#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AHNAK	79026	genome.wustl.edu	37	11	62294600	62294600	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr11:62294600T>G	ENST00000378024.4	-	5	7563	c.7289A>C	c.(7288-7290)gAg>gCg	p.E2430A	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2430					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTCTGGTCCCTCAATGTCAAT	0.463																																						dbGAP											0													84.0	82.0	83.0					11																	62294600		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7289A>C	11.37:g.62294600T>G	ENSP00000367263:p.Glu2430Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E2430A	ENST00000378024.4	37	c.7289	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	t	13.15	2.152149	0.38021	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.01665	4.7	4.15	4.15	0.48705	.	.	.	.	.	T	0.06690	0.0171	H	0.97415	4	0.36221	D	0.851984	P	0.41131	0.739	B	0.36464	0.225	T	0.30060	-0.9991	9	0.25751	T	0.34	-1.1476	12.8759	0.57989	0.0:0.0:0.0:1.0	.	2430	Q09666	AHNK_HUMAN	A	519;2430	ENSP00000367263:E2430A	ENSP00000244934:E519A	E	-	2	0	AHNAK	62051176	0.016000	0.18221	0.463000	0.27130	0.851000	0.48451	1.650000	0.37292	1.524000	0.49035	0.392000	0.25879	GAG	AHNAK	-	NULL	ENSG00000124942		0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	106	0.00	0	T	NM_024060		62294600	62294600	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	89	25.83	31	SNP	0.998	G
AIM1	202	genome.wustl.edu	37	6	106967352	106967352	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr6:106967352G>A	ENST00000369066.3	+	2	1532	c.1045G>A	c.(1045-1047)Gaa>Aaa	p.E349K		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TACCGTCTCGGAAGAAGAGAT	0.438																																						dbGAP											0													81.0	89.0	86.0					6																	106967352		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1045G>A	6.37:g.106967352G>A	ENSP00000358062:p.Glu349Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E349K	ENST00000369066.3	37	c.1045	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667485	0.47677	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.73897	-0.79	5.93	3.17	0.36434	.	0.636004	0.13924	N	0.353383	T	0.38081	0.1027	L	0.47716	1.5	0.19575	N	0.999966	B	0.13145	0.007	B	0.09377	0.004	T	0.33752	-0.9856	10	0.02654	T	1	.	9.6891	0.40116	0.2677:0.0:0.7323:0.0	.	349	Q9Y4K1	AIM1_HUMAN	K	757;349	ENSP00000358062:E349K	ENSP00000285105:E757K	E	+	1	0	AIM1	107074045	0.002000	0.14202	0.005000	0.12908	0.060000	0.15804	0.849000	0.27723	0.394000	0.25230	0.655000	0.94253	GAA	AIM1	-	NULL	ENSG00000112297		0.438	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	31	0.00	0	G			106967352	106967352	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	15	16.67	3	SNP	0.003	A
ANKRD28	23243	genome.wustl.edu	37	3	15736712	15736712	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr3:15736712C>T	ENST00000399451.2	-	16	1946	c.1579G>A	c.(1579-1581)Gaa>Aaa	p.E527K	ANKRD28_ENST00000383777.1_Missense_Mutation_p.E560K|ANKRD28_ENST00000497037.1_5'UTR|MIR3134_ENST00000579433.1_RNA	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	527						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						AGAGGAGTTTCACTTGCAATC	0.333																																						dbGAP											0													63.0	58.0	60.0					3																	15736712		1835	4084	5919	-	-	-	SO:0001583	missense	0			AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.1579G>A	3.37:g.15736712C>T	ENSP00000382379:p.Glu527Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E560K	ENST00000399451.2	37	c.1678	CCDS46769.1	3	.	.	.	.	.	.	.	.	.	.	C	15.46	2.841522	0.51057	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.63580	1.37;-0.05;1.37	6.07	6.07	0.98685	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.47820	0.1466	N	0.17474	0.49	0.80722	D	1	B;B;B	0.10296	0.001;0.003;0.0	B;B;B	0.11329	0.006;0.006;0.002	T	0.45498	-0.9257	10	0.08179	T	0.78	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	560;557;527	O15084-1;O15084-4;O15084	.;.;ANR28_HUMAN	K	527;560;527	ENSP00000382379:E527K;ENSP00000373287:E560K;ENSP00000397341:E527K	ENSP00000373287:E560K	E	-	1	0	ANKRD28	15711716	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	GAA	ANKRD28	-	smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000206560		0.333	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ANKRD28	HGNC	protein_coding	OTTHUMT00000339758.1	37	0.00	0	C	NM_015199		15736712	15736712	-1	no_errors	ENST00000383777	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	1.000	T
BCL9L	283149	genome.wustl.edu	37	11	118779095	118779095	+	Missense_Mutation	SNP	G	G	A	rs200863037		TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr11:118779095G>A	ENST00000334801.3	-	2	1260	c.296C>T	c.(295-297)gCa>gTa	p.A99V	BCL9L_ENST00000526143.1_5'UTR|MIR4492_ENST00000581627.1_RNA	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	99					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GGGCACCCCTGCCTGGGGGTT	0.647													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15754	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													75.0	71.0	72.0					11																	118779095		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.296C>T	11.37:g.118779095G>A	ENSP00000335320:p.Ala99Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.A99V	ENST00000334801.3	37	c.296	CCDS8403.1	11	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	18.75	3.689839	0.68271	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000392849;ENST00000431085;ENST00000532899	T;T	0.66099	-0.19;-0.19	5.5	3.5	0.40072	.	0.787332	0.11123	N	0.597183	T	0.48333	0.1494	N	0.22421	0.69	0.20074	N	0.999933	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.44159	-0.9346	10	0.66056	D	0.02	-0.1208	10.057	0.42250	0.0:0.1224:0.6558:0.2217	.	94;99	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	V	99;62;99;99;99	ENSP00000335320:A99V;ENSP00000432804:A99V	ENSP00000335320:A99V	A	-	2	0	BCL9L	118284305	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.213000	0.58520	1.301000	0.44836	0.561000	0.74099	GCA	BCL9L	-	NULL	ENSG00000186174		0.647	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1	63	0.00	0	G	NM_182557		118779095	118779095	-1	no_errors	ENST00000334801	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.985	A
C2orf82	389084	genome.wustl.edu	37	2	233740258	233740258	+	Intron	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr2:233740258G>A	ENST00000409230.1	+	3	320				C2orf82_ENST00000409533.1_Intron|C2orf82_ENST00000331342.2_Intron			Q6UX34	CB082_HUMAN	chromosome 2 open reading frame 82							cell periphery (GO:0071944)|integral component of membrane (GO:0016021)											ACTGGGGTGGGCTGGCTGGTG	0.602																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY358535, BC035093	CCDS2499.1	2q37.1	2013-10-11			ENSG00000182600	ENSG00000182600			33763	protein-coding gene	gene with protein product						12975309	Standard	NM_206895		Approved	UNQ830, ASCL830	uc002vtr.1	Q6UX34	OTTHUMG00000133273	ENST00000409230.1:c.74-392G>A	2.37:g.233740258G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A41T	ENST00000409230.1	37	c.121	CCDS2499.1	2	.	.	.	.	.	.	.	.	.	.	G	2.865	-0.235332	0.05983	.	.	ENSG00000182600	ENST00000449331	.	.	.	1.52	0.553	0.17235	.	.	.	.	.	T	0.24470	0.0593	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24728	-1.0152	4	.	.	.	.	4.8569	0.13564	0.0:0.0:0.6413:0.3587	.	.	.	.	T	41	.	.	A	+	1	0	C2orf82	233448502	0.000000	0.05858	0.002000	0.10522	0.034000	0.12701	0.118000	0.15605	0.194000	0.20326	0.448000	0.29417	GCT	C2orf82	-	NULL	ENSG00000182600		0.602	C2orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf82	HGNC	protein_coding	OTTHUMT00000257052.2	35	0.00	0	G	NM_206895		233740258	233740258	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000449331	ensembl	human	putative	69_37n	missense	25	32.43	12	SNP	0.001	A
