926N	H	-	1	0	ABCC12	46695678	1.000000	0.71417	0.800000	0.32199	0.952000	0.60782	1.318000	0.33643	2.594000	0.87642	0.655000	0.94253	CAC	ABCC12	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000140798		0.488	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	53	0.00	0	G	NM_033226		48138177	48138177	-1	no_errors	ENST00000311303	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	0.993	T
ADAM20	8748	genome.wustl.edu	37	14	70990617	70990617	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr14:70990617G>T	ENST00000256389.3	-	2	1252	c.1008C>A	c.(1006-1008)aaC>aaA	p.N336K	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	286	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		GATTATTAAGGTTATAATTCT	0.358																																						dbGAP											0													139.0	91.0	108.0					14																	70990617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.1008C>A	14.37:g.70990617G>T	ENSP00000256389:p.Asn336Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.N336K	ENST00000256389.3	37	c.1008	CCDS32111.1	14	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772216	0.31411	.	.	ENSG00000134007	ENST00000256389	T	0.62105	0.05	4.39	-3.6	0.04570	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	1.240070	0.06318	U	0.704025	T	0.43478	0.1249	L	0.34521	1.04	0.09310	N	1	B	0.18741	0.03	B	0.29440	0.102	T	0.25328	-1.0135	10	0.17369	T	0.5	.	0.6161	0.00769	0.2362:0.1349:0.3127:0.3162	.	286	O43506	ADA20_HUMAN	K	336	ENSP00000256389:N336K	ENSP00000256389:N336K	N	-	3	2	ADAM20	70060370	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.515000	0.02252	-1.140000	0.02877	-0.259000	0.10710	AAC	ADAM20	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000134007		0.358	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM20	HGNC	protein_coding	OTTHUMT00000395004.2	17	0.00	0	G			70990617	70990617	-1	no_errors	ENST00000256389	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.000	T
AHNAK	79026	genome.wustl.edu	37	11	62288700	62288700	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr11:62288700G>A	ENST00000378024.4	-	5	13463	c.13189C>T	c.(13189-13191)Ccc>Tcc	p.P4397S	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4397					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTCACTTTGGGACCCTTCAAG	0.468																																						dbGAP											0													149.0	157.0	154.0					11																	62288700		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13189C>T	11.37:g.62288700G>A	ENSP00000367263:p.Pro4397Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P4397S	ENST00000378024.4	37	c.13189	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010494	0.75046	.	.	ENSG00000124942	ENST00000378024	T	0.03152	4.03	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.19406	0.0466	M	0.81682	2.555	0.50039	D	0.999841	D	0.76494	0.999	D	0.85130	0.997	T	0.01657	-1.1302	10	0.34782	T	0.22	.	17.6111	0.88053	0.0:0.0:1.0:0.0	.	4397	Q09666	AHNK_HUMAN	S	4397	ENSP00000367263:P4397S	ENSP00000367263:P4397S	P	-	1	0	AHNAK	62045276	1.000000	0.71417	0.950000	0.38849	0.893000	0.52053	4.773000	0.62331	2.300000	0.77407	0.551000	0.68910	CCC	AHNAK	-	NULL	ENSG00000124942		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	96	0.00	0	G	NM_024060		62288700	62288700	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	111	21.83	31	SNP	1.000	A
AIDA	64853	genome.wustl.edu	37	1	222885594	222885594	+	Silent	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:222885594G>A	ENST00000340020.6	-	1	272	c.66C>T	c.(64-66)ttC>ttT	p.F22F	AIDA_ENST00000474863.1_5'UTR|BROX_ENST00000537020.1_5'Flank|AIDA_ENST00000355727.2_Silent_p.F22F|AIDA_ENST00000541237.1_Intron|BROX_ENST00000340934.5_5'Flank|BROX_ENST00000539697.1_5'Flank	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	22					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						CCCAAGAGTCGAAGTCGGCGC	0.672																																						dbGAP											0													21.0	17.0	19.0					1																	222885594		2202	4296	6498	-	-	-	SO:0001819	synonymous_variant	0			BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.66C>T	1.37:g.222885594G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Silent	SNP	pfam_AIDA,superfamily_AIDA_N	p.F22	ENST00000340020.6	37	c.66	CCDS1533.1	1																																																																																			AIDA	-	pfam_AIDA,superfamily_AIDA_N	ENSG00000186063		0.672	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AIDA	HGNC	protein_coding	OTTHUMT00000091818.1	42	0.00	0	G	NM_022831		222885594	222885594	-1	no_errors	ENST00000340020	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	1.000	A
AKAP13	11214	genome.wustl.edu	37	15	86123427	86123427	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr15:86123427G>A	ENST00000394518.2	+	7	2223	c.2128G>A	c.(2128-2130)Gaa>Aaa	p.E710K	AKAP13_ENST00000361243.2_Missense_Mutation_p.E710K|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	710					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CTCCCACTGTGAAGACCCACA	0.507																																					Melanoma(94;603 1453 3280 32295 32951)	dbGAP											0													76.0	70.0	72.0					15																	86123427		2202	4299	6501	-	-	-	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.2128G>A	15.37:g.86123427G>A	ENSP00000378026:p.Glu710Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.E710K	ENST00000394518.2	37	c.2128	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295707	0.40594	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.10382	2.9;2.88	5.58	-0.0382	0.13881	.	.	.	.	.	T	0.06690	0.0171	L	0.32530	0.975	0.09310	N	0.999999	B;B	0.09022	0.001;0.002	B;B	0.09377	0.002;0.004	T	0.39683	-0.9602	9	0.41790	T	0.15	.	0.8219	0.01113	0.2755:0.2077:0.3622:0.1547	.	710;710	Q12802;Q12802-2	AKP13_HUMAN;.	K	710;710;709;709	ENSP00000354718:E710K;ENSP00000378026:E710K	ENSP00000354718:E710K	E	+	1	0	AKAP13	83924431	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	0.317000	0.19487	0.330000	0.23485	0.655000	0.94253	GAA	AKAP13	-	NULL	ENSG00000170776		0.507	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	40	0.00	0	G	NM_007200		86123427	86123427	+1	no_errors	ENST00000361243	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.000	A
ARHGAP15	55843	genome.wustl.edu	37	2	144381782	144381782	+	Silent	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr2:144381782C>T	ENST00000295095.6	+	12	1251	c.1084C>T	c.(1084-1086)Ctg>Ttg	p.L362L		NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	362	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		TTTCCGGGAGCTGCCTGAGCC	0.502																																						dbGAP											0													97.0	90.0	93.0					2																	144381782		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.1084C>T	2.37:g.144381782C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.L362	ENST00000295095.6	37	c.1084	CCDS2184.1	2																																																																																			ARHGAP15	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000075884		0.502	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP15	HGNC	protein_coding	OTTHUMT00000254793.2	65	0.00	0	C	NM_018460		144381782	144381782	+1	no_errors	ENST00000295095	ensembl	human	known	69_37n	silent	40	31.03	18	SNP	1.000	T
ARHGAP44	9912	genome.wustl.edu	37	17	12832350	12832350	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr17:12832350T>G	ENST00000379672.5	+	7	869	c.569T>G	c.(568-570)gTg>gGg	p.V190G	ARHGAP44_ENST00000340825.3_Missense_Mutation_p.V190G|ARHGAP44_ENST00000262444.9_Missense_Mutation_p.V190G	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	190	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						GCCAACAGAGTGGAGATTTGC	0.542																																						dbGAP											0													64.0	74.0	70.0					17																	12832350		1878	4105	5983	-	-	-	SO:0001583	missense	0				CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.569T>G	17.37:g.12832350T>G	ENSP00000368994:p.Val190Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.V190G	ENST00000379672.5	37	c.569	CCDS45616.1	17	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709678	0.48517	.	.	ENSG00000006740	ENST00000379672;ENST00000340825	T;T	0.64618	-0.11;-0.11	5.82	5.82	0.92795	BAR (3);	0.052401	0.85682	D	0.000000	T	0.74321	0.3701	L	0.57536	1.79	0.80722	D	1	P;D	0.61697	0.891;0.99	P;D	0.64877	0.673;0.93	T	0.76969	-0.2762	10	0.87932	D	0	.	14.1249	0.65213	0.0:0.0:0.0:1.0	.	190;190	A6NCP5;Q17R89	.;RHG44_HUMAN	G	190	ENSP00000368994:V190G;ENSP00000342566:V190G	ENSP00000342566:V190G	V	+	2	0	ARHGAP44	12773075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.660000	0.83776	2.228000	0.72767	0.533000	0.62120	GTG	ARHGAP44	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000006740		0.542	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP44	HGNC	protein_coding	OTTHUMT00000441566.1	39	0.00	0	T	NM_014859		12832350	12832350	+1	no_errors	ENST00000379672	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	1.000	G
ARHGAP9	64333	genome.wustl.edu	37	12	57872469	57872469	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr12:57872469C>G	ENST00000356411.2	-	3	526	c.388G>C	c.(388-390)Gag>Cag	p.E130Q	ARHGAP9_ENST00000550288.1_Missense_Mutation_p.E209Q|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.E130Q|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.E130Q|ARHGAP9_ENST00000430041.2_5'Flank|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.E201Q|ARHGAP9_ENST00000550454.1_5'Flank			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	130					positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			GGAGGCTGCTCCGAGCTAGCC	0.587																																						dbGAP											0													80.0	76.0	78.0					12																	57872469		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.388G>C	12.37:g.57872469C>G	ENSP00000348782:p.Glu130Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_Rsp5_WWP,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.E130Q	ENST00000356411.2	37	c.388		12	.	.	.	.	.	.	.	.	.	.	C	0.217	-1.031634	0.02029	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000552249	T;T;T;T;T	0.44881	3.17;3.17;1.82;3.13;0.91	4.49	-4.66	0.03329	.	0.827487	0.10677	N	0.646829	T	0.21427	0.0516	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.09022	0.002;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.001;0.001;0.001	T	0.31110	-0.9955	10	0.12103	T	0.63	.	2.2306	0.03995	0.1229:0.2048:0.4048:0.2675	.	130;209;130;130;130	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9	.;.;RHG09_HUMAN;.;.	Q	130;130;130;201;179;48	ENSP00000377380:E130Q;ENSP00000348782:E130Q;ENSP00000394307:E130Q;ENSP00000377386:E201Q;ENSP00000448358:E48Q	ENSP00000344852:E179Q	E	-	1	0	ARHGAP9	56158736	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.788000	0.04614	-0.650000	0.05423	-0.150000	0.13652	GAG	ARHGAP9	-	NULL	ENSG00000123329		0.587	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP9	HGNC	protein_coding		37	0.00	0	C	NM_032496		57872469	57872469	-1	no_errors	ENST00000356411	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	0.000	G
ARHGEF39	84904	genome.wustl.edu	37	9	35663051	35663051	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr9:35663051C>T	ENST00000378387.3	-	6	682	c.565G>A	c.(565-567)Gag>Aag	p.E189K	ARHGEF39_ENST00000343259.3_Intron|ARHGEF39_ENST00000490970.1_Intron|ARHGEF39_ENST00000378395.2_Missense_Mutation_p.E153K	NM_032818.2	NP_116207.2	Q8N4T4	ARG39_HUMAN	Rho guanine nucleotide exchange factor (GEF) 39	189	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				positive regulation of cell migration (GO:0030335)	plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)										TGGGCAGTCTCACTTATCAGT	0.522																																						dbGAP											0													103.0	91.0	95.0					9																	35663051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001187	CCDS6584.2	9p13.3	2012-08-08	2012-08-08	2012-08-08	ENSG00000137135	ENSG00000137135			25909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 100"""	C9orf100		22327280	Standard	XR_242516		Approved	FLJ14642	uc003zxm.1	Q8N4T4	OTTHUMG00000019869	ENST00000378387.3:c.565G>A	9.37:g.35663051C>T	ENSP00000367638:p.Glu189Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AG0|Q6TPQ2|Q96ST6	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E189K	ENST00000378387.3	37	c.565	CCDS6584.2	9	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097486	0.76870	.	.	ENSG00000137135	ENST00000378387;ENST00000378395	T;T	0.63580	-0.05;-0.05	5.94	5.03	0.67393	Dbl homology (DH) domain (5);	0.151848	0.56097	D	0.000021	T	0.52256	0.1723	L	0.45051	1.395	0.80722	D	1	P	0.40731	0.728	B	0.35655	0.207	T	0.54423	-0.8296	10	0.44086	T	0.13	-20.4007	13.0252	0.58810	0.0:0.8384:0.1616:0.0	.	189	Q8N4T4	CI100_HUMAN	K	189;153	ENSP00000367638:E189K;ENSP00000367648:E153K	ENSP00000367638:E189K	E	-	1	0	C9orf100	35653051	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.101000	0.50283	1.483000	0.48342	0.650000	0.86243	GAG	ARHGEF39	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000137135		0.522	ARHGEF39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF39	HGNC	protein_coding	OTTHUMT00000052330.1	76	0.00	0	C	NM_032818		35663051	35663051	-1	no_errors	ENST00000378387	ensembl	human	known	69_37n	missense	40	28.57	16	SNP	1.000	T
ARID1A	8289	genome.wustl.edu	37	1	27092809	27092809	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:27092809C>T	ENST00000324856.7	+	9	3201	c.2830C>T	c.(2830-2832)Cag>Tag	p.Q944*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q944*|RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q561*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	944					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q944*(3)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GATCAACCCTCAGGGACCCCC	0.498			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	3	Substitution - Nonsense(3)	breast(2)|cervix(1)											94.0	94.0	94.0					1																	27092809		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2830C>T	1.37:g.27092809C>T	ENSP00000320485:p.Gln944*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q944*	ENST00000324856.7	37	c.2830	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	42	9.295775	0.99128	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	6.17	6.17	0.99709	.	0.285769	0.40385	N	0.001120	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-7.365	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	944;944;561	.	ENSP00000320485:Q944X	Q	+	1	0	ARID1A	26965396	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CAG	ARID1A	-	NULL	ENSG00000117713		0.498	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	66	0.00	0	C	NM_139135		27092809	27092809	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	nonsense	29	32.56	14	SNP	1.000	T
BAI3	577	genome.wustl.edu	37	6	70071070	70071070	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:70071070G>C	ENST00000370598.1	+	29	4726	c.3905G>C	c.(3904-3906)aGa>aCa	p.R1302T	BAI3_ENST00000238918.8_Missense_Mutation_p.R508T|BAI3_ENST00000546190.1_Missense_Mutation_p.R266T	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1302					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1302I(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CCTCAAGAAAGAATGATGGAA	0.373																																						dbGAP											1	Substitution - Missense(1)	lung(1)											66.0	64.0	65.0					6																	70071070		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3905G>C	6.37:g.70071070G>C	ENSP00000359630:p.Arg1302Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.R1302T	ENST00000370598.1	37	c.3905	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	13.84	2.356236	0.41700	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.05925	3.37;3.37;3.37	5.44	5.44	0.79542	.	0.051154	0.85682	D	0.000000	T	0.03434	0.0099	L	0.29908	0.895	0.36790	D	0.884814	B;B	0.33694	0.421;0.421	B;B	0.32864	0.107;0.154	T	0.47861	-0.9084	10	0.44086	T	0.13	.	19.6299	0.95698	0.0:0.0:1.0:0.0	.	508;1302	B7Z356;O60242	.;BAI3_HUMAN	T	1302;508;266	ENSP00000359630:R1302T;ENSP00000238918:R508T;ENSP00000441821:R266T	ENSP00000238918:R508T	R	+	2	0	BAI3	70127791	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.943000	0.70211	2.723000	0.93209	0.591000	0.81541	AGA	BAI3	-	NULL	ENSG00000135298		0.373	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	20	0.00	0	G			70071070	70071070	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	1.000	C
BARX2	8538	genome.wustl.edu	37	11	129312660	129312660	+	Intron	SNP	C	C	T	rs3827487	byFrequency	TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr11:129312660C>T	ENST00000281437.4	+	3	584				BARX2_ENST00000526127.1_Intron|BARX2_ENST00000531946.1_Missense_Mutation_p.A18V	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2						cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CTGGAGCCTGCCAGCAGGATC	0.542													T|||	3096	0.618211	0.5825	0.5461	5008	,	,		18946	0.7411		0.5	False		,,,				2504	0.7127					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.489-70C>T	11.37:g.129312660C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43518|Q6NT51	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif	p.A18V	ENST00000281437.4	37	c.53	CCDS8481.1	11	1300	0.5952380952380952	300	0.6097560975609756	204	0.56353591160221	415	0.7255244755244755	381	0.5026385224274407	T	3.513	-0.099478	0.07010	.	.	ENSG00000043039	ENST00000531946	D	0.86865	-2.18	1.01	-0.269	0.12930	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.42716	-0.9435	4	.	.	.	.	4.546	0.12081	0.0:0.6305:0.0:0.3695	rs3827487	.	.	.	V	18	ENSP00000450418:A18V	.	A	+	2	0	BARX2	128817870	0.000000	0.05858	0.007000	0.13788	0.026000	0.11368	-0.707000	0.05041	-0.863000	0.04084	-0.891000	0.02926	GCC	BARX2	-	smart_Homeodomain	ENSG00000043039		0.542	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARX2	HGNC	protein_coding	OTTHUMT00000386153.1	78	0.00	0	C	NM_003658		129312660	129312660	+1	no_errors	ENST00000531946	ensembl	human	putative	69_37n	missense	37	11.90	5	SNP	0.001	T
BBS9	27241	genome.wustl.edu	37	7	33573688	33573688	+	Silent	SNP	A	A	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr7:33573688A>G	ENST00000242067.6	+	21	2942	c.2421A>G	c.(2419-2421)caA>caG	p.Q807Q	BBS9_ENST00000396127.2_Silent_p.Q772Q|BBS9_ENST00000355070.2_Silent_p.Q802Q|BBS9_ENST00000350941.3_Silent_p.Q767Q|BBS9_ENST00000354265.4_Silent_p.Q772Q	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	807					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			ACACAAGCCAACTGAAGAAAC	0.512									Bardet-Biedl syndrome																													dbGAP											0													156.0	122.0	134.0					7																	33573688		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.2421A>G	7.37:g.33573688A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.T374A	ENST00000242067.6	37	c.1120	CCDS43566.1	7	.	.	.	.	.	.	.	.	.	.	A	8.100	0.776378	0.16051	.	.	ENSG00000122507	ENST00000434373	.	.	.	5.93	-7.28	0.01456	.	.	.	.	.	T	0.36580	0.0972	.	.	.	0.39156	D	0.962313	.	.	.	.	.	.	T	0.43228	-0.9404	4	.	.	.	-8.3237	3.5895	0.07983	0.3475:0.1731:0.3779:0.1015	.	.	.	.	A	374	.	.	T	+	1	0	BBS9	33540213	0.000000	0.05858	0.354000	0.25760	0.949000	0.60115	-2.007000	0.01457	-1.004000	0.03421	-0.274000	0.10170	ACT	BBS9	-	NULL	ENSG00000122507		0.512	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1	49	0.00	0	A			33573688	33573688	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434373	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	0.041	G
BCL11B	64919	genome.wustl.edu	37	14	99723900	99723900	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr14:99723900G>A	ENST00000357195.3	-	2	344	c.335C>T	c.(334-336)cCg>cTg	p.P112L	BCL11B_ENST00000345514.2_Missense_Mutation_p.P112L|BCL11B_ENST00000443726.2_Intron	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	112					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P112L(1)		NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GATCTCCACCGGCTCGGACAC	0.607			T	TLX3	T-ALL																																	dbGAP		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	1	Substitution - Missense(1)	lung(1)											91.0	89.0	90.0					14																	99723900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.335C>T	14.37:g.99723900G>A	ENSP00000349723:p.Pro112Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H162	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P112L	ENST00000357195.3	37	c.335	CCDS9950.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.190325	0.94923	.	.	ENSG00000127152	ENST00000357195;ENST00000345514	T;T	0.30448	1.53;2.27	5.79	5.79	0.91817	.	0.291607	0.26836	N	0.022242	T	0.56630	0.1998	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.977	D;P	0.85130	0.997;0.46	T	0.55630	-0.8111	10	0.72032	D	0.01	-14.4946	20.0263	0.97523	0.0:0.0:1.0:0.0	.	112;112	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	L	112	ENSP00000349723:P112L;ENSP00000280435:P112L	ENSP00000280435:P112L	P	-	2	0	BCL11B	98793653	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.731000	0.98807	2.735000	0.93741	0.655000	0.94253	CCG	BCL11B	-	NULL	ENSG00000127152		0.607	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	HGNC	protein_coding	OTTHUMT00000072332.2	94	0.00	0	G	NM_138576		99723900	99723900	-1	no_errors	ENST00000357195	ensembl	human	known	69_37n	missense	62	17.33	13	SNP	1.000	A
BCR	613	genome.wustl.edu	37	22	23658007	23658007	+	3'UTR	SNP	G	G	A	rs180817	byFrequency	TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr22:23658007G>A	ENST00000305877.8	+	0	4865				BCR_ENST00000359540.3_3'UTR|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GAAGGGAGTGGTTTTTATGAA	0.527			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								.|||	2183	0.435903	0.4077	0.3905	5008	,	,		20090	0.6171		0.3708	False		,,,				2504	0.3865					dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*298G>A	22.37:g.23658007G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-	ENSG00000186716		0.527	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	25	0.00	0	G	NM_004327		23658007	23658007	+1	no_errors	ENST00000436990	ensembl	human	known	69_37n	rna	21	16.00	4	SNP	0.996	A
BORA	79866	genome.wustl.edu	37	13	73318666	73318666	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr13:73318666C>G	ENST00000390667.5	+	7	575	c.478C>G	c.(478-480)Ctt>Gtt	p.L160V	BORA_ENST00000464754.1_3'UTR|BORA_ENST00000377815.3_Missense_Mutation_p.L90V	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator	160					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)										ATTGCTGTCTCTTCCTGTGGA	0.299																																						dbGAP											0													66.0	63.0	64.0					13																	73318666		1825	4079	5904	-	-	-	SO:0001583	missense	0			BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.478C>G	13.37:g.73318666C>G	ENSP00000375082:p.Leu160Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Missense_Mutation	SNP	prints_Aurora_borealis_protien	p.L160V	ENST00000390667.5	37	c.478	CCDS9446.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.12|19.12	3.766826|3.766826	0.69878|0.69878	.|.	.|.	ENSG00000136122|ENSG00000136122	ENST00000377815;ENST00000390667|ENST00000377814	T;T|T	0.62788|0.59502	-0.0;0.58|0.26	5.93|5.93	5.08|5.08	0.68730|0.68730	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69708|0.69708	0.3141|0.3141	M|M	0.79693|0.79693	2.465|2.465	0.43994|0.43994	D|D	0.996694|0.996694	D;D;D;D|.	0.76494|.	0.998;0.999;0.999;0.999|.	D;D;D;D|.	0.85130|.	0.996;0.981;0.997;0.981|.	T|T	0.72966|0.72966	-0.4131|-0.4131	10|7	0.87932|0.87932	D|D	0|0	-29.0083|-29.0083	8.5853|8.5853	0.33655|0.33655	0.0:0.7945:0.0:0.2055|0.0:0.7945:0.0:0.2055	.|.	90;160;220;160|.	B4DQ30;A8K631;B5LMG6;Q6PGQ7|.	.;.;.;BORA_HUMAN|.	V|C	90;160|137	ENSP00000367046:L90V;ENSP00000375082:L160V|ENSP00000367045:S137C	ENSP00000367046:L90V|ENSP00000367045:S137C	L|S	+|+	1|2	0|0	BORA|BORA	72216667|72216667	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.981000|2.981000	0.49329|0.49329	2.805000|2.805000	0.96524|0.96524	0.655000|0.655000	0.94253|0.94253	CTT|TCT	BORA	-	prints_Aurora_borealis_protien	ENSG00000136122		0.299	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BORA	HGNC	protein_coding	OTTHUMT00000045245.3	59	0.00	0	C	NM_024808		73318666	73318666	+1	no_errors	ENST00000390667	ensembl	human	known	69_37n	missense	45	33.82	23	SNP	1.000	G
