#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTB	60	genome.wustl.edu	37	7	5567112	5567112	+	3'UTR	SNP	C	C	T	rs7612	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr7:5567112C>T	ENST00000331789.5	-	0	1586				AC006483.1_ENST00000579427.1_RNA|ACTB_ENST00000464611.1_5'UTR	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta						adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CCTGTAACAACGCATCTCATA	0.488													c|||	1615	0.322484	0.4085	0.3415	5008	,	,		15516	0.2212		0.327	False		,,,				2504	0.2924					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.*267G>A	7.37:g.5567112C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	RNA	SNP	-	NULL	ENST00000331789.5	37	NULL	CCDS5341.1	7																																																																																			ACTB	-	-	ENSG00000075624		0.488	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	HGNC	protein_coding	OTTHUMT00000059589.4	43	0.00	0	C	NM_001101		5567112	5567112	-1	no_errors	ENST00000464611	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.998	T
ANKRD20A4	728747	genome.wustl.edu	37	9	69390020	69390020	+	Missense_Mutation	SNP	T	T	A	rs200769647		TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr9:69390020T>A	ENST00000357336.3	+	4	855	c.574T>A	c.(574-576)Tca>Aca	p.S192T	RNU6-1193P_ENST00000459461.1_RNA	NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	192										breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						GAAAGCAAGTTCACATGCCGT	0.313																																						dbGAP											0													3.0	3.0	3.0					9																	69390020		1031	2307	3338	-	-	-	SO:0001583	missense	0				CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.574T>A	9.37:g.69390020T>A	ENSP00000349891:p.Ser192Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S192T	ENST00000357336.3	37	c.574	CCDS43828.1	9	.	.	.	.	.	.	.	.	.	.	T	1.745	-0.490649	0.04322	.	.	ENSG00000172014	ENST00000357336	T	0.52057	0.68	2.26	-0.246	0.13022	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.19805	0.0476	N	0.03268	-0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14117	-1.0484	9	0.46703	T	0.11	.	2.3964	0.04391	0.4743:0.0:0.3053:0.2205	.	192	Q4UJ75	A20A4_HUMAN	T	192	ENSP00000349891:S192T	ENSP00000349891:S192T	S	+	1	0	ANKRD20A4	68679840	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.285000	0.08410	-0.423000	0.07394	-3.249000	0.00050	TCA	ANKRD20A4	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000172014		0.313	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	HGNC	protein_coding	OTTHUMT00000143287.3	26	0.00	0	T	NM_001098805		69390020	69390020	+1	no_errors	ENST00000357336	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.002	A
ANKRD49	54851	genome.wustl.edu	37	11	94231847	94231847	+	3'UTR	SNP	G	G	A	rs1046654	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr11:94231847G>A	ENST00000544612.1	+	0	1366				ANKRD49_ENST00000302755.4_3'UTR|ANKRD49_ENST00000544253.1_3'UTR|ANKRD49_ENST00000538535.1_3'UTR	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49						positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCCTGACTTTGATGTCAAAAT	0.274													G|||	428	0.0854633	0.0091	0.0735	5008	,	,		18944	0.1746		0.1233	False		,,,				2504	0.0665				Melanoma(113;823 1621 4352 9582 22033)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.*149G>A	11.37:g.94231847G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDF2|Q96JE5|Q9NXK7	RNA	SNP	-	NULL	ENST00000544612.1	37	NULL	CCDS8300.1	11																																																																																			ANKRD49	-	-	ENSG00000168876		0.274	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD49	HGNC	protein_coding	OTTHUMT00000396314.2	19	0.00	0	G	NM_017704		94231847	94231847	+1	no_errors	ENST00000538535	ensembl	human	known	69_37n	rna	15	25.00	5	SNP	0.932	A
C1S	716	genome.wustl.edu	37	12	7169068	7169068	+	5'UTR	SNP	C	C	T			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr12:7169068C>T	ENST00000328916.3	+	0	376				C1S_ENST00000360817.5_Intron|C1S_ENST00000402681.3_5'UTR|C1S_ENST00000406697.1_Intron	NM_201442.2	NP_958850.1	P09871	C1S_HUMAN	complement component 1, s subcomponent						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GACACTGAGCCCCAGGTGACG	0.547																																					GBM(156;750 1943 12971 24779 31015)	dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000328916.3:c.-149C>T	12.37:g.7169068C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	RNA	SNP	-	NULL	ENST00000328916.3	37	NULL	CCDS31735.1	12																																																																																			C1S	-	-	ENSG00000182326		0.547	C1S-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1S	HGNC	protein_coding	OTTHUMT00000317483.1	36	0.00	0	C	NM_001734		7169068	7169068	+1	no_errors	ENST00000541647	ensembl	human	known	69_37n	rna	34	17.07	7	SNP	0.000	T
CFAP54	144535	genome.wustl.edu	37	12	97023937	97023937	+	Silent	SNP	A	A	C	rs9919717	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr12:97023937A>C	ENST00000524981.4	+	31	4193	c.4170A>C	c.(4168-4170)gcA>gcC	p.A1390A	C12orf55_ENST00000554108.2_3'UTR			Q96N23	CL055_HUMAN		0																	ATAAAAAAGCAAACAAATCTT	0.284													A|||	1915	0.382388	0.416	0.562	5008	,	,		16742	0.2361		0.4702	False		,,,				2504	0.2699					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0																														ENST00000524981.4:c.4170A>C	12.37:g.97023937A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.K137Q	ENST00000524981.4	37	c.409		12	834	0.38186813186813184	162	0.32926829268292684	188	0.5193370165745856	134	0.23426573426573427	350	0.46174142480211083	A	4.178	0.031613	0.08101	.	.	ENSG00000188596	ENST00000550977	.	.	.	4.37	-8.74	0.00838	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.11227	-1.0596	3	.	.	.	.	7.2263	0.26018	0.1373:0.2901:0.482:0.0906	rs9919717;rs59400917;rs9919717	.	.	.	Q	137	.	.	K	+	1	0	C12orf63	95548068	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.146000	0.01294	-3.493000	0.00153	0.519000	0.50382	AAA	C12orf55	-	NULL	ENSG00000188596		0.284	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	45	0.00	0	A			97023937	97023937	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000550977	ensembl	human	putative	69_37n	missense	39	13.33	6	SNP	0.000	C