CD163L1	283316	genome.wustl.edu	37	12	7559399	7559399	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr12:7559399C>T	ENST00000313599.3	-	5	873	c.816G>A	c.(814-816)atG>atA	p.M272I	CD163L1_ENST00000416109.2_Missense_Mutation_p.M282I|CD163L1_ENST00000396630.1_Missense_Mutation_p.M272I			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	272	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CTACTCTCCCCATACAGCGGT	0.458																																						dbGAP											0													227.0	199.0	208.0					12																	7559399		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.816G>A	12.37:g.7559399C>T	ENSP00000315945:p.Met272Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.M272I	ENST00000313599.3	37	c.816	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	C	9.796	1.179167	0.21787	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.34667	1.35;1.35;1.35	1.67	-3.31	0.04988	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.16085	0.0387	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17776	-1.0358	9	0.59425	D	0.04	.	0.6732	0.00862	0.1823:0.2033:0.1812:0.4332	.	282;272	E7EVK4;Q9NR16	.;C163B_HUMAN	I	272;282;272	ENSP00000315945:M272I;ENSP00000393474:M282I;ENSP00000379871:M272I	ENSP00000315945:M272I	M	-	3	0	CD163L1	7450666	0.000000	0.05858	0.001000	0.08648	0.634000	0.38068	-7.361000	0.00038	-1.145000	0.02858	0.460000	0.39030	ATG	CD163L1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000177675		0.458	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	29	0.00	0	C	NM_174941		7559399	7559399	-1	no_errors	ENST00000313599	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.014	T
CDH1	999	genome.wustl.edu	37	16	68867258	68867258	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr16:68867258T>A	ENST00000261769.5	+	16	2696	c.2505T>A	c.(2503-2505)taT>taA	p.Y835*	CDH1_ENST00000422392.2_Nonsense_Mutation_p.Y774*|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	835	Required for binding alpha, beta and gamma catenins.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGTTTGACTATGAAGGAAGCG	0.483			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													91.0	89.0	90.0					16																	68867258		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2505T>A	16.37:g.68867258T>A	ENSP00000261769:p.Tyr835*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y835*	ENST00000261769.5	37	c.2505	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	T	37	6.216058	0.97385	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000422392	.	.	.	6.04	-3.31	0.04988	.	0.000000	0.46442	D	0.000300	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6305	0.85032	0.0:0.6579:0.0:0.3421	.	.	.	.	X	835;853;774	.	ENSP00000261769:Y835X	Y	+	3	2	CDH1	67424759	0.011000	0.17503	0.951000	0.38953	0.972000	0.66771	-1.009000	0.03660	-0.921000	0.03794	0.460000	0.39030	TAT	CDH1	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000039068		0.483	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	83	0.00	0	T	NM_004360		68867258	68867258	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	28	49.09	27	SNP	0.988	A
CHD4	1108	genome.wustl.edu	37	12	6710219	6710219	+	Splice_Site	SNP	C	C	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr12:6710219C>A	ENST00000357008.2	-	7	963	c.800G>T	c.(799-801)gGt>gTt	p.G267V	CHD4_ENST00000544040.1_Splice_Site_p.G260V|CHD4_ENST00000544484.1_Splice_Site_p.G264V|CHD4_ENST00000309577.6_Splice_Site_p.G267V	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	267					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						AGCATTGGGACCTAAAATCAG	0.463																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													144.0	149.0	148.0					12																	6710219		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.800-1G>T	12.37:g.6710219C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G267V	ENST00000357008.2	37	c.800	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924423	0.92319	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90444	-2.65;-2.67;-2.65;-2.67;0.48	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.95579	0.8563	M	0.82323	2.585	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.846	D;D;P	0.97110	1.0;1.0;0.623	D	0.96067	0.9043	10	0.72032	D	0.01	.	17.9991	0.89193	0.0:1.0:0.0:0.0	.	267;267;260	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	V	264;260;267;267;241;267	ENSP00000440392:G264V;ENSP00000440542:G260V;ENSP00000312419:G267V;ENSP00000349508:G267V;ENSP00000437506:G267V	ENSP00000312419:G267V	G	-	2	0	CHD4	6580480	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.401000	0.79962	2.530000	0.85305	0.555000	0.69702	GGT	CHD4	-	NULL	ENSG00000111642		0.463	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		61	0.00	0	C	NM_001273	Missense_Mutation	6710219	6710219	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	39	35.00	21	SNP	1.000	A
CLK2	1196	genome.wustl.edu	37	1	155233769	155233769	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr1:155233769T>C	ENST00000368361.4	-	12	1604	c.1289A>G	c.(1288-1290)tAt>tGt	p.Y430C	SCAMP3_ENST00000302631.3_5'Flank|CLK2_ENST00000536801.1_Missense_Mutation_p.Y430C|CLK2_ENST00000355560.4_Missense_Mutation_p.Y428C|CLK2_ENST00000361168.5_Missense_Mutation_p.Y429C|CLK2_ENST00000497188.1_5'UTR|SCAMP3_ENST00000355379.3_5'Flank			P49760	CLK2_HUMAN	CDC-like kinase 2	430	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTCACGAACATAGCGCCCAGC	0.542								Other conserved DNA damage response genes																														dbGAP											0													90.0	97.0	94.0					1																	155233769		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.1289A>G	1.37:g.155233769T>C	ENSP00000357345:p.Tyr430Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y430C	ENST00000368361.4	37	c.1289		1	.	.	.	.	.	.	.	.	.	.	.	20.2	3.958100	0.73902	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000424156;ENST00000536801	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	4.2	4.2	0.49525	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	M	0.70787	2.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.21484	-1.0244	10	0.87932	D	0	.	12.4977	0.55937	0.0:0.0:0.0:1.0	.	430;429	P49760;P49760-3	CLK2_HUMAN;.	C	429;430;428;202;430	ENSP00000354856:Y429C;ENSP00000357345:Y430C;ENSP00000347759:Y428C;ENSP00000441023:Y430C	ENSP00000347759:Y428C	Y	-	2	0	CLK2	153500393	1.000000	0.71417	0.980000	0.43619	0.977000	0.68977	7.825000	0.86693	1.891000	0.54761	0.459000	0.35465	TAT	CLK2	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000176444		0.542	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CLK2	HGNC	protein_coding	OTTHUMT00000087391.1	54	0.00	0	T	NM_003993		155233769	155233769	-1	no_errors	ENST00000368361	ensembl	human	known	69_37n	missense	31	53.03	35	SNP	1.000	C
CPAMD8	27151	genome.wustl.edu	37	19	17062885	17062885	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr19:17062885G>T	ENST00000443236.1	-	20	2574	c.2543C>A	c.(2542-2544)aCc>aAc	p.T848N		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	801						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGGCTTGAAGGTCTTCAGCAG	0.612																																						dbGAP											0													32.0	34.0	34.0					19																	17062885		2030	4174	6204	-	-	-	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2543C>A	19.37:g.17062885G>T	ENSP00000402505:p.Thr848Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.T848N	ENST00000443236.1	37	c.2543	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.38|18.38	3.611923|3.611923	0.66558|0.66558	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	D|.	0.86694|.	-2.16|.	3.14|3.14	2.09|2.09	0.27110|0.27110	.|Alpha-2-macroglobulin (1);	.|0.000000	.|0.64402	.|U	.|0.000001	T|T	0.77525|0.77525	0.4143|0.4143	M|M	0.87097|0.87097	2.86|2.86	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.65874	.|0.939	T|T	0.78440|0.78440	-0.2203|-0.2203	6|9	.|0.66056	.|D	.|0.02	.|.	10.1571|10.1571	0.42829|0.42829	0.1013:0.0:0.8987:0.0|0.1013:0.0:0.8987:0.0	.|.	.|801	.|Q8IZJ3	.|CPMD8_HUMAN	T|N	859|848	ENSP00000402505:P859T|.	.|ENSP00000291440:T848N	P|T	-|-	1|2	0|0	CPAMD8|CPAMD8	16923885|16923885	1.000000|1.000000	0.71417|0.71417	0.947000|0.947000	0.38551|0.38551	0.904000|0.904000	0.53231|0.53231	7.905000|7.905000	0.87416|0.87416	0.451000|0.451000	0.26802|0.26802	0.491000|0.491000	0.48974|0.48974	CCT|ACC	CPAMD8	-	pfam_Macroglobln_a2	ENSG00000160111		0.612	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	54	0.00	0	G	NM_015692		17062885	17062885	-1	no_errors	ENST00000291440	ensembl	human	known	69_37n	missense	37	25.49	13	SNP	1.000	T
WASH3P	374666	genome.wustl.edu	37	15	102516922	102516922	+	RNA	SNP	A	A	C			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr15:102516922A>C	ENST00000557932.1	+	0	1679				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						AGAGAAGGGCAGTCAGCAGGG	0.562																																						dbGAP											0																																										-	-	-			0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516922A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			DDX11L9	-	-	ENSG00000248472		0.562	WASH3P-001	KNOWN	basic	processed_transcript	DDX11L9	HGNC	pseudogene	OTTHUMT00000417608.1	10	0.00	0	A	NM_199163		102516922	102516922	-1	no_errors	ENST00000559159	ensembl	human	known	69_37n	rna	8	33.33	4	SNP	0.002	C