BRIP1	83990	genome.wustl.edu	37	17	59885858	59885858	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr17:59885858C>G	ENST00000259008.2	-	7	1155	c.888G>C	c.(886-888)gaG>gaC	p.E296D	BRIP1_ENST00000577598.1_Missense_Mutation_p.E296D	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	296	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						CCATGCACTTCTCATTTCTGT	0.383			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0													119.0	109.0	112.0					17																	59885858		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.888G>C	17.37:g.59885858C>G	ENSP00000259008:p.Glu296Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.E296D	ENST00000259008.2	37	c.888	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684463	0.29872	.	.	ENSG00000136492	ENST00000259008	T	0.71817	-0.6	5.29	1.71	0.24356	DEAD-like helicase (1);DEAD2 (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.093895	0.64402	D	0.000001	T	0.72120	0.3421	L	0.33189	0.99	0.37251	D	0.906579	D	0.89917	1.0	D	0.87578	0.998	T	0.69499	-0.5129	9	.	.	.	-12.4483	9.0449	0.36341	0.0:0.2181:0.0:0.7819	.	296	Q9BX63	FANCJ_HUMAN	D	296	ENSP00000259008:E296D	.	E	-	3	2	BRIP1	57240640	0.998000	0.40836	0.998000	0.56505	0.982000	0.71751	0.430000	0.21428	0.069000	0.16605	-0.340000	0.08031	GAG	BRIP1	-	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000136492		0.383	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	21	0.00	0	C	NM_032043		59885858	59885858	-1	no_errors	ENST00000259008	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	G
C16orf59	80178	genome.wustl.edu	37	16	2510695	2510695	+	Splice_Site	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr16:2510695G>C	ENST00000361837.4	+	3	261		c.e3+1		C16orf59_ENST00000569496.1_Splice_Site|C16orf59_ENST00000483320.1_Splice_Site|RP11-715J22.4_ENST00000566085.1_lincRNA|C16orf59_ENST00000563531.1_Splice_Site	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59											lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				CCCCTTCCAGGTAAACCTCCA	0.632																																						dbGAP											0													25.0	29.0	27.0					16																	2510695		2014	4182	6196	-	-	-	SO:0001630	splice_region_variant	0			AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.196+1G>C	16.37:g.2510695G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXD7|Q96H61|Q9H872	Splice_Site	SNP	-	e3+1	ENST00000361837.4	37	c.196+1	CCDS10468.2	16	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444342	0.43429	.	.	ENSG00000162062	ENST00000361837	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2635	0.54663	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C16orf59	2450696	1.000000	0.71417	1.000000	0.80357	0.074000	0.17049	4.216000	0.58540	2.607000	0.88179	0.655000	0.94253	.	C16orf59	-	-	ENSG00000162062		0.632	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf59	HGNC	protein_coding	OTTHUMT00000250802.3	87	0	0	G	NM_025108	Intron	2510695	2510695	+1	no_errors	ENST00000361837	ensembl	human	known	69_37n	splice_site	54	20.59	14	SNP	1.000	C
C16orf59	80178	genome.wustl.edu	37	16	2510695	2510695	+	Splice_Site	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr16:2510695G>C	ENST00000361837.4	+	3	261		c.e3+1		C16orf59_ENST00000569496.1_Splice_Site|C16orf59_ENST00000483320.1_Splice_Site|RP11-715J22.4_ENST00000566085.1_lincRNA|C16orf59_ENST00000563531.1_Splice_Site	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59											lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				CCCCTTCCAGGTAAACCTCCA	0.632																																						dbGAP											0													25.0	29.0	27.0					16																	2510695		2014	4182	6196	-	-	-	SO:0001630	splice_region_variant	0			AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.196+1G>C	16.37:g.2510695G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXD7|Q96H61|Q9H872	Splice_Site	SNP	-	e3+1	ENST00000361837.4	37	c.196+1	CCDS10468.2	16	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444342	0.43429	.	.	ENSG00000162062	ENST00000361837	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2635	0.54663	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C16orf59	2450696	1.000000	0.71417	1.000000	0.80357	0.074000	0.17049	4.216000	0.58540	2.607000	0.88179	0.655000	0.94253	.	C16orf59	-	-	ENSG00000162062		0.632	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf59	HGNC	protein_coding	OTTHUMT00000250802.3	87	0.00	0	G	NM_025108	Intron	2510695	2510695	+1	no_errors	ENST00000361837	ensembl	human	known	69_37n	splice_site	54	20.59	14	SNP	1.000	C
CFAP74	85452	genome.wustl.edu	37	1	1861575	1861575	+	IGR	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:1861575G>T								TMEM52 (10863 upstream) : C1orf222 (57987 downstream)																							CTCGAAAGACGTGGGCCCCAT	0.627																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.1861575G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_PapD-like	p.T354K		37	c.1061		1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219855	0.39201	.	.	ENSG00000142609	ENST00000493964	T	0.26518	1.73	3.29	3.29	0.37713	.	.	.	.	.	T	0.18509	0.0444	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.02047	-1.1223	6	0.06757	T	0.87	.	14.4375	0.67293	0.0:0.0:1.0:0.0	.	.	.	.	K	354	ENSP00000417061:T354K	ENSP00000417061:T354K	T	-	2	0	C1orf222	1851435	1.000000	0.71417	0.799000	0.32177	0.251000	0.25915	5.428000	0.66489	1.794000	0.52575	0.591000	0.81541	ACG	C1orf222	-	NULL	ENSG00000142609	0	0.627					C1orf222	HGNC			76	0.00	0	G			1861575	1861575	-1	no_start_codon	ENST00000493964	ensembl	human	putative	69_37n	missense	25	16.67	5	SNP	0.989	T
CCDC180	100499483	genome.wustl.edu	37	9	100085182	100085182	+	Silent	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr9:100085182G>T	ENST00000357054.1	+	26	2711	c.1776G>T	c.(1774-1776)ctG>ctT	p.L592L	CCDC180_ENST00000395220.1_Silent_p.L552L|CCDC180_ENST00000411667.2_Silent_p.L450L|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Silent_p.L453L|CCDC180_ENST00000375202.2_Silent_p.L453L|CCDC180_ENST00000460482.2_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	592						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGGAGTGCCTGATGCATGTGC	0.557																																						dbGAP											0													99.0	75.0	83.0					9																	100085182		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1776G>T	9.37:g.100085182G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	NULL	p.L453	ENST00000357054.1	37	c.1359		9																																																																																			C9orf174	-	NULL	ENSG00000197816		0.557	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		80	0.00	0	G	NM_020893		100085182	100085182	+1	no_errors	ENST00000375202	ensembl	human	known	69_37n	silent	58	21.62	16	SNP	0.842	T
CACNA1E	777	genome.wustl.edu	37	1	181727244	181727244	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:181727244G>A	ENST00000367573.2	+	31	4491	c.4491G>A	c.(4489-4491)atG>atA	p.M1497I	CACNA1E_ENST00000367567.4_Missense_Mutation_p.M1104I|CACNA1E_ENST00000526775.1_Missense_Mutation_p.M1478I|CACNA1E_ENST00000358338.5_Missense_Mutation_p.M1429I|CACNA1E_ENST00000357570.5_Missense_Mutation_p.M1448I|CACNA1E_ENST00000367570.1_Missense_Mutation_p.M1497I|CACNA1E_ENST00000360108.3_Missense_Mutation_p.M1478I	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1497					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGCTGATGATGAAGGTGAGAG	0.557																																						dbGAP											0													92.0	90.0	91.0					1																	181727244		2119	4232	6351	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4491G>A	1.37:g.181727244G>A	ENSP00000356545:p.Met1497Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.M1497I	ENST00000367573.2	37	c.4491	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.142405	0.94560	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97279	-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.98292	0.9434	M	0.79011	2.435	0.80722	D	1	B;B;D	0.53745	0.187;0.047;0.962	B;B;D	0.66716	0.309;0.118;0.946	D	0.99000	1.0811	10	0.59425	D	0.04	.	18.5085	0.90907	0.0:0.0:1.0:0.0	.	1478;1497;1497	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	I	1497;1478;1448;1429;1104;1478;1497	ENSP00000356542:M1497I;ENSP00000434814:M1478I;ENSP00000350183:M1448I;ENSP00000351101:M1429I;ENSP00000356539:M1104I;ENSP00000353222:M1478I;ENSP00000356545:M1497I	ENSP00000350183:M1448I	M	+	3	0	CACNA1E	179993867	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.731000	0.98807	2.465000	0.83290	0.655000	0.94253	ATG	CACNA1E	-	NULL	ENSG00000198216		0.557	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	51	0.00	0	G	NM_000721		181727244	181727244	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	35	27.08	13	SNP	1.000	A
CASP8AP2	9994	genome.wustl.edu	37	6	90566808	90566808	+	RNA	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:90566808C>T	ENST00000551025.1	+	0	1743									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTTAGAATTTCAGCTTAATAA	0.299																																					Colon(187;1656 2025 17045 31481 39901)	dbGAP											0													40.0	36.0	37.0					6																	90566808		1811	4072	5883	-	-	-			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90566808C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.299	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		85	0.00	0	C	NM_001137667		90566808	90566808	+1	no_errors	ENST00000237177	ensembl	human	known	69_37n	rna	61	20.51	16	SNP	1.000	T
CCDC136	64753	genome.wustl.edu	37	7	128452016	128452016	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr7:128452016C>G	ENST00000297788.4	+	13	2558	c.2191C>G	c.(2191-2193)Caa>Gaa	p.Q731E	CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000487361.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	731						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						GCAGCTGCTTCAAGTCCAGTC	0.527																																						dbGAP											0													95.0	94.0	94.0					7																	128452016		1928	4134	6062	-	-	-	SO:0001583	missense	0				CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.2191C>G	7.37:g.128452016C>G	ENSP00000297788:p.Gln731Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	NULL	p.Q731E	ENST00000297788.4	37	c.2191	CCDS47704.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.80|15.80	2.939725|2.939725	0.52972|0.52972	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000494552|ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672	.|T;T	.|0.49720	.|0.77;0.77	5.93|5.93	5.0|5.0	0.66597|0.66597	.|.	.|0.321956	.|0.29572	.|N	.|0.011771	T|T	0.42854|0.42854	0.1221|0.1221	L|L	0.55103|0.55103	1.725|1.725	0.09310|0.09310	N|N	0.99999|0.99999	.|P;P;P	.|0.41673	.|0.728;0.728;0.759	.|B;B;B	.|0.40410	.|0.258;0.217;0.328	T|T	0.38929|0.38929	-0.9638|-0.9638	5|10	.|0.28530	.|T	.|0.3	-5.954|-5.954	11.5919|11.5919	0.50951|0.50951	0.1774:0.8225:0.0:0.0|0.1774:0.8225:0.0:0.0	.|.	.|731;731;731	.|Q96JN2-4;Q96JN2-2;Q96JN2	.|.;.;CC136_HUMAN	L|E	607|731;731;731;322	.|ENSP00000297788:Q731E;ENSP00000417991:Q322E	.|ENSP00000297788:Q731E	F|Q	+|+	3|1	2|0	CCDC136|CCDC136	128239252|128239252	0.998000|0.998000	0.40836|0.40836	0.663000|0.663000	0.29738|0.29738	0.499000|0.499000	0.33736|0.33736	1.539000|1.539000	0.36104|0.36104	2.815000|2.815000	0.96918|0.96918	0.561000|0.561000	0.74099|0.74099	TTC|CAA	CCDC136	-	NULL	ENSG00000128596		0.527	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC136	HGNC	protein_coding	OTTHUMT00000350641.1	24	0.00	0	C	NM_022742		128452016	128452016	+1	no_errors	ENST00000297788	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	0.586	G
CCDC154	645811	genome.wustl.edu	37	16	1492430	1492430	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr16:1492430C>A	ENST00000389176.3	-	6	818	c.652G>T	c.(652-654)Gac>Tac	p.D218Y	LA16c-390E6.5_ENST00000566287.1_RNA|CCDC154_ENST00000409671.1_Missense_Mutation_p.D73Y	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	218						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						ACCTCCAGGTCCACCCTCCGG	0.682																																						dbGAP											0													21.0	25.0	24.0					16																	1492430		692	1589	2281	-	-	-	SO:0001583	missense	0					16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.652G>T	16.37:g.1492430C>A	ENSP00000373828:p.Asp218Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	G9JV18	Missense_Mutation	SNP	NULL	p.D218Y	ENST00000389176.3	37	c.652		16	.	.	.	.	.	.	.	.	.	.	C	11.36	1.614853	0.28712	.	.	ENSG00000197599	ENST00000409671;ENST00000389176	.	.	.	3.92	2.96	0.34315	.	0.191644	0.25619	N	0.029435	T	0.40372	0.1114	L	0.29908	0.895	0.09310	N	1	D	0.76494	0.999	D	0.66979	0.948	T	0.06588	-1.0818	9	0.87932	D	0	-21.55	6.7245	0.23348	0.0:0.872:0.0:0.128	.	218	A6NI56	CC154_HUMAN	Y	73;218	.	ENSP00000373828:D218Y	D	-	1	0	CCDC154	1432431	0.017000	0.18338	0.484000	0.27391	0.023000	0.10783	1.195000	0.32186	2.194000	0.70268	0.561000	0.74099	GAC	CCDC154	-	NULL	ENSG00000197599		0.682	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC154	HGNC	protein_coding		120	0.00	0	C	NM_001143980		1492430	1492430	-1	no_errors	ENST00000389176	ensembl	human	known	69_37n	missense	70	27.08	26	SNP	0.040	A
CCDC159	126075	genome.wustl.edu	37	19	11462756	11462756	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:11462756G>C	ENST00000588790.1	+	9	961	c.514G>C	c.(514-516)Gag>Cag	p.E172Q	CCDC159_ENST00000458408.1_Missense_Mutation_p.E172Q			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	287										endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						TGAGATCTCAGAGAACTTGGT	0.592																																						dbGAP											0													69.0	71.0	71.0					19																	11462756		1939	4128	6067	-	-	-	SO:0001583	missense	0			BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.514G>C	19.37:g.11462756G>C	ENSP00000468232:p.Glu172Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	NULL	p.E172Q	ENST00000588790.1	37	c.514	CCDS45976.1	19	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452155	0.43531	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.57752	0.38	4.94	2.59	0.31030	.	.	.	.	.	T	0.56992	0.2023	L	0.47716	1.5	0.23528	N	0.997482	D;B;B	0.69078	0.997;0.033;0.033	D;B;B	0.66196	0.942;0.031;0.038	T	0.43327	-0.9398	9	0.30078	T	0.28	-27.7853	5.0279	0.14395	0.1784:0.1842:0.6373:0.0	.	287;287;172	P0C7I6;P0C7I6-4;P0C7I6-2	CC159_HUMAN;.;.	Q	172;287	ENSP00000402239:E172Q	ENSP00000390400:E287Q	E	+	1	0	CCDC159	11323756	0.132000	0.22450	0.990000	0.47175	0.382000	0.30200	0.209000	0.17435	2.296000	0.77279	0.555000	0.69702	GAG	CCDC159	-	NULL	ENSG00000183401		0.592	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC159	HGNC	protein_coding	OTTHUMT00000458761.1	49	0.00	0	G	NM_001080503		11462756	11462756	+1	no_errors	ENST00000458408	ensembl	human	known	69_37n	missense	39	26.42	14	SNP	0.935	C
CCDC74B	91409	genome.wustl.edu	37	2	130896959	130896959	+	3'UTR	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr2:130896959G>C	ENST00000310463.6	-	0	1449				CCDC74B_ENST00000392984.3_3'UTR|CCDC74B_ENST00000409943.3_3'UTR|MED15P9_ENST00000427638.1_RNA	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B											endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					ATAACAGCTAGAAAATAAACA	0.358																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.*169C>G	2.37:g.130896959G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NW18	RNA	SNP	-	NULL	ENST00000310463.6	37	NULL	CCDS2155.1	2																																																																																			CCDC74B-AS1	-	-	ENSG00000223760		0.358	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74B-AS1	HGNC	protein_coding	OTTHUMT00000254522.3	32	0.00	0	G	NM_207310		130896959	130896959	+1	no_errors	ENST00000427638	ensembl	human	known	69_37n	rna	33	21.43	9	SNP	0.764	C
CCR6	1235	genome.wustl.edu	37	6	167550687	167550687	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:167550687C>G	ENST00000341935.5	+	3	1521	c.969C>G	c.(967-969)ttC>ttG	p.F323L	CCR6_ENST00000349984.4_Missense_Mutation_p.F323L|RP11-517H2.6_ENST00000609590.1_RNA|CCR6_ENST00000400926.2_Missense_Mutation_p.F323L	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	323					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		GGCAGAAGTTCAGAAACTACT	0.473																																						dbGAP											0													83.0	81.0	82.0					6																	167550687		2203	4300	6503	-	-	-	SO:0001583	missense	0			U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.969C>G	6.37:g.167550687C>G	ENSP00000343952:p.Phe323Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5C6|P78553|Q92846	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CCR6,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CXC/IL8_rcpt	p.F323L	ENST00000341935.5	37	c.969	CCDS5298.1	6	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777395	0.49786	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	T;T;T	0.46451	0.87;0.87;0.87	4.79	-3.41	0.04839	.	0.000000	0.85682	U	0.000000	T	0.49949	0.1587	M	0.86343	2.81	0.24807	N	0.992666	D	0.65815	0.995	D	0.69479	0.964	T	0.57991	-0.7715	10	0.87932	D	0	.	12.941	0.58345	0.0:0.317:0.0:0.683	.	323	P51684	CCR6_HUMAN	L	323	ENSP00000383715:F323L;ENSP00000343952:F323L;ENSP00000339393:F323L	ENSP00000343952:F323L	F	+	3	2	CCR6	167470677	0.299000	0.24426	0.001000	0.08648	0.604000	0.37047	-0.284000	0.08422	-0.604000	0.05760	-0.140000	0.14226	TTC	CCR6	-	prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt	ENSG00000112486		0.473	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCR6	HGNC	protein_coding	OTTHUMT00000043118.1	46	0.00	0	C			167550687	167550687	+1	no_errors	ENST00000341935	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	0.072	G
CELSR1	9620	genome.wustl.edu	37	22	46760558	46760558	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr22:46760558C>T	ENST00000262738.3	-	33	8629	c.8630G>A	c.(8629-8631)aGc>aAc	p.S2877N		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2877					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGGCTTGCCGCTGGGGTCCTC	0.692																																						dbGAP											0													29.0	31.0	30.0					22																	46760558		2197	4298	6495	-	-	-	SO:0001583	missense	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.8630G>A	22.37:g.46760558C>T	ENSP00000262738:p.Ser2877Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S2877N	ENST00000262738.3	37	c.8630	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	C	8.383	0.838050	0.16891	.	.	ENSG00000075275	ENST00000262738	T	0.68479	-0.33	4.62	1.03	0.20045	.	0.387034	0.16677	U	0.204140	T	0.38348	0.1037	N	0.08118	0	0.19575	N	0.999969	B	0.28636	0.218	B	0.24006	0.05	T	0.21109	-1.0255	10	0.15066	T	0.55	.	8.347	0.32279	0.0:0.619:0.2955:0.0855	.	2877	Q9NYQ6	CELR1_HUMAN	N	2877	ENSP00000262738:S2877N	ENSP00000262738:S2877N	S	-	2	0	CELSR1	45139222	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	1.310000	0.33551	0.340000	0.23745	0.563000	0.77884	AGC	CELSR1	-	NULL	ENSG00000075275		0.692	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	34	0.00	0	C	NM_014246		46760558	46760558	-1	no_errors	ENST00000262738	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	0.001	T
CENPE	1062	genome.wustl.edu	37	4	104057412	104057412	+	Missense_Mutation	SNP	C	C	G	rs200997499		TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr4:104057412C>G	ENST00000265148.3	-	40	6497	c.6408G>C	c.(6406-6408)atG>atC	p.M2136I	CENPE_ENST00000380026.3_Missense_Mutation_p.M2015I	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2136	Kinetochore-binding domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTTTAACTCTCATTGAAAGCT	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		17217	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													141.0	139.0	140.0					4																	104057412		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6408G>C	4.37:g.104057412C>G	ENSP00000265148:p.Met2136Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.M2136I	ENST00000265148.3	37	c.6408	CCDS34042.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	2.689	-0.273600	0.05679	.	.	ENSG00000138778	ENST00000265148;ENST00000380026	T;T	0.70399	-0.05;-0.48	5.26	-1.7	0.08159	.	.	.	.	.	T	0.33556	0.0867	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21484	-1.0244	9	0.17369	T	0.5	.	1.0292	0.01534	0.3294:0.3357:0.1845:0.1504	.	2015;2136	Q02224-3;Q02224	.;CENPE_HUMAN	I	2136;2015	ENSP00000265148:M2136I;ENSP00000369365:M2015I	ENSP00000265148:M2136I	M	-	3	0	CENPE	104276861	0.000000	0.05858	0.004000	0.12327	0.947000	0.59692	-0.020000	0.12525	0.069000	0.16605	-0.291000	0.09656	ATG	CENPE	-	NULL	ENSG00000138778		0.358	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		84	0.00	0	C			104057412	104057412	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	39	45.83	33	SNP	0.000	G
CEP170	9859	genome.wustl.edu	37	1	243333040	243333040	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:243333040G>C	ENST00000366542.1	-	12	1784	c.1733C>G	c.(1732-1734)tCt>tGt	p.S578C	RP11-261C10.4_ENST00000422938.1_RNA|RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000366543.1_Missense_Mutation_p.S480C|CEP170_ENST00000366544.1_Missense_Mutation_p.S480C	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	578						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TTTGCTTCCAGATGAAGATGT	0.393																																						dbGAP											0													83.0	76.0	78.0					1																	243333040		1864	4095	5959	-	-	-	SO:0001583	missense	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1733C>G	1.37:g.243333040G>C	ENSP00000355500:p.Ser578Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_Fibronectin_type3,smart_FHA_dom,pfscan_FHA_dom	p.S578C	ENST00000366542.1	37	c.1733	CCDS44339.1	1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.09|16.09|16.09	3.023422|3.023422|3.023422	0.54683|0.54683|0.54683	.|.|.	.|.|.	ENSG00000143702|ENSG00000143702|ENSG00000143702	ENST00000522895|ENST00000336415|ENST00000366542;ENST00000366544;ENST00000366543	.|.|T;T;T	.|.|0.48201	.|.|0.89;0.85;0.82	4.66|4.66|4.66	4.66|4.66|4.66	0.58398|0.58398|0.58398	.|.|.	.|.|0.713130	.|.|0.14417	.|.|N	.|.|0.320927	T|T|T	0.48978|0.48978|0.48978	0.1530|0.1530|0.1530	N|N|N	0.25647|0.25647|0.25647	0.755|0.755|0.755	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;B	.|.|0.56287	.|.|0.969;0.975;0.001	.|.|P;P;B	.|.|0.55615	.|.|0.634;0.78;0.003	T|T|T	0.44050|0.44050|0.44050	-0.9353|-0.9353|-0.9353	5|5|10	.|.|0.48119	.|.|T	.|.|0.1	-0.3729|-0.3729|-0.3729	12.4613|12.4613|12.4613	0.55733|0.55733|0.55733	0.0:0.1685:0.8315:0.0|0.0:0.1685:0.8315:0.0|0.0:0.1685:0.8315:0.0	.|.|.	.|.|480;480;578	.|.|Q5SW79-3;Q5SW79-2;Q5SW79	.|.|.;.;CE170_HUMAN	M|V|C	106|542|578;480;480	.|.|ENSP00000355500:S578C;ENSP00000355502:S480C;ENSP00000355501:S480C	.|.|ENSP00000355500:S578C	I|L|S	-|-|-	3|1|2	3|2|0	CEP170|CEP170|CEP170	241399663|241399663|241399663	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.977000|0.977000|0.977000	0.68977|0.68977|0.68977	4.272000|4.272000|4.272000	0.58908|0.58908|0.58908	2.143000|2.143000|2.143000	0.66587|0.66587|0.66587	0.484000|0.484000|0.484000	0.47621|0.47621|0.47621	ATC|CTG|TCT	CEP170	-	NULL	ENSG00000143702		0.393	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2	54	0.00	0	G	NM_014812		243333040	243333040	-1	no_errors	ENST00000366542	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	0.995	C