CASP2	835	genome.wustl.edu	37	7	142997325	142997325	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr7:142997325A>G	ENST00000310447.5	+	8	1146	c.905A>G	c.(904-906)aAc>aGc	p.N302S	RN7SL481P_ENST00000477764.2_RNA|CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	302					aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					CTCTTTGACAACGCCAACTGC	0.522																																						dbGAP											0													82.0	74.0	76.0					7																	142997325		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.905A>G	7.37:g.142997325A>G	ENSP00000312664:p.Asn302Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	pfam_Pept_C14_cat,pfam_CARD,superfamily_DEATH-like,smart_CARD,smart_Pept_C14_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.N302S	ENST00000310447.5	37	c.905	CCDS5879.1	7	.	.	.	.	.	.	.	.	.	.	A	24.9	4.585749	0.86748	.	.	ENSG00000106144	ENST00000310447;ENST00000392923	T	0.29397	1.57	5.52	5.52	0.82312	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.85682	D	0.000000	T	0.50973	0.1647	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.41251	-0.9519	10	0.27082	T	0.32	.	15.7064	0.77583	1.0:0.0:0.0:0.0	.	302	P42575	CASP2_HUMAN	S	302;271	ENSP00000312664:N302S	ENSP00000312664:N302S	N	+	2	0	CASP2	142707447	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.698000	0.91311	2.112000	0.64535	0.524000	0.50904	AAC	CASP2	-	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20	ENSG00000106144		0.522	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP2	HGNC	protein_coding	OTTHUMT00000059962.3	49	0.00	0	A	NM_032982		142997325	142997325	+1	no_errors	ENST00000310447	ensembl	human	known	69_37n	missense	45	10.00	5	SNP	1.000	G
CBX8	57332	genome.wustl.edu	37	17	77772068	77772068	+	5'Flank	SNP	G	G	A	rs9905914	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr17:77772068G>A	ENST00000269385.4	-	0	0				CBX8_ENST00000485449.1_Intron|RP11-353N14.1_ENST00000570512.1_RNA	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8						histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TCCCAACGTGGGCGGCGGACA	0.736													A|||	2534	0.50599	0.6604	0.5749	5008	,	,		13187	0.2202		0.4692	False		,,,				2504	0.5808					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416		17.37:g.77772068G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H39|Q9NR07	Silent	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.A4	ENST00000269385.4	37	c.12	CCDS11765.1	17																																																																																			CBX8	-	smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000141570		0.736	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	HGNC	protein_coding	OTTHUMT00000318011.1	19	0.00	0	G	NM_020649		77772068	77772068	-1	no_stop_codon	ENST00000413392	ensembl	human	putative	69_37n	silent	10	23.08	3	SNP	0.003	A
CCT6P3	643180	genome.wustl.edu	37	7	64498782	64498782	+	RNA	SNP	G	G	T	rs34438629	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr7:64498782G>T	ENST00000426828.1	+	0	45					NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		GCGTGTCGGTGCCGCGGTGGG	0.731													.|||	1943	0.387979	0.4047	0.2666	5008	,	,		4729	0.4067		0.4036	False		,,,				2504	0.4162					dbGAP											0																																										-	-	-			0					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64498782G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000426828.1	37	NULL		7																																																																																			CCT6P3	-	-	ENSG00000234585		0.731	CCT6P3-004	KNOWN	basic	processed_transcript	CCT6P3	HGNC	pseudogene	OTTHUMT00000344862.1	39	0.00	0	G			64498782	64498782	+1	no_errors	ENST00000426828	ensembl	human	known	69_37n	rna	32	13.51	5	SNP	1.000	T
CDO1	1036	genome.wustl.edu	37	5	115152249	115152249	+	5'UTR	SNP	G	G	A	rs12782	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr5:115152249G>A	ENST00000250535.4	-	0	402				CDO1_ENST00000502631.1_Intron	NM_001801.2	NP_001792.2	Q16878	CDO1_HUMAN	cysteine dioxygenase type 1						cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|inflammatory response (GO:0006954)|L-cysteine catabolic process (GO:0019448)|lactation (GO:0007595)|oxidation-reduction process (GO:0055114)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid biosynthetic process (GO:0000097)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)	cytosol (GO:0005829)	cysteine dioxygenase activity (GO:0017172)|ferrous iron binding (GO:0008198)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|skin(5)	11		all_cancers(142;0.0046)|all_epithelial(76;0.000161)|Prostate(80;0.0132)|Ovarian(225;0.0776)		OV - Ovarian serous cystadenocarcinoma(64;7.8e-08)|Epithelial(69;7.32e-07)|all cancers(49;3.24e-05)	L-Cysteine(DB00151)	CGAAACGTAAGGATGTCGTCG	0.612													G|||	614	0.122604	0.4312	0.0461	5008	,	,		17421	0.0		0.0089	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS4121.1	5q23.2	2013-06-11	2013-06-11		ENSG00000129596	ENSG00000129596	1.13.11.20		1795	protein-coding gene	gene with protein product		603943	"""cysteine dioxygenase, type I"""			7524679	Standard	NM_001801		Approved		uc003krg.3	Q16878	OTTHUMG00000128891	ENST00000250535.4:c.-155C>T	5.37:g.115152249G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAK4|P78513|Q6FHZ8|Q8TB64	RNA	SNP	-	NULL	ENST00000250535.4	37	NULL	CCDS4121.1	5																																																																																			CDO1	-	-	ENSG00000129596		0.612	CDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDO1	HGNC	protein_coding	OTTHUMT00000250853.2	22	0.00	0	G	NM_001801		115152249	115152249	-1	no_errors	ENST00000504613	ensembl	human	putative	69_37n	rna	22	15.38	4	SNP	0.001	A