DOCK7	85440	genome.wustl.edu	37	1	63090858	63090858	+	Intron	SNP	C	C	T	rs6587980	byFrequency	TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr1:63090858C>T	ENST00000340370.5	-	12	1443				DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						ATAGTACAATCACTACCTTTC	0.289													T|||	2055	0.410343	0.6044	0.379	5008	,	,		14685	0.2321		0.3052	False		,,,				2504	0.4622					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.1425+71G>A	1.37:g.63090858C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	RNA	SNP	-	NULL	ENST00000340370.5	37	NULL	CCDS30734.1	1																																																																																			DOCK7	-	-	ENSG00000116641		0.289	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	43	0.00	0	C	NM_033407		63090858	63090858	-1	no_errors	ENST00000464312	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.000	T
EFR3B	22979	genome.wustl.edu	37	2	25366673	25366673	+	Silent	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr2:25366673G>A	ENST00000403714.3	+	18	2175	c.1992G>A	c.(1990-1992)ctG>ctA	p.L664L	EFR3B_ENST00000402191.1_Silent_p.L629L|EFR3B_ENST00000405108.1_Silent_p.L516L|EFR3B_ENST00000401432.3_Silent_p.L664L	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	664										endometrium(1)	1						GTGAAGTCCTGGGAGGCAGTG	0.557																																						dbGAP											0													106.0	91.0	95.0					2																	25366673		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.1992G>A	2.37:g.25366673G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPL8|Q86XU6	Silent	SNP	superfamily_ARM-type_fold	p.L664	ENST00000403714.3	37	c.1992	CCDS46231.1	2																																																																																			EFR3B	-	NULL	ENSG00000084710		0.557	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFR3B	HGNC	protein_coding	OTTHUMT00000324808.1	103	0.00	0	G	NM_014971		25366673	25366673	+1	no_errors	ENST00000403714	ensembl	human	known	69_37n	silent	45	25.00	15	SNP	0.999	A
ENPP4	22875	genome.wustl.edu	37	6	46108830	46108830	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr6:46108830C>T	ENST00000321037.4	+	3	1098	c.868C>T	c.(868-870)Cat>Tat	p.H290Y		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	290					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						CTGTAGCCCTCATATGAATGT	0.328																																						dbGAP											0													57.0	56.0	56.0					6																	46108830		2202	4297	6499	-	-	-	SO:0001583	missense	0			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.868C>T	6.37:g.46108830C>T	ENSP00000318066:p.His290Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5G1|Q7L2N1	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.H290Y	ENST00000321037.4	37	c.868	CCDS34468.1	6	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356942	0.61293	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	T	0.75477	-0.94	6.1	4.18	0.49190	Alkaline-phosphatase-like, core domain (1);	0.130591	0.64402	D	0.000001	T	0.79040	0.4379	M	0.76170	2.325	0.49798	D	0.999822	D	0.58970	0.984	P	0.59595	0.86	T	0.81387	-0.0956	10	0.51188	T	0.08	-10.7599	14.8135	0.70013	0.28:0.72:0.0:0.0	.	290	Q9Y6X5	ENPP4_HUMAN	Y	290	ENSP00000318066:H290Y	ENSP00000318066:H290Y	H	+	1	0	ENPP4	46216789	0.245000	0.23899	0.993000	0.49108	0.577000	0.36160	0.956000	0.29202	1.522000	0.49001	0.650000	0.86243	CAT	ENPP4	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000001561		0.328	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP4	HGNC	protein_coding	OTTHUMT00000040777.2	33	0.00	0	C			46108830	46108830	+1	no_errors	ENST00000321037	ensembl	human	known	69_37n	missense	35	27.08	13	SNP	0.996	T
FAM47A	158724	genome.wustl.edu	37	X	34149179	34149179	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chrX:34149179G>T	ENST00000346193.3	-	1	1268	c.1217C>A	c.(1216-1218)aCt>aAt	p.T406N		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	406										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GCACACTCCAGTCTTGGGAGG	0.567																																						dbGAP											0													46.0	45.0	45.0					X																	34149179		2200	4298	6498	-	-	-	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1217C>A	X.37:g.34149179G>T	ENSP00000345029:p.Thr406Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.T406N	ENST00000346193.3	37	c.1217	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	g	11.40	1.627944	0.28978	.	.	ENSG00000185448	ENST00000346193	T	0.19105	2.17	0.226	0.226	0.15353	.	.	.	.	.	T	0.18383	0.0441	L	0.52573	1.65	0.09310	N	1	D	0.53151	0.958	P	0.44990	0.466	T	0.20538	-1.0272	8	0.18710	T	0.47	.	.	.	.	.	406	Q5JRC9	FA47A_HUMAN	N	406	ENSP00000345029:T406N	ENSP00000345029:T406N	T	-	2	0	FAM47A	34059100	0.039000	0.19947	0.001000	0.08648	0.001000	0.01503	0.025000	0.13577	0.283000	0.22279	0.287000	0.19450	ACT	FAM47A	-	NULL	ENSG00000185448		0.567	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	107	0.00	0	G	NM_203408		34149179	34149179	-1	no_errors	ENST00000346193	ensembl	human	known	69_37n	missense	117	28.22	46	SNP	0.048	T
FLG	2312	genome.wustl.edu	37	1	152283148	152283148	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr1:152283148G>T	ENST00000368799.1	-	3	4249	c.4214C>A	c.(4213-4215)tCa>tAa	p.S1405*	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1405	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTGTGTCTGAGTCTTCTGA	0.567									Ichthyosis																													dbGAP											0													286.0	276.0	279.0					1																	152283148		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4214C>A	1.37:g.152283148G>T	ENSP00000357789:p.Ser1405*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S1405*	ENST00000368799.1	37	c.4214	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.911835	0.98557	.	.	ENSG00000143631	ENST00000368799	.	.	.	3.25	3.25	0.37280	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3249	0.43787	0.0:0.0:1.0:0.0	.	.	.	.	X	1405	.	ENSP00000357789:S1405X	S	-	2	0	FLG	150549772	0.004000	0.15560	0.027000	0.17364	0.029000	0.11900	1.400000	0.34577	2.151000	0.67156	0.556000	0.70494	TCA	FLG	-	NULL	ENSG00000143631		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	254	0.00	0	G	NM_002016		152283148	152283148	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	nonsense	316	14.36	53	SNP	0.029	T
FLAD1	80308	genome.wustl.edu	37	1	154956253	154956253	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr1:154956253G>C	ENST00000292180.3	+	1	405	c.83G>C	c.(82-84)aGg>aCg	p.R28T	FLAD1_ENST00000368433.1_Missense_Mutation_p.R28T|FLAD1_ENST00000315144.10_Intron|FLAD1_ENST00000487371.1_Intron|FLAD1_ENST00000368431.3_Intron|FLAD1_ENST00000368432.1_Intron	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	28					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GAGAAGACTAGGGTCTTCCTC	0.527																																						dbGAP											0													101.0	100.0	100.0					1																	154956253		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.83G>C	1.37:g.154956253G>C	ENSP00000292180:p.Arg28Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	pfam_Mopterin-bd,pfam_PAPS_reduct,superfamily_Mopterin-bd,smart_Mopterin-bd,pirsf_FAD_synth_Mopterin-bd	p.R28T	ENST00000292180.3	37	c.83	CCDS1078.1	1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362882	0.24684	.	.	ENSG00000160688	ENST00000368433;ENST00000292180	.	.	.	1.99	0.0246	0.14142	.	.	.	.	.	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.35599	-0.9782	8	0.87932	D	0	.	4.2671	0.10768	0.366:0.0:0.634:0.0	.	28	Q8NFF5	FAD1_HUMAN	T	28	.	ENSP00000292180:R28T	R	+	2	0	FLAD1	153222877	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-0.068000	0.11561	0.004000	0.14682	0.561000	0.74099	AGG	FLAD1	-	pirsf_FAD_synth_Mopterin-bd	ENSG00000160688		0.527	FLAD1-001	NOVEL	basic|CCDS	protein_coding	FLAD1	HGNC	protein_coding	OTTHUMT00000091089.1	46	0.00	0	G	NM_025207		154956253	154956253	+1	no_errors	ENST00000292180	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	0.001	C