CHST1	8534	genome.wustl.edu	37	11	45671789	45671789	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr11:45671789C>T	ENST00000308064.2	-	4	1355	c.685G>A	c.(685-687)Gtc>Atc	p.V229I	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	229					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		AGCTGGATGACCTTGAGGTTT	0.687																																						dbGAP											0													40.0	41.0	41.0					11																	45671789		2203	4299	6502	-	-	-	SO:0001583	missense	0			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.685G>A	11.37:g.45671789C>T	ENSP00000309270:p.Val229Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQP2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.V229I	ENST00000308064.2	37	c.685	CCDS7913.1	11	.	.	.	.	.	.	.	.	.	.	C	8.734	0.917267	0.17982	.	.	ENSG00000175264	ENST00000308064	T	0.81415	-1.49	4.98	4.98	0.66077	Sulfotransferase domain (1);	0.064919	0.64402	D	0.000008	T	0.65015	0.2651	N	0.17278	0.47	0.53005	D	0.999963	B	0.17038	0.02	B	0.22601	0.04	T	0.59359	-0.7469	10	0.08837	T	0.75	-12.4997	12.6815	0.56924	0.0:0.9204:0.0:0.0796	.	229	O43916	CHST1_HUMAN	I	229	ENSP00000309270:V229I	ENSP00000309270:V229I	V	-	1	0	CHST1	45628365	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.730000	0.47335	2.310000	0.77875	0.462000	0.41574	GTC	CHST1	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	ENSG00000175264		0.687	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1	78	0.00	0	C	NM_003654		45671789	45671789	-1	no_errors	ENST00000308064	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	1.000	T
COASY	80347	genome.wustl.edu	37	17	40714739	40714739	+	Silent	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr17:40714739G>A	ENST00000393818.2	+	1	555	c.99G>A	c.(97-99)gtG>gtA	p.V33V	COASY_ENST00000590958.1_Silent_p.V62V|COASY_ENST00000421097.2_Silent_p.V33V|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000449624.1_Intron|COASY_ENST00000420359.1_Silent_p.V33V	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	33					cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CCCGGCTGGTGAATCACACAC	0.667																																						dbGAP											0													35.0	42.0	40.0					17																	40714739		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.99G>A	17.37:g.40714739G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Silent	SNP	pfam_Depp_CoAkinase,pfam_Cytidylyltransf,tigrfam_Depp_CoAkinase	p.V62	ENST00000393818.2	37	c.186	CCDS11429.1	17																																																																																			COASY	-	NULL	ENSG00000068120		0.667	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COASY	HGNC	protein_coding	OTTHUMT00000450409.1	81	0.00	0	G	NM_025233		40714739	40714739	+1	no_errors	ENST00000590958	ensembl	human	known	69_37n	silent	53	26.39	19	SNP	1.000	A
COL22A1	169044	genome.wustl.edu	37	8	139647307	139647307	+	Splice_Site	SNP	C	C	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr8:139647307C>A	ENST00000303045.6	-	49	4002		c.e49-1		COL22A1_ENST00000435777.1_Splice_Site|COL22A1_ENST00000341807.4_Splice_Site	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CAGGATGACCCTAGGAAAACA	0.413										HNSCC(7;0.00092)																												dbGAP											0													63.0	60.0	61.0					8																	139647307		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3556-1G>T	8.37:g.139647307C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMH0|C9K0G4|Q8IVT9	Splice_Site	SNP	-	e48-1	ENST00000303045.6	37	c.3556-1	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824955	0.50739	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6382	0.62235	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL22A1	139716489	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	3.827000	0.55745	2.604000	0.88044	0.591000	0.81541	.	COL22A1	-	-	ENSG00000169436		0.413	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	34	0.00	0	C	XM_291257	Intron	139647307	139647307	-1	no_errors	ENST00000303045	ensembl	human	known	69_37n	splice_site	44	25.42	15	SNP	1.000	A
CRADD	8738	genome.wustl.edu	37	12	94244020	94244020	+	Silent	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr12:94244020C>G	ENST00000542893.2	+	3	891	c.573C>G	c.(571-573)ccC>ccG	p.P191P	CRADD_ENST00000548483.1_Intron|CRADD_ENST00000548330.1_3'UTR|CRADD_ENST00000332896.3_Silent_p.P191P|CRADD_ENST00000541813.1_Intron			P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with death domain	191					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic signaling pathway (GO:2001235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death domain binding (GO:0070513)|protease binding (GO:0002020)|protein binding, bridging (GO:0030674)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)	8						AGGTGGACCCCTCGCTGCTCC	0.632																																						dbGAP											0													39.0	41.0	40.0					12																	94244020		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			U84388	CCDS9048.1	12q21.33-q23.1	2008-08-04				ENSG00000169372			2340	protein-coding gene	gene with protein product	"""RIP-associated ICH1/CED3-homologous protein with death domain"""	603454				8985253, 9044836	Standard	NM_003805		Approved	RAIDD	uc001tda.3	P78560		ENST00000542893.2:c.573C>G	12.37:g.94244020C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2Q5	Silent	SNP	pfam_CARD,pfam_Death,superfamily_DEATH-like,smart_CARD,smart_Death,pfscan_CARD,pfscan_Death	p.P191	ENST00000542893.2	37	c.573	CCDS9048.1	12																																																																																			CRADD	-	smart_Death	ENSG00000169372		0.632	CRADD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CRADD	HGNC	protein_coding	OTTHUMT00000408515.1	29	0.00	0	C	NM_003805		94244020	94244020	+1	no_errors	ENST00000332896	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	0.965	G
CXorf22	170063	genome.wustl.edu	37	X	35993902	35993902	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:35993902G>A	ENST00000297866.5	+	15	2651	c.2585G>A	c.(2584-2586)gGc>gAc	p.G862D		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	862										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGACCACGAGGCTTCTTCATG	0.448																																						dbGAP											0													185.0	160.0	169.0					X																	35993902		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2585G>A	X.37:g.35993902G>A	ENSP00000297866:p.Gly862Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	superfamily_PapD-like	p.G862D	ENST00000297866.5	37	c.2585	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639967	0.29157	.	.	ENSG00000165164	ENST00000297866	T	0.14516	2.5	5.14	4.24	0.50183	.	0.503892	0.22657	N	0.057259	T	0.22399	0.0540	M	0.62016	1.91	0.09310	N	1	D	0.64830	0.994	P	0.60068	0.868	T	0.09143	-1.0688	10	0.09338	T	0.73	-3.0516	6.2221	0.20687	0.1054:0.2489:0.6457:0.0	.	862	Q6ZTR5	CX022_HUMAN	D	862	ENSP00000297866:G862D	ENSP00000297866:G862D	G	+	2	0	CXorf22	35903823	0.475000	0.25894	0.016000	0.15963	0.020000	0.10135	1.037000	0.30241	0.839000	0.34971	0.600000	0.82982	GGC	CXorf22	-	NULL	ENSG00000165164		0.448	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	45	0.00	0	G	NM_152632		35993902	35993902	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	0.039	A
CYP3A5	1577	genome.wustl.edu	37	7	99250398	99250398	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr7:99250398G>A	ENST00000222982.4	-	11	1130	c.1031C>T	c.(1030-1032)cCa>cTa	p.P344L	CYP3A5_ENST00000343703.5_Missense_Mutation_p.P334L|CYP3A5_ENST00000339843.2_3'UTR	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	344					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	ATAGGTAGGTGGTGCCTGGAA	0.418																																						dbGAP											0													76.0	68.0	70.0					7																	99250398		2203	4300	6503	-	-	-	SO:0001583	missense	0			L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.1031C>T	7.37:g.99250398G>A	ENSP00000222982:p.Pro344Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.P344L	ENST00000222982.4	37	c.1031	CCDS5672.1	7	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057358	0.36277	.	.	ENSG00000106258	ENST00000222982;ENST00000343703	T;T	0.68479	-0.33;-0.33	4.86	2.06	0.26882	.	0.828458	0.10843	N	0.628007	T	0.65719	0.2718	M	0.77313	2.365	0.18873	N	0.999986	B;B	0.19073	0.027;0.033	B;B	0.20955	0.028;0.032	T	0.57400	-0.7818	10	0.51188	T	0.08	.	8.1171	0.30950	0.2717:0.0:0.7283:0.0	.	334;344	F5H4S0;P20815	.;CP3A5_HUMAN	L	344;334	ENSP00000222982:P344L;ENSP00000342969:P334L	ENSP00000222982:P344L	P	-	2	0	CYP3A5	99088334	0.004000	0.15560	0.000000	0.03702	0.236000	0.25371	1.448000	0.35112	0.114000	0.18032	0.650000	0.86243	CCA	CYP3A5	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000106258		0.418	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A5	HGNC	protein_coding	OTTHUMT00000345469.1	63	0.00	0	G			99250398	99250398	-1	no_errors	ENST00000222982	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	0.002	A
DOCK3	1795	genome.wustl.edu	37	3	51378757	51378757	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:51378757G>C	ENST00000266037.9	+	38	3879	c.3856G>C	c.(3856-3858)Gag>Cag	p.E1286Q		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1286	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ATCGCAGACAGAGTGGCAGCG	0.552																																						dbGAP											0													54.0	59.0	57.0					3																	51378757		2083	4213	6296	-	-	-	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3856G>C	3.37:g.51378757G>C	ENSP00000266037:p.Glu1286Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O15017	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.E1286Q	ENST00000266037.9	37	c.3856	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457260	0.84317	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.04809	3.55	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.15089	0.0364	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.09207	-1.0685	10	0.23891	T	0.37	.	20.2191	0.98319	0.0:0.0:1.0:0.0	.	1286	Q8IZD9	DOCK3_HUMAN	Q	1286;82	ENSP00000266037:E1286Q	ENSP00000266037:E1286Q	E	+	1	0	DOCK3	51353797	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.881000	0.87252	2.780000	0.95670	0.655000	0.94253	GAG	DOCK3	-	NULL	ENSG00000088538		0.552	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	68	0.00	0	G	NM_004947		51378757	51378757	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	1.000	C
DSP	1832	genome.wustl.edu	37	6	7567658	7567658	+	Silent	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:7567658G>A	ENST00000379802.3	+	9	1457	c.1116G>A	c.(1114-1116)ctG>ctA	p.L372L	DSP_ENST00000418664.2_Silent_p.L372L	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	372	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATGTTCATCTGAAAGAAAATG	0.358																																						dbGAP											0													195.0	190.0	192.0					6																	7567658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1116G>A	6.37:g.7567658G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L372	ENST00000379802.3	37	c.1116	CCDS4501.1	6																																																																																			DSP	-	smart_Spectrin/alpha-actinin	ENSG00000096696		0.358	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	56	0.00	0	G	NM_004415		7567658	7567658	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	silent	58	22.67	17	SNP	1.000	A
DOPEY1	23033	genome.wustl.edu	37	6	83834448	83834448	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:83834448G>C	ENST00000349129.2	+	13	1625	c.1365G>C	c.(1363-1365)caG>caC	p.Q455H	DOPEY1_ENST00000369739.3_Missense_Mutation_p.Q446H|DOPEY1_ENST00000237163.5_Missense_Mutation_p.Q446H	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	455					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TGAGACTTCAGATTGGACCTG	0.388																																						dbGAP											0													212.0	206.0	208.0					6																	83834448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.1365G>C	6.37:g.83834448G>C	ENSP00000195654:p.Gln455His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.Q455H	ENST00000349129.2	37	c.1365	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864151	0.32977	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T;T	0.24350	1.87;1.86;1.87	5.67	3.88	0.44766	.	0.500539	0.20899	N	0.083664	T	0.10981	0.0268	L	0.40543	1.245	0.80722	D	1	B;B;B	0.32128	0.002;0.0;0.357	B;B;B	0.33960	0.002;0.0;0.173	T	0.04900	-1.0919	10	0.48119	T	0.1	.	9.9343	0.41541	0.2224:0.0:0.7776:0.0	.	352;446;455	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	H	455;446;446	ENSP00000195654:Q455H;ENSP00000237163:Q446H;ENSP00000358754:Q446H	ENSP00000237163:Q446H	Q	+	3	2	DOPEY1	83891167	0.969000	0.33509	0.982000	0.44146	0.983000	0.72400	0.667000	0.25112	1.389000	0.46526	0.557000	0.71058	CAG	DOPEY1	-	superfamily_ARM-type_fold	ENSG00000083097		0.388	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	44	0.00	0	G	NM_015018		83834448	83834448	+1	no_errors	ENST00000349129	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	0.995	C
PDXDC2P	283970	genome.wustl.edu	37	16	70011737	70011737	+	RNA	SNP	T	T	C	rs199849939	byFrequency	TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr16:70011737T>C	ENST00000531894.1	-	0	2724				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										CAGGGCCCATTTGCTATTACA	0.438													t|||	927	0.185104	0.0227	0.3228	5008	,	,		20508	0.0833		0.4046	False		,,,				2504	0.1861					dbGAP											0																																										-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70011737T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			RP11-419C5.2	-	-	ENSG00000226232		0.438	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	19	0.00	0	T			70011737	70011737	-1	no_errors	ENST00000525562	ensembl	human	known	69_37n	rna	26	30.77	12	SNP	0.002	C
DONSON	29980	genome.wustl.edu	37	21	34958385	34958385	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr21:34958385G>C	ENST00000303071.5	-	3	571	c.505C>G	c.(505-507)Caa>Gaa	p.Q169E	DONSON_ENST00000453626.1_Missense_Mutation_p.Q169E|DONSON_ENST00000303113.6_Missense_Mutation_p.Q169E|AP000304.12_ENST00000429238.1_Nonsense_Mutation_p.S130*|DONSON_ENST00000432378.1_Missense_Mutation_p.Q169E	NM_017613.3	NP_060083.1	Q9NYP3	DONS_HUMAN	downstream neighbor of SON	169					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|ovary(1)	11						GTAAAGGGTTGAGAAGAGGTG	0.433											OREG0003565	type=REGULATORY REGION|Gene=DONSON|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													101.0	87.0	92.0					21																	34958385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000002	CCDS13632.1	21q22.1	2008-07-31			ENSG00000159147	ENSG00000159147			2993	protein-coding gene	gene with protein product		611428		C21orf60		10773462, 10950926	Standard	NM_017613		Approved	B17, C2TA, DKFZP434M035	uc002ysk.4	Q9NYP3	OTTHUMG00000065904	ENST00000303071.5:c.505C>G	21.37:g.34958385G>C	ENSP00000307143:p.Gln169Glu	Somatic	851	WXS	Illumina GAIIx	Phase_IV	Q8NC53|Q9NSR9|Q9NVZ5|Q9NYP1|Q9NYP2	Nonsense_Mutation	SNP	pfam_ATPase_F1-cplx_OSCP/dsu,superfamily_ATPase_OSCP/delta_N	p.S130*	ENST00000303071.5	37	c.389	CCDS13632.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.68|18.68	3.675839|3.675839	0.67928|0.67928	.|.	.|.	ENSG00000159147|ENSG00000159147;ENSG00000249209	ENST00000303113;ENST00000453626;ENST00000303071;ENST00000432378|ENST00000440810;ENST00000429238	.|.	.|.	.|.	5.9|5.9	5.02|5.02	0.67125|0.67125	.|.	0.236778|.	0.44483|.	D|.	0.000445|.	T|.	0.77864|.	0.4194|.	M|M	0.79805|0.79805	2.47|2.47	0.38859|0.38859	D|D	0.956449|0.956449	B;B;B|.	0.09022|.	0.001;0.002;0.001|.	B;B;B|.	0.11329|.	0.002;0.006;0.002|.	T|.	0.81850|.	-0.0743|.	9|.	0.07030|0.52906	T|T	0.85|0.07	-12.3092|-12.3092	17.2527|17.2527	0.87047|0.87047	0.0:0.1256:0.8744:0.0|0.0:0.1256:0.8744:0.0	.|.	169;169;169|.	F8W8A5;C9J4K5;Q9NYP3|.	.;.;DONS_HUMAN|.	E|X	169|27;130	.|.	ENSP00000307143:Q169E|ENSP00000394107:S130X	Q|S	-|-	1|2	0|0	DONSON|DONSON;AP000304.12	33880255|33880255	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.443000|3.443000	0.52907|0.52907	1.491000|1.491000	0.48482|0.48482	-0.257000|-0.257000	0.10917|0.10917	CAA|TCA	AP000304.12	-	NULL	ENSG00000249209		0.433	DONSON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000249209	Clone_based_vega_gene	protein_coding	OTTHUMT00000141184.1	29	0.00	0	G	NM_017613		34958385	34958385	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429238	ensembl	human	putative	69_37n	nonsense	38	22.45	11	SNP	1.000	C
EPG5	57724	genome.wustl.edu	37	18	43435611	43435611	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr18:43435611A>G	ENST00000282041.5	-	43	7518	c.7484T>C	c.(7483-7485)gTt>gCt	p.V2495A	EPG5_ENST00000585906.1_5'Flank	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2495					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						AGGAACCTGAACTGAAAGGAA	0.453																																						dbGAP											0													59.0	60.0	60.0					18																	43435611		1899	4123	6022	-	-	-	SO:0001583	missense	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7484T>C	18.37:g.43435611A>G	ENSP00000282041:p.Val2495Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.V2495A	ENST00000282041.5	37	c.7484	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	A	11.85	1.760608	0.31137	.	.	ENSG00000152223	ENST00000282041;ENST00000540322	T	0.08546	3.08	5.54	5.54	0.83059	.	0.229124	0.27447	U	0.019325	T	0.04634	0.0126	N	0.16478	0.41	0.34233	D	0.676725	B	0.31318	0.319	B	0.26416	0.069	T	0.32955	-0.9887	10	0.10111	T	0.7	-11.8754	10.0801	0.42384	0.9249:0.0:0.0751:0.0	.	2495	Q9HCE0	EPG5_HUMAN	A	2495;423	ENSP00000282041:V2495A	ENSP00000282041:V2495A	V	-	2	0	EPG5	41689609	0.998000	0.40836	0.997000	0.53966	0.986000	0.74619	5.665000	0.68052	2.110000	0.64415	0.459000	0.35465	GTT	EPG5	-	NULL	ENSG00000152223		0.453	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	25	0.00	0	A	NM_020964		43435611	43435611	-1	no_errors	ENST00000282041	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.990	G
EPS8L3	79574	genome.wustl.edu	37	1	110300157	110300157	+	Silent	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:110300157C>T	ENST00000361965.4	-	11	1021	c.915G>A	c.(913-915)ctG>ctA	p.L305L	EPS8L3_ENST00000494151.1_5'Flank|EPS8L3_ENST00000361852.4_Silent_p.L305L|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000369805.3_Silent_p.L306L	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	305						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		TTGTCTCCTTCAGCCAGGTGG	0.557																																						dbGAP											0													81.0	69.0	73.0					1																	110300157		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.915G>A	1.37:g.110300157C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Silent	SNP	pfam_PTB,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_SH3_domain,pfscan_SH3_domain	p.L306	ENST00000361965.4	37	c.918	CCDS814.1	1																																																																																			EPS8L3	-	NULL	ENSG00000198758		0.557	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EPS8L3	HGNC	protein_coding	OTTHUMT00000032234.1	99	0.00	0	C	NM_024526		110300157	110300157	-1	no_errors	ENST00000369805	ensembl	human	known	69_37n	silent	100	13.04	15	SNP	0.225	T
F5	2153	genome.wustl.edu	37	1	169510087	169510087	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:169510087T>A	ENST00000367797.3	-	13	4442	c.4241A>T	c.(4240-4242)gAc>gTc	p.D1414V	F5_ENST00000367796.3_Missense_Mutation_p.D1419V	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1414	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CTCACCAAGGTCTGGAGAAAG	0.522																																						dbGAP											0													83.0	88.0	87.0					1																	169510087		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.4241A>T	1.37:g.169510087T>A	ENSP00000356771:p.Asp1414Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.D1419V	ENST00000367797.3	37	c.4256	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.820755	0.50633	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.35421	1.31;1.31	4.79	3.6	0.41247	.	0.336802	0.27130	N	0.020796	T	0.19005	0.0456	M	0.78456	2.415	0.29011	N	0.886887	P	0.38250	0.624	B	0.35727	0.209	T	0.08554	-1.0716	9	0.33141	T	0.24	-11.3574	5.6498	0.17610	0.1681:0.0:0.1744:0.6575	.	1414	P12259	FA5_HUMAN	V	1414;1419	ENSP00000356771:D1414V;ENSP00000356770:D1419V	ENSP00000356770:D1419V	D	-	2	0	F5	167776711	0.797000	0.28877	0.172000	0.22920	0.028000	0.11728	2.909000	0.48758	1.812000	0.52913	0.477000	0.44152	GAC	F5	-	NULL	ENSG00000198734		0.522	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	78	0.00	0	T	NM_000130		169510087	169510087	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	105	13.93	17	SNP	0.085	A
F5	2153	genome.wustl.edu	37	1	169510415	169510415	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:169510415G>C	ENST00000367797.3	-	13	4114	c.3913C>G	c.(3913-3915)Cca>Gca	p.P1305A	F5_ENST00000367796.3_Missense_Mutation_p.P1310A	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1305	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CTGAGTTCTGGAGAGAGAGTC	0.512																																						dbGAP											0													273.0	297.0	289.0					1																	169510415		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3913C>G	1.37:g.169510415G>C	ENSP00000356771:p.Pro1305Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.P1310A	ENST00000367797.3	37	c.3928	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.310444	0.40895	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.39406	1.08;1.08	3.91	1.81	0.25067	.	0.773554	0.11719	N	0.536082	T	0.17109	0.0411	M	0.67397	2.05	0.25081	N	0.990921	P	0.46395	0.877	B	0.38106	0.265	T	0.07328	-1.0778	9	0.17832	T	0.49	-7.9703	6.6003	0.22697	0.1084:0.0:0.7149:0.1767	.	1305	P12259	FA5_HUMAN	A	1305;1310	ENSP00000356771:P1305A;ENSP00000356770:P1310A	ENSP00000356770:P1310A	P	-	1	0	F5	167777039	0.001000	0.12720	0.478000	0.27316	0.027000	0.11550	0.039000	0.13884	0.758000	0.33059	0.542000	0.68232	CCA	F5	-	NULL	ENSG00000198734		0.512	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	188	0.00	0	G	NM_000130		169510415	169510415	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	211	12.08	29	SNP	0.096	C
FAM179B	23116	genome.wustl.edu	37	14	45496657	45496657	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr14:45496657G>C	ENST00000361577.3	+	9	3698	c.3484G>C	c.(3484-3486)Gat>Cat	p.D1162H	FAM179B_ENST00000361462.2_Missense_Mutation_p.D1162H|FAM179B_ENST00000382233.2_3'UTR|KLHL28_ENST00000553817.1_Intron	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1162										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						ATCATATCTTGATGTTGAGAA	0.313																																						dbGAP											0													53.0	54.0	54.0					14																	45496657		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3484G>C	14.37:g.45496657G>C	ENSP00000355045:p.Asp1162His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1162H	ENST00000361577.3	37	c.3484	CCDS9681.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.48|14.48	2.548981|2.548981	0.45383|0.45383	.|.	.|.	ENSG00000198718|ENSG00000198718	ENST00000361577;ENST00000361462|ENST00000429476	T;T|.	0.04083|.	3.71;3.71|.	5.39|5.39	5.39|5.39	0.77823|0.77823	Armadillo-type fold (1);|.	0.321554|.	0.29760|.	N|.	0.011277|.	T|.	0.50650|.	0.1628|.	N|N	0.17082|0.17082	0.46|0.46	0.80722|0.80722	D|D	1|1	B;B|.	0.18610|.	0.029;0.029|.	B;B|.	0.17433|.	0.018;0.011|.	T|.	0.44498|.	-0.9324|.	10|.	0.38643|.	T|.	0.18|.	-13.0584|-13.0584	16.4437|16.4437	0.83909|0.83909	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1162;1162|.	G3XAE9;Q9Y4F4|.	.;F179B_HUMAN|.	H|S	1162|1161	ENSP00000355045:D1162H;ENSP00000354917:D1162H|.	ENSP00000354917:D1162H|.	D|X	+|+	1|2	0|2	FAM179B|FAM179B	44566407|44566407	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.971000|0.971000	0.66376|0.66376	4.095000|4.095000	0.57728|0.57728	2.676000|2.676000	0.91093|0.91093	0.655000|0.655000	0.94253|0.94253	GAT|TGA	FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.313	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	29	0.00	0	G	XM_113781		45496657	45496657	+1	no_errors	ENST00000361577	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	C