CTBP1	1487	genome.wustl.edu	37	4	1244267	1244267	+	5'Flank	SNP	A	A	G	rs2291199	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr4:1244267A>G	ENST00000290921.6	-	0	0				CTBP1_ENST00000382952.3_5'Flank|CTBP1-AS2_ENST00000578730.1_RNA|CTBP1-AS2_ENST00000357591.2_RNA|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000581398.1_RNA|CTBP1-AS2_ENST00000507044.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		AAAAAATTCCAGAAAAATGAG	0.607													A|||	1359	0.271366	0.0802	0.3343	5008	,	,		19283	0.2054		0.4324	False		,,,				2504	0.3875					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244267A>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5N3|Q7Z2Q5	RNA	SNP	-	NULL	ENST00000290921.6	37	NULL	CCDS3348.1	4																																																																																			CTBP1-AS1	-	-	ENSG00000196810		0.607	CTBP1-001	KNOWN	basic|CCDS	protein_coding	CTBP1-AS1	HGNC	protein_coding	OTTHUMT00000202938.1	42	0.00	0	A	NM_001328		1244267	1244267	+1	no_errors	ENST00000578730	ensembl	human	known	69_37n	rna	51	12.07	7	SNP	0.326	G
CYP2C18	1562	genome.wustl.edu	37	10	96495284	96495284	+	3'UTR	SNP	G	G	A	rs1042192	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr10:96495284G>A	ENST00000285979.6	+	0	1755				CYP2C19_ENST00000464755.1_Intron|CYP2C18_ENST00000339022.5_3'UTR	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18						small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	CCTTCTCTCTGTGAGGGATAT	0.473													A|||	1164	0.232428	0.211	0.1066	5008	,	,		20359	0.3135		0.1451	False		,,,				2504	0.3569					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.*83G>A	10.37:g.96495284G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	RNA	SNP	-	NULL	ENST00000285979.6	37	NULL	CCDS7435.1	10																																																																																			CYP2C18	-	-	ENSG00000108242		0.473	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1	44	0.00	0	G	NM_000772		96495284	96495284	+1	no_errors	ENST00000476630	ensembl	human	known	69_37n	rna	52	10.34	6	SNP	0.000	A
DTYMK	1841	genome.wustl.edu	37	2	242615462	242615462	+	3'UTR	SNP	T	T	C	rs5860	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr2:242615462T>C	ENST00000305784.2	-	0	926					NM_001165031.1|NM_012145.3	NP_001158503.1|NP_036277.2	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|cellular response to growth factor stimulus (GO:0071363)|dTDP biosynthetic process (GO:0006233)|dTTP biosynthetic process (GO:0006235)|myoblast differentiation (GO:0045445)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside monophosphate phosphorylation (GO:0046940)|nucleotide phosphorylation (GO:0046939)|response to cadmium ion (GO:0046686)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|nucleoside phosphate kinase activity (GO:0050145)|thymidylate kinase activity (GO:0004798)			NS(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GTCTGGACTCTGCTGGGGACG	0.672													C|||	2728	0.544728	0.4372	0.7089	5008	,	,		15692	0.494		0.665	False		,,,				2504	0.502					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X54729	CCDS2552.1	2q37	2008-02-05			ENSG00000168393	ENSG00000168393	2.7.4.9		3061	protein-coding gene	gene with protein product	"""dTMP kinase"", ""thymidylate (dTMP) kinase"""	188345				2017365, 8024690	Standard	NM_001165031		Approved	CDC8, TYMK, TMPK	uc002wbz.2	P23919	OTTHUMG00000133409	ENST00000305784.2:c.*80A>G	2.37:g.242615462T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZW70|Q6FGX1|Q9BUX4	RNA	SNP	-	NULL	ENST00000305784.2	37	NULL	CCDS2552.1	2																																																																																			DTYMK	-	-	ENSG00000168393		0.672	DTYMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTYMK	HGNC	protein_coding	OTTHUMT00000257266.2	9	0.00	0	T	NM_012145		242615462	242615462	-1	no_errors	ENST00000472618	ensembl	human	putative	69_37n	rna	15	44.44	12	SNP	0.000	C
ESRP1	54845	genome.wustl.edu	37	8	95718733	95718733	+	3'UTR	SNP	A	A	T	rs7010722	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr8:95718733A>T	ENST00000433389.2	+	0	2852				ESRP1_ENST00000523347.1_3'UTR|ESRP1_ENST00000358397.5_3'UTR|ESRP1_ENST00000423620.2_3'UTR|ESRP1_ENST00000454170.2_3'UTR	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1						mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						CCTGAAGATAAATTAGAAGAA	0.299													A|||	3293	0.657548	0.9539	0.6513	5008	,	,		15709	0.4702		0.6093	False		,,,				2504	0.5041					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.*616A>T	8.37:g.95718733A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	RNA	SNP	-	NULL	ENST00000433389.2	37	NULL	CCDS47897.1	8																																																																																			ESRP1	-	-	ENSG00000104413		0.299	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	17	0.00	0	A	NM_017697		95718733	95718733	+1	no_errors	ENST00000523347	ensembl	human	known	69_37n	rna	17	22.73	5	SNP	0.000	T