FOXA1	3169	genome.wustl.edu	37	14	38061222	38061223	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr14:38061222_38061223delTT	ENST00000250448.2	-	2	827_828	c.766_767delAA	c.(766-768)aacfs	p.N256fs	FOXA1_ENST00000540786.1_Frame_Shift_Del_p.N223fs|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	256					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		GTAGCAGCCGTTCTCGAACATG	0.693																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.766_767delAA	14.37:g.38061222_38061223delTT	ENSP00000250448:p.Asn256fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Frame_Shift_Del	DEL	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.N256fs	ENST00000250448.2	37	c.767_766	CCDS9665.1	14																																																																																			FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000129514		0.693	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	67	0.00	0	TT			38061222	38061223	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	frame_shift_del	61	15.07	11	DEL	1.000:1.000	-
FOXA1	3169	genome.wustl.edu	37	14	38061225	38061228	+	Frame_Shift_Del	DEL	TCGA	TCGA	-			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	TCGA	TCGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr14:38061225_38061228delTCGA	ENST00000250448.2	-	2	822_825	c.761_764delTCGA	c.(760-765)ttcgagfs	p.FE254fs	FOXA1_ENST00000540786.1_Frame_Shift_Del_p.FE221fs|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	254					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		GCAGCCGTTCTCGAACATGTTGCC	0.686																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.761_764delTCGA	14.37:g.38061225_38061228delTCGA	ENSP00000250448:p.Phe254fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Frame_Shift_Del	DEL	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.F254fs	ENST00000250448.2	37	c.764_761	CCDS9665.1	14																																																																																			FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000129514		0.686	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	72	0.00	0	TCGA			38061225	38061228	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	frame_shift_del	65	14.10	11	DEL	1.000:1.000:1.000:1.000	-
GLUL	2752	genome.wustl.edu	37	1	182353775	182353775	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr1:182353775T>C	ENST00000331872.6	-	7	1427	c.887A>G	c.(886-888)aAt>aGt	p.N296S	GLUL_ENST00000311223.5_Missense_Mutation_p.N296S|GLUL_ENST00000339526.4_Missense_Mutation_p.N296S|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000417584.2_Missense_Mutation_p.N296S	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	296					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	ACGTCGGGCATTGTCCAGGCC	0.512																																						dbGAP											0													112.0	103.0	106.0					1																	182353775		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.887A>G	1.37:g.182353775T>C	ENSP00000356537:p.Asn296Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.N296S	ENST00000331872.6	37	c.887	CCDS1344.1	1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339494	0.81911	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	5.47	4.3	0.51218	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86932	0.6052	M	0.87900	2.915	0.80722	D	1	D	0.53151	0.958	P	0.53722	0.733	D	0.87498	0.2431	10	0.87932	D	0	-25.1432	10.5526	0.45099	0.145:0.0:0.0:0.855	.	296	P15104	GLNA_HUMAN	S	296	ENSP00000356537:N296S;ENSP00000307900:N296S;ENSP00000398320:N296S;ENSP00000344958:N296S	ENSP00000307900:N296S	N	-	2	0	GLUL	180620398	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.481000	0.81124	0.844000	0.35094	0.533000	0.62120	AAT	GLUL	-	pfam_Gln_synth_cat_dom	ENSG00000135821		0.512	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	HGNC	protein_coding	OTTHUMT00000091043.1	74	0.00	0	T	NM_002065		182353775	182353775	-1	no_errors	ENST00000311223	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	1.000	C
GSDMB	55876	genome.wustl.edu	37	17	38063216	38063216	+	Intron	SNP	A	A	G			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr17:38063216A>G	ENST00000394179.1	-	7	843				GSDMB_ENST00000394175.2_Intron|GSDMB_ENST00000418519.1_Missense_Mutation_p.L242S|GSDMB_ENST00000360317.3_Missense_Mutation_p.L242S|GSDMB_ENST00000520542.1_Intron|GSDMB_ENST00000309481.7_Missense_Mutation_p.L229S			Q8TAX9	GSDMB_HUMAN	gasdermin B							cytoplasm (GO:0005737)				breast(2)|endometrium(3)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|stomach(2)	21						ACCCTTACCTAAACAGGATGA	0.532																																						dbGAP											0													114.0	110.0	112.0					17																	38063216		2006	4164	6170	-	-	-	SO:0001627	intron_variant	0			AF119884	CCDS11354.1, CCDS42313.1, CCDS54119.1, CCDS54120.1	17q21.2	2008-07-31	2008-07-31	2008-07-31	ENSG00000073605	ENSG00000073605			23690	protein-coding gene	gene with protein product		611221	"""gasdermin-like"""	GSDML		12883658, 15010812, 17350798	Standard	NM_001042471		Approved	PRO2521	uc010cwj.3	Q8TAX9	OTTHUMG00000133248	ENST00000394179.1:c.713-692T>C	17.37:g.38063216A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKK7|Q7Z377|Q8WY76|Q9NX71|Q9P163	Missense_Mutation	SNP	pfam_Gasdermin	p.L242S	ENST00000394179.1	37	c.725		17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.673|1.673	-0.508429|-0.508429	0.04231|0.04231	.|.	.|.	ENSG00000073605|ENSG00000073605	ENST00000309481;ENST00000418519|ENST00000420491	T;T|.	0.20069|.	3.27;2.1|.	3.54|3.54	0.00265|0.00265	0.14051|0.14051	.|.	.|.	.|.	.|.	.|.	T|.	0.31979|.	0.0814|.	L|L	0.44542|0.44542	1.39|1.39	0.19575|0.19575	N|N	0.999968|0.999968	P;P|.	0.46912|.	0.886;0.886|.	B;B|.	0.39094|.	0.29;0.29|.	T|.	0.27054|.	-1.0085|.	9|.	0.06891|.	T|.	0.86|.	.|.	2.5611|2.5611	0.04772|0.04772	0.5703:0.0:0.2302:0.1994|0.5703:0.0:0.2302:0.1994	.|.	242;229|.	Q8TAX9-4;Q8TAX9-3|.	.;.|.	S|Q	229;242|174	ENSP00000312584:L229S;ENSP00000415049:L242S|.	ENSP00000312584:L229S|.	L|X	-|-	2|1	0|0	GSDMB|GSDMB	35316742|35316742	0.000000|0.000000	0.05858|0.05858	0.071000|0.071000	0.20095|0.20095	0.084000|0.084000	0.17831|0.17831	-0.099000|-0.099000	0.11007|0.11007	-0.047000|-0.047000	0.13423|0.13423	-0.314000|-0.314000	0.08810|0.08810	TTA|TAG	GSDMB	-	pfam_Gasdermin	ENSG00000073605		0.532	GSDMB-201	KNOWN	basic|appris_candidate	protein_coding	GSDMB	HGNC	protein_coding		23	0.00	0	A	NM_018530		38063216	38063216	-1	no_errors	ENST00000360317	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.094	G
KRTAP21-3	100288323	genome.wustl.edu	37	21	32090972	32090972	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr21:32090972A>G	ENST00000444335.1	-	1	123	c.106T>C	c.(106-108)Tat>Cat	p.Y36H		NM_001164435.1	NP_001157907.1	Q3LHN1	KR213_HUMAN	keratin associated protein 21-3	36						intermediate filament (GO:0005882)											TAACAACCATAATAACCGTTA	0.358																																						dbGAP											0													71.0	63.0	65.0					21																	32090972		692	1591	2283	-	-	-	SO:0001583	missense	0			AB180042	CCDS54481.1	21q22.11	2011-02-24			ENSG00000231068	ENSG00000231068		"""Keratin associated proteins"""	34216	protein-coding gene	gene with protein product							Standard	NM_001164435		Approved		uc021wii.1	Q3LHN1	OTTHUMG00000125533	ENST00000444335.1:c.106T>C	21.37:g.32090972A>G	ENSP00000404517:p.Tyr36His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Y36H	ENST00000444335.1	37	c.106	CCDS54481.1	21	.	.	.	.	.	.	.	.	.	.	A	6.873	0.530452	0.13127	.	.	ENSG00000231068	ENST00000444335	.	.	.	2.33	-0.0618	0.13783	.	.	.	.	.	T	0.37404	0.1002	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38672	-0.9650	5	0.87932	D	0	.	4.4426	0.11582	0.6715:0.0:0.3285:0.0	.	.	.	.	H	36	.	ENSP00000404517:Y36H	Y	-	1	0	KRTAP21-3	31012843	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.552000	0.23376	-0.012000	0.14223	-0.317000	0.08691	TAT	KRTAP21-3	-	NULL	ENSG00000231068		0.358	KRTAP21-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP21-3	HGNC	protein_coding	OTTHUMT00000246864.1	53	0.00	0	A	XM_002343741		32090972	32090972	-1	no_errors	ENST00000444335	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	0.000	G