FAM214B	80256	genome.wustl.edu	37	9	35105681	35105681	+	Silent	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr9:35105681G>C	ENST00000378561.1	-	7	4516	c.1461C>G	c.(1459-1461)ctC>ctG	p.L487L	FAM214B_ENST00000378566.1_Silent_p.L182L|STOML2_ENST00000356493.5_5'Flank|STOML2_ENST00000452248.2_5'Flank|FAM214B_ENST00000322813.5_Silent_p.L487L|FAM214B_ENST00000378557.1_Silent_p.L487L|FAM214B_ENST00000603301.1_Silent_p.L487L|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000488109.2_Silent_p.L487L|FAM214B_ENST00000378554.2_Intron|FAM214B_ENST00000605244.1_Silent_p.L487L			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	487						nucleus (GO:0005634)											CTCCTCACCTGAGGTGCAGCA	0.592																																						dbGAP											0													39.0	41.0	40.0					9																	35105681		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.1461C>G	9.37:g.35105681G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Silent	SNP	NULL	p.L487	ENST00000378561.1	37	c.1461	CCDS6578.1	9																																																																																			FAM214B	-	NULL	ENSG00000005238		0.592	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214B	HGNC	protein_coding	OTTHUMT00000052261.1	33	0.00	0	G	NM_025182		35105681	35105681	-1	no_errors	ENST00000322813	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	1.000	C
FAM71B	153745	genome.wustl.edu	37	5	156589753	156589753	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr5:156589753T>A	ENST00000302938.4	-	2	1618	c.1523A>T	c.(1522-1524)gAg>gTg	p.E508V		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	508						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGTTCTCGACTCCTTTTTGGT	0.478																																						dbGAP											0													151.0	152.0	152.0					5																	156589753		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1523A>T	5.37:g.156589753T>A	ENSP00000305596:p.Glu508Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	pfam_DUF3699	p.E508V	ENST00000302938.4	37	c.1523	CCDS4335.1	5	.	.	.	.	.	.	.	.	.	.	T	12.91	2.079249	0.36662	.	.	ENSG00000170613	ENST00000302938	T	0.18502	2.21	4.52	3.33	0.38152	.	0.176528	0.27504	N	0.019079	T	0.12092	0.0294	L	0.51914	1.62	0.31545	N	0.659409	P	0.43169	0.8	B	0.29942	0.109	T	0.15983	-1.0418	10	0.62326	D	0.03	-19.5778	7.8344	0.29362	0.185:0.0:0.0:0.815	.	508	Q8TC56	FA71B_HUMAN	V	508	ENSP00000305596:E508V	ENSP00000305596:E508V	E	-	2	0	FAM71B	156522331	0.927000	0.31430	0.463000	0.27130	0.020000	0.10135	0.745000	0.26259	0.808000	0.34231	0.533000	0.62120	GAG	FAM71B	-	NULL	ENSG00000170613		0.478	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	170	0.00	0	T	NM_130899		156589753	156589753	-1	no_errors	ENST00000302938	ensembl	human	known	69_37n	missense	104	34.18	54	SNP	0.978	A
FATE1	89885	genome.wustl.edu	37	X	150884668	150884669	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:150884668_150884669GG>TT	ENST00000370350.3	+	1	162_163	c.77_78GG>TT	c.(76-78)gGG>gTT	p.G26V		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	26						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GGACGCCAAGGGGAAAACCAAG	0.52																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	Exception_encountered	X.37:g.150884668_150884669delinsTT	ENSP00000359375:p.Gly26Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation|Silent	SNP	pfam_FATE/Miff/Tango-11	p.G26V|p.G26	ENST00000370350.3	37	c.77|c.78	CCDS14700.1	X																																																																																			FATE1	-	NULL	ENSG00000147378		0.520	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	49|48	0.00	0	G	NM_033085		150884668|150884669	150884668|150884669	+1	no_errors	ENST00000370350	ensembl	human	known	69_37n	missense|silent	21|20	22.22|20.00	6|5	SNP	0.000	T
FERD3L	222894	genome.wustl.edu	37	7	19184757	19184757	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr7:19184757C>A	ENST00000275461.3	-	1	287	c.229G>T	c.(229-231)Gag>Tag	p.E77*	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	77	Poly-Glu.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E77K(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						tcttcctcctcctcttctccg	0.632																																						dbGAP											1	Substitution - Missense(1)	lung(1)											69.0	49.0	56.0					7																	19184757		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.229G>T	7.37:g.19184757C>A	ENSP00000275461:p.Glu77*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495K0	Nonsense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.E77*	ENST00000275461.3	37	c.229	CCDS5368.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.246066	0.95272	.	.	ENSG00000146618	ENST00000275461	.	.	.	5.55	5.55	0.83447	.	0.663993	0.15107	N	0.280182	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	0.37	17.6923	0.88271	0.0:1.0:0.0:0.0	.	.	.	.	X	77	.	ENSP00000275461:E77X	E	-	1	0	FERD3L	19151282	1.000000	0.71417	0.991000	0.47740	0.925000	0.55904	6.714000	0.74692	2.637000	0.89404	0.650000	0.86243	GAG	FERD3L	-	NULL	ENSG00000146618		0.632	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1	18	0.00	0	C			19184757	19184757	-1	no_errors	ENST00000275461	ensembl	human	known	69_37n	nonsense	29	18.92	7	SNP	0.930	A
FRMPD4	9758	genome.wustl.edu	37	X	12735862	12735862	+	Missense_Mutation	SNP	G	G	A	rs200249861		TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:12735862G>A	ENST00000380682.1	+	16	3423	c.2917G>A	c.(2917-2919)Gct>Act	p.A973T		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	973					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CGCCCTGGCTGCTAGGCCAGC	0.597																																						dbGAP											0													57.0	59.0	58.0					X																	12735862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2917G>A	X.37:g.12735862G>A	ENSP00000370057:p.Ala973Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X9|O15032	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.A973T	ENST00000380682.1	37	c.2917	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	G	6.329	0.428783	0.11987	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.05786	3.39	5.47	1.52	0.23074	.	0.697816	0.13925	N	0.353274	T	0.05227	0.0139	L	0.51422	1.61	0.09310	N	1	B;B	0.31769	0.339;0.304	B;B	0.24701	0.055;0.05	T	0.40997	-0.9533	10	0.21540	T	0.41	-3.1597	4.8077	0.13328	0.307:0.2702:0.4228:0.0	.	965;973	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	T	973;964;962	ENSP00000370057:A973T	ENSP00000304583:A962T	A	+	1	0	FRMPD4	12645783	0.136000	0.22515	0.004000	0.12327	0.399000	0.30720	0.524000	0.22940	0.152000	0.19188	0.513000	0.50165	GCT	FRMPD4	-	NULL	ENSG00000169933		0.597	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	33	0.00	0	G	XM_045712		12735862	12735862	+1	no_errors	ENST00000380682	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	0.000	A
FXYD3	5349	genome.wustl.edu	37	19	35612200	35612200	+	Intron	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:35612200G>C	ENST00000344013.6	+	5	293				FXYD3_ENST00000535103.1_Intron|FXYD3_ENST00000604621.1_Intron|FXYD3_ENST00000603524.1_Intron|FXYD3_ENST00000604804.1_Intron|FXYD3_ENST00000435734.2_Intron|FXYD3_ENST00000604255.1_Intron|FXYD3_ENST00000603181.1_Intron|FXYD3_ENST00000346446.5_Intron|FXYD3_ENST00000605550.1_Intron|FXYD3_ENST00000605552.1_Missense_Mutation_p.V50L|FXYD3_ENST00000406988.1_Intron|FXYD3_ENST00000603449.1_Missense_Mutation_p.V50L|FXYD3_ENST00000454903.2_Missense_Mutation_p.V50L|FXYD3_ENST00000605677.1_Intron|FXYD3_ENST00000604404.1_Intron|FXYD3_ENST00000406242.3_Intron			Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of catalytic activity (GO:0050790)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			endometrium(1)|lung(2)|prostate(1)	4	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			ATACTGCTTGGTGCCAAGGGT	0.507																																						dbGAP											0													40.0	44.0	43.0					19																	35612200		2200	4298	6498	-	-	-	SO:0001627	intron_variant	0			X93036	CCDS12442.1, CCDS12443.1, CCDS46048.1, CCDS46049.1, CCDS46050.1	19q13.11-q13.12	2008-05-14	2002-01-14			ENSG00000089356			4027	protein-coding gene	gene with protein product		604996	"""FXYD domain-containing ion transport regulator 3"""	PLML		7836447, 10950925	Standard	NM_005971		Approved	MAT-8	uc010xsm.2	Q14802		ENST00000344013.6:c.97+51G>C	19.37:g.35612200G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDE0|C9JDU2|F5H174|F8WB34|Q13211|Q6IB59	Missense_Mutation	SNP	NULL	p.V50L	ENST00000344013.6	37	c.148	CCDS12442.1	19	.	.	.	.	.	.	.	.	.	.	G	9.876	1.200311	0.22121	.	.	ENSG00000089356	ENST00000454903	.	.	.	4.09	-1.27	0.09347	.	.	.	.	.	T	0.16128	0.0388	.	.	.	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.25117	-1.0141	6	.	.	.	.	1.0342	0.01544	0.2152:0.1772:0.4265:0.1812	.	50	C9JDU2	.	L	50	.	.	V	+	1	0	FXYD3	40304040	0.000000	0.05858	0.003000	0.11579	0.219000	0.24729	0.081000	0.14823	0.103000	0.17682	0.467000	0.42956	GTG	FXYD3	-	NULL	ENSG00000089356		0.507	FXYD3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FXYD3	HGNC	protein_coding	OTTHUMT00000468985.1	43	0.00	0	G	NM_021910		35612200	35612200	+1	no_errors	ENST00000454903	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	0.000	C
GABRA3	2556	genome.wustl.edu	37	X	151358349	151358350	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C|A	C|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:151358349_151358350CA>AC	ENST00000370314.4	-	9	1233_1234	c.995_996TG>GT	c.(994-996)gTG>gGT	p.V332G	GABRA3_ENST00000497894.1_5'UTR|GABRA3_ENST00000535043.1_Missense_Mutation_p.V332G	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	332					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCGCATATGCCACTTTAGGTAA	0.465																																					NSCLC(142;2578 2613 10251 16743)	dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.995_996delinsAC	X.37:g.151358349_151358350delinsAC	ENSP00000359337:p.Val332Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAF9	Silent|Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABBAa3_rcpt,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V332|p.V332G	ENST00000370314.4	37	c.996|c.995	CCDS14706.1	X																																																																																			GABRA3	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000011677		0.465	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA3	HGNC	protein_coding	OTTHUMT00000060921.1	51|52	0.00	0	C|A	NM_000808		151358349|151358350	151358349|151358350	-1	no_errors	ENST00000370311	ensembl	human	known	69_37n	silent|missense	39|38	11.36|11.63	5	SNP	1.000	A|C
GOT1	2805	genome.wustl.edu	37	10	101163403	101163403	+	Intron	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr10:101163403G>C	ENST00000370508.5	-	7	821				GOT1_ENST00000543866.1_Intron	NM_002079.2	NP_002070.1	P17174	AATC_HUMAN	glutamic-oxaloacetic transaminase 1, soluble						2-oxoglutarate metabolic process (GO:0006103)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to insulin stimulus (GO:0032869)|fatty acid homeostasis (GO:0055089)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|glycerol biosynthetic process (GO:0006114)|L-methionine biosynthetic process from methylthioadenosine (GO:0019509)|oxaloacetate metabolic process (GO:0006107)|polyamine metabolic process (GO:0006595)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	carboxylic acid binding (GO:0031406)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-cysteine:2-oxoglutarate aminotransferase activity (GO:0047801)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|phosphatidylserine decarboxylase activity (GO:0004609)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)	16		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)	TAAAGAGAGGGACCAGAATCA	0.532																																					Melanoma(173;770 3544 21601)	dbGAP											0													78.0	76.0	76.0					10																	101163403		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			M37400	CCDS7479.1	10q24.1-q25.1	2013-05-29	2013-05-29		ENSG00000120053	ENSG00000120053	2.6.1.1		4432	protein-coding gene	gene with protein product	"""aspartate aminotransferase 1"", ""aspartate transaminase 1"""	138180	"""glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)"""			1974457	Standard	NM_002079		Approved		uc001kpr.3	P17174	OTTHUMG00000018882	ENST00000370508.5:c.794-12C>G	10.37:g.101163403G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6R7|B7Z7E9|Q5VW80	RNA	SNP	-	NULL	ENST00000370508.5	37	NULL	CCDS7479.1	10																																																																																			GOT1	-	-	ENSG00000120053		0.532	GOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT1	HGNC	protein_coding	OTTHUMT00000049794.1	48	0.00	0	G	NM_002079		101163403	101163403	-1	no_errors	ENST00000489349	ensembl	human	known	69_37n	rna	33	21.43	9	SNP	0.000	C
GPNMB	10457	genome.wustl.edu	37	7	23286540	23286540	+	Missense_Mutation	SNP	G	G	A	rs370332714		TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr7:23286540G>A	ENST00000381990.2	+	1	225	c.64G>A	c.(64-66)Gcc>Acc	p.A22T	GPNMB_ENST00000409458.3_Missense_Mutation_p.A22T|GPNMB_ENST00000539136.1_Missense_Mutation_p.A22T|GPNMB_ENST00000453162.2_Missense_Mutation_p.A22T|GPNMB_ENST00000258733.4_Missense_Mutation_p.A22T	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	22					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			ACTTGATGCCGCCAAACGTGA	0.448																																						dbGAP											0													150.0	159.0	156.0					7																	23286540		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.64G>A	7.37:g.23286540G>A	ENSP00000371420:p.Ala22Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.A22T	ENST00000381990.2	37	c.64	CCDS34610.1	7	.	.	.	.	.	.	.	.	.	.	G	16.14	3.037463	0.54896	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000425903;ENST00000409458;ENST00000539136;ENST00000453162	T;T;T;T	0.17528	2.5;2.51;2.27;2.51	5.8	3.04	0.35103	.	0.090041	0.48286	N	0.000189	T	0.15652	0.0377	M	0.76838	2.35	0.28817	N	0.89791	P;P;P;P;P	0.45283	0.855;0.855;0.774;0.855;0.855	B;B;B;B;B	0.29942	0.109;0.109;0.051;0.109;0.109	T	0.17289	-1.0374	10	0.28530	T	0.3	-14.4791	10.1805	0.42965	0.214:0.0:0.786:0.0	.	22;22;22;22;22	F6SKP1;F5GY20;Q14956;Q14956-2;Q96F58	.;.;GPNMB_HUMAN;.;.	T	22;57;22;22;22;22;22	ENSP00000258733:A22T;ENSP00000371420:A22T;ENSP00000445266:A22T;ENSP00000405586:A22T	ENSP00000258733:A22T	A	+	1	0	GPNMB	23253065	0.956000	0.32656	0.389000	0.26208	0.262000	0.26303	1.481000	0.35476	0.377000	0.24735	0.591000	0.81541	GCC	GPNMB	-	NULL	ENSG00000136235		0.448	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPNMB	HGNC	protein_coding	OTTHUMT00000327152.1	70	0.00	0	G	NM_001005340		23286540	23286540	+1	no_errors	ENST00000381990	ensembl	human	known	69_37n	missense	60	25.00	20	SNP	0.838	A
GSPT2	23708	genome.wustl.edu	37	X	51487622	51487622	+	Silent	SNP	T	T	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:51487622T>A	ENST00000340438.4	+	1	1142	c.900T>A	c.(898-900)ggT>ggA	p.G300G		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	300	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					ATATGATTGGTGGTGCTTCTC	0.438																																						dbGAP											0													167.0	159.0	162.0					X																	51487622		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.900T>A	X.37:g.51487622T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H909|Q9NVY0|Q9NY44	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd	p.G300	ENST00000340438.4	37	c.900	CCDS14336.1	X																																																																																			GSPT2	-	pfam_ProtSyn_GTP-bd,prints_ProtSyn_GTP-bd	ENSG00000189369		0.438	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSPT2	HGNC	protein_coding	OTTHUMT00000056587.1	43	0.00	0	T			51487622	51487622	+1	no_errors	ENST00000340438	ensembl	human	known	69_37n	silent	45	10.00	5	SNP	0.991	A
HIVEP1	3096	genome.wustl.edu	37	6	12161680	12161680	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:12161680C>G	ENST00000379388.2	+	8	6828	c.6496C>G	c.(6496-6498)Cag>Gag	p.Q2166E	HIVEP1_ENST00000541134.1_Missense_Mutation_p.Q31E	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2166					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AGATGAAAAACAGAGATTCAG	0.383																																						dbGAP											0													88.0	94.0	92.0					6																	12161680		1889	4120	6009	-	-	-	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.6496C>G	6.37:g.12161680C>G	ENSP00000368698:p.Gln2166Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q2166E	ENST00000379388.2	37	c.6496	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583418	0.65992	.	.	ENSG00000095951	ENST00000379388;ENST00000442081;ENST00000541134;ENST00000542327	T;T	0.32515	2.94;1.45	5.77	5.77	0.91146	.	0.000000	0.33127	N	0.005245	T	0.36853	0.0982	M	0.76170	2.325	0.52099	D	0.999949	P	0.42248	0.774	P	0.49047	0.599	T	0.04737	-1.0930	10	0.22109	T	0.4	-21.1529	19.9827	0.97334	0.0:1.0:0.0:0.0	.	2166	P15822	ZEP1_HUMAN	E	2166;93;31;148	ENSP00000368698:Q2166E;ENSP00000445617:Q31E	ENSP00000368698:Q2166E	Q	+	1	0	HIVEP1	12269666	1.000000	0.71417	0.361000	0.25849	0.532000	0.34746	4.169000	0.58223	2.728000	0.93425	0.655000	0.94253	CAG	HIVEP1	-	NULL	ENSG00000095951		0.383	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	13	0.00	0	C	NM_002114		12161680	12161680	+1	no_errors	ENST00000379388	ensembl	human	known	69_37n	missense	23	27.27	9	SNP	1.000	G
HRH1	3269	genome.wustl.edu	37	3	11301539	11301539	+	Silent	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:11301539C>G	ENST00000397056.1	+	3	1007	c.816C>G	c.(814-816)gtC>gtG	p.V272V	HRH1_ENST00000438284.2_Silent_p.V272V|HRH1_ENST00000431010.2_Silent_p.V272V	NM_000861.3|NM_001098211.1	NP_000852.1|NP_001091681.1	P35367	HRH1_HUMAN	histamine receptor H1	272					cellular response to histamine (GO:0071420)|eosinophil chemotaxis (GO:0048245)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|inositol phosphate-mediated signaling (GO:0048016)|memory (GO:0007613)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|regulation of vascular permeability (GO:0043114)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|histamine receptor activity (GO:0004969)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25					Aceprometazine(DB01615)|Alcaftadine(DB06766)|Alimemazine(DB01246)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Antazoline(DB08799)|Aripiprazole(DB01238)|Asenapine(DB06216)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzatropine(DB00245)|Bepotastine(DB04890)|Betahistine(DB06698)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlorcyclizine(DB08936)|Chloropyramine(DB08800)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clemastine(DB00283)|Clofedanol(DB04837)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Dimetindene(DB08801)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Escitalopram(DB01175)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Iloperidone(DB04946)|Imipramine(DB00458)|Isothipendyl(DB08802)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Loxapine(DB00408)|Maprotiline(DB00934)|Meclizine(DB00737)|Mepyramine(DB06691)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Paliperidone(DB01267)|Phenindamine(DB01619)|Pheniramine(DB01620)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	GTGGATCTGTCTTGAAGTCAC	0.507																																						dbGAP											0													58.0	63.0	61.0					3																	11301539		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2604.1	3p25	2012-11-12			ENSG00000196639	ENSG00000196639		"""GPCR / Class A : Histamine receptors"""	5182	protein-coding gene	gene with protein product		600167				8003029	Standard	NM_001098211		Approved		uc010hds.3	P35367	OTTHUMG00000129719	ENST00000397056.1:c.816C>G	3.37:g.11301539C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K047|Q6P9E5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Histamine_H1_recept,prints_7TM_GPCR_Rhodpsn,prints_Musac_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.V272	ENST00000397056.1	37	c.816	CCDS2604.1	3																																																																																			HRH1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196639		0.507	HRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH1	HGNC	protein_coding	OTTHUMT00000251928.2	14	0.00	0	C			11301539	11301539	+1	no_errors	ENST00000397056	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	0.001	G
HSD3B2	3284	genome.wustl.edu	37	1	119965062	119965062	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:119965062C>T	ENST00000543831.1	+	4	1187	c.938C>T	c.(937-939)cCc>cTc	p.P313L	HSD3B2_ENST00000369416.3_Missense_Mutation_p.P313L	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	313					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	TATCAACCCCCCTTCAACCGC	0.488																																						dbGAP											0													91.0	93.0	92.0					1																	119965062		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.938C>T	1.37:g.119965062C>T	ENSP00000445122:p.Pro313Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	p.P313L	ENST00000543831.1	37	c.938	CCDS902.1	1	.	.	.	.	.	.	.	.	.	.	-	7.418	0.636192	0.14386	.	.	ENSG00000203859	ENST00000543831;ENST00000369416	T;T	0.55930	0.49;0.49	4.1	2.1	0.27182	.	0.163924	0.53938	N	0.000042	T	0.22085	0.0532	L	0.41906	1.305	0.43617	D	0.99599	B	0.23854	0.092	B	0.27262	0.078	T	0.04650	-1.0936	9	.	.	.	-0.1767	8.5908	0.33686	0.0:0.7583:0.153:0.0887	.	313	P26439	3BHS2_HUMAN	L	313	ENSP00000445122:P313L;ENSP00000358424:P313L	.	P	+	2	0	HSD3B2	119766585	0.015000	0.18098	0.041000	0.18516	0.059000	0.15707	2.262000	0.43285	0.197000	0.20387	0.298000	0.19748	CCC	HSD3B2	-	NULL	ENSG00000203859		0.488	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	HGNC	protein_coding	OTTHUMT00000034994.1	71	0.00	0	C	NM_000198		119965062	119965062	+1	no_errors	ENST00000369416	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	0.809	T
IFITM2	10581	genome.wustl.edu	37	11	308202	308202	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr11:308202A>T	ENST00000399817.4	+	1	40	c.10A>T	c.(10-12)Att>Ttt	p.I4F	IFITM2_ENST00000533141.1_Intron|IFITM2_ENST00000602569.1_5'Flank|RP11-326C3.7_ENST00000526612.1_RNA	NM_006435.2	NP_006426.2	Q01629	IFM2_HUMAN	interferon induced transmembrane protein 2	4					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		CATGAACCACATTGTGCAAAC	0.562																																						dbGAP											0													173.0	202.0	193.0					11																	308202		2027	4178	6205	-	-	-	SO:0001583	missense	0			X57351	CCDS41583.1	11p15.5	2012-03-13	2012-03-13		ENSG00000185201	ENSG00000185201			5413	protein-coding gene	gene with protein product		605578	"""interferon induced transmembrane protein 2 (1-8D)"""			1906403	Standard	NM_006435		Approved	1-8D	uc001lox.4	Q01629		ENST00000399817.4:c.10A>T	11.37:g.308202A>T	ENSP00000382714:p.Ile4Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FH82|Q96DA8	Missense_Mutation	SNP	pfam_Interferon-induced_TM_protein	p.I4F	ENST00000399817.4	37	c.10	CCDS41583.1	11	.	.	.	.	.	.	.	.	.	.	A	11.51	1.659300	0.29515	.	.	ENSG00000185201	ENST00000399817;ENST00000327366	T	0.75477	-0.94	2.8	0.08	0.14418	.	.	.	.	.	T	0.54565	0.1866	N	0.19112	0.55	0.09310	N	1	B	0.23316	0.083	B	0.23275	0.045	T	0.46275	-0.9203	9	0.66056	D	0.02	.	3.2356	0.06763	0.6066:0.2431:0.1503:0.0	.	4	Q01629	IFM2_HUMAN	F	4	ENSP00000382714:I4F	ENSP00000327996:I4F	I	+	1	0	IFITM2	298202	0.016000	0.18221	0.001000	0.08648	0.039000	0.13416	0.545000	0.23268	-0.121000	0.11787	0.260000	0.18958	ATT	IFITM2	-	NULL	ENSG00000185201		0.562	IFITM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFITM2	HGNC	protein_coding	OTTHUMT00000383591.1	49	0.00	0	A	NM_006435		308202	308202	+1	no_errors	ENST00000399817	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.001	T