FER1L6	654463	genome.wustl.edu	37	8	125047692	125047692	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr8:125047692C>A	ENST00000522917.1	+	19	2667	c.2461C>A	c.(2461-2463)Caa>Aaa	p.Q821K	FER1L6_ENST00000399018.1_Missense_Mutation_p.Q821K|RP11-959I15.4_ENST00000522005.1_RNA|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	821	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CCTGCTCTACCAAGGTAGGGT	0.512																																						dbGAP											0													43.0	41.0	41.0					8																	125047692		1911	4115	6026	-	-	-	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2461C>A	8.37:g.125047692C>A	ENSP00000428280:p.Gln821Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ABC_transptrTM_dom_typ1,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.Q821K	ENST00000522917.1	37	c.2461	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.704523	0.00719	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.80033	-1.33;-1.33	4.91	3.06	0.35304	C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);	0.489002	0.19643	U	0.109417	T	0.50888	0.1642	N	0.01809	-0.71	0.30848	N	0.734888	B	0.06786	0.001	B	0.04013	0.001	T	0.45338	-0.9268	10	0.12766	T	0.61	.	6.6022	0.22707	0.4315:0.4836:0.0:0.0849	.	821	Q2WGJ9	FR1L6_HUMAN	K	821	ENSP00000428280:Q821K;ENSP00000381982:Q821K	ENSP00000381982:Q821K	Q	+	1	0	FER1L6	125116873	0.089000	0.21612	1.000000	0.80357	0.043000	0.13939	0.233000	0.17911	0.551000	0.29008	-0.140000	0.14226	CAA	FER1L6	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_C2_membr_targeting	ENSG00000214814		0.512	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	83	0.00	0	C	NM_001039112		125047692	125047692	+1	no_errors	ENST00000399018	ensembl	human	known	69_37n	missense	67	12.99	10	SNP	0.996	A
GPR63	81491	genome.wustl.edu	37	6	97247453	97247453	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr6:97247453G>C	ENST00000229955.3	-	2	500	c.155C>G	c.(154-156)gCt>gGt	p.A52G	GPR63_ENST00000417980.1_Missense_Mutation_p.A52G	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		ACCAGTGGGAGCCATGGTTTC	0.448																																						dbGAP											0													109.0	103.0	105.0					6																	97247453		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.155C>G	6.37:g.97247453G>C	ENSP00000229955:p.Ala52Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJH3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A52G	ENST00000229955.3	37	c.155	CCDS5036.1	6	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526958	0.27299	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.61158	0.13;0.13;0.13	5.15	4.26	0.50523	.	0.619162	0.14973	N	0.287671	T	0.15478	0.0373	N	0.08118	0	0.23304	N	0.997947	B	0.02656	0.0	B	0.01281	0.0	T	0.13176	-1.0519	10	0.30854	T	0.27	-2.7126	7.6276	0.28220	0.1142:0.1654:0.7204:0.0	.	52	Q9BZJ6	GPR63_HUMAN	G	76;52;52;52	ENSP00000393170:A52G;ENSP00000229955:A52G;ENSP00000358273:A52G	ENSP00000229955:A52G	A	-	2	0	GPR63	97354174	0.965000	0.33210	1.000000	0.80357	0.970000	0.65996	1.672000	0.37523	1.269000	0.44280	0.650000	0.86243	GCT	GPR63	-	NULL	ENSG00000112218		0.448	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR63	HGNC	protein_coding	OTTHUMT00000041566.2	75	0.00	0	G			97247453	97247453	-1	no_errors	ENST00000229955	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	0.998	C
KIAA1211	57482	genome.wustl.edu	37	4	57180592	57180592	+	Frame_Shift_Del	DEL	T	T	-	rs386674634		TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr4:57180592delT	ENST00000504228.1	+	6	1029	c.924delT	c.(922-924)cgtfs	p.R308fs	KIAA1211_ENST00000541073.1_Frame_Shift_Del_p.R301fs|KIAA1211_ENST00000264229.6_Frame_Shift_Del_p.R308fs			Q6ZU35	K1211_HUMAN	KIAA1211	308	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GGAGGGAGCGTGAGGAGCGCG	0.736																																						dbGAP											0													5.0	7.0	6.0					4																	57180592		1903	3760	5663	-	-	-	SO:0001589	frameshift_variant	0			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.924delT	4.37:g.57180592delT	ENSP00000423366:p.Arg308fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTE2|Q9NTP8|Q9ULK9	Frame_Shift_Del	DEL	NULL	p.E309fs	ENST00000504228.1	37	c.924	CCDS43230.1	4																																																																																			KIAA1211	-	NULL	ENSG00000109265		0.736	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	10	0.00	0	T	NM_020722		57180592	57180592	+1	no_errors	ENST00000504228	ensembl	human	known	69_37n	frame_shift_del	15	28.57	6	DEL	0.000	-
Unknown	0	genome.wustl.edu	37	GL000209.1	88540	88540	+	IGR	SNP	A	A	G			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chrGL000209.1:88540A>G								None (None upstream) : None (None downstream)																							GTTCACACCCACGCTCCCCCA	0.572																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															GL000209.1.37:g.88540A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.P100		37	c.300		GL000209.1																																																																																			KIR2DL2	-	smart_Ig_sub	ENSG00000215764	0	0.572					KIR2DL2	HGNC			54	0.00	0	A			88540	88540	+1	no_errors	ENST00000391731	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	NULL	G