LINC00661	126536	genome.wustl.edu	37	19	16136382	16136382	+	RNA	SNP	C	C	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr19:16136382C>A	ENST00000549354.2	+	0	1452					NR_026828.1				long intergenic non-protein coding RNA 661																		ACCGACCCAGCAAGCCCACCG	0.592											OREG0025325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-			0			AI184190, CR749400		19p13.12	2012-10-12			ENSG00000205396	ENSG00000205396		"""Long non-coding RNAs"""	27002	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026828		Approved		uc002nbw.2		OTTHUMG00000169715		19.37:g.16136382C>A		Somatic	708	WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000549354.2	37	NULL		19																																																																																			LINC00661	-	-	ENSG00000205396		0.592	LINC00661-001	KNOWN	basic	lincRNA	LINC00661	HGNC	processed_transcript	OTTHUMT00000405577.4	70	0.00	0	C	NR_026828		16136382	16136382	+1	no_errors	ENST00000379899	ensembl	human	known	69_37n	rna	61	18.67	14	SNP	0.026	A
LRRC17	10234	genome.wustl.edu	37	7	102574414	102574414	+	Silent	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr7:102574414G>A	ENST00000339431.4	+	2	349	c.54G>A	c.(52-54)ctG>ctA	p.L18L	FBXL13_ENST00000313221.4_Intron|FBXL13_ENST00000393772.2_Intron|FBXL13_ENST00000379308.3_Intron|FBXL13_ENST00000379306.3_Intron|LRRC17_ENST00000249377.4_Silent_p.L18L|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000455112.2_Intron	NM_001031692.2	NP_001026862.1	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17	18					bone marrow development (GO:0048539)|negative regulation of osteoclast differentiation (GO:0045671)|ossification (GO:0001503)	extracellular space (GO:0005615)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	17						CGGCTGAGCTGCGCAAAGCAA	0.577																																						dbGAP											0													46.0	44.0	45.0					7																	102574414		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U32907	CCDS5727.1, CCDS34721.1	7q22.1	2009-05-26			ENSG00000128606	ENSG00000128606			16895	protein-coding gene	gene with protein product						8982252, 19336404	Standard	NM_005824		Approved	P37NB, H_RG318M05.3	uc003vau.3	Q8N6Y2	OTTHUMG00000157210	ENST00000339431.4:c.54G>A	7.37:g.102574414G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13288|Q6UWA7|Q75MG5	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L18	ENST00000339431.4	37	c.54	CCDS34721.1	7																																																																																			LRRC17	-	NULL	ENSG00000128606		0.577	LRRC17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC17	HGNC	protein_coding	OTTHUMT00000347930.1	72	0.00	0	G	NM_005824		102574414	102574414	+1	no_errors	ENST00000339431	ensembl	human	known	69_37n	silent	58	21.62	16	SNP	0.969	A
MARCO	8685	genome.wustl.edu	37	2	119735465	119735465	+	Silent	SNP	A	A	G			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr2:119735465A>G	ENST00000327097.4	+	8	855	c.720A>G	c.(718-720)aaA>aaG	p.K240K	MARCO_ENST00000541757.1_Silent_p.K162K	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	240	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						TTGGCCCAAAAGGGGAAACTG	0.597																																					GBM(8;18 374 7467 11269 32796)	dbGAP											0													45.0	44.0	44.0					2																	119735465		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.720A>G	2.37:g.119735465A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DW79|Q9Y5S3	Silent	SNP	pfam_Collagen,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.K240	ENST00000327097.4	37	c.720	CCDS2124.1	2																																																																																			MARCO	-	NULL	ENSG00000019169		0.597	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCO	HGNC	protein_coding	OTTHUMT00000254190.2	39	0.00	0	A	NM_006770		119735465	119735465	+1	no_errors	ENST00000327097	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	0.990	G
NINJ1	4814	genome.wustl.edu	37	9	95887400	95887400	+	Intron	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr9:95887400G>A	ENST00000375446.4	-	3	375				NINJ1_ENST00000489274.1_5'UTR	NM_004148.3	NP_004139.2	Q92982	NINJ1_HUMAN	ninjurin 1						cell adhesion (GO:0007155)|hyaloid vascular plexus regression (GO:1990384)|nervous system development (GO:0007399)|positive regulation of cell-matrix adhesion (GO:0001954)|tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|upper_aerodigestive_tract(1)	4						CAGCGCCCCAGCCTGGGACAG	0.602																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U91512	CCDS6703.1	9q22	2008-07-21			ENSG00000131669	ENSG00000131669			7824	protein-coding gene	gene with protein product	"""nerve injury-induced protein-1"""	602062				8780658	Standard	NM_004148		Approved	NIN1	uc004atg.4	Q92982	OTTHUMG00000020242	ENST00000375446.4:c.305-56C>T	9.37:g.95887400G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GU89|Q8WUV5|Q9BT07	RNA	SNP	-	NULL	ENST00000375446.4	37	NULL	CCDS6703.1	9																																																																																			NINJ1	-	-	ENSG00000131669		0.602	NINJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NINJ1	HGNC	protein_coding	OTTHUMT00000053123.2	65	0.00	0	G	NM_004148		95887400	95887400	-1	no_errors	ENST00000489274	ensembl	human	known	69_37n	rna	53	30.26	23	SNP	0.000	A
NT5C2	22978	genome.wustl.edu	37	10	104850710	104850710	+	Missense_Mutation	SNP	T	T	C	rs533660770		TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr10:104850710T>C	ENST00000404739.3	-	15	1278	c.1255A>G	c.(1255-1257)Atc>Gtc	p.I419V	NT5C2_ENST00000343289.5_Missense_Mutation_p.I419V|NT5C2_ENST00000423468.2_Missense_Mutation_p.I390V|NT5C2_ENST00000369857.4_5'UTR			P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	419					cell death (GO:0008219)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|nucleobase-containing small molecule metabolic process (GO:0055086)|phosphorylation (GO:0016310)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleoside phosphotransferase activity (GO:0050146)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|urinary_tract(1)	16		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	CGTCTCTGGATGGAACTGATG	0.358													T|||	1	0.000199681	0.0	0.0	5008	,	,		20444	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													91.0	91.0	91.0					10																	104850710		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38524	CCDS7544.1	10q24.32	2014-03-03	2002-04-18	2002-04-19	ENSG00000076685	ENSG00000076685			8022	protein-coding gene	gene with protein product	"""purine 5' nucleotidase"""	600417	"""5'-nucleotidase (purine), cytosolic type B"""	NT5B		7999131, 24482476	Standard	NM_012229		Approved	PNT5, GMP, cN-II, SPG65	uc001kwq.3	P49902	OTTHUMG00000018981	ENST00000404739.3:c.1255A>G	10.37:g.104850710T>C	ENSP00000383960:p.Ile419Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z382|D3DR91|Q5JUV5	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	p.I419V	ENST00000404739.3	37	c.1255	CCDS7544.1	10	.	.	.	.	.	.	.	.	.	.	T	12.72	2.021357	0.35701	.	.	ENSG00000076685	ENST00000343289;ENST00000404739;ENST00000423468;ENST00000421281	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.95	5.95	0.96441	HAD-like domain (1);	0.107759	0.64402	D	0.000008	T	0.17619	0.0423	L	0.28504	0.86	0.58432	D	0.999992	B;B;B	0.13594	0.002;0.008;0.002	B;B;B	0.08055	0.002;0.003;0.003	T	0.05273	-1.0895	10	0.23302	T	0.38	-24.493	16.4159	0.83738	0.0:0.0:0.0:1.0	.	390;266;419	B7Z382;B3KXN5;P49902	.;.;5NTC_HUMAN	V	419;419;390;119	ENSP00000339479:I419V;ENSP00000383960:I419V;ENSP00000392236:I390V;ENSP00000408112:I119V	ENSP00000339479:I419V	I	-	1	0	NT5C2	104840700	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.722000	0.54948	2.279000	0.76181	0.533000	0.62120	ATC	NT5C2	-	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase	ENSG00000076685		0.358	NT5C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5C2	HGNC	protein_coding	OTTHUMT00000050121.1	29	0.00	0	T	NM_012229		104850710	104850710	-1	no_errors	ENST00000343289	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	C
NYNRIN	57523	genome.wustl.edu	37	14	24884073	24884073	+	Missense_Mutation	SNP	C	C	T	rs201775736		TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr14:24884073C>T	ENST00000382554.3	+	9	3436	c.3118C>T	c.(3118-3120)Cgg>Tgg	p.R1040W		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1040					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GGAGATCCTGCGGTGCCTCAG	0.652																																						dbGAP											0													95.0	118.0	110.0					14																	24884073		2155	4249	6404	-	-	-	SO:0001583	missense	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3118C>T	14.37:g.24884073C>T	ENSP00000371994:p.Arg1040Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.R1040W	ENST00000382554.3	37	c.3118	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117878	0.37339	.	.	ENSG00000205978	ENST00000382554	T	0.11821	2.74	4.36	4.36	0.52297	.	.	.	.	.	T	0.15435	0.0372	L	0.40543	1.245	0.24682	N	0.993351	D	0.60575	0.988	P	0.45037	0.467	T	0.08411	-1.0723	9	0.87932	D	0	.	12.251	0.54597	0.0:1.0:0.0:0.0	.	1040	Q9P2P1	NYNRI_HUMAN	W	1040	ENSP00000371994:R1040W	ENSP00000371994:R1040W	R	+	1	2	NYNRIN	23953913	0.402000	0.25311	1.000000	0.80357	0.350000	0.29205	0.558000	0.23469	2.244000	0.73946	0.313000	0.20887	CGG	NYNRIN	-	NULL	ENSG00000205978		0.652	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	57	0.00	0	C			24884073	24884073	+1	no_errors	ENST00000382554	ensembl	human	known	69_37n	missense	39	31.58	18	SNP	1.000	T