IFNA7	3444	genome.wustl.edu	37	9	21201849	21201849	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr9:21201849C>G	ENST00000239347.3	-	1	355	c.316G>C	c.(316-318)Gaa>Caa	p.E106Q		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	106					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GAAAATTTTTCTAGGAGGCTC	0.483																																						dbGAP											0													48.0	56.0	53.0					9																	21201849		2199	4279	6478	-	-	-	SO:0001583	missense	0				CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.316G>C	9.37:g.21201849C>G	ENSP00000239347:p.Glu106Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14607|Q5VV14	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.E106Q	ENST00000239347.3	37	c.316	CCDS34995.1	9	.	.	.	.	.	.	.	.	.	.	C	8.474	0.858155	0.17178	.	.	ENSG00000214042	ENST00000239347	T	0.08008	3.14	3.56	0.463	0.16700	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.554721	0.19168	N	0.121007	T	0.09774	0.0240	M	0.66439	2.03	0.09310	N	1	B	0.23650	0.089	B	0.29785	0.107	T	0.25222	-1.0138	10	0.72032	D	0.01	.	4.2336	0.10615	0.0:0.5083:0.1839:0.3078	.	106	P01567	IFNA7_HUMAN	Q	106	ENSP00000239347:E106Q	ENSP00000239347:E106Q	E	-	1	0	IFNA7	21191849	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.146000	0.10250	0.141000	0.18875	-0.201000	0.12746	GAA	IFNA7	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	ENSG00000214042		0.483	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA7	HGNC	protein_coding	OTTHUMT00000051891.1	80	0.00	0	C	NM_021057		21201849	21201849	-1	no_errors	ENST00000239347	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	0.000	G
IGF1R	3480	genome.wustl.edu	37	15	99465386	99465386	+	Silent	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr15:99465386G>A	ENST00000268035.6	+	11	2822	c.2211G>A	c.(2209-2211)agG>agA	p.R737R	IGF1R_ENST00000558762.1_Silent_p.R737R	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	737	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GACCTGAAAGGAAGCGGAGAG	0.483																																						dbGAP											0													75.0	73.0	74.0					15																	99465386		2197	4297	6494	-	-	-	SO:0001819	synonymous_variant	0			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2211G>A	15.37:g.99465386G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1B5Y2|Q14CV2|Q9UCC0	Silent	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.R737	ENST00000268035.6	37	c.2211	CCDS10378.1	15																																																																																			IGF1R	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000140443		0.483	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	IGF1R	HGNC	protein_coding	OTTHUMT00000313537.2	33	0.00	0	G	NM_000875		99465386	99465386	+1	no_errors	ENST00000268035	ensembl	human	known	69_37n	silent	73	12.05	10	SNP	1.000	A
ING5	84289	genome.wustl.edu	37	2	242648663	242648663	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr2:242648663G>C	ENST00000313552.6	+	3	168	c.142G>C	c.(142-144)Gag>Cag	p.E48Q	ING5_ENST00000482774.1_3'UTR|ING5_ENST00000406941.1_Missense_Mutation_p.E48Q	NM_032329.4	NP_115705.2	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5	48					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|skin(1)	3		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		CCTGGCTGCAGAGTACATCTC	0.532																																						dbGAP											0													147.0	148.0	147.0					2																	242648663		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF189286	CCDS33425.1	2q37.3	2013-01-28			ENSG00000168395	ENSG00000168395		"""Zinc fingers, PHD-type"""	19421	protein-coding gene	gene with protein product		608525				12750254	Standard	NM_032329		Approved	FLJ23842, p28ING5	uc002wcd.3	Q8WYH8	OTTHUMG00000151501	ENST00000313552.6:c.142G>C	2.37:g.242648663G>C	ENSP00000322142:p.Glu48Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1P3|Q53NU6|Q57Z54|Q9BS30	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E48Q	ENST00000313552.6	37	c.142	CCDS33425.1	2	.	.	.	.	.	.	.	.	.	.	G	16.12	3.034057	0.54896	.	.	ENSG00000168395	ENST00000313552;ENST00000406941	.	.	.	5.54	4.65	0.58169	Inhibitor of growth protein, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.44829	0.1312	L	0.37697	1.125	0.49798	D	0.999821	B;B	0.29341	0.014;0.242	B;B	0.25987	0.026;0.065	T	0.30563	-0.9974	9	0.21014	T	0.42	-11.2063	12.1053	0.53810	0.0:0.1306:0.7337:0.1357	.	48;48	Q8WYH8;B7Z6R2	ING5_HUMAN;.	Q	48	.	ENSP00000322142:E48Q	E	+	1	0	ING5	242297336	1.000000	0.71417	0.983000	0.44433	0.998000	0.95712	6.817000	0.75252	1.332000	0.45431	0.591000	0.81541	GAG	ING5	-	NULL	ENSG00000168395		0.532	ING5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING5	HGNC	protein_coding	OTTHUMT00000322901.3	53	0.00	0	G	NM_032329		242648663	242648663	+1	no_errors	ENST00000313552	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	0.994	C
INVS	27130	genome.wustl.edu	37	9	103055138	103055138	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr9:103055138C>A	ENST00000262457.2	+	14	2784	c.2599C>A	c.(2599-2601)Ctg>Atg	p.L867M	INVS_ENST00000541287.1_Missense_Mutation_p.L771M|INVS_ENST00000262456.2_Intron	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	867					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				GACATCTACCCTGTCCGAGGA	0.537																																						dbGAP											0													115.0	112.0	113.0					9																	103055138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.2599C>A	9.37:g.103055138C>A	ENSP00000262457:p.Leu867Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_IQ_motif_EF-hand-BS,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Ankyrin_rpt	p.L867M	ENST00000262457.2	37	c.2599	CCDS6746.1	9	.	.	.	.	.	.	.	.	.	.	C	1.884	-0.457222	0.04540	.	.	ENSG00000119509	ENST00000262457;ENST00000541287	T;T	0.42513	0.97;0.97	5.21	0.459	0.16678	.	1.444430	0.04530	N	0.386191	T	0.24314	0.0589	N	0.14661	0.345	0.09310	N	1	B;B	0.22146	0.065;0.008	B;B	0.16289	0.015;0.006	T	0.16012	-1.0417	10	0.30854	T	0.27	.	4.2022	0.10471	0.1451:0.4862:0.2777:0.091	.	771;867	F5GZH2;Q9Y283	.;INVS_HUMAN	M	867;771	ENSP00000262457:L867M;ENSP00000444454:L771M	ENSP00000262457:L867M	L	+	1	2	INVS	102094959	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.134000	0.10436	0.176000	0.19873	0.650000	0.86243	CTG	INVS	-	NULL	ENSG00000119509		0.537	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	INVS	HGNC	protein_coding	OTTHUMT00000053407.1	81	0.00	0	C	NM_014425		103055138	103055138	+1	no_errors	ENST00000262457	ensembl	human	known	69_37n	missense	65	27.47	25	SNP	0.000	A
ITPR3	3710	genome.wustl.edu	37	6	33646572	33646572	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:33646572G>A	ENST00000374316.5	+	31	4988	c.3928G>A	c.(3928-3930)Gag>Aag	p.E1310K	ITPR3_ENST00000605930.1_Missense_Mutation_p.E1310K			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1310					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CATTAAGGCCGAGGGCAAGTA	0.622																																						dbGAP											0													54.0	45.0	48.0					6																	33646572		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.3928G>A	6.37:g.33646572G>A	ENSP00000363435:p.Glu1310Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14649|Q5TAQ2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,pfscan_MIR_motif,prints_InsP3_rcpt-bd	p.E1310K	ENST00000374316.5	37	c.3928	CCDS4783.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.783303	0.96937	.	.	ENSG00000096433	ENST00000374316	D	0.95554	-3.74	5.18	5.18	0.71444	Intracellular calcium-release channel (1);	0.051611	0.85682	D	0.000000	D	0.96457	0.8844	M	0.76170	2.325	0.80722	D	1	D	0.63046	0.992	P	0.55260	0.772	D	0.96286	0.9210	10	0.59425	D	0.04	-29.6606	19.0623	0.93097	0.0:0.0:1.0:0.0	.	1310	Q14573	ITPR3_HUMAN	K	1310	ENSP00000363435:E1310K	ENSP00000363435:E1310K	E	+	1	0	ITPR3	33754550	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	9.752000	0.98900	2.584000	0.87258	0.561000	0.74099	GAG	ITPR3	-	pfam_Ca-rel_channel	ENSG00000096433		0.622	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	37	0.00	0	G	NM_002224		33646572	33646572	+1	no_errors	ENST00000374316	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	1.000	A
KDM4C	23081	genome.wustl.edu	37	9	7169948	7169948	+	Intron	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr9:7169948C>G	ENST00000381309.3	+	21	3559				KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000381306.3_Missense_Mutation_p.H1018D|KDM4C_ENST00000428870.2_Intron	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C						histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GTCCTCACCTCATGTTTCCCA	0.433																																						dbGAP											0													52.0	43.0	46.0					9																	7169948		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.2994+58C>G	9.37:g.7169948C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.H1018D	ENST00000381309.3	37	c.3052	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	C	0.042	-1.280545	0.01398	.	.	ENSG00000107077	ENST00000381306	T	0.15017	2.46	4.37	-4.73	0.03259	.	.	.	.	.	T	0.06826	0.0174	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38178	-0.9673	7	.	.	.	.	1.4806	0.02436	0.2644:0.367:0.1255:0.2431	.	1018	Q9H3R0-2	.	D	1018	ENSP00000370707:H1018D	.	H	+	1	0	KDM4C	7159948	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.153000	0.10144	-1.044000	0.03254	0.467000	0.42956	CAT	KDM4C	-	NULL	ENSG00000107077		0.433	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	43	0.00	0	C	NM_015061		7169948	7169948	+1	no_errors	ENST00000381306	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.000	G
KIF7	374654	genome.wustl.edu	37	15	90190234	90190234	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr15:90190234C>T	ENST00000394412.3	-	7	1691	c.1615G>A	c.(1615-1617)Gag>Aag	p.E539K		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	539	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CGCACCAGCTCTAACCGCAGC	0.682											OREG0023460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													15.0	19.0	18.0					15																	90190234		2194	4293	6487	-	-	-	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.1615G>A	15.37:g.90190234C>T	ENSP00000377934:p.Glu539Lys	Somatic	1273	WXS	Illumina GAIIx	Phase_IV	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E539K	ENST00000394412.3	37	c.1615	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	c	12.73	2.026055	0.35701	.	.	ENSG00000166813	ENST00000394412	T	0.71579	-0.58	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000011	T	0.75095	0.3803	M	0.62723	1.935	0.36096	D	0.843793	D;P	0.60160	0.987;0.889	P;B	0.54270	0.747;0.344	T	0.75190	-0.3405	10	0.11485	T	0.65	.	15.8007	0.78453	0.0:1.0:0.0:0.0	.	26;539	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	K	539	ENSP00000377934:E539K	ENSP00000377934:E539K	E	-	1	0	KIF7	87991238	0.995000	0.38212	0.993000	0.49108	0.595000	0.36748	3.145000	0.50623	2.394000	0.81467	0.457000	0.33378	GAG	KIF7	-	NULL	ENSG00000166813		0.682	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	78	0.00	0	C	NM_198525		90190234	90190234	-1	no_errors	ENST00000394412	ensembl	human	known	69_37n	missense	76	18.95	18	SNP	0.997	T
KRT34	3885	genome.wustl.edu	37	17	39534312	39534312	+	Nonstop_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr17:39534312C>G	ENST00000394001.1	-	7	1340	c.1310G>C	c.(1309-1311)tGa>tCa	p.*437S		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	0					epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				ACAAGCTTTTCAATTACAGCA	0.498																																						dbGAP											0													101.0	90.0	94.0					17																	39534312		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.1310G>C	17.37:g.39534312C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUT8|Q8N4W2	Nonstop_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.*437S	ENST00000394001.1	37	c.1310	CCDS11390.1	17	.	.	.	.	.	.	.	.	.	.	-	14.44	2.534917	0.45073	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	4.91	1.6	0.23607	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.1097	0.25382	0.2719:0.5981:0.1299:0.0	.	.	.	.	S	395;437	.	.	X	-	2	2	KRT34	36787838	0.000000	0.05858	0.051000	0.19133	0.852000	0.48524	-0.018000	0.12568	0.567000	0.29293	0.632000	0.83419	TGA	KRT34	-	NULL	ENSG00000131737		0.498	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT34	HGNC	protein_coding	OTTHUMT00000257304.3	43	0.00	0	C	NM_021013		39534312	39534312	-1	no_errors	ENST00000394001	ensembl	human	known	69_37n	nonstop	27	25.00	9	SNP	0.001	G
LAMA5	3911	genome.wustl.edu	37	20	60928253	60928253	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr20:60928253G>C	ENST00000252999.3	-	3	571	c.505C>G	c.(505-507)Ctc>Gtc	p.L169V	LAMA5_ENST00000370677.3_Missense_Mutation_p.L169V|RP11-157P1.5_ENST00000477848.1_RNA|RP11-157P1.5_ENST00000478167.1_RNA|RP11-157P1.5_ENST00000487421.1_RNA|LAMA5_ENST00000370692.3_Missense_Mutation_p.L169V|RP11-157P1.5_ENST00000456721.2_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	169	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AGCACCCAGAGGTCCGGCCGG	0.677																																						dbGAP											0													41.0	38.0	39.0					20																	60928253		2180	4278	6458	-	-	-	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.505C>G	20.37:g.60928253G>C	ENSP00000252999:p.Leu169Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.L169V	ENST00000252999.3	37	c.505	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609441	0.66558	.	.	ENSG00000130702	ENST00000252999;ENST00000370692;ENST00000370677	T;T;T	0.76316	-1.01;-1.01;-1.01	4.39	3.44	0.39384	Laminin, N-terminal (3);	0.077129	0.50627	U	0.000110	T	0.72252	0.3437	L	0.39020	1.185	0.58432	D	0.999996	P	0.42908	0.793	P	0.47864	0.559	T	0.71009	-0.4716	10	0.59425	D	0.04	.	7.494	0.27479	0.2657:0.0:0.7343:0.0	.	169	O15230	LAMA5_HUMAN	V	169	ENSP00000252999:L169V;ENSP00000359726:L169V;ENSP00000359711:L169V	ENSP00000252999:L169V	L	-	1	0	LAMA5	60361648	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	5.597000	0.67577	0.852000	0.35287	0.455000	0.32223	CTC	LAMA5	-	pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,pfscan_Laminin_N	ENSG00000130702		0.677	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	126	0.00	0	G	NM_005560		60928253	60928253	-1	no_errors	ENST00000252999	ensembl	human	known	69_37n	missense	66	29.03	27	SNP	1.000	C
LGR5	8549	genome.wustl.edu	37	12	71978369	71978369	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr12:71978369A>G	ENST00000266674.5	+	18	2890	c.2579A>G	c.(2578-2580)cAg>cGg	p.Q860R	LGR5_ENST00000540815.2_Missense_Mutation_p.Q836R|RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000536515.1_Missense_Mutation_p.Q788R			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	860					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						GTCGAAAAACAGTCCTGTGAC	0.468																																						dbGAP											0													171.0	164.0	167.0					12																	71978369		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2579A>G	12.37:g.71978369A>G	ENSP00000266674:p.Gln860Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q860R	ENST00000266674.5	37	c.2579	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	A	8.826	0.938760	0.18206	.	.	ENSG00000139292	ENST00000266674;ENST00000536515;ENST00000540815	T;T;T	0.58652	0.38;0.32;0.45	5.94	2.3	0.28687	.	0.094101	0.46758	N	0.000262	T	0.45034	0.1322	L	0.42245	1.32	0.27265	N	0.958513	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.002	T	0.30357	-0.9981	10	0.25751	T	0.34	.	9.5095	0.39067	0.7936:0.0:0.2064:0.0	.	836;860	O75473-2;O75473	.;LGR5_HUMAN	R	860;788;836	ENSP00000266674:Q860R;ENSP00000443033:Q788R;ENSP00000441035:Q836R	ENSP00000266674:Q860R	Q	+	2	0	LGR5	70264636	1.000000	0.71417	0.999000	0.59377	0.843000	0.47879	2.886000	0.48578	0.514000	0.28300	0.455000	0.32223	CAG	LGR5	-	NULL	ENSG00000139292		0.468	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	45	0.00	0	A	NM_003667		71978369	71978369	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	G
LRRK1	79705	genome.wustl.edu	37	15	101593547	101593547	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr15:101593547A>T	ENST00000388948.3	+	26	4335	c.3976A>T	c.(3976-3978)Agc>Tgc	p.S1326C	LRRK1_ENST00000284395.5_Missense_Mutation_p.S1323C|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CATCGGCATCAGCATCCACCC	0.687																																						dbGAP											0													25.0	30.0	28.0					15																	101593547		2190	4288	6478	-	-	-	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3976A>T	15.37:g.101593547A>T	ENSP00000373600:p.Ser1326Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.S1326C	ENST00000388948.3	37	c.3976	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	A	21.7	4.192150	0.78902	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762	D;D	0.92446	-3.04;-3.04	5.02	5.02	0.67125	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046400	0.85682	D	0.000000	D	0.90120	0.6913	N	0.04787	-0.16	0.54753	D	0.999982	D	0.89917	1.0	D	0.72982	0.979	D	0.90043	0.4143	10	0.28530	T	0.3	.	15.033	0.71723	1.0:0.0:0.0:0.0	.	1326	Q38SD2	LRRK1_HUMAN	C	1326;1323;17	ENSP00000373600:S1326C;ENSP00000284395:S1323C	ENSP00000284395:S1323C	S	+	1	0	LRRK1	99411070	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	8.732000	0.91534	2.011000	0.59026	0.454000	0.30748	AGC	LRRK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000154237		0.687	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	36	0.00	0	A	NM_024652		101593547	101593547	+1	no_errors	ENST00000388948	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	T
MAP3K15	389840	genome.wustl.edu	37	X	19387187	19387187	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:19387187C>G	ENST00000338883.4	-	25	3550	c.3551G>C	c.(3550-3552)aGa>aCa	p.R1184T	MAP3K15_ENST00000469203.2_Missense_Mutation_p.R1016T|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Missense_Mutation_p.R619T	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1184							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GGTCTCCTGTCTGAGCTCACC	0.622																																						dbGAP											0													56.0	51.0	53.0					X																	19387187		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3551G>C	X.37:g.19387187C>G	ENSP00000345629:p.Arg1184Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R1184T	ENST00000338883.4	37	c.3551		X	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321985	0.41096	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.73469	-0.71;-0.75;-0.7	5.45	1.65	0.23941	.	0.141343	0.45606	U	0.000350	T	0.74374	0.3708	L	0.58428	1.81	0.09310	N	1	P;P	0.44627	0.837;0.839	P;B	0.52823	0.71;0.276	T	0.65269	-0.6209	10	0.72032	D	0.01	.	4.785	0.13220	0.0:0.4641:0.1534:0.3825	.	659;1184	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	T	1184;619;1016	ENSP00000345629:R1184T;ENSP00000352093:R619T;ENSP00000428356:R1016T	ENSP00000345629:R1184T	R	-	2	0	MAP3K15	19297108	0.974000	0.33945	0.001000	0.08648	0.631000	0.37964	1.720000	0.38022	0.139000	0.18822	0.506000	0.49869	AGA	MAP3K15	-	NULL	ENSG00000180815		0.622	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	HGNC	protein_coding		104	0.00	0	C	NM_001001671		19387187	19387187	-1	no_errors	ENST00000338883	ensembl	human	known	69_37n	missense	54	15.62	10	SNP	0.008	G
MARCH3	115123	genome.wustl.edu	37	5	126213929	126213929	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr5:126213929C>G	ENST00000308660.5	-	4	1065	c.551G>C	c.(550-552)gGa>gCa	p.G184A		NM_178450.3	NP_848545.1	Q86UD3	MARH3_HUMAN	membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase	184					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)		TGCAATCAGTCCGACGGCTTC	0.572																																						dbGAP											0													76.0	69.0	71.0					5																	126213929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055007	CCDS4141.1	5q23.2	2013-01-09	2012-02-23		ENSG00000173926	ENSG00000173926		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28728	protein-coding gene	gene with protein product		613333	"""membrane-associated ring finger (C3HC4) 3"""			14722266, 8619474	Standard	NM_178450		Approved	MGC48332, MARCH-III, RNF173	uc003kuf.4	Q86UD3	OTTHUMG00000128968	ENST00000308660.5:c.551G>C	5.37:g.126213929C>G	ENSP00000309141:p.Gly184Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K264|B9EJE7	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.G184A	ENST00000308660.5	37	c.551	CCDS4141.1	5	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702055	0.68501	.	.	ENSG00000173926	ENST00000308660	T	0.18810	2.19	4.33	4.33	0.51752	.	0.000000	0.64402	D	0.000003	T	0.48714	0.1515	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.48317	-0.9046	10	0.14252	T	0.57	-7.0198	18.1469	0.89661	0.0:1.0:0.0:0.0	.	184	Q86UD3	MARH3_HUMAN	A	184	ENSP00000309141:G184A	ENSP00000309141:G184A	G	-	2	0	MARCH3	126241828	1.000000	0.71417	0.999000	0.59377	0.923000	0.55619	7.609000	0.82925	2.690000	0.91761	0.591000	0.81541	GGA	MARCH3	-	NULL	ENSG00000173926		0.572	MARCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH3	HGNC	protein_coding	OTTHUMT00000250955.2	36	0.00	0	C	NM_178450		126213929	126213929	-1	no_errors	ENST00000308660	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	G
MGLL	11343	genome.wustl.edu	37	3	127434724	127434724	+	Intron	SNP	A	A	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:127434724A>T	ENST00000434178.2	-	5	1377				MGLL_ENST00000453507.2_Intron|MGLL_ENST00000265052.5_Intron|MGLL_ENST00000398104.1_Intron|MGLL_ENST00000476682.1_5'Flank|MGLL_ENST00000398101.3_Intron			Q99685	MGLL_HUMAN	monoglyceride lipase						acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						CCAAAACTTTAACATTCTTGA	0.512																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.480+5171T>A	3.37:g.127434724A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Nonstop_Mutation	SNP	NULL	p.*57K	ENST00000434178.2	37	c.169	CCDS43148.1	3	.	.	.	.	.	.	.	.	.	.	A	10.33	1.321410	0.23994	.	.	ENSG00000074416	ENST00000496306	.	.	.	3.6	-1.84	0.07809	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1759	0.31281	0.4091:0.0:0.5909:0.0	.	.	.	.	K	57	.	.	X	-	1	0	MGLL	128917414	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.377000	0.20552	-0.341000	0.08376	0.482000	0.46254	TAA	MGLL	-	NULL	ENSG00000074416		0.512	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGLL	HGNC	protein_coding	OTTHUMT00000356637.2	43	0.00	0	A	NM_007283		127434724	127434724	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000496306	ensembl	human	novel	69_37n	nonstop	34	17.07	7	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9089883	9089883	+	Silent	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:9089883C>T	ENST00000397910.4	-	1	2135	c.1932G>A	c.(1930-1932)acG>acA	p.T644T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	644	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGACACCGTTCGTGGCCAGAG	0.567																																						dbGAP											0													121.0	124.0	123.0					19																	9089883		2160	4274	6434	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1932G>A	19.37:g.9089883C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T644	ENST00000397910.4	37	c.1932	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.567	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	79	0.00	0	C	NM_024690		9089883	9089883	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	61	22.78	18	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195538696	195538696	+	5'UTR	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:195538696G>A	ENST00000478685.1	-	0	148				MUC4_ENST00000346145.4_5'UTR|MUC4_ENST00000475231.1_5'UTR|MUC4_ENST00000349607.4_5'UTR|MUC4_ENST00000463781.3_5'UTR			Q99102	MUC4_HUMAN	mucin 4, cell surface associated						cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CATGGCTGCGGCAAAAGTCCC	0.667																																						dbGAP											0													51.0	49.0	50.0					3																	195538696		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000478685.1:c.-777C>T	3.37:g.195538696G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	RNA	SNP	-	NULL	ENST00000478685.1	37	NULL		3																																																																																			MUC4	-	-	ENSG00000145113		0.667	MUC4-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC4	HGNC	protein_coding	OTTHUMT00000341849.1	26	0.00	0	G	NM_018406		195538696	195538696	-1	no_errors	ENST00000478685	ensembl	human	putative	69_37n	rna	20	16.67	4	SNP	0.000	A