KIR3DL1	3811	genome.wustl.edu	37	19	55275387	55275387	+	Intron	SNP	A	A	G	rs62121577	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr19:55275387A>G	ENST00000538269.1	+	1	61				KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_Missense_Mutation_p.K237E			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		ACCAAGCTCCAAAACCGGTGA	0.498													.|||	953	0.190296	0.2337	0.1628	5008	,	,		16041	0.0427		0.173	False		,,,				2504	0.3211					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.34+39352A>G	19.37:g.55275387A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.K237E	ENST00000538269.1	37	c.709		19	283	0.1295787545787546	90	0.18292682926829268	61	0.1685082872928177	17	0.02972027972027972	115	0.1517150395778364	A	5.922	0.354151	0.11182	.	.	ENSG00000243772	ENST00000434419	T	0.00469	7.21	0.704	0.704	0.18121	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.48958	-0.8988	4	0.51188	T	0.08	.	.	.	.	rs62121577	.	.	.	E	237	ENSP00000415758:K237E	ENSP00000415758:K237E	K	+	1	0	KIR2DL3	59967199	0.000000	0.05858	0.035000	0.18076	0.037000	0.13140	-0.546000	0.06062	0.553000	0.29044	0.327000	0.21459	AAA	KIR2DL3	-	NULL	ENSG00000243772		0.498	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL3	HGNC	protein_coding		80	0.00	0	A	NM_013289		55275387	55275387	+1	no_errors	ENST00000434419	ensembl	human	known	69_37n	missense	84	11.58	11	SNP	0.051	G
MYBPHL	343263	genome.wustl.edu	37	1	109839483	109839483	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr1:109839483G>A	ENST00000357155.1	-	5	701	c.652C>T	c.(652-654)Cgt>Tgt	p.R218C	MYBPHL_ENST00000477962.1_Intron	NM_001010985.2|NM_001265613.1	NP_001010985.2|NP_001252542.1	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	218	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.									central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(2)	14		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)		GCAAAGACACGGAAGGCATAG	0.567																																						dbGAP											0													141.0	110.0	121.0					1																	109839483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129834	CCDS30793.1	1p13	2013-02-11			ENSG00000221986	ENSG00000221986		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	30434	protein-coding gene	gene with protein product							Standard	NM_001010985		Approved		uc001dxk.1	A2RUH7	OTTHUMG00000012002	ENST00000357155.1:c.652C>T	1.37:g.109839483G>A	ENSP00000349678:p.Arg218Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZME5|Q5T2Z7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R218C	ENST00000357155.1	37	c.652	CCDS30793.1	1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278709	0.59758	.	.	ENSG00000221986	ENST00000357155	D	0.91894	-2.93	4.91	3.97	0.46021	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	D	0.96864	0.8976	H	0.98295	4.195	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96165	0.9118	9	0.87932	D	0	.	6.4694	0.21999	0.0938:0.0:0.7266:0.1796	.	195;218	B7ZME5;A2RUH7	.;MBPHL_HUMAN	C	218	ENSP00000349678:R218C	ENSP00000349678:R218C	R	-	1	0	MYBPHL	109641006	1.000000	0.71417	0.952000	0.39060	0.667000	0.39255	3.081000	0.50120	2.561000	0.86390	0.561000	0.74099	CGT	MYBPHL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000221986		0.567	MYBPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPHL	HGNC	protein_coding	OTTHUMT00000033197.1	124	0.00	0	G	NM_001010985		109839483	109839483	-1	no_errors	ENST00000357155	ensembl	human	known	69_37n	missense	95	11.21	12	SNP	0.994	A
LINC00303	284573	genome.wustl.edu	37	1	204006538	204006538	+	lincRNA	SNP	T	T	C	rs4951291	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr1:204006538T>C	ENST00000367207.3	-	0	482							Q3SY05	CA157_HUMAN	long intergenic non-protein coding RNA 303																		ATCACCTTCCTCTCATGCTGC	0.592													C|||	4485	0.895567	0.9917	0.951	5008	,	,		18649	0.8016		0.8728	False		,,,				2504	0.8466					dbGAP											0													22.0	41.0	32.0					1																	204006538		576	667	1243	-	-	-			0			AK097662		1q32.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000176754	ENSG00000176754		"""Long non-coding RNAs"""	26865	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 157"", ""non-protein coding RNA 303"""	C1orf157, NCRNA00303			Standard	NR_027902		Approved	FLJ40343	uc010pqo.1	Q3SY05	OTTHUMG00000036054		1.37:g.204006538T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY06|Q8N7U1	RNA	SNP	-	NULL	ENST00000367207.3	37	NULL		1																																																																																			LINC00303	-	-	ENSG00000176754		0.592	LINC00303-001	KNOWN	basic	lincRNA	LINC00303	HGNC	lincRNA	OTTHUMT00000087885.3	80	0.00	0	T	NR_027902		204006538	204006538	-1	no_errors	ENST00000367207	ensembl	human	known	69_37n	rna	38	13.64	6	SNP	0.001	C
NLGN3	54413	genome.wustl.edu	37	X	70375090	70375090	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chrX:70375090G>A	ENST00000358741.3	+	5	907	c.604G>A	c.(604-606)Gtc>Atc	p.V202I	NLGN3_ENST00000374051.3_Missense_Mutation_p.V182I|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Missense_Mutation_p.V162I	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	202					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					TGCTAAACCCGTCATGGTCTA	0.587																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0													191.0	121.0	144.0					X																	70375090		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.604G>A	X.37:g.70375090G>A	ENSP00000351591:p.Val202Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.V202I	ENST00000358741.3	37	c.604	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756938	0.89843	.	.	ENSG00000196338	ENST00000536169;ENST00000542063;ENST00000374051;ENST00000395855;ENST00000358741	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.93400	0.7895	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76071	0.983;0.987;0.941	D	0.95449	0.8532	10	0.87932	D	0	.	16.4607	0.84044	0.0:0.0:1.0:0.0	.	162;162;182	D3DVV1;B7Z5Y1;Q9NZ94-2	.;.;.	I	162;65;182;162;202	ENSP00000445298:V162I;ENSP00000363163:V182I;ENSP00000379196:V162I;ENSP00000351591:V202I	ENSP00000351591:V202I	V	+	1	0	NLGN3	70291815	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.601000	0.98297	2.054000	0.61138	0.544000	0.68410	GTC	NLGN3	-	pfam_CarbesteraseB	ENSG00000196338		0.587	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	83	0.00	0	G	NM_018977		70375090	70375090	+1	no_errors	ENST00000358741	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	71	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	1.000	A