PALB2	79728	genome.wustl.edu	37	16	23647523	23647523	+	Missense_Mutation	SNP	C	C	T	rs145598272		TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr16:23647523C>T	ENST00000261584.4	-	4	496	c.344G>A	c.(343-345)gGa>gAa	p.G115E		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	115	DNA-binding (with the preference D loop > dsDNA > ssDNA).|Interaction with BRCA1.|Interaction with RAD51.|Required for its oligomerization and is important for its focal concentration at DNA damage sites.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		TATAGGTAATCCTCCTGGGCC	0.458			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	0													79.0	76.0	77.0					16																	23647523		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.344G>A	16.37:g.23647523C>T	ENSP00000261584:p.Gly115Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.G115E	ENST00000261584.4	37	c.344	CCDS32406.1	16	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.453740	0.01071	.	.	ENSG00000083093	ENST00000261584	T	0.15487	2.42	5.77	-10.8	0.00216	.	2.141050	0.01696	N	0.026915	T	0.06690	0.0171	N	0.17674	0.51	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.29212	-1.0019	10	0.11794	T	0.64	0.3792	1.3993	0.02267	0.198:0.166:0.1883:0.4477	.	115	Q86YC2	PALB2_HUMAN	E	115	ENSP00000261584:G115E	ENSP00000261584:G115E	G	-	2	0	PALB2	23555024	0.000000	0.05858	0.000000	0.03702	0.159000	0.22180	-0.240000	0.08952	-1.943000	0.01039	-0.444000	0.05651	GGA	PALB2	-	NULL	ENSG00000083093		0.458	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALB2	HGNC	protein_coding	OTTHUMT00000435287.2	103	0.00	0	C	NM_024675		23647523	23647523	-1	no_errors	ENST00000261584	ensembl	human	known	69_37n	missense	91	17.27	19	SNP	0.000	T
PCDHB2	56133	genome.wustl.edu	37	5	140474744	140474744	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr5:140474744C>T	ENST00000194155.4	+	1	518	c.370C>T	c.(370-372)Cgg>Tgg	p.R124W		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	124	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGGAGCTACGGATTAGGGA	0.448																																						dbGAP											0													39.0	43.0	42.0					5																	140474744		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.370C>T	5.37:g.140474744C>T	ENSP00000194155:p.Arg124Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R124W	ENST00000194155.4	37	c.370	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	C	0.391	-0.923419	0.02377	.	.	ENSG00000112852	ENST00000194155	T	0.51071	0.72	5.12	2.18	0.27775	Cadherin (2);Cadherin conserved site (1);	.	.	.	.	T	0.37073	0.0990	L	0.59436	1.845	0.09310	N	1	B	0.14805	0.011	B	0.06405	0.002	T	0.36939	-0.9727	9	0.42905	T	0.14	.	0.858	0.01186	0.2318:0.3947:0.1285:0.245	.	124	Q9Y5E7	PCDB2_HUMAN	W	124	ENSP00000194155:R124W	ENSP00000194155:R124W	R	+	1	2	PCDHB2	140454928	0.000000	0.05858	0.004000	0.12327	0.000000	0.00434	-1.257000	0.02866	0.674000	0.31244	-0.140000	0.14226	CGG	PCDHB2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.448	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	37	0.00	0	C	NM_018936		140474744	140474744	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	67	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	47	22.95	14	SNP	1.000	A
PRKX	5613	genome.wustl.edu	37	X	3592644	3592644	+	Silent	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chrX:3592644G>A	ENST00000262848.5	-	2	684	c.330C>T	c.(328-330)atC>atT	p.I110I		NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				CTCACAGCCTGATGAGGAACG	0.562																																						dbGAP											0													218.0	141.0	167.0					X																	3592644		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.330C>T	X.37:g.3592644G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I110	ENST00000262848.5	37	c.330	CCDS14125.1	X																																																																																			PRKX	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000183943		0.562	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKX	HGNC	protein_coding	OTTHUMT00000055659.1	99	0.00	0	G	NM_005044		3592644	3592644	-1	no_errors	ENST00000262848	ensembl	human	known	69_37n	silent	84	26.96	31	SNP	1.000	A
QSER1	79832	genome.wustl.edu	37	11	32979425	32979425	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr11:32979425G>T	ENST00000399302.2	+	8	4710	c.4375G>T	c.(4375-4377)Gct>Tct	p.A1459S	QSER1_ENST00000527788.1_Missense_Mutation_p.A1220S	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1459										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AACTGTTCAAGCTAAGCCAAG	0.333																																						dbGAP											0													50.0	47.0	48.0					11																	32979425		1823	4084	5907	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4375G>T	11.37:g.32979425G>T	ENSP00000382241:p.Ala1459Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.A1459S	ENST00000399302.2	37	c.4375	CCDS41631.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.068|6.068	0.380776|0.380776	0.11466|0.11466	.|.	.|.	ENSG00000060749|ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788|ENST00000524678	T;T|.	0.22945|.	2.26;1.93|.	5.91|5.91	-0.808|-0.808	0.10868|0.10868	.|.	0.466770|.	0.19362|.	N|.	0.116116|.	T|T	0.09247|0.09247	0.0228|0.0228	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	B;B;B|.	0.13594|.	0.008;0.005;0.003|.	B;B;B|.	0.14578|.	0.011;0.003;0.001|.	T|T	0.34900|0.34900	-0.9810|-0.9810	10|5	0.05525|.	T|.	0.97|.	.|.	6.6266|6.6266	0.22833|0.22833	0.0745:0.0865:0.1745:0.6645|0.0745:0.0865:0.1745:0.6645	.|.	1220;1220;1459|.	C9JJ88;Q2KHR3-2;Q2KHR3|.	.;.;QSER1_HUMAN|.	S|N	1459;1220;1220|479	ENSP00000382241:A1459S;ENSP00000432766:A1220S|.	ENSP00000078652:A1220S|.	A|K	+|+	1|3	0|2	QSER1|QSER1	32936001|32936001	0.002000|0.002000	0.14202|0.14202	0.701000|0.701000	0.30321|0.30321	0.977000|0.977000	0.68977|0.68977	0.010000|0.010000	0.13242|0.13242	-0.028000|-0.028000	0.13850|0.13850	0.655000|0.655000	0.94253|0.94253	GCT|AAG	QSER1	-	NULL	ENSG00000060749		0.333	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	33	0.00	0	G	NM_024774		32979425	32979425	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.136	T
RPL36A	6173	genome.wustl.edu	37	X	100646803	100646803	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chrX:100646803G>A	ENST00000553110.3	+	3	254	c.170G>A	c.(169-171)cGg>cAg	p.R57Q	RPL36A_ENST00000471855.1_5'UTR|RPL36A_ENST00000427805.2_Missense_Mutation_p.R93Q|RPL36A-HNRNPH2_ENST00000409170.3_Missense_Mutation_p.G68R			P83881	RL36A_HUMAN	ribosomal protein L36a	57					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			liver(4)|lung(1)|prostate(1)	6						CCGATTTTCCGGAAAAAGGTG	0.418																																						dbGAP											0													191.0	157.0	169.0					X																	100646803		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001781	CCDS14483.1, CCDS14483.2	Xq22.1	2011-04-06	2002-01-15	2002-01-18	ENSG00000241343	ENSG00000241343		"""L ribosomal proteins"""	10359	protein-coding gene	gene with protein product		300902	"""ribosomal protein L44"""	RPL44		3461443	Standard	NM_021029		Approved	L36A		P83881	OTTHUMG00000022027	ENST00000553110.3:c.170G>A	X.37:g.100646803G>A	ENSP00000446503:p.Arg57Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P09896|P10661|Q08ES5|Q5J9I6	Missense_Mutation	SNP	pfam_Ribosomal_L44e,superfamily_Ribosomal_zn-bd_dom	p.R93Q	ENST00000553110.3	37	c.278		X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.39|19.39	3.817994|3.817994	0.71028|0.71028	.|.	.|.	ENSG00000257529|ENSG00000241343;ENSG00000241343;ENSG00000257529	ENST00000409170|ENST00000427805;ENST00000553110;ENST00000409338	.|T;T;T	.|0.44083	.|0.93;0.93;0.93	5.85|5.85	4.98|4.98	0.66077|0.66077	.|Ribosomal protein, zinc-binding domain (1);	.|0.000000	.|0.56097	.|U	.|0.000031	T|T	0.41719|0.41719	0.1171|0.1171	M|M	0.64080|0.64080	1.96|1.96	0.33401|0.33401	D|D	0.577369|0.577369	.|B;B	.|0.15719	.|0.0;0.014	.|B;B	.|0.19391	.|0.007;0.025	T|T	0.50294|0.50294	-0.8845|-0.8845	5|10	.|0.27785	.|T	.|0.31	-18.2697|-18.2697	14.4302|14.4302	0.67243|0.67243	0.0737:0.0:0.9263:0.0|0.0737:0.0:0.9263:0.0	.|.	.|57;57	.|P83881;B2REA7	.|RL36A_HUMAN;.	R|Q	68|93;57;68	.|ENSP00000404375:R93Q;ENSP00000446503:R57Q;ENSP00000386974:R68Q	.|ENSP00000386974:R68Q	G|R	+|+	1|2	0|0	RP1-164F3.9|RPL36A;RP1-164F3.9	100533459|100533459	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	7.602000|7.602000	0.82796|0.82796	2.471000|2.471000	0.83476|0.83476	0.468000|0.468000	0.43344|0.43344	GGA|CGG	RPL36A	-	pfam_Ribosomal_L44e,superfamily_Ribosomal_zn-bd_dom	ENSG00000241343		0.418	RPL36A-201	KNOWN	basic|appris_principal	protein_coding	RPL36A	HGNC	protein_coding		72	0.00	0	G	NM_021029		100646803	100646803	+1	no_errors	ENST00000427805	ensembl	human	known	69_37n	missense	52	16.13	10	SNP	1.000	A