MYO1H	283446	genome.wustl.edu	37	12	109839002	109839005	+	Frame_Shift_Del	DEL	GGCA	GGCA	-			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	GGCA	GGCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr12:109839002_109839005delGGCA	ENST00000431443.2	+	5	627_630	c.627_630delGGCA	c.(625-630)ctggcafs	p.LA209fs	MYO1H_ENST00000310903.5_Frame_Shift_Del_p.LA209fs	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	209	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						ACCAGCTGCTGGCAGGTGGCGAAG	0.539																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.627_630delGGCA	12.37:g.109839002_109839005delGGCA	ENSP00000444076:p.Leu209fs	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H3C6	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.A210fs	ENST00000431443.2	37	c.627_630		12																																																																																			MYO1H	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000174527		0.539	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	HGNC	protein_coding		75	0.00	0	GGCA	NM_173597		109839002	109839005	+1	no_errors	ENST00000431443	ensembl	human	known	69_37n	frame_shift_del	74	10.84	9	DEL	0.720:1.000:1.000:0.998	-
MYO3A	53904	genome.wustl.edu	37	10	26491957	26491957	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr10:26491957C>T	ENST00000265944.5	+	34	4817	c.4651C>T	c.(4651-4653)Cca>Tca	p.P1551S	MYO3A_ENST00000478093.1_3'UTR|MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1551					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TCGTTCTGGACCAAAGGAACA	0.348																																						dbGAP											0													78.0	77.0	77.0					10																	26491957		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.4651C>T	10.37:g.26491957C>T	ENSP00000265944:p.Pro1551Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.P1551S	ENST00000265944.5	37	c.4651	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693401	0.30052	.	.	ENSG00000095777	ENST00000265944	T	0.79845	-1.31	5.11	4.2	0.49525	.	0.490077	0.24361	N	0.039197	T	0.70850	0.3271	L	0.39898	1.24	0.80722	D	1	B	0.14438	0.01	B	0.10450	0.005	T	0.64433	-0.6409	10	0.29301	T	0.29	.	9.7259	0.40330	0.0:0.904:0.0:0.096	.	1551	Q8NEV4	MYO3A_HUMAN	S	1551	ENSP00000265944:P1551S	ENSP00000265944:P1551S	P	+	1	0	MYO3A	26531963	0.993000	0.37304	1.000000	0.80357	0.990000	0.78478	0.771000	0.26633	1.278000	0.44430	0.561000	0.74099	CCA	MYO3A	-	NULL	ENSG00000095777		0.348	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	47	0.00	0	C	NM_017433		26491957	26491957	+1	no_errors	ENST00000265944	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	1.000	T
NLRP12	91662	genome.wustl.edu	37	19	54308693	54308693	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:54308693C>T	ENST00000324134.6	-	5	2423	c.2255G>A	c.(2254-2256)tGc>tAc	p.C752Y	NLRP12_ENST00000345770.5_Missense_Mutation_p.C753Y|NLRP12_ENST00000535162.1_Missense_Mutation_p.C752Y|NLRP12_ENST00000351894.4_Missense_Mutation_p.C752Y|NLRP12_ENST00000391773.1_Missense_Mutation_p.C753Y|NLRP12_ENST00000391775.3_Missense_Mutation_p.C752Y|NLRP12_ENST00000354278.3_Missense_Mutation_p.C752Y|NLRP12_ENST00000391772.1_Missense_Mutation_p.C753Y	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	752					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGAGATGCGGCACCTCTTCAG	0.463																																						dbGAP											0													77.0	78.0	78.0					19																	54308693		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2255G>A	19.37:g.54308693C>T	ENSP00000319377:p.Cys752Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.C753Y	ENST00000324134.6	37	c.2258	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055278	0.36277	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000358661;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38;0.38	3.12	3.12	0.35913	.	.	.	.	.	T	0.78547	0.4300	H	0.96080	3.765	0.35428	D	0.793821	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.997;0.993;0.999;0.999;0.986	D	0.86194	0.1614	9	0.87932	D	0	.	9.9434	0.41593	0.0:1.0:0.0:0.0	.	753;35;752;752;752	F2Z321;P59046-5;A8K407;A8MTQ2;P59046	.;.;.;.;NAL12_HUMAN	Y	752;752;752;752;35;752;753;753;753	ENSP00000319377:C752Y;ENSP00000438030:C752Y;ENSP00000340473:C752Y;ENSP00000346231:C752Y;ENSP00000375655:C752Y;ENSP00000375653:C753Y;ENSP00000375652:C753Y	ENSP00000319377:C752Y	C	-	2	0	NLRP12	59000505	0.216000	0.23585	0.861000	0.33841	0.454000	0.32378	1.771000	0.38542	1.783000	0.52377	0.289000	0.19496	TGC	NLRP12	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000142405		0.463	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	37	0.00	0	C	NM_144687		54308693	54308693	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.900	T
NOTCH4	4855	genome.wustl.edu	37	6	32187943	32187943	+	Silent	SNP	C	C	A	rs534019696	byFrequency	TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:32187943C>A	ENST00000375023.3	-	7	1416	c.1278G>T	c.(1276-1278)ggG>ggT	p.G426G		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	426	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GGCAGGTGGGCCCCGAATAGC	0.612																																						dbGAP											0													51.0	53.0	53.0					6																	32187943		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1278G>T	6.37:g.32187943C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.G426	ENST00000375023.3	37	c.1278	CCDS34420.1	6																																																																																			NOTCH4	-	smart_EGF-like,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	58	0.00	0	C			32187943	32187943	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	0.991	A
NOX1	27035	genome.wustl.edu	37	X	100117162	100117162	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:100117162C>G	ENST00000372966.3	-	7	1007	c.802G>C	c.(802-804)Gag>Cag	p.E268Q	NOX1_ENST00000372964.1_Intron|NOX1_ENST00000372960.4_Missense_Mutation_p.E231Q|NOX1_ENST00000217885.5_Missense_Mutation_p.E268Q	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	268	Ferric oxidoreductase.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						GCTCTTACCTCAGGGGGATGC	0.428																																						dbGAP											0													100.0	94.0	96.0					X																	100117162		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.802G>C	X.37:g.100117162C>G	ENSP00000362057:p.Glu268Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.E268Q	ENST00000372966.3	37	c.802	CCDS14474.1	X	.	.	.	.	.	.	.	.	.	.	C	0.069	-1.206317	0.01568	.	.	ENSG00000007952	ENST00000372966;ENST00000217885;ENST00000372960	D;D;D	0.95554	-3.65;-3.74;-3.74	4.34	3.45	0.39498	.	0.362490	0.28409	N	0.015453	D	0.88599	0.6480	L	0.29908	0.895	0.34716	D	0.728284	B;B;B	0.16166	0.016;0.001;0.0	B;B;B	0.14578	0.011;0.004;0.002	T	0.81274	-0.1007	10	0.08381	T	0.77	-6.822	6.4527	0.21912	0.0:0.7133:0.1835:0.1031	.	231;268;268	A6NGA6;Q9Y5S8-3;Q9Y5S8	.;.;NOX1_HUMAN	Q	268;268;231	ENSP00000362057:E268Q;ENSP00000217885:E268Q;ENSP00000362051:E231Q	ENSP00000217885:E268Q	E	-	1	0	NOX1	100003818	0.998000	0.40836	0.987000	0.45799	0.069000	0.16628	0.893000	0.28336	0.944000	0.37579	0.600000	0.82982	GAG	NOX1	-	NULL	ENSG00000007952		0.428	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX1	HGNC	protein_coding	OTTHUMT00000057495.1	40	0.00	0	C	NM_007052		100117162	100117162	-1	no_errors	ENST00000372966	ensembl	human	known	69_37n	missense	27	34.15	14	SNP	1.000	G
NRIP1	8204	genome.wustl.edu	37	21	16338244	16338244	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr21:16338244G>C	ENST00000400202.1	-	3	2982	c.2270C>G	c.(2269-2271)tCt>tGt	p.S757C	NRIP1_ENST00000318948.4_Missense_Mutation_p.S757C|AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Missense_Mutation_p.S757C			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	757	Interaction with ZNF366.|Repression domain 3.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.S757F(1)		cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		ACAAGGCTCAGATTTTATTTT	0.403																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											112.0	108.0	109.0					21																	16338244		2203	4300	6503	-	-	-	SO:0001583	missense	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2270C>G	21.37:g.16338244G>C	ENSP00000383063:p.Ser757Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWE8	Missense_Mutation	SNP	NULL	p.S757C	ENST00000400202.1	37	c.2270	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312919	0.81358	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.09817	2.94;2.94;2.94	6.17	6.17	0.99709	.	0.239164	0.30714	N	0.009021	T	0.23410	0.0566	L	0.46157	1.445	0.43787	D	0.99632	D	0.65815	0.995	P	0.57620	0.824	T	0.00008	-1.2473	10	0.87932	D	0	-18.3492	16.2608	0.82541	0.0:0.1316:0.8683:0.0	.	757	P48552	NRIP1_HUMAN	C	757	ENSP00000383060:S757C;ENSP00000383063:S757C;ENSP00000327213:S757C	ENSP00000327213:S757C	S	-	2	0	NRIP1	15260115	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.073000	0.76784	2.941000	0.99782	0.655000	0.94253	TCT	NRIP1	-	NULL	ENSG00000180530		0.403	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	57	0.00	0	G	NM_003489		16338244	16338244	-1	no_errors	ENST00000318948	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.998	C
NRIP1	8204	genome.wustl.edu	37	21	16338289	16338289	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr21:16338289G>C	ENST00000400202.1	-	3	2937	c.2225C>G	c.(2224-2226)tCa>tGa	p.S742*	NRIP1_ENST00000318948.4_Nonsense_Mutation_p.S742*|AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Nonsense_Mutation_p.S742*			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	742	Repression domain 3.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		AGCTCTCTCTGAGTGTTCCTG	0.408																																						dbGAP											0													86.0	83.0	84.0					21																	16338289		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2225C>G	21.37:g.16338289G>C	ENSP00000383063:p.Ser742*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWE8	Nonsense_Mutation	SNP	NULL	p.S742*	ENST00000400202.1	37	c.2225	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	43	10.151432	0.99348	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	.	.	.	6.11	4.26	0.50523	.	1.263920	0.05273	N	0.517845	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-8.6207	10.4989	0.44794	0.0657:0.2538:0.6806:0.0	.	.	.	.	X	742	.	ENSP00000327213:S742X	S	-	2	0	NRIP1	15260160	0.068000	0.21057	0.018000	0.16275	0.713000	0.41058	2.176000	0.42500	0.859000	0.35456	0.655000	0.94253	TCA	NRIP1	-	NULL	ENSG00000180530		0.408	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	36	0.00	0	G	NM_003489		16338289	16338289	-1	no_errors	ENST00000318948	ensembl	human	known	69_37n	nonsense	41	24.07	13	SNP	0.082	C
OGFR	11054	genome.wustl.edu	37	20	61444569	61444569	+	Silent	SNP	A	A	G	rs3204348		TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr20:61444569A>G	ENST00000290291.6	+	7	1627	c.1602A>G	c.(1600-1602)ccA>ccG	p.P534P	OGFR_ENST00000370461.1_Silent_p.P482P	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	534	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGGACGAGCCAGCCGAGAGCC	0.721																																						dbGAP											0													11.0	17.0	15.0					20																	61444569		2124	4201	6325	-	-	-	SO:0001819	synonymous_variant	0			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1602A>G	20.37:g.61444569A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.P534	ENST00000290291.6	37	c.1602	CCDS13504.1	20																																																																																			OGFR	-	pfam_OGF_rcpt_rpt	ENSG00000060491		0.721	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1	23	0.00	0	A			61444569	61444569	+1	no_errors	ENST00000290291	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	0.000	G
PABPC4	8761	genome.wustl.edu	37	1	40041514	40041514	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:40041514A>T	ENST00000372857.3	-	1	902	c.110T>A	c.(109-111)gTg>gAg	p.V37E	RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372862.3_Missense_Mutation_p.V37E|PABPC4_ENST00000372858.3_Missense_Mutation_p.V37E|PABPC4_ENST00000372856.3_Missense_Mutation_p.V37E	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	37	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GATGGACAGCACAGGCCCCGC	0.652																																						dbGAP											0													35.0	38.0	37.0					1																	40041514		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.110T>A	1.37:g.40041514A>T	ENSP00000361948:p.Val37Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.V37E	ENST00000372857.3	37	c.110	CCDS438.1	1	.	.	.	.	.	.	.	.	.	.	A	32	5.153891	0.94645	.	.	ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856;ENST00000451091;ENST00000531243	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01	4.9	3.75	0.43078	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.054170	0.64402	N	0.000001	T	0.56877	0.2015	H	0.96430	3.82	0.58432	D	0.999995	D;D;D	0.69078	0.979;0.997;0.988	D;D;D	0.76575	0.914;0.988;0.952	T	0.66540	-0.5898	10	0.87932	D	0	.	10.8354	0.46683	0.8584:0.0:0.0:0.1416	.	37;37;37	Q13310;Q13310-2;Q4VC03	PABP4_HUMAN;.;.	E	37	ENSP00000361953:V37E;ENSP00000361949:V37E;ENSP00000361948:V37E;ENSP00000361947:V37E;ENSP00000406675:V37E	ENSP00000361947:V37E	V	-	2	0	PABPC4	39814101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.247000	0.95444	0.678000	0.31325	0.533000	0.62120	GTG	PABPC4	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000090621		0.652	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	HGNC	protein_coding	OTTHUMT00000025220.1	109	0.00	0	A	NM_001135653		40041514	40041514	-1	no_errors	ENST00000372858	ensembl	human	known	69_37n	missense	83	33.86	43	SNP	1.000	T
PCNXL3	399909	genome.wustl.edu	37	11	65387069	65387069	+	Silent	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr11:65387069G>A	ENST00000355703.3	+	7	2306	c.1767G>A	c.(1765-1767)cgG>cgA	p.R589R		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	589						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						AGGCCATTCGGAGACGCCACA	0.682																																						dbGAP											0													23.0	32.0	29.0					11																	65387069		2143	4241	6384	-	-	-	SO:0001819	synonymous_variant	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.1767G>A	11.37:g.65387069G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6MZN8	Silent	SNP	pfam_Pecanex	p.R589	ENST00000355703.3	37	c.1767	CCDS44650.1	11																																																																																			PCNXL3	-	NULL	ENSG00000197136		0.682	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	26	0.00	0	G	NM_032223		65387069	65387069	+1	no_errors	ENST00000355703	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	0.996	A
PDHA2	5161	genome.wustl.edu	37	4	96761627	96761627	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr4:96761627C>T	ENST00000295266.4	+	1	389	c.326C>T	c.(325-327)tCg>tTg	p.S109L		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	109					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		ATAAACCCCTCGGATCACGTC	0.527																																						dbGAP											0													125.0	110.0	115.0					4																	96761627		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.326C>T	4.37:g.96761627C>T	ENSP00000295266:p.Ser109Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.S109L	ENST00000295266.4	37	c.326	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	C	8.419	0.846034	0.16963	.	.	ENSG00000163114	ENST00000295266	D	0.95724	-3.79	4.77	3.0	0.34707	Dehydrogenase, E1 component (1);	0.414077	0.23334	N	0.049303	D	0.94703	0.8291	M	0.68952	2.095	0.25146	N	0.990463	P	0.44946	0.846	P	0.46917	0.531	D	0.88128	0.2836	10	0.29301	T	0.29	-11.1125	13.0922	0.59172	0.0:0.691:0.309:0.0	.	109	P29803	ODPAT_HUMAN	L	109	ENSP00000295266:S109L	ENSP00000295266:S109L	S	+	2	0	PDHA2	96980650	0.011000	0.17503	0.024000	0.17045	0.052000	0.14988	2.083000	0.41615	0.706000	0.31912	0.467000	0.42956	TCG	PDHA2	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000163114		0.527	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	89	0.00	0	C			96761627	96761627	+1	no_errors	ENST00000295266	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	0.794	T
PDLIM7	9260	genome.wustl.edu	37	5	176917060	176917060	+	Intron	SNP	C	C	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr5:176917060C>A	ENST00000355841.2	-	8	639				PDLIM7_ENST00000356618.4_Intron|PDLIM7_ENST00000393551.1_Intron|PDLIM7_ENST00000359895.2_Intron	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)						actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTCCCGCTTCTGAGGCAGCT	0.632																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.573-227G>T	5.37:g.176917060C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Nonsense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E205*	ENST00000355841.2	37	c.613	CCDS4422.1	5	.	.	.	.	.	.	.	.	.	.	C	3.269	-0.149522	0.06585	.	.	ENSG00000196923	ENST00000505074	.	.	.	2.42	1.52	0.23074	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	7.0981	0.25321	0.0:0.7183:0.2817:0.0	.	.	.	.	X	205	.	ENSP00000426213:E205X	E	-	1	0	PDLIM7	176849666	0.016000	0.18221	0.056000	0.19401	0.017000	0.09413	1.443000	0.35057	0.583000	0.29574	-0.314000	0.08810	GAA	PDLIM7	-	NULL	ENSG00000196923		0.632	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDLIM7	HGNC	protein_coding	OTTHUMT00000253423.1	48	0.00	0	C	NM_005451		176917060	176917060	-1	no_stop_codon	ENST00000505074	ensembl	human	novel	69_37n	nonsense	37	11.90	5	SNP	0.007	A
GATB	5188	genome.wustl.edu	37	4	152592249	152592249	+	3'UTR	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr4:152592249C>T	ENST00000515812.1	-	0	1644				PET112_ENST00000263985.6_3'UTR|PET112_ENST00000507592.1_5'UTR|RP11-164P12.4_ENST00000508664.1_RNA																breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						ACATGGGCATCAGCTTTCACA	0.542																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0																														ENST00000515812.1:c.*77G>A	4.37:g.152592249C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515812.1	37	NULL		4																																																																																			PET112	-	-	ENSG00000059691		0.542	PET112-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	PET112	HGNC	protein_coding	OTTHUMT00000365672.1	53	0.00	0	C			152592249	152592249	-1	no_errors	ENST00000507592	ensembl	human	known	69_37n	rna	33	32.65	16	SNP	0.000	T
PEX13	5194	genome.wustl.edu	37	2	61258835	61258835	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr2:61258835G>C	ENST00000295030.5	+	2	412	c.374G>C	c.(373-375)aGc>aCc	p.S125T	PEX13_ENST00000472678.1_3'UTR	NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	125					cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			GCTGAAGAAAGCAGCAGGGGT	0.443																																						dbGAP											0													149.0	141.0	144.0					2																	61258835		2203	4300	6503	-	-	-	SO:0001583	missense	0			U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.374G>C	2.37:g.61258835G>C	ENSP00000295030:p.Ser125Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCS1	Missense_Mutation	SNP	pfam_Peroxin-13_N,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.S125T	ENST00000295030.5	37	c.374	CCDS1866.1	2	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743033	0.89663	.	.	ENSG00000162928	ENST00000295030	D	0.83992	-1.79	5.85	5.85	0.93711	Peroxin 13, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91317	0.7262	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	D	0.90200	0.4256	10	0.45353	T	0.12	-14.6139	20.1649	0.98147	0.0:0.0:1.0:0.0	.	125	Q92968	PEX13_HUMAN	T	125	ENSP00000295030:S125T	ENSP00000295030:S125T	S	+	2	0	PEX13	61112339	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.656000	0.98514	2.753000	0.94483	0.655000	0.94253	AGC	PEX13	-	pfam_Peroxin-13_N	ENSG00000162928		0.443	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX13	HGNC	protein_coding	OTTHUMT00000251581.3	56	0.00	0	G	NM_002618		61258835	61258835	+1	no_errors	ENST00000295030	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	1.000	C
PHF3	23469	genome.wustl.edu	37	6	64421231	64421231	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:64421231C>T	ENST00000262043.3	+	15	4310	c.3970C>T	c.(3970-3972)Cac>Tac	p.H1324Y	PHF3_ENST00000393387.1_Missense_Mutation_p.H1324Y			Q92576	PHF3_HUMAN	PHD finger protein 3	1324					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TAAAATTCCACACCCTCTTGT	0.403																																					GBM(135;136 1820 29512 34071 46235)	dbGAP											0													106.0	97.0	100.0					6																	64421231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.3970C>T	6.37:g.64421231C>T	ENSP00000262043:p.His1324Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.H1324Y	ENST00000262043.3	37	c.3970	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	C	5.895	0.349151	0.11182	.	.	ENSG00000118482	ENST00000515594;ENST00000262043;ENST00000393387	T;T;T	0.46063	0.88;2.15;2.15	6.04	6.04	0.98038	.	0.000000	0.41605	D	0.000841	T	0.53367	0.1792	L	0.50333	1.59	0.80722	D	1	D	0.53745	0.962	D	0.67725	0.953	T	0.36383	-0.9750	10	0.40728	T	0.16	-10.0761	20.5801	0.99389	0.0:1.0:0.0:0.0	.	1324	Q92576	PHF3_HUMAN	Y	593;1324;1324	ENSP00000425338:H593Y;ENSP00000262043:H1324Y;ENSP00000377048:H1324Y	ENSP00000262043:H1324Y	H	+	1	0	PHF3	64479190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.998000	0.70653	2.873000	0.98535	0.643000	0.83706	CAC	PHF3	-	NULL	ENSG00000118482		0.403	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	HGNC	protein_coding	OTTHUMT00000041086.2	49	0.00	0	C			64421231	64421231	+1	no_errors	ENST00000262043	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	1.000	T
POTEA	340441	genome.wustl.edu	37	8	43218150	43218150	+	RNA	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr8:43218150G>A	ENST00000522175.2	+	0	1619							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GCATGATGCAGGAAGAAATTG	0.343																																						dbGAP											0																																										-	-	-			0			AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43218150G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND17|A6ND71|Q6S8J6	RNA	SNP	-	NULL	ENST00000522175.2	37	NULL		8																																																																																			POTEA	-	-	ENSG00000188877		0.343	POTEA-003	KNOWN	basic	processed_transcript	POTEA	HGNC	pseudogene	OTTHUMT00000383492.1	35	0.00	0	G	NM_001002920		43218150	43218150	+1	no_errors	ENST00000522175	ensembl	human	known	69_37n	rna	53	23.19	16	SNP	0.003	A
PPFIBP1	8496	genome.wustl.edu	37	12	27799034	27799034	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr12:27799034G>T	ENST00000318304.8	+	5	593	c.310G>T	c.(310-312)Gaa>Taa	p.E104*	PPFIBP1_ENST00000537927.1_5'UTR|PPFIBP1_ENST00000228425.6_Nonsense_Mutation_p.E104*|PPFIBP1_ENST00000542629.1_Nonsense_Mutation_p.E104*|PPFIBP1_ENST00000535047.1_Nonsense_Mutation_p.E104*	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	104					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					TGTGTATCAAGAAAGGCTGGC	0.378																																						dbGAP											0													104.0	93.0	97.0					12																	27799034		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.310G>T	12.37:g.27799034G>T	ENSP00000314724:p.Glu104*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75336|Q86X70|Q9NY03|Q9ULJ0	Nonsense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E104*	ENST00000318304.8	37	c.310	CCDS55812.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.390192	0.95988	.	.	ENSG00000110841	ENST00000543820;ENST00000545381;ENST00000318304;ENST00000535047;ENST00000542629;ENST00000228425;ENST00000542187	.	.	.	5.12	4.24	0.50183	.	0.000000	0.35151	U	0.003420	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-22.2399	13.1553	0.59514	0.0781:0.0:0.9219:0.0	.	.	.	.	X	104;104;104;104;104;104;117	.	ENSP00000228425:E104X	E	+	1	0	PPFIBP1	27690301	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	9.370000	0.97159	1.157000	0.42530	0.555000	0.69702	GAA	PPFIBP1	-	NULL	ENSG00000110841		0.378	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	PPFIBP1	HGNC	protein_coding	OTTHUMT00000402877.1	34	0.00	0	G	NM_003622		27799034	27799034	+1	no_errors	ENST00000318304	ensembl	human	known	69_37n	nonsense	39	18.75	9	SNP	1.000	T