PLA2G6	8398	genome.wustl.edu	37	22	38512402	38512402	+	Intron	SNP	G	G	A	rs11089863	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr22:38512402G>A	ENST00000332509.3	-	13	1926				PLA2G6_ENST00000402064.1_Intron|PLA2G6_ENST00000335539.3_Intron	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)						cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	CTGGAGGAGTGTCAGATTGGT	0.517													G|||	1503	0.30012	0.2073	0.3919	5008	,	,		17696	0.1438		0.3678	False		,,,				2504	0.4519					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.1743-184C>T	22.37:g.38512402G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.H135Y	ENST00000332509.3	37	c.403	CCDS13967.1	22																																																																																			PLA2G6	-	NULL	ENSG00000184381		0.517	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G6	HGNC	protein_coding	OTTHUMT00000321860.1	44	0.00	0	G	NM_001004426		38512402	38512402	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000454670	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.050	A
POLK	51426	genome.wustl.edu	37	5	74894333	74894333	+	3'UTR	SNP	G	G	C	rs5744720	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr5:74894333G>C	ENST00000241436.4	+	0	3275				CTC-366B18.2_ENST00000511329.1_RNA|POLK_ENST00000352007.5_3'UTR|POLK_ENST00000506928.1_3'UTR	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa						DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		TTTTCTTCAGGAAAATAAATA	0.234								DNA polymerases (catalytic subunits)					G|||	290	0.0579073	0.1891	0.0303	5008	,	,		15040	0.0		0.0179	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.*490G>C	5.37:g.74894333G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	RNA	SNP	-	NULL	ENST00000241436.4	37	NULL	CCDS4030.1	5																																																																																			POLK	-	-	ENSG00000122008		0.234	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLK	HGNC	protein_coding	OTTHUMT00000219945.3	22	0.00	0	G	NM_016218		74894333	74894333	+1	no_errors	ENST00000506928	ensembl	human	known	69_37n	rna	33	17.50	7	SNP	0.859	C
SDHAP1	255812	genome.wustl.edu	37	3	195692347	195692347	+	RNA	SNP	G	G	A	rs62282794		TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr3:195692347G>A	ENST00000427841.1	-	0	2155					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		TTCCTCCAGTGCTCCTCAAAG	0.572																																					Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195692347G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.572	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	59	0.00	0	G			195692347	195692347	-1	no_errors	ENST00000354559	ensembl	human	known	69_37n	rna	53	11.67	7	SNP	1.000	A
SKIV2L	6499	genome.wustl.edu	37	6	31928496	31928496	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr6:31928496G>T	ENST00000375394.2	+	6	636	c.523G>T	c.(523-525)Gag>Tag	p.E175*	NELFE_ENST00000444811.2_5'Flank|NELFE_ENST00000375429.3_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|NELFE_ENST00000375425.5_5'Flank|SKIV2L_ENST00000544581.1_Intron	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	175					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GGAGGCTGAGGAGGAGATAGA	0.542																																						dbGAP											0													113.0	113.0	113.0					6																	31928496		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.523G>T	6.37:g.31928496G>T	ENSP00000364543:p.Glu175*	Somatic		WXS	Illumina GAIIx	Phase_IV	O15005|Q12902|Q15476|Q5ST66	Nonsense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E175*	ENST00000375394.2	37	c.523	CCDS4731.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.582582	0.97680	.	.	ENSG00000204351	ENST00000375394;ENST00000433155	.	.	.	5.14	5.14	0.70334	.	0.187159	0.44097	D	0.000499	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-25.6553	17.398	0.87451	0.0:0.0:1.0:0.0	.	.	.	.	X	175;17	.	ENSP00000364543:E175X	E	+	1	0	SKIV2L	32036475	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.101000	0.71479	2.412000	0.81896	0.655000	0.94253	GAG	SKIV2L	-	pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000204351		0.542	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	HGNC	protein_coding	OTTHUMT00000076264.3	29	0.00	0	G			31928496	31928496	+1	no_errors	ENST00000375394	ensembl	human	known	69_37n	nonsense	35	10.26	4	SNP	1.000	T
TAS2R43	259289	genome.wustl.edu	37	12	11244166	11244166	+	Silent	SNP	G	G	C	rs35720106	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr12:11244166G>C	ENST00000531678.1	-	1	746	c.663C>G	c.(661-663)acC>acG	p.T221T	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	221					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.T221T(1)		endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TGTGGACCTTGGTGCTGGGAT	0.398													.|||	3199	0.638778	0.1218	0.7205	5008	,	,		13366	0.9405		0.7793	False		,,,				2504	0.8241					dbGAP											1	Substitution - coding silent(1)	prostate(1)											130.0	112.0	118.0					12																	11244166		2176	4249	6425	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.663C>G	12.37:g.11244166G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.T221	ENST00000531678.1	37	c.663	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	18	0.00	0	G	NM_176884		11244166	11244166	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	19	24.00	6	SNP	0.185	C