SLC25A41	284427	genome.wustl.edu	37	19	6430137	6430137	+	Silent	SNP	C	C	A	rs61730225	byFrequency	TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr19:6430137C>A	ENST00000321510.6	-	3	467	c.399G>T	c.(397-399)ctG>ctT	p.L133L		NM_173637.3	NP_775908.2			solute carrier family 25, member 41											large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	6						GTAGCCCCCCCAGCAGGTTGG	0.637																																						dbGAP											0													34.0	37.0	36.0					19																	6430137		2000	4183	6183	-	-	-	SO:0001819	synonymous_variant	0			AK097761	CCDS45937.1	19p13.3	2013-05-22			ENSG00000181240	ENSG00000181240		"""Solute carriers"""	28533	protein-coding gene	gene with protein product		610822				16949250	Standard	NM_173637		Approved	FLJ40442, MGC34725, APC4	uc010dus.3	Q8N5S1		ENST00000321510.6:c.399G>T	19.37:g.6430137C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier	p.W166L	ENST00000321510.6	37	c.497	CCDS45937.1	19	.	.	.	.	.	.	.	.	.	.	c	18.19	3.568786	0.65765	.	.	ENSG00000181240	ENST00000458275	T	0.38401	1.14	4.31	3.24	0.37175	.	0.063204	0.64402	D	0.000008	T	0.36276	0.0961	.	.	.	0.23991	N	0.99625	.	.	.	.	.	.	T	0.17077	-1.0381	6	.	.	.	-8.0247	12.3459	0.55119	0.1705:0.8295:0.0:0.0	.	.	.	.	L	166	ENSP00000405411:W166L	.	W	-	2	0	SLC25A41	6381137	0.003000	0.15002	0.892000	0.35008	0.837000	0.47467	-0.148000	0.10219	0.985000	0.38656	0.471000	0.43371	TGG	SLC25A41	-	NULL	ENSG00000181240		0.637	SLC25A41-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A41	HGNC	protein_coding	OTTHUMT00000462222.1	83	0.00	0	C	NM_173637		6430137	6430137	-1	no_errors	ENST00000458275	ensembl	human	known	69_37n	missense	67	20.24	17	SNP	0.984	A
SPTBN2	6712	genome.wustl.edu	37	11	66466533	66466533	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr11:66466533G>T	ENST00000533211.1	-	19	4128	c.3797C>A	c.(3796-3798)gCa>gAa	p.A1266E	SPTBN2_ENST00000309996.2_Missense_Mutation_p.A1266E|SPTBN2_ENST00000529997.1_Missense_Mutation_p.A1266E			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1266					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TTGCTGCGCTGCGTCTTGATT	0.552																																						dbGAP											0													84.0	79.0	81.0					11																	66466533		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3797C>A	11.37:g.66466533G>T	ENSP00000432568:p.Ala1266Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,prints_PH_dom-spectrin-type	p.A1266E	ENST00000533211.1	37	c.3797	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502112	0.64298	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.36157	1.27;1.27;1.27	4.7	4.7	0.59300	.	0.192990	0.43919	D	0.000513	T	0.39118	0.1066	L	0.59436	1.845	0.58432	D	0.999999	P	0.47191	0.891	P	0.46208	0.507	T	0.18840	-1.0324	10	0.08837	T	0.75	.	16.5926	0.84770	0.0:0.0:1.0:0.0	.	1266	O15020	SPTN2_HUMAN	E	1266	ENSP00000432568:A1266E;ENSP00000311489:A1266E;ENSP00000433593:A1266E	ENSP00000311489:A1266E	A	-	2	0	SPTBN2	66223109	0.998000	0.40836	0.411000	0.26484	0.512000	0.34134	3.900000	0.56295	2.441000	0.82636	0.655000	0.94253	GCA	SPTBN2	-	pirsf_Spectrin_bsu,smart_Spectrin/alpha-actinin	ENSG00000173898		0.552	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	45	0.00	0	G	NM_006946		66466533	66466533	-1	no_errors	ENST00000309996	ensembl	human	known	69_37n	missense	28	37.78	17	SNP	0.975	T
SYMPK	8189	genome.wustl.edu	37	19	46333417	46333417	+	Silent	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr19:46333417G>A	ENST00000245934.7	-	13	1888	c.1644C>T	c.(1642-1644)gaC>gaT	p.D548D	AC092301.3_ENST00000601618.1_RNA	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	548					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GCTTCAGCACGTCGCTGAGAC	0.622																																						dbGAP											0													31.0	27.0	28.0					19																	46333417		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.1644C>T	19.37:g.46333417G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.D548	ENST00000245934.7	37	c.1644	CCDS12676.2	19																																																																																			SYMPK	-	superfamily_ARM-type_fold	ENSG00000125755		0.622	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	HGNC	protein_coding	OTTHUMT00000316581.1	183	0.00	0	G	NM_004819		46333417	46333417	-1	no_errors	ENST00000245934	ensembl	human	known	69_37n	silent	149	21.16	40	SNP	0.086	A
SYNC	81493	genome.wustl.edu	37	1	33160553	33160553	+	Silent	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr1:33160553G>A	ENST00000409190.3	-	2	1604	c.1146C>T	c.(1144-1146)gcC>gcT	p.A382A	SYNC_ENST00000373484.3_Silent_p.A382A	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	382	Coil 2.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						GGAGCTGCCGGGCCTCTGCTT	0.572																																						dbGAP											0													141.0	146.0	144.0					1																	33160553		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.1146C>T	1.37:g.33160553G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNK8|B4DY58|C9IY41	Silent	SNP	pfam_F	p.A382	ENST00000409190.3	37	c.1146	CCDS367.2	1																																																																																			SYNC	-	pfam_F	ENSG00000162520		0.572	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNC	HGNC	protein_coding	OTTHUMT00000022129.3	58	0.00	0	G	NM_030786		33160553	33160553	-1	no_errors	ENST00000409190	ensembl	human	known	69_37n	silent	44	18.52	10	SNP	0.467	A
TAF1B	9014	genome.wustl.edu	37	2	10008444	10008444	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr2:10008444G>A	ENST00000263663.5	+	6	627	c.439G>A	c.(439-441)Gag>Aag	p.E147K	TAF1B_ENST00000402170.1_3'UTR|TAF1B_ENST00000396242.3_5'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	147	N-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CTGGGCTAGTGAGCCTGAGCT	0.393																																						dbGAP											0													100.0	86.0	91.0					2																	10008444		2203	4300	6503	-	-	-	SO:0001583	missense	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.439G>A	2.37:g.10008444G>A	ENSP00000263663:p.Glu147Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	pfam_TF_Rrn7	p.E147K	ENST00000263663.5	37	c.439	CCDS33143.1	2	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442998	0.63067	.	.	ENSG00000115750	ENST00000263663;ENST00000402170	T	0.14766	2.48	5.55	5.55	0.83447	.	0.589948	0.19237	N	0.119280	T	0.18467	0.0443	M	0.65498	2.005	0.80722	D	1	P;P;P	0.43094	0.608;0.799;0.787	B;B;B	0.39379	0.188;0.244;0.298	T	0.00986	-1.1490	9	.	.	.	-4.4886	14.8729	0.70471	0.0:0.0:1.0:0.0	.	147;147;147	B5MD29;Q53T94;Q53T94-2	.;TAF1B_HUMAN;.	K	147	ENSP00000263663:E147K	.	E	+	1	0	TAF1B	9925895	1.000000	0.71417	0.532000	0.27989	0.671000	0.39405	4.491000	0.60326	2.885000	0.99019	0.655000	0.94253	GAG	TAF1B	-	NULL	ENSG00000115750		0.393	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2	31	0.00	0	G	NM_005680		10008444	10008444	+1	no_errors	ENST00000263663	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.933	A