PRSS22	64063	genome.wustl.edu	37	16	2903953	2903953	+	Silent	SNP	A	A	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr16:2903953A>G	ENST00000161006.3	-	5	695	c.630T>C	c.(628-630)caT>caC	p.H210H	PRSS22_ENST00000574768.1_5'Flank|PRSS22_ENST00000571228.1_Silent_p.H100H	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	210	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						GCCAGTACAGATGGCTGCAGA	0.592																																						dbGAP											0													85.0	81.0	82.0					16																	2903953		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.630T>C	16.37:g.2903953A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O43342|Q6UXE0	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.H210	ENST00000161006.3	37	c.630	CCDS10481.1	16																																																																																			PRSS22	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000005001		0.592	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS22	HGNC	protein_coding	OTTHUMT00000250943.1	110	0.00	0	A	NM_022119		2903953	2903953	-1	no_errors	ENST00000161006	ensembl	human	known	69_37n	silent	58	30.95	26	SNP	0.947	G
PSG2	5670	genome.wustl.edu	37	19	43579653	43579653	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:43579653G>A	ENST00000406487.1	-	3	660	c.562C>T	c.(562-564)Cct>Tct	p.P188S		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	188	Ig-like C2-type 1.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				TGAGTCATAGGGAGGCTCTGA	0.478																																						dbGAP											0													256.0	259.0	258.0					19																	43579653		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.562C>T	19.37:g.43579653G>A	ENSP00000385706:p.Pro188Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P188S	ENST00000406487.1	37	c.562	CCDS12616.1	19	.	.	.	.	.	.	.	.	.	.	N	9.957	1.221639	0.22457	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.11169	2.8	1.33	1.33	0.21861	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23926	0.0579	M	0.64170	1.965	0.09310	N	1	D;D	0.89917	0.99;1.0	D;D	0.83275	0.976;0.996	T	0.06844	-1.0804	9	0.37606	T	0.19	.	6.0088	0.19562	0.0:0.0:1.0:0.0	.	188;188	B5MCM8;P11465	.;PSG2_HUMAN	S	188	ENSP00000385706:P188S	ENSP00000332984:P188S	P	-	1	0	PSG2	48271493	0.002000	0.14202	0.012000	0.15200	0.005000	0.04900	1.076000	0.30729	0.703000	0.31848	0.454000	0.30748	CCT	PSG2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000242221		0.478	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG2	HGNC	protein_coding	OTTHUMT00000323083.1	163	0.00	0	G	NM_031246		43579653	43579653	-1	no_errors	ENST00000329509	ensembl	human	known	69_37n	missense	142	25.65	49	SNP	0.007	A
PSMC3	5702	genome.wustl.edu	37	11	47446006	47446006	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr11:47446006C>G	ENST00000298852.3	-	5	584	c.427G>C	c.(427-429)Gaa>Caa	p.E143Q	PSMC3_ENST00000530912.1_Missense_Mutation_p.E101Q|PSMC3_ENST00000602866.1_Missense_Mutation_p.E127Q	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	143					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TTTAGCTTTTCAGCATCCACC	0.572																																						dbGAP											0													78.0	69.0	72.0					11																	47446006		2201	4298	6499	-	-	-	SO:0001583	missense	0			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.427G>C	11.37:g.47446006C>G	ENSP00000298852:p.Glu143Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.E143Q	ENST00000298852.3	37	c.427	CCDS7935.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.259035	0.95368	.	.	ENSG00000165916	ENST00000298852;ENST00000530912;ENST00000524447;ENST00000530887;ENST00000530651;ENST00000527906;ENST00000526993;ENST00000531653	D;D	0.94723	-3.5;-3.49	5.48	5.48	0.80851	.	0.102534	0.64402	D	0.000003	D	0.94918	0.8357	M	0.84326	2.69	0.80722	D	1	B;B	0.33413	0.015;0.411	B;B	0.33042	0.018;0.157	D	0.94659	0.7846	10	0.72032	D	0.01	-22.169	19.3681	0.94473	0.0:1.0:0.0:0.0	.	101;143	E9PM69;P17980	.;PRS6A_HUMAN	Q	143;101;108;108;108;108;151;127	ENSP00000298852:E143Q;ENSP00000433097:E101Q	ENSP00000298852:E143Q	E	-	1	0	PSMC3	47402582	1.000000	0.71417	0.972000	0.41901	0.970000	0.65996	7.287000	0.78681	2.556000	0.86216	0.655000	0.94253	GAA	PSMC3	-	tigrfam_26S_Psome_P45	ENSG00000165916		0.572	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMC3	HGNC	protein_coding	OTTHUMT00000395660.2	63	0.00	0	C	NM_002804		47446006	47446006	-1	no_errors	ENST00000298852	ensembl	human	known	69_37n	missense	47	31.88	22	SNP	1.000	G
RASGRF1	5923	genome.wustl.edu	37	15	79277356	79277356	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr15:79277356G>A	ENST00000419573.3	-	24	3729	c.3455C>T	c.(3454-3456)tCt>tTt	p.S1152F	RASGRF1_ENST00000394745.3_Missense_Mutation_p.S368F|RP11-16K12.1_ENST00000316148.4_RNA|RASGRF1_ENST00000558480.2_Missense_Mutation_p.S1136F|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1152	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CACCTGCTTAGAGACTTTGAG	0.597																																						dbGAP											0													82.0	64.0	70.0					15																	79277356		2196	4293	6489	-	-	-	SO:0001583	missense	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3455C>T	15.37:g.79277356G>A	ENSP00000405963:p.Ser1152Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S1152F	ENST00000419573.3	37	c.3455	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513139	0.85389	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.37915	1.17;1.17	4.25	4.25	0.50352	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.67543	0.2904	M	0.93420	3.415	0.80722	D	1	D;D;D	0.76494	0.999;0.995;0.997	D;D;D	0.68765	0.96;0.941;0.934	T	0.77453	-0.2582	10	0.72032	D	0.01	.	14.5549	0.68094	0.0:0.0:1.0:0.0	.	1136;1154;1136	Q8IUU5;Q13972;F8VPA5	.;RGRF1_HUMAN;.	F	1152;1136;368	ENSP00000405963:S1152F;ENSP00000378228:S368F	ENSP00000378224:S1136F	S	-	2	0	RASGRF1	77064411	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	7.489000	0.81451	2.348000	0.79779	0.655000	0.94253	TCT	RASGRF1	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000058335		0.597	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	76	0.00	0	G	NM_002891		79277356	79277356	-1	no_errors	ENST00000419573	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	1.000	A
RIOK3	8780	genome.wustl.edu	37	18	21057146	21057146	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr18:21057146T>C	ENST00000339486.3	+	11	1875	c.1258T>C	c.(1258-1260)Tgg>Cgg	p.W420R	RIOK3_ENST00000581585.1_Missense_Mutation_p.W404R|RIOK3_ENST00000577501.1_Missense_Mutation_p.W420R	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	420	Protein kinase.				chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GAAATAGGTCTGGTTGATCGA	0.408																																						dbGAP											0													157.0	134.0	142.0					18																	21057146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.1258T>C	18.37:g.21057146T>C	ENSP00000341874:p.Trp420Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXN9	Missense_Mutation	SNP	pfam_RIO-like_kinase,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio3	p.W420R	ENST00000339486.3	37	c.1258	CCDS11877.1	18	.	.	.	.	.	.	.	.	.	.	T	28.7	4.942682	0.92526	.	.	ENSG00000101782	ENST00000339486	T	0.07114	3.22	5.96	5.96	0.96718	RIO kinase (1);Protein kinase-like domain (1);RIO-like kinase (1);	0.173368	0.56097	D	0.000040	T	0.33789	0.0875	M	0.83012	2.62	0.80722	D	1	D;P;D;D	0.89917	0.999;0.883;1.0;1.0	D;P;D;D	0.83275	0.996;0.718;0.991;0.995	T	0.10132	-1.0643	10	0.87932	D	0	-14.2968	16.492	0.84203	0.0:0.0:0.0:1.0	.	164;404;420;420	E7ESK5;B4E1Q4;O14730-2;O14730	.;.;.;RIOK3_HUMAN	R	420	ENSP00000341874:W420R	ENSP00000341874:W420R	W	+	1	0	RIOK3	19311144	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.833000	0.86765	2.294000	0.77228	0.514000	0.50259	TGG	RIOK3	-	pfam_RIO-like_kinase,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio3	ENSG00000101782		0.408	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK3	HGNC	protein_coding	OTTHUMT00000254756.1	53	0.00	0	T	NM_003831		21057146	21057146	+1	no_errors	ENST00000339486	ensembl	human	known	69_37n	missense	39	29.09	16	SNP	1.000	C
SAMD14	201191	genome.wustl.edu	37	17	48195544	48195544	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr17:48195544G>C	ENST00000330175.4	-	3	508	c.191C>G	c.(190-192)tCg>tGg	p.S64W	SAMD14_ENST00000503734.1_5'UTR|SAMD14_ENST00000503131.1_Missense_Mutation_p.S64W	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	64										breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						GGGCCCATCCGAGCCTTCACC	0.642																																						dbGAP											0													49.0	52.0	51.0					17																	48195544		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.191C>G	17.37:g.48195544G>C	ENSP00000329144:p.Ser64Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8V1|Q8N2X0	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S64W	ENST00000330175.4	37	c.191	CCDS58562.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178341	0.78564	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	.	.	.	5.29	5.29	0.74685	.	0.309716	0.27039	N	0.021240	T	0.67411	0.2890	L	0.40543	1.245	0.54753	D	0.999984	D;D	0.76494	0.973;0.999	P;D	0.65987	0.581;0.94	T	0.69669	-0.5083	9	0.66056	D	0.02	-16.8288	15.8414	0.78848	0.0:0.0:1.0:0.0	.	64;64	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	W	64;76;64	.	ENSP00000285206:S76W	S	-	2	0	SAMD14	45550543	0.999000	0.42202	0.998000	0.56505	0.951000	0.60555	3.552000	0.53705	2.461000	0.83175	0.557000	0.71058	TCG	SAMD14	-	NULL	ENSG00000167100		0.642	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD14	HGNC	protein_coding	OTTHUMT00000366661.1	43	0.00	0	G	NM_174920		48195544	48195544	-1	no_errors	ENST00000503131	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	C
SAMD7	344658	genome.wustl.edu	37	3	169644815	169644815	+	Silent	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:169644815C>G	ENST00000428432.2	+	6	1154	c.765C>G	c.(763-765)ctC>ctG	p.L255L	SAMD7_ENST00000335556.3_Silent_p.L255L	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	255										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			GTGGAGAGCTCGAGCCCACCC	0.517																																						dbGAP											0													90.0	89.0	90.0					3																	169644815		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.765C>G	3.37:g.169644815C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L255	ENST00000428432.2	37	c.765	CCDS3209.1	3																																																																																			SAMD7	-	NULL	ENSG00000187033		0.517	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD7	HGNC	protein_coding	OTTHUMT00000351959.1	35	0.00	0	C	NM_182610		169644815	169644815	+1	no_errors	ENST00000335556	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	0.000	G
SEL1L2	80343	genome.wustl.edu	37	20	13912405	13912405	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr20:13912405C>A	ENST00000284951.5	-	3	201	c.127G>T	c.(127-129)Gaa>Taa	p.E43*	SEL1L2_ENST00000486903.1_5'UTR|SEL1L2_ENST00000378072.5_Nonsense_Mutation_p.E43*			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	43						integral component of membrane (GO:0016021)		p.E43K(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						TGTTTGATTTCGTTCACTGAT	0.289																																						dbGAP											1	Substitution - Missense(1)	skin(1)											81.0	76.0	78.0					20																	13912405		1804	4055	5859	-	-	-	SO:0001587	stop_gained	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.127G>T	20.37:g.13912405C>A	ENSP00000284951:p.Glu43*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXX5	Nonsense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.E43*	ENST00000284951.5	37	c.127		20	.	.	.	.	.	.	.	.	.	.	C	14.59	2.579526	0.46006	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	.	.	.	5.34	-2.2	0.06994	.	1.051140	0.07462	N	0.900849	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-1.89	5.6615	0.17672	0.0:0.3878:0.1372:0.475	.	.	.	.	X	43	.	ENSP00000284951:E43X	E	-	1	0	SEL1L2	13860405	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	-0.242000	0.08928	-0.592000	0.05851	-1.779000	0.00650	GAA	SEL1L2	-	NULL	ENSG00000101251		0.289	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	43	0.00	0	C	NM_025229		13912405	13912405	-1	no_errors	ENST00000284951	ensembl	human	known	69_37n	nonsense	27	20.59	7	SNP	0.001	A
SH3BP5	9467	genome.wustl.edu	37	3	15297790	15297790	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:15297790C>G	ENST00000383791.3	-	9	1391	c.1171G>C	c.(1171-1173)Gag>Cag	p.E391Q	SH3BP5_ENST00000253688.5_Missense_Mutation_p.E234Q|SH3BP5_ENST00000426925.1_Missense_Mutation_p.E234Q|SH3BP5_ENST00000408919.3_Missense_Mutation_p.E234Q|SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	391	Ser-rich.				intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GTTTTATTCTCTGCCCCTTCT	0.463																																						dbGAP											0													138.0	119.0	125.0					3																	15297790		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.1171G>C	3.37:g.15297790C>G	ENSP00000373301:p.Glu391Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQW6|Q5JWV9	Missense_Mutation	SNP	pfam_SH3-bd_5	p.E391Q	ENST00000383791.3	37	c.1171	CCDS2625.2	3	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788600	0.90367	.	.	ENSG00000131370	ENST00000383791;ENST00000426925;ENST00000253688;ENST00000408919	.	.	.	5.67	5.67	0.87782	.	0.119502	0.64402	D	0.000009	T	0.78362	0.4271	L	0.61218	1.895	0.58432	D	0.999999	D	0.76494	0.999	D	0.80764	0.994	T	0.79107	-0.1939	9	0.72032	D	0.01	-34.7145	19.4186	0.94712	0.0:1.0:0.0:0.0	.	391	O60239	3BP5_HUMAN	Q	391;234;234;234	.	ENSP00000253688:E234Q	E	-	1	0	SH3BP5	15272794	0.996000	0.38824	1.000000	0.80357	0.949000	0.60115	3.959000	0.56744	2.696000	0.92011	0.456000	0.33151	GAG	SH3BP5	-	NULL	ENSG00000131370		0.463	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5	HGNC	protein_coding	OTTHUMT00000340740.2	138	0.00	0	C	NM_004844		15297790	15297790	-1	no_errors	ENST00000383791	ensembl	human	known	69_37n	missense	124	20.00	31	SNP	1.000	G
SORCS2	57537	genome.wustl.edu	37	4	7730093	7730093	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr4:7730093G>A	ENST00000507866.2	+	22	2995	c.2886G>A	c.(2884-2886)atG>atA	p.M962I	SORCS2_ENST00000329016.9_Missense_Mutation_p.M790I	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	962					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						TTCAAGTCATGCCTCTGCAGT	0.602																																						dbGAP											0													64.0	70.0	68.0					4																	7730093		1979	4148	6127	-	-	-	SO:0001583	missense	0			AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2886G>A	4.37:g.7730093G>A	ENSP00000422185:p.Met962Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L7	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.M962I	ENST00000507866.2	37	c.2886	CCDS47008.1	4	.	.	.	.	.	.	.	.	.	.	G	2.659	-0.280268	0.05642	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.12774	2.66;2.65	3.97	3.97	0.46021	.	0.299222	0.26975	U	0.021553	T	0.04770	0.0129	N	0.02539	-0.55	0.23277	N	0.99799	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27706	-1.0066	10	0.36615	T	0.2	.	5.7054	0.17905	0.1039:0.0:0.6399:0.2562	.	790;962	B5MED8;Q96PQ0	.;SORC2_HUMAN	I	962;790	ENSP00000422185:M962I;ENSP00000329124:M790I	ENSP00000329124:M790I	M	+	3	0	SORCS2	7780993	1.000000	0.71417	0.943000	0.38184	0.011000	0.07611	1.091000	0.30915	1.904000	0.55121	0.467000	0.42956	ATG	SORCS2	-	NULL	ENSG00000184985		0.602	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS2	HGNC	protein_coding	OTTHUMT00000358685.4	28	0.00	0	G	NM_020777		7730093	7730093	+1	no_errors	ENST00000507866	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	0.999	A
SH3D19	152503	genome.wustl.edu	37	4	152054357	152054357	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr4:152054357T>C	ENST00000409252.2	-	16	2454	c.1747A>G	c.(1747-1749)Att>Gtt	p.I583V	SH3D19_ENST00000427414.2_Missense_Mutation_p.I524V|SH3D19_ENST00000304527.4_Missense_Mutation_p.I583V|SH3D19_ENST00000455740.1_Missense_Mutation_p.I560V|SH3D19_ENST00000409598.4_Missense_Mutation_p.I560V|SH3D19_ENST00000424281.1_Missense_Mutation_p.I524V|SH3D19_ENST00000514152.1_Missense_Mutation_p.I560V			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	583	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TGCTCTCCAATATATTCAAAC	0.388																																						dbGAP											0													70.0	73.0	72.0					4																	152054357		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.1747A>G	4.37:g.152054357T>C	ENSP00000386848:p.Ile583Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,prints_p67phox,prints_SH3_domain,pfscan_SH3_domain	p.I583V	ENST00000409252.2	37	c.1747	CCDS34077.2	4	.	.	.	.	.	.	.	.	.	.	T	12.67	2.007208	0.35415	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9	5.36	4.14	0.48551	Src homology-3 domain (4);	0.351400	0.24096	N	0.041581	T	0.34308	0.0893	N	0.02830	-0.485	0.39371	D	0.966088	P;P;B;D	0.61697	0.69;0.641;0.108;0.99	P;B;B;D	0.64877	0.685;0.428;0.211;0.93	T	0.31779	-0.9931	10	0.30078	T	0.28	-7.2404	10.385	0.44134	0.0:0.0819:0.0:0.9181	.	583;560;524;338	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	V	560;583;560;524;524;583;560	ENSP00000387030:I560V;ENSP00000302913:I583V;ENSP00000416708:I560V;ENSP00000404542:I524V;ENSP00000415694:I524V;ENSP00000386848:I583V;ENSP00000423449:I560V	ENSP00000302913:I583V	I	-	1	0	SH3D19	152273807	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.319000	0.59197	0.822000	0.34565	-0.366000	0.07423	ATT	SH3D19	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,prints_p67phox,pfscan_SH3_domain	ENSG00000109686		0.388	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	SH3D19	HGNC	protein_coding	OTTHUMT00000335132.3	25	0.00	0	T	NM_001009555		152054357	152054357	-1	no_errors	ENST00000304527	ensembl	human	known	69_37n	missense	18	14.29	3	SNP	1.000	C
ST7L	54879	genome.wustl.edu	37	1	113161562	113161562	+	Silent	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:113161562G>T	ENST00000358039.4	-	1	478	c.174C>A	c.(172-174)atC>atA	p.I58I	ST7L_ENST00000490067.1_Silent_p.I58I|ST7L_ENST00000538187.1_5'Flank|ST7L_ENST00000360743.4_Silent_p.I58I|ST7L_ENST00000463235.1_Intron|ST7L_ENST00000369668.2_Silent_p.I58I|ST7L_ENST00000544629.1_Silent_p.I58I|ST7L_ENST00000343210.7_Silent_p.I58I|ST7L_ENST00000369666.1_Silent_p.I58I|ST7L_ENST00000369669.1_5'Flank|CAPZA1_ENST00000263168.3_5'Flank|ST7L_ENST00000543570.1_Silent_p.I58I	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	58					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCTCAAAGGGATCCTCAGGG	0.687																																						dbGAP											0													19.0	21.0	20.0					1																	113161562		2172	4263	6435	-	-	-	SO:0001819	synonymous_variant	0			AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.174C>A	1.37:g.113161562G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Silent	SNP	pfam_ST7	p.I58	ENST00000358039.4	37	c.174	CCDS848.1	1																																																																																			ST7L	-	pfam_ST7	ENSG00000007341		0.687	ST7L-001	KNOWN	basic|CCDS	protein_coding	ST7L	HGNC	protein_coding	OTTHUMT00000032504.3	55	0.00	0	G			113161562	113161562	-1	no_errors	ENST00000358039	ensembl	human	known	69_37n	silent	38	20.83	10	SNP	0.933	T
SVIL	6840	genome.wustl.edu	37	10	29811407	29811407	+	Silent	SNP	T	T	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr10:29811407T>C	ENST00000355867.4	-	16	4073	c.3321A>G	c.(3319-3321)ggA>ggG	p.G1107G	SVIL_ENST00000375398.2_Silent_p.G1107G|SVIL_ENST00000375400.3_Silent_p.G681G|SVIL_ENST00000535393.1_Silent_p.G5G	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1107					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TTTTGATCTCTCCAGCAGCAA	0.502																																						dbGAP											0													83.0	82.0	82.0					10																	29811407		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.3321A>G	10.37:g.29811407T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.G1107	ENST00000355867.4	37	c.3321	CCDS7164.1	10																																																																																			SVIL	-	NULL	ENSG00000197321		0.502	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	56	0.00	0	T			29811407	29811407	-1	no_errors	ENST00000355867	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	0.978	C
SYNRG	11276	genome.wustl.edu	37	17	35956267	35956268	+	Splice_Site	DEL	TA	TA	-			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr17:35956267_35956268delTA	ENST00000339208.6	-	3	381		c.e3+1		SYNRG_ENST00000345615.4_Splice_Site|SYNRG_ENST00000394378.2_Splice_Site|SYNRG_ENST00000346661.4_Splice_Site|SYNRG_ENST00000591288.1_Splice_Site|SYNRG_ENST00000585472.1_Splice_Site|SYNRG_ENST00000502449.2_Splice_Site	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma						endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AAGAAGTAAGTACCTGCATAGC	0.366																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.240+1TA>-	17.37:g.35956267_35956268delTA		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Splice_Site	DEL	-	e3+2	ENST00000339208.6	37	c.240+2_240+1	CCDS11321.1	17																																																																																			SYNRG	-	-	ENSG00000006114		0.366	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNRG	HGNC	protein_coding	OTTHUMT00000256811.2	76	0	0	TA	NM_007247	Intron	35956267	35956268	-1	no_errors	ENST00000339208	ensembl	human	known	69_37n	splice_site_del	44	18.52	10	DEL	0.997:1.000	0
TEX14	56155	genome.wustl.edu	37	17	56647814	56647814	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr17:56647814G>A	ENST00000240361.8	-	26	3972	c.3887C>T	c.(3886-3888)tCc>tTc	p.S1296F	TEX14_ENST00000349033.5_Missense_Mutation_p.S1250F|TEX14_ENST00000389934.3_Missense_Mutation_p.S1290F			Q8IWB6	TEX14_HUMAN	testis expressed 14	1296					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AAGGCTGGGGGATCCAGCCCC	0.433																																						dbGAP											0													95.0	99.0	98.0					17																	56647814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.3887C>T	17.37:g.56647814G>A	ENSP00000240361:p.Ser1296Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.S1296F	ENST00000240361.8	37	c.3887	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788668	0.49997	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	D;D;D	0.85013	-1.92;-1.92;-1.93	3.91	3.91	0.45181	.	0.364736	0.23834	N	0.044119	D	0.89969	0.6869	M	0.61703	1.905	0.09310	N	1	D;D;D	0.89917	0.985;0.999;1.0	P;D;D	0.85130	0.771;0.974;0.997	T	0.81647	-0.0838	10	0.87932	D	0	-11.6621	11.7191	0.51672	0.0:0.0:1.0:0.0	.	1296;1250;1290	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	F	1296;1290;1250	ENSP00000240361:S1296F;ENSP00000374584:S1290F;ENSP00000268910:S1250F	ENSP00000240361:S1296F	S	-	2	0	TEX14	54002813	0.578000	0.26717	0.072000	0.20136	0.056000	0.15407	3.591000	0.53986	2.475000	0.83589	0.655000	0.94253	TCC	TEX14	-	NULL	ENSG00000121101		0.433	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1	29	0.00	0	G			56647814	56647814	-1	no_errors	ENST00000240361	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.082	A
TIAM1	7074	genome.wustl.edu	37	21	32639231	32639231	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr21:32639231T>C	ENST00000286827.3	-	5	529	c.58A>G	c.(58-60)Agc>Ggc	p.S20G	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Missense_Mutation_p.S20G	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	20					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CGCCCCAGGCTGGCATGCTTT	0.572																																						dbGAP											0													49.0	53.0	51.0					21																	32639231		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.58A>G	21.37:g.32639231T>C	ENSP00000286827:p.Ser20Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.S20G	ENST00000286827.3	37	c.58	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	T	9.811	1.183243	0.21870	.	.	ENSG00000156299	ENST00000286827;ENST00000541036;ENST00000455508	T;T	0.40756	1.03;1.02	5.09	2.7	0.31948	.	0.397739	0.30911	N	0.008631	T	0.26048	0.0635	N	0.22421	0.69	0.28746	N	0.901684	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.13656	-1.0501	10	0.32370	T	0.25	.	8.7914	0.34852	0.0:0.2367:0.0:0.7633	.	20;20;20	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	G	20	ENSP00000286827:S20G;ENSP00000441570:S20G	ENSP00000286827:S20G	S	-	1	0	TIAM1	31561102	0.999000	0.42202	0.999000	0.59377	0.986000	0.74619	0.986000	0.29590	0.274000	0.22072	0.383000	0.25322	AGC	TIAM1	-	NULL	ENSG00000156299		0.572	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	48	0.00	0	T	NM_003253		32639231	32639231	-1	no_errors	ENST00000286827	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.996	C