TLR1	7096	genome.wustl.edu	37	4	38798935	38798935	+	Silent	SNP	C	C	T	rs5743614	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr4:38798935C>T	ENST00000502213.2	-	3	1747	c.1518G>A	c.(1516-1518)tcG>tcA	p.S506S	TLR1_ENST00000510552.1_5'Flank|TLR1_ENST00000308979.2_Silent_p.S506S			Q15399	TLR1_HUMAN	toll-like receptor 1	506					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						AGAAATCAGCCGATGGGTGGG	0.418													c|||	2802	0.559505	0.8404	0.4654	5008	,	,		18263	0.5992		0.2744	False		,,,				2504	0.499				GBM(5;216 373 40795 46382)	dbGAP											0													75.0	79.0	78.0					4																	38798935		2202	4280	6482	-	-	-	SO:0001819	synonymous_variant	0			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1518G>A	4.37:g.38798935C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Silent	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom	p.S506	ENST00000502213.2	37	c.1518	CCDS33973.1	4																																																																																			TLR1	-	pirsf_Toll-like_receptor	ENSG00000174125		0.418	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	HGNC	protein_coding	OTTHUMT00000360510.3	120	0.00	0	C			38798935	38798935	-1	no_errors	ENST00000308979	ensembl	human	known	69_37n	silent	126	10.00	14	SNP	0.002	T
TMEM53	79639	genome.wustl.edu	37	1	45119965	45119965	+	3'UTR	SNP	C	C	T	rs3444	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr1:45119965C>T	ENST00000372237.3	-	0	1263				TMEM53_ENST00000476724.1_5'UTR|TMEM53_ENST00000372244.3_Intron|TMEM53_ENST00000372243.3_Intron|TMEM53_ENST00000372242.3_Intron	NM_024587.2	NP_078863.2	Q6P2H8	TMM53_HUMAN	transmembrane protein 53							integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(3)|ovary(2)|urinary_tract(1)	10	Acute lymphoblastic leukemia(166;0.155)					AGCAGCCTGACTGTTGCACTT	0.512													c|||	915	0.182708	0.0227	0.2421	5008	,	,		16984	0.0665		0.33	False		,,,				2504	0.3252					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS511.1, CCDS72773.1	1p34.1	2008-02-26			ENSG00000126106	ENSG00000126106			26186	protein-coding gene	gene with protein product						12958361	Standard	XR_425151		Approved	FLJ22353, NET4	uc001cmc.3	Q6P2H8	OTTHUMG00000007833	ENST00000372237.3:c.*266G>A	1.37:g.45119965C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG0|Q5JPH2|Q6IA07|Q9H6E2	RNA	SNP	-	NULL	ENST00000372237.3	37	NULL	CCDS511.1	1																																																																																			TMEM53	-	-	ENSG00000126106		0.512	TMEM53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM53	HGNC	protein_coding	OTTHUMT00000021599.1	10	0.00	0	C	NM_024587		45119965	45119965	-1	no_errors	ENST00000468117	ensembl	human	known	69_37n	rna	9	30.77	4	SNP	0.000	T
TPM2	7169	genome.wustl.edu	37	9	35689839	35689839	+	5'UTR	SNP	C	C	T			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr9:35689839C>T	ENST00000360958.2	-	0	80				TPM2_ENST00000378292.3_5'UTR|TPM2_ENST00000329305.2_5'UTR|TPM2_ENST00000378300.5_5'UTR	NM_003289.3	NP_003280.2	P07951	TPM2_HUMAN	tropomyosin 2 (beta)						muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)	cytosol (GO:0005829)|muscle thin filament tropomyosin (GO:0005862)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GTGGGCCGGCCGGCAGGCGGT	0.706																																						dbGAP											0													84.0	87.0	86.0					9																	35689839		2202	4299	6501	-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS6586.1, CCDS6587.1	9p13	2014-09-17	2003-12-02		ENSG00000198467	ENSG00000198467		"""Tropomyosins"""	12011	protein-coding gene	gene with protein product	"""nemaline myopathy type 4"""	190990	"""arthrogryposis multiplex congenital, distal, type 1"""	AMCD1		7606936	Standard	NM_003289		Approved	DA1, NEM4	uc003zxq.3	P07951	OTTHUMG00000019878	ENST00000360958.2:c.-25G>A	9.37:g.35689839C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM85|P06468|Q13894|Q53FM4|Q5TCU4|Q5TCU7|Q9UH67	RNA	SNP	-	NULL	ENST00000360958.2	37	NULL	CCDS6587.1	9																																																																																			TPM2	-	-	ENSG00000198467		0.706	TPM2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM2	HGNC	protein_coding	OTTHUMT00000052376.1	129	0.00	0	C	NM_003289		35689839	35689839	-1	no_errors	ENST00000471212	ensembl	human	known	69_37n	rna	87	11.22	11	SNP	0.000	T
TRDMT1	1787	genome.wustl.edu	37	10	17194026	17194026	+	Intron	SNP	A	A	G	rs17139991	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr10:17194026A>G	ENST00000377799.3	-	10	1123				TRDMT1_ENST00000457442.2_Intron|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000358282.7_Intron|TRDMT1_ENST00000377766.5_Intron|TRDMT1_ENST00000412821.3_Intron|TRDMT1_ENST00000351358.4_Intron	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1						C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	AGCACTGAAGAAAAGCTGAGG	0.348													A|||	583	0.116414	0.1014	0.2205	5008	,	,		17040	0.0387		0.1521	False		,,,				2504	0.1063					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.1075+1479T>C	10.37:g.17194026A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	RNA	SNP	-	NULL	ENST00000377799.3	37	NULL	CCDS7114.1	10																																																																																			TRDMT1	-	-	ENSG00000107614		0.348	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRDMT1	HGNC	protein_coding	OTTHUMT00000047024.3	57	0.00	0	A	NM_004412		17194026	17194026	-1	no_errors	ENST00000452380	ensembl	human	known	69_37n	rna	46	14.81	8	SNP	0.001	G