TBC1D22B	55633	genome.wustl.edu	37	6	37252159	37252159	+	Silent	SNP	G	G	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr6:37252159G>T	ENST00000373491.3	+	6	866	c.720G>T	c.(718-720)cgG>cgT	p.R240R		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	240	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			CCCTGCAGCGGAAGCGGGAGG	0.483																																						dbGAP											0													124.0	116.0	119.0					6																	37252159		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.720G>T	6.37:g.37252159G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R240	ENST00000373491.3	37	c.720	CCDS4832.1	6																																																																																			TBC1D22B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000065491		0.483	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22B	HGNC	protein_coding	OTTHUMT00000040402.1	59	0.00	0	G	NM_017772		37252159	37252159	+1	no_errors	ENST00000373491	ensembl	human	known	69_37n	silent	33	13.16	5	SNP	1.000	T
TBX3	6926	genome.wustl.edu	37	12	115118792	115118793	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr12:115118792_115118793insCT	ENST00000257566.3	-	2	937_938	c.548_549insAG	c.(547-549)aggfs	p.R183fs	TBX3_ENST00000349155.2_Frame_Shift_Ins_p.R183fs	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	183					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GAATGTACATCCTCTTTGGCAT	0.46																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.547_548dupAG	12.37:g.115118795_115118796dupCT	ENSP00000257566:p.Arg183fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB20|Q9UKF8	Frame_Shift_Ins	INS	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.M184fs	ENST00000257566.3	37	c.549_548	CCDS9176.1	12																																																																																			TBX3	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000135111		0.460	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	52	0.00	0	-	NM_016569, NM_005996		115118792	115118793	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	frame_shift_ins	39	22.00	11	INS	1.000:1.000	CT
TNKS	8658	genome.wustl.edu	37	8	9627729	9627729	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr8:9627729A>G	ENST00000310430.6	+	26	3880	c.3854A>G	c.(3853-3855)aAt>aGt	p.N1285S	TNKS_ENST00000518281.1_Missense_Mutation_p.N1048S	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1285	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		CCGAGCGTCAATGGGCTGGCA	0.473																																						dbGAP											0													80.0	68.0	72.0					8																	9627729		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3854A>G	8.37:g.9627729A>G	ENSP00000311579:p.Asn1285Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95272|Q4G0F2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom	p.N1285S	ENST00000310430.6	37	c.3854	CCDS5974.1	8	.	.	.	.	.	.	.	.	.	.	A	13.40	2.226964	0.39399	.	.	ENSG00000173273	ENST00000310430;ENST00000518281;ENST00000517770	T;T;T	0.12984	2.63;2.63;2.65	5.18	5.18	0.71444	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.15176	0.0366	L	0.44542	1.39	0.80722	D	1	B	0.27229	0.172	B	0.27500	0.08	T	0.02553	-1.1142	10	0.56958	D	0.05	.	15.3416	0.74303	1.0:0.0:0.0:0.0	.	1285	O95271	TNKS1_HUMAN	S	1285;1048;30	ENSP00000311579:N1285S;ENSP00000429890:N1048S;ENSP00000428185:N30S	ENSP00000311579:N1285S	N	+	2	0	TNKS	9665139	1.000000	0.71417	1.000000	0.80357	0.181000	0.23173	9.277000	0.95755	2.098000	0.63641	0.533000	0.62120	AAT	TNKS	-	pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000173273		0.473	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS	HGNC	protein_coding	OTTHUMT00000206935.1	41	0.00	0	A	NM_003747		9627729	9627729	+1	no_errors	ENST00000310430	ensembl	human	known	69_37n	missense	24	40.00	16	SNP	1.000	G
TRAPPC6B	122553	genome.wustl.edu	37	14	39623467	39623467	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr14:39623467C>T	ENST00000330149.5	-	4	525	c.299G>A	c.(298-300)cGc>cAc	p.R100H	TRAPPC6B_ENST00000557764.1_5'UTR|TRAPPC6B_ENST00000347691.5_Intron	NM_001079537.1	NP_001073005.1	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B	100					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		AGTAAGCAGGCGAAATTTGTT	0.333																																						dbGAP											0													102.0	92.0	95.0					14																	39623467		1829	4085	5914	-	-	-	SO:0001583	missense	0			AK025437	CCDS9670.1, CCDS41947.1	14q13.3	2011-10-10			ENSG00000182400	ENSG00000182400		"""Trafficking protein particle complex"""	23066	protein-coding gene	gene with protein product		610397					Standard	NM_177452		Approved		uc001wut.1	Q86SZ2	OTTHUMG00000140259	ENST00000330149.5:c.299G>A	14.37:g.39623467C>T	ENSP00000330289:p.Arg100His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPS2|Q5JPD6|Q86U35|Q86X35	Missense_Mutation	SNP	pfam_TRAPP_component,superfamily_NO_sig/Golgi_transp_ligand-bd	p.R100H	ENST00000330149.5	37	c.299	CCDS41947.1	14	.	.	.	.	.	.	.	.	.	.	C	16.66	3.186105	0.57909	.	.	ENSG00000182400	ENST00000330149	T	0.44482	0.92	6.08	5.19	0.71726	NO signalling/Golgi transport  ligand-binding domain (1);	0.222920	0.47455	D	0.000224	T	0.67239	0.2872	M	0.90309	3.105	0.80722	D	1	D;P	0.69078	0.997;0.66	P;B	0.60789	0.879;0.134	T	0.70908	-0.4744	10	0.44086	T	0.13	-23.4208	15.8169	0.78608	0.0:0.9341:0.0:0.0659	.	38;100	B4DFZ8;Q86SZ2	.;TPC6B_HUMAN	H	100	ENSP00000330289:R100H	ENSP00000330289:R100H	R	-	2	0	TRAPPC6B	38693218	0.822000	0.29219	1.000000	0.80357	0.994000	0.84299	1.539000	0.36104	2.894000	0.99253	0.591000	0.81541	CGC	TRAPPC6B	-	pfam_TRAPP_component,superfamily_NO_sig/Golgi_transp_ligand-bd	ENSG00000182400		0.333	TRAPPC6B-002	NOVEL	basic|appris_principal|CCDS	protein_coding	TRAPPC6B	HGNC	protein_coding	OTTHUMT00000276775.1	22	0.00	0	C	NM_177452		39623467	39623467	-1	no_errors	ENST00000330149	ensembl	human	novel	69_37n	missense	17	19.05	4	SNP	0.936	T
USP29	57663	genome.wustl.edu	37	19	57640903	57640903	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr19:57640903T>C	ENST00000254181.4	+	4	1314	c.860T>C	c.(859-861)tTc>tCc	p.F287S	USP29_ENST00000598197.1_Missense_Mutation_p.F287S	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	287	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAGCAGGGGTTCCCCAATTTG	0.478																																						dbGAP											0													76.0	74.0	74.0					19																	57640903		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.860T>C	19.37:g.57640903T>C	ENSP00000254181:p.Phe287Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.F287S	ENST00000254181.4	37	c.860	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	T	11.73	1.724427	0.30593	.	.	ENSG00000131864	ENST00000254181	T	0.74842	-0.88	2.68	1.65	0.23941	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.33772	U	0.004568	T	0.80964	0.4725	M	0.72479	2.2	0.28351	N	0.92091	D	0.76494	0.999	D	0.71870	0.975	T	0.72047	-0.4408	10	0.87932	D	0	-8.6797	6.2773	0.20987	0.0:0.1332:0.0:0.8668	.	287	Q9HBJ7	UBP29_HUMAN	S	287	ENSP00000254181:F287S	ENSP00000254181:F287S	F	+	2	0	USP29	62332715	1.000000	0.71417	0.111000	0.21465	0.171000	0.22731	3.417000	0.52714	0.417000	0.25871	0.477000	0.44152	TTC	USP29	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000131864		0.478	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	HGNC	protein_coding	OTTHUMT00000465075.1	57	0.00	0	T			57640903	57640903	+1	no_errors	ENST00000254181	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	0.978	C
WISP2	8839	genome.wustl.edu	37	20	43353470	43353470	+	Silent	SNP	C	C	T			TCGA-A2-A4S2-01A-12D-A25Q-09	TCGA-A2-A4S2-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1452df07-b990-46ec-8b2c-b6a17bd464c3	1196567b-472e-44b1-adfa-ca04fce2438f	g.chr20:43353470C>T	ENST00000372868.2	+	4	712	c.369C>T	c.(367-369)tgC>tgT	p.C123C	RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000372865.4_Intron|RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA|WISP2_ENST00000190983.4_Silent_p.C123C|WISP2_ENST00000471629.1_3'UTR			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	123	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GCTGCCGCTGCGAGGACGGCG	0.692																																						dbGAP											0													27.0	21.0	23.0					20																	43353470		2198	4293	6491	-	-	-	SO:0001819	synonymous_variant	0			AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.369C>T	20.37:g.43353470C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N4|E1P612|Q6PEG3	Silent	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.C123	ENST00000372868.2	37	c.369	CCDS13336.1	20																																																																																			WISP2	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	ENSG00000064205		0.692	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000127824.1	177	0.00	0	C	NM_003881		43353470	43353470	+1	no_errors	ENST00000190983	ensembl	human	known	69_37n	silent	137	26.34	49	SNP	0.002	T