TMEM184C	55751	genome.wustl.edu	37	4	148550836	148550836	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr4:148550836C>T	ENST00000296582.3	+	6	1233	c.659C>T	c.(658-660)tCa>tTa	p.S220L	TMEM184C_ENST00000508208.1_Missense_Mutation_p.S220L	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	220						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						AACAACATGTCACAGTTGGTA	0.303																																						dbGAP											0													79.0	82.0	81.0					4																	148550836		2203	4294	6497	-	-	-	SO:0001583	missense	0			AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.659C>T	4.37:g.148550836C>T	ENSP00000296582:p.Ser220Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	pfam_Ost-alpha	p.S220L	ENST00000296582.3	37	c.659	CCDS3770.1	4	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019881	0.75275	.	.	ENSG00000164168	ENST00000296582;ENST00000508208	T;T	0.63744	-0.06;-0.06	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.74906	0.3778	M	0.93241	3.395	0.80722	D	1	B	0.13145	0.007	B	0.17098	0.017	T	0.75895	-0.3156	10	0.87932	D	0	-1.1845	19.7605	0.96314	0.0:1.0:0.0:0.0	.	220	Q9NVA4	T184C_HUMAN	L	220	ENSP00000296582:S220L;ENSP00000425940:S220L	ENSP00000296582:S220L	S	+	2	0	TMEM184C	148770286	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.729000	0.84864	2.734000	0.93682	0.655000	0.94253	TCA	TMEM184C	-	pfam_Ost-alpha	ENSG00000164168		0.303	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM184C	HGNC	protein_coding	OTTHUMT00000364644.1	36	0.00	0	C	NM_018241		148550836	148550836	+1	no_errors	ENST00000296582	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
TMEM216	51259	genome.wustl.edu	37	11	61165359	61165359	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr11:61165359C>T	ENST00000515837.2	+	4	1288	c.343C>T	c.(343-345)Cgc>Tgc	p.R115C	TMEM216_ENST00000334888.5_Missense_Mutation_p.R115C|TMEM216_ENST00000398979.3_Missense_Mutation_p.R54C			Q9P0N5	TM216_HUMAN	transmembrane protein 216	115					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				endometrium(1)|large_intestine(2)|lung(1)|prostate(2)	6						CTACGTACTCCGCCTGGAAGC	0.542																																						dbGAP											0													201.0	195.0	197.0					11																	61165359		2120	4239	6359	-	-	-	SO:0001583	missense	0				CCDS53640.1	11q13.1	2014-09-17			ENSG00000187049	ENSG00000187049			25018	protein-coding gene	gene with protein product		613277	"""cerebello-oculo-renal syndrome 2"", ""Meckel syndrome, type 2"""	CORS2, MKS2		11042152, 20036350, 20512146	Standard	NM_016499		Approved	MGC13379, HSPC244, JBTS2	uc021qkf.1	Q9P0N5		ENST00000515837.2:c.343C>T	11.37:g.61165359C>T	ENSP00000440638:p.Arg115Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZ23|B7Z8N1	Missense_Mutation	SNP	pfam_Uncharacterised_TM-17	p.R115C	ENST00000515837.2	37	c.343	CCDS53640.1	11	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103886	0.76983	.	.	ENSG00000187049	ENST00000515837;ENST00000334888;ENST00000398979	D;D;D	0.89270	-2.49;-2.49;-2.49	6.05	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.93743	0.8000	M	0.83384	2.64	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.951	D	0.93517	0.6858	10	0.54805	T	0.06	-14.4013	9.2122	0.37326	0.145:0.7812:0.0:0.0738	.	108;54	Q9P0N5;Q9P0N5-2	TM216_HUMAN;.	C	115;115;54	ENSP00000440638:R115C;ENSP00000334844:R115C;ENSP00000381950:R54C	ENSP00000334844:R115C	R	+	1	0	TMEM216	60921935	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.507000	0.60434	1.581000	0.49865	-0.142000	0.14014	CGC	TMEM216	-	pfam_Uncharacterised_TM-17	ENSG00000187049		0.542	TMEM216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMEM216	HGNC	protein_coding	OTTHUMT00000398430.1	86	0.00	0	C	NM_016499		61165359	61165359	+1	no_errors	ENST00000334888	ensembl	human	known	69_37n	missense	60	25.93	21	SNP	1.000	T
TPST1	8460	genome.wustl.edu	37	7	65751514	65751514	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr7:65751514G>C	ENST00000304842.5	+	3	1287	c.862G>C	c.(862-864)Gac>Cac	p.D288H	TPST1_ENST00000480281.1_3'UTR	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	288					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GAGATCTACAGACCAAGTAAT	0.323																																						dbGAP											0													113.0	105.0	108.0					7																	65751514		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.862G>C	7.37:g.65751514G>C	ENSP00000302413:p.Asp288His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2M0|Q6FGM7	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.D288H	ENST00000304842.5	37	c.862	CCDS5533.1	7	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351218	0.82132	.	.	ENSG00000169902	ENST00000304842;ENST00000544114	T	0.46063	0.88	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.70325	0.3211	M	0.88570	2.965	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.67725	0.953;0.948	T	0.73808	-0.3866	10	0.51188	T	0.08	-23.005	18.8625	0.92278	0.0:0.0:1.0:0.0	.	288;288	F5H7U7;O60507	.;TPST1_HUMAN	H	288	ENSP00000302413:D288H	ENSP00000302413:D288H	D	+	1	0	TPST1	65388949	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.737000	0.91562	2.714000	0.92807	0.591000	0.81541	GAC	TPST1	-	NULL	ENSG00000169902		0.323	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPST1	HGNC	protein_coding	OTTHUMT00000251705.2	44	0.00	0	G	NM_003596		65751514	65751514	+1	no_errors	ENST00000304842	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	C
TUBBP1	92755	genome.wustl.edu	37	8	30209455	30209456	+	RNA	INS	-	-	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr8:30209455_30209456insA	ENST00000518096.1	+	0	67_68									tubulin, beta pseudogene 1																		GACCTGCAGAGAAAAAAAAATT	0.475																																						dbGAP											0																																										-	-	-			0			J00317		8p12	2012-10-16	2005-11-15		ENSG00000127589	ENSG00000127589			12414	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 1"""			7070533	Standard	NG_001206		Approved				OTTHUMG00000163834		8.37:g.30209464_30209464dupA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000518096.1	37	NULL		8																																																																																			TUBBP1	-	-	ENSG00000127589		0.475	TUBBP1-002	KNOWN	basic	processed_transcript	TUBBP1	HGNC	pseudogene	OTTHUMT00000375880.1	22	0.00	0	-	NG_001206		30209455	30209456	+1	no_errors	ENST00000518096	ensembl	human	known	69_37n	rna	20	16.67	4	INS	0.999:1.000	A
UBR4	23352	genome.wustl.edu	37	1	19428097	19428097	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:19428097T>A	ENST00000375254.3	-	88	12967	c.12940A>T	c.(12940-12942)Att>Ttt	p.I4314F	UBR4_ENST00000375226.2_Missense_Mutation_p.I4290F|UBR4_ENST00000375267.2_Missense_Mutation_p.I4314F|UBR4_ENST00000375217.2_Missense_Mutation_p.I4307F|UBR4_ENST00000467272.2_5'Flank|UBR4_ENST00000543981.1_Missense_Mutation_p.I5F|UBR4_ENST00000429347.2_5'Flank|UBR4_ENST00000375224.1_Missense_Mutation_p.I21F	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4314					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GCTGTCTCAATGCACACAGCC	0.507																																						dbGAP											0													136.0	121.0	127.0					1																	19428097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.12940A>T	1.37:g.19428097T>A	ENSP00000364403:p.Ile4314Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.I4314F	ENST00000375254.3	37	c.12940	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.292097	0.59976	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000375224;ENST00000543981	T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;1.06;1.25	5.64	4.49	0.54785	.	0.097898	0.64402	D	0.000002	T	0.55800	0.1943	L	0.50333	1.59	0.80722	D	1	B;B;B	0.20052	0.012;0.041;0.02	B;B;B	0.23574	0.021;0.021;0.047	T	0.53732	-0.8397	10	0.49607	T	0.09	.	10.5099	0.44855	0.0:0.0:0.1627:0.8373	.	5;4314;4290	B4DYV5;Q5T4S7;Q5T4S7-3	.;UBR4_HUMAN;.	F	4314;4314;4307;4290;21;5	ENSP00000364403:I4314F;ENSP00000364416:I4314F;ENSP00000364365:I4307F;ENSP00000364374:I4290F;ENSP00000364372:I21F;ENSP00000444070:I5F	ENSP00000364365:I4307F	I	-	1	0	UBR4	19300684	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.782000	0.68973	1.116000	0.41820	0.528000	0.53228	ATT	UBR4	-	NULL	ENSG00000127481		0.507	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	63	0.00	0	T	NM_020765		19428097	19428097	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	A
UBXN11	91544	genome.wustl.edu	37	1	26620739	26620739	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr1:26620739A>T	ENST00000374222.1	-	9	980	c.516T>A	c.(514-516)caT>caA	p.H172Q	UBXN11_ENST00000374223.1_Intron|UBXN11_ENST00000374221.3_Missense_Mutation_p.H172Q|UBXN11_ENST00000535108.1_Missense_Mutation_p.H14Q|UBXN11_ENST00000436301.2_Missense_Mutation_p.H97Q|UBXN11_ENST00000314675.7_Intron|UBXN11_ENST00000357089.4_Missense_Mutation_p.H139Q|UBXN11_ENST00000374217.2_Missense_Mutation_p.H139Q			Q5T124	UBX11_HUMAN	UBX domain protein 11	172						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						CCCTCTCGCCATGCTCTGAGA	0.577																																						dbGAP											0													104.0	104.0	104.0					1																	26620739		2051	4200	6251	-	-	-	SO:0001583	missense	0			AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.516T>A	1.37:g.26620739A>T	ENSP00000363339:p.His172Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	pfam_SEP_domain,superfamily_SEP_domain,pfscan_UBX	p.H172Q	ENST00000374222.1	37	c.516	CCDS41288.1	1	.	.	.	.	.	.	.	.	.	.	A	8.979	0.974766	0.18736	.	.	ENSG00000158062	ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217;ENST00000389235;ENST00000535108;ENST00000436301;ENST00000374215;ENST00000452980;ENST00000442942;ENST00000450041;ENST00000423664	T;T;T;T;T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01	4.71	-2.41	0.06562	.	1.162180	0.06222	N	0.687016	T	0.21227	0.0511	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.23990	0.003;0.007;0.095;0.039;0.028	B;B;B;B;B	0.26416	0.004;0.006;0.069;0.048;0.019	T	0.19679	-1.0298	10	0.13853	T	0.58	-3.2359	1.1292	0.01742	0.2962:0.2901:0.272:0.1417	.	14;97;139;134;172	B7Z1T8;B7Z3N8;Q5T124-2;Q5T124-4;Q5T124	.;.;.;.;UBX11_HUMAN	Q	139;172;172;139;139;14;97;134;139;139;97;134	ENSP00000349601:H139Q;ENSP00000363338:H172Q;ENSP00000363339:H172Q;ENSP00000363334:H139Q;ENSP00000446034:H14Q;ENSP00000393858:H97Q;ENSP00000363332:H134Q;ENSP00000410357:H139Q;ENSP00000404956:H139Q;ENSP00000413448:H97Q;ENSP00000394036:H134Q	ENSP00000349601:H139Q	H	-	3	2	UBXN11	26493326	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	0.039000	0.13884	-0.183000	0.10585	0.533000	0.62120	CAT	UBXN11	-	NULL	ENSG00000158062		0.577	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBXN11	HGNC	protein_coding	OTTHUMT00000009500.1	65	0.00	0	A	NM_145345		26620739	26620739	-1	no_errors	ENST00000374221	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	0.000	T
USHBP1	83878	genome.wustl.edu	37	19	17369072	17369072	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:17369072G>T	ENST00000252597.3	-	8	1342	c.1169C>A	c.(1168-1170)gCa>gAa	p.A390E	AC010646.3_ENST00000594059.1_5'Flank|USHBP1_ENST00000431146.2_Missense_Mutation_p.A326E	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1											breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						CTCCTCTTGTGCCAGCAGCCT	0.607																																						dbGAP											0													91.0	76.0	81.0					19																	17369072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1169C>A	19.37:g.17369072G>T	ENSP00000252597:p.Ala390Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain	p.A390E	ENST00000252597.3	37	c.1169	CCDS12353.1	19	.	.	.	.	.	.	.	.	.	.	g	14.37	2.515655	0.44763	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.19532	2.14;2.14	4.11	1.88	0.25563	.	0.646706	0.14437	N	0.319643	T	0.14399	0.0348	L	0.54323	1.7	0.47698	D	0.999494	B;B	0.27498	0.18;0.18	B;B	0.24155	0.051;0.051	T	0.12142	-1.0559	10	0.02654	T	1	-1.7323	6.0856	0.19964	0.2732:0.0:0.7268:0.0	.	326;390	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	E	390;326	ENSP00000252597:A390E;ENSP00000407902:A326E	ENSP00000252597:A390E	A	-	2	0	USHBP1	17230072	0.317000	0.24589	0.349000	0.25694	0.686000	0.39977	1.101000	0.31037	0.413000	0.25759	0.544000	0.68410	GCA	USHBP1	-	NULL	ENSG00000130307		0.607	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USHBP1	HGNC	protein_coding	OTTHUMT00000463328.1	36	0.00	0	G	NM_031941		17369072	17369072	-1	no_errors	ENST00000252597	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.616	T
UNC13A	23025	genome.wustl.edu	37	19	17750006	17750006	+	Silent	SNP	C	C	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:17750006C>T	ENST00000519716.2	-	25	2966	c.2967G>A	c.(2965-2967)ccG>ccA	p.P989P	UNC13A_ENST00000552293.1_Silent_p.P989P|UNC13A_ENST00000550896.1_Silent_p.P987P|UNC13A_ENST00000551649.1_Silent_p.P989P|UNC13A_ENST00000252773.7_Silent_p.P989P|UNC13A_ENST00000428389.2_Silent_p.P1077P	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	989					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TGGCTCGGGGCGGGCTCTGGA	0.547																																						dbGAP											0													43.0	47.0	46.0					19																	17750006		2019	4242	6261	-	-	-	SO:0001819	synonymous_variant	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2967G>A	19.37:g.17750006C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E5RHY9	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.P1077	ENST00000519716.2	37	c.3231	CCDS46013.2	19																																																																																			UNC13A	-	NULL	ENSG00000130477		0.547	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	39	0.00	0	C	XM_038604		17750006	17750006	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	silent	63	16.88	13	SNP	0.232	T
VPRBP	9730	genome.wustl.edu	37	3	51464977	51464977	+	Intron	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:51464977G>A	ENST00000335891.5	-	7	682							Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein						B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		ATCTGTTCATGAGTATATGAG	0.388																																						dbGAP											0													30.0	27.0	28.0					3																	51464977		1804	4066	5870	-	-	-	SO:0001627	intron_variant	0			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.673-6573C>T	3.37:g.51464977G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.H136Y	ENST00000335891.5	37	c.406		3	.	.	.	.	.	.	.	.	.	.	G	9.146	1.014989	0.19355	.	.	ENSG00000145041	ENST00000423656	T	0.17370	2.28	6.06	6.06	0.98353	Armadillo-like helical (1);Armadillo-type fold (1);	0.055461	0.85682	D	0.000000	T	0.11750	0.0286	N	0.14661	0.345	0.80722	D	1	P	0.38863	0.65	B	0.38500	0.275	T	0.03534	-1.1027	10	0.02654	T	1	-21.3613	20.6282	0.99521	0.0:0.0:1.0:0.0	.	565	Q9Y4B6	VPRBP_HUMAN	Y	136	ENSP00000393183:H136Y	ENSP00000393183:H136Y	H	-	1	0	VPRBP	51440017	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.160000	0.94734	2.871000	0.98454	0.655000	0.94253	CAT	VPRBP	-	superfamily_ARM-type_fold	ENSG00000145041		0.388	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding		26	0.00	0	G	NM_014703		51464977	51464977	-1	no_start_codon	ENST00000423656	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	A
WDR36	134430	genome.wustl.edu	37	5	110446555	110446555	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr5:110446555G>T	ENST00000513710.2	+	14	1682	c.1678G>T	c.(1678-1680)Gaa>Taa	p.E560*	WDR36_ENST00000505303.1_Nonsense_Mutation_p.E504*|WDR36_ENST00000506538.2_Nonsense_Mutation_p.E560*			Q8NI36	WDR36_HUMAN	WD repeat domain 36	560					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		AACTGGTAGTGAAGGATTACT	0.368																																						dbGAP											0													57.0	61.0	60.0					5																	110446555		2199	4299	6498	-	-	-	SO:0001587	stop_gained	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1678G>T	5.37:g.110446555G>T	ENSP00000424628:p.Glu560*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUS4|Q68E02|Q8N1Q2	Nonsense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E560*	ENST00000513710.2	37	c.1678	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.580560	0.97680	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	.	.	.	5.72	5.72	0.89469	.	0.043748	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-29.1131	19.8765	0.96875	0.0:0.0:1.0:0.0	.	.	.	.	X	560;560;504	.	ENSP00000422158:E504X	E	+	1	0	WDR36	110474454	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.611000	0.90905	2.695000	0.91970	0.650000	0.86243	GAA	WDR36	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000134987		0.368	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	32	0.00	0	G	NM_139281		110446555	110446555	+1	no_errors	ENST00000506538	ensembl	human	known	69_37n	nonsense	36	10.00	4	SNP	1.000	T
YEATS2	55689	genome.wustl.edu	37	3	183446539	183446539	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr3:183446539G>A	ENST00000305135.5	+	7	907	c.712G>A	c.(712-714)Gtc>Atc	p.V238I		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	238	YEATS. {ECO:0000255|PROSITE- ProRule:PRU00376}.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GATGGTATATGTCCGAGGGTC	0.403																																						dbGAP											0													119.0	119.0	119.0					3																	183446539		1843	4090	5933	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.712G>A	3.37:g.183446539G>A	ENSP00000306983:p.Val238Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.V238I	ENST00000305135.5	37	c.712	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.268459	0.95429	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.49139	0.79	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000003	T	0.70369	0.3216	M	0.74258	2.255	0.80722	D	1	D	0.58970	0.984	D	0.72982	0.979	T	0.72447	-0.4291	10	0.62326	D	0.03	-19.4739	19.3172	0.94220	0.0:0.0:1.0:0.0	.	238	Q9ULM3	YETS2_HUMAN	I	238	ENSP00000306983:V238I	ENSP00000306983:V238I	V	+	1	0	YEATS2	184929233	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.897000	0.87356	2.553000	0.86117	0.563000	0.77884	GTC	YEATS2	-	pfam_YEATS,pfscan_YEATS	ENSG00000163872		0.403	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	46	0.00	0	G	NM_018023		183446539	183446539	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	1.000	A
ZBTB32	27033	genome.wustl.edu	37	19	36205602	36205602	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr19:36205602G>A	ENST00000392197.2	+	3	392	c.74G>A	c.(73-75)cGg>cAg	p.R25Q	ZBTB32_ENST00000262630.3_Missense_Mutation_p.R25Q			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	25					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCAGGCTCCGGCCAGCACTC	0.632																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.74G>A	19.37:g.36205602G>A	ENSP00000376035:p.Arg25Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WVP2	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R25Q	ENST00000392197.2	37	c.74	CCDS12471.1	19	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892091	0.91889	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.21031	2.03;2.03	5.54	5.54	0.83059	BTB/POZ (1);BTB/POZ fold (2);	0.160951	0.29660	N	0.011533	T	0.25269	0.0614	N	0.05441	-0.05	0.37940	D	0.932293	D	0.89917	1.0	D	0.64042	0.921	T	0.25710	-1.0124	10	0.87932	D	0	-1.9557	14.8575	0.70351	0.0:0.0:1.0:0.0	.	25	Q9Y2Y4	ZBT32_HUMAN	Q	25	ENSP00000262630:R25Q;ENSP00000376035:R25Q	ENSP00000262630:R25Q	R	+	2	0	ZBTB32	40897442	0.994000	0.37717	0.994000	0.49952	0.992000	0.81027	3.004000	0.49513	2.884000	0.98904	0.655000	0.94253	CGG	ZBTB32	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold	ENSG00000011590		0.632	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB32	HGNC	protein_coding	OTTHUMT00000109491.3	54	0.00	0	G	NM_014383		36205602	36205602	+1	no_errors	ENST00000262630	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.983	A
ZFX	7543	genome.wustl.edu	37	X	24197366	24197366	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chrX:24197366C>G	ENST00000379177.1	+	6	552	c.125C>G	c.(124-126)tCa>tGa	p.S42*	ZFX_ENST00000540034.1_Nonsense_Mutation_p.S81*|ZFX_ENST00000338565.3_Nonsense_Mutation_p.S42*|ZFX_ENST00000459724.1_Intron|ZFX_ENST00000304543.5_Nonsense_Mutation_p.S42*|ZFX_ENST00000379188.3_Nonsense_Mutation_p.S42*|ZFX_ENST00000539115.1_Intron	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	42					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						GTTTTTGTTTCAGATGTTGTG	0.343																																					Esophageal Squamous(20;306 562 7346 32868 37983)	dbGAP											0													240.0	207.0	218.0					X																	24197366		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.125C>G	X.37:g.24197366C>G	ENSP00000368475:p.Ser42*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG97|O43668|Q8WYJ8	Nonsense_Mutation	SNP	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S81*	ENST00000379177.1	37	c.242	CCDS14211.1	X	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931624	0.92389	.	.	ENSG00000005889	ENST00000428571;ENST00000379188;ENST00000536464;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	.	.	.	6.13	6.13	0.99165	.	0.109437	0.40818	N	0.001005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.1293	19.725	0.96161	0.0:1.0:0.0:0.0	.	.	.	.	X	42;42;42;42;42;81;42	.	ENSP00000304985:S42X	S	+	2	0	ZFX	24107287	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.021000	0.70832	2.615000	0.88500	0.597000	0.82753	TCA	ZFX	-	NULL	ENSG00000005889		0.343	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	HGNC	protein_coding	OTTHUMT00000056084.1	68	0.00	0	C	NM_003410		24197366	24197366	+1	no_errors	ENST00000540034	ensembl	human	known	69_37n	nonsense	60	25.93	21	SNP	1.000	G
ZNF318	24149	genome.wustl.edu	37	6	43325259	43325259	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4RW-01A-21D-A25Q-09	TCGA-A2-A4RW-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d0a7623-cc2d-443f-9798-df420fc50d17	abd9cb0d-01de-478e-8dd7-b8b93e099f58	g.chr6:43325259C>G	ENST00000361428.2	-	3	870	c.793G>C	c.(793-795)Gaa>Caa	p.E265Q	ZNF318_ENST00000318149.3_Missense_Mutation_p.E265Q	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	265					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTCCTTTCTTCAGATCGTATG	0.473																																						dbGAP											0													106.0	101.0	103.0					6																	43325259		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.793G>C	6.37:g.43325259C>G	ENSP00000354964:p.Glu265Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.E265Q	ENST00000361428.2	37	c.793	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233696	0.79688	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.05258	3.47;3.47	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000001	T	0.09949	0.0244	L	0.27053	0.805	0.37686	D	0.923662	D	0.89917	1.0	D	0.85130	0.997	T	0.23048	-1.0199	10	0.46703	T	0.11	-17.4694	17.8421	0.88718	0.0:1.0:0.0:0.0	.	265	Q5VUA4	ZN318_HUMAN	Q	265	ENSP00000323032:E265Q;ENSP00000354964:E265Q	ENSP00000323032:E265Q	E	-	1	0	ZNF318	43433237	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	5.446000	0.66600	2.653000	0.90120	0.555000	0.69702	GAA	ZNF318	-	NULL	ENSG00000171467		0.473	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	77	0.00	0	C	NM_014345		43325259	43325259	-1	no_errors	ENST00000361428	ensembl	human	known	69_37n	missense	81	17.00	17	SNP	1.000	G