UAP1	6675	genome.wustl.edu	37	1	162557578	162557578	+	Intron	SNP	C	C	T	rs41271987	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr1:162557578C>T	ENST00000367925.1	+	5	1060				UAP1_ENST00000271469.3_Intron|UAP1_ENST00000367924.1_Intron|UAP1_ENST00000367926.4_Intron			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)			breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TCCTGAGGATCACTTATCAAA	0.378													C|||	370	0.0738818	0.0408	0.1052	5008	,	,		18331	0.0		0.1451	False		,,,				2504	0.0992					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.1028+120C>T	1.37:g.162557578C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	RNA	SNP	-	NULL	ENST00000367925.1	37	NULL		1																																																																																			UAP1	-	-	ENSG00000117143		0.378	UAP1-002	KNOWN	basic	protein_coding	UAP1	HGNC	protein_coding	OTTHUMT00000083203.1	11	0.00	0	C	NM_003115		162557578	162557578	+1	no_errors	ENST00000474728	ensembl	human	known	69_37n	rna	20	20.00	5	SNP	0.000	T
ULK1	8408	genome.wustl.edu	37	12	132399950	132399950	+	Silent	SNP	C	C	T			TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr12:132399950C>T	ENST00000321867.4	+	18	1944	c.1593C>T	c.(1591-1593)ggC>ggT	p.G531G	ULK1_ENST00000540647.1_5'Flank	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	531					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		TGCGGGGTGGCAGGTCCCCTC	0.647																																						dbGAP											0													29.0	35.0	33.0					12																	132399950		2199	4299	6498	-	-	-	SO:0001819	synonymous_variant	0			AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.1593C>T	12.37:g.132399950C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQ28	Missense_Mutation	SNP	NULL	p.A46V	ENST00000321867.4	37	c.137	CCDS9274.1	12	.	.	.	.	.	.	.	.	.	.	C	10.02	1.237472	0.22711	.	.	ENSG00000177169	ENST00000538444	.	.	.	4.08	2.18	0.27775	.	.	.	.	.	T	0.62539	0.2436	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61797	-0.6989	5	0.87932	D	0	-21.3316	6.9889	0.24743	0.1995:0.6078:0.1927:0.0	.	.	.	.	V	46	.	ENSP00000439648:A46V	A	+	2	0	ULK1	130965903	1.000000	0.71417	0.898000	0.35279	0.259000	0.26198	1.967000	0.40491	0.464000	0.27142	0.462000	0.41574	GCA	ULK1	-	NULL	ENSG00000177169		0.647	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK1	HGNC	protein_coding	OTTHUMT00000397769.3	57	0.00	0	C			132399950	132399950	+1	no_errors	ENST00000538444	ensembl	human	putative	69_37n	missense	36	16.28	7	SNP	0.999	T
ZNF417	147687	genome.wustl.edu	37	19	58420699	58420699	+	Missense_Mutation	SNP	C	C	A	rs3745133	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr19:58420699C>A	ENST00000312026.5	-	3	1111	c.947G>T	c.(946-948)cGt>cTt	p.R316L	ZNF417_ENST00000536263.1_Missense_Mutation_p.R117L|ZNF417_ENST00000595559.1_Missense_Mutation_p.R315L|CTD-2583A14.9_ENST00000602124.1_Intron	NM_152475.2	NP_689688.2	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	316				R -> L (in Ref. 3; AAH25783). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R316L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|stomach(3)|upper_aerodigestive_tract(1)	18		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		AGTGTGAACACGCTGATGGCT	0.458													C|||	1690	0.33746	0.4153	0.2911	5008	,	,		25205	0.2817		0.3499	False		,,,				2504	0.3098					dbGAP											1	Substitution - Missense(1)	stomach(1)											167.0	147.0	154.0					19																	58420699		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025783	CCDS12965.1, CCDS74469.1	19q13.43	2013-01-08				ENSG00000173480		"""Zinc fingers, C2H2-type"", ""-"""	20646	protein-coding gene	gene with protein product							Standard	NM_152475		Approved	MGC34079	uc002qqq.3	Q8TAU3		ENST00000312026.5:c.947G>T	19.37:g.58420699C>A	ENSP00000311319:p.Arg316Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEU1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R316L	ENST00000312026.5	37	c.947	CCDS12965.1	19	645	0.29532967032967034	167	0.3394308943089431	107	0.2955801104972376	118	0.2062937062937063	253	0.3337730870712401	.	8.577	0.881369	0.17467	.	.	ENSG00000173480	ENST00000312026;ENST00000536263	T;T	0.25085	1.82;1.82	2.15	-2.01	0.07410	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	L	0.60012	1.86	0.80722	P	0.0	P	0.38335	0.627	B	0.36922	0.236	T	0.32981	-0.9886	8	0.66056	D	0.02	.	7.8865	0.29653	0.0:0.6777:0.0:0.3223	rs3745133;rs17856732	316	Q8TAU3	ZN417_HUMAN	L	316;117	ENSP00000311319:R316L;ENSP00000442760:R117L	ENSP00000311319:R316L	R	-	2	0	ZNF417	63112511	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-2.414000	0.01037	-0.691000	0.05135	-1.050000	0.02344	CGT	ZNF417	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173480		0.458	ZNF417-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF417	HGNC	protein_coding	OTTHUMT00000466860.1	194	0.00	0	C	NM_152475		58420699	58420699	-1	no_errors	ENST00000312026	ensembl	human	known	69_37n	missense	175	10.20	20	SNP	0.000	A
ZNF518A	9849	genome.wustl.edu	37	10	97922999	97922999	+	RNA	SNP	T	T	A	rs3748226	byFrequency	TCGA-A2-A4RY-01A-31D-A25Q-09	TCGA-A2-A4RY-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4c400e78-37d6-45e8-a080-08edaa1fd748	89b85d2b-73e8-4256-96f0-0cd90ad601de	g.chr10:97922999T>A	ENST00000534948.1	+	0	7775							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TAAGTTATTCTGAGGGAGGCA	0.358													T|||	1841	0.367612	0.1248	0.3184	5008	,	,		17594	0.6835		0.3419	False		,,,				2504	0.4315					dbGAP											0																																										-	-	-			0			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97922999T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJI5|O15044|Q32MP4	RNA	SNP	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			ZNF518A	-	-	ENSG00000177853		0.358	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		51	0.00	0	T	NM_014803		97922999	97922999	+1	no_errors	ENST00000534948	ensembl	human	known	69_37n	rna	50	12.28	7	SNP	0.008	A
