#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANP32B	10541	genome.wustl.edu	37	9	100757043	100757043	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:100757043A>T	ENST00000339399.4	+	2	380	c.185A>T	c.(184-186)aAg>aTg	p.K62M	ANP32B_ENST00000473205.1_3'UTR	NM_006401.2	NP_006392.1	Q92688	AN32B_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member B	62					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|inner ear development (GO:0048839)|negative regulation of cell differentiation (GO:0045596)|nucleosome assembly (GO:0006334)|palate development (GO:0060021)|positive regulation of protein export from nucleus (GO:0046827)|vasculature development (GO:0001944)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	histone binding (GO:0042393)|RNA polymerase binding (GO:0070063)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	6		Acute lymphoblastic leukemia(62;0.0559)				AATCTCCCCAAGCTGCCTAAA	0.358																																						dbGAP											0													63.0	62.0	62.0					9																	100757043		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y07969	CCDS6732.1	9q22.32	2010-06-17			ENSG00000136938	ENSG00000136938		"""ANP32 acidic nuclear phosphoproteins"""	16677	protein-coding gene	gene with protein product	"""acidic protein rich in leucines"""					9285060, 9473664	Standard	NM_006401		Approved	SSP29, PHAPI2, APRIL	uc004aya.3	Q92688	OTTHUMG00000020338	ENST00000339399.4:c.185A>T	9.37:g.100757043A>T	ENSP00000345848:p.Lys62Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9C7|O00655|P78458|P78459	Missense_Mutation	SNP	smart_U2A'_phosphoprotein32A_C	p.K62M	ENST00000339399.4	37	c.185	CCDS6732.1	9	.	.	.	.	.	.	.	.	.	.	A	22.9	4.348406	0.82132	.	.	ENSG00000136938	ENST00000339399	T	0.53857	0.6	5.51	5.51	0.81932	.	0.088055	0.85682	D	0.000000	T	0.78304	0.4262	H	0.94582	3.555	0.80722	D	1	D	0.63046	0.992	D	0.66716	0.946	T	0.81820	-0.0757	10	0.33940	T	0.23	-15.2298	14.926	0.70878	1.0:0.0:0.0:0.0	.	62	Q92688	AN32B_HUMAN	M	62	ENSP00000345848:K62M	ENSP00000345848:K62M	K	+	2	0	ANP32B	99796864	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.017000	0.76399	2.234000	0.73211	0.528000	0.53228	AAG	ANP32B	-	NULL	ENSG00000136938		0.358	ANP32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32B	HGNC	protein_coding	OTTHUMT00000053346.4	65	0.00	0	A	NM_006401		100757043	100757043	+1	no_errors	ENST00000339399	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	T
ANXA11	311	genome.wustl.edu	37	10	81915536	81915536	+	3'UTR	SNP	C	C	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr10:81915536C>G	ENST00000438331.1	-	0	2073				ANXA11_ENST00000537102.1_3'UTR|ANXA11_ENST00000360615.4_3'UTR|ANXA11_ENST00000535999.1_3'UTR|ANXA11_ENST00000422982.3_3'UTR|ANXA11_ENST00000265447.4_3'UTR|ANXA11_ENST00000372231.3_3'UTR	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11						cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			TTGTTAGAAACAGACATTCTT	0.537																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.*73G>C	10.37:g.81915536C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVE7	RNA	SNP	-	NULL	ENST00000438331.1	37	NULL	CCDS7364.1	10																																																																																			ANXA11	-	-	ENSG00000122359		0.537	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANXA11	HGNC	protein_coding	OTTHUMT00000049044.1	115	0.00	0	C	NM_145869		81915536	81915536	-1	no_errors	ENST00000463340	ensembl	human	known	69_37n	rna	87	23.68	27	SNP	0.000	G
AQR	9716	genome.wustl.edu	37	15	35198909	35198909	+	Silent	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr15:35198909A>G	ENST00000156471.5	-	18	1893	c.1668T>C	c.(1666-1668)ctT>ctC	p.L556L		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	556					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		CATGCTTACGAAGACCTGGTA	0.373																																						dbGAP											0													84.0	76.0	78.0					15																	35198909		1858	4090	5948	-	-	-	SO:0001819	synonymous_variant	0			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1668T>C	15.37:g.35198909A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Silent	SNP	NULL	p.L556	ENST00000156471.5	37	c.1668	CCDS42013.1	15																																																																																			AQR	-	NULL	ENSG00000021776		0.373	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	HGNC	protein_coding	OTTHUMT00000417526.2	87	0.00	0	A	NM_014691		35198909	35198909	-1	no_errors	ENST00000156471	ensembl	human	known	69_37n	silent	30	43.40	23	SNP	0.998	G
ATP1A1	476	genome.wustl.edu	37	1	116931552	116931552	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:116931552C>G	ENST00000295598.5	+	7	917	c.665C>G	c.(664-666)tCa>tGa	p.S222*	ATP1A1_ENST00000537345.1_Nonsense_Mutation_p.S222*|ATP1A1_ENST00000491156.1_3'UTR|ATP1A1_ENST00000369496.4_Nonsense_Mutation_p.S191*	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	222					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.S222*(1)		NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	ACTGGTGAATCAGAACCCCAG	0.443																																						dbGAP											1	Substitution - Nonsense(1)	cervix(1)											84.0	90.0	88.0					1																	116931552		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.665C>G	1.37:g.116931552C>G	ENSP00000295598:p.Ser222*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.S222*	ENST00000295598.5	37	c.665	CCDS887.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.818101	0.98966	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000339159;ENST00000369496	.	.	.	5.14	5.14	0.70334	.	0.120690	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.7939	0.91985	0.0:1.0:0.0:0.0	.	.	.	.	X	222;222;221;191	.	ENSP00000295598:S222X	S	+	2	0	ATP1A1	116733075	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	7.651000	0.83577	2.681000	0.91329	0.655000	0.94253	TCA	ATP1A1	-	pfam_ATPase_P-typ_ATPase-assoc-dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000163399		0.443	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1A1	HGNC	protein_coding	OTTHUMT00000033481.5	27	0.00	0	C	NM_001160233		116931552	116931552	+1	no_errors	ENST00000295598	ensembl	human	known	69_37n	nonsense	22	31.25	10	SNP	1.000	G
BAIAP2	10458	genome.wustl.edu	37	17	79079916	79079916	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr17:79079916A>T	ENST00000321300.6	+	11	1400	c.1307A>T	c.(1306-1308)gAc>gTc	p.D436V	BAIAP2_ENST00000416299.2_Missense_Mutation_p.D299V|BAIAP2_ENST00000575245.1_Missense_Mutation_p.D469V|BAIAP2_ENST00000321280.7_Missense_Mutation_p.D436V|BAIAP2_ENST00000428708.2_Missense_Mutation_p.D436V|BAIAP2_ENST00000575712.1_Missense_Mutation_p.D436V|BAIAP2_ENST00000435091.3_Missense_Mutation_p.D436V|BAIAP2_ENST00000392411.3_Missense_Mutation_p.D358V	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	436	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CGGGTCTTGGACAGCGATGGC	0.647																																						dbGAP											0													65.0	56.0	59.0					17																	79079916		2187	4290	6477	-	-	-	SO:0001583	missense	0			AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1307A>T	17.37:g.79079916A>T	ENSP00000316338:p.Asp436Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.D436V	ENST00000321300.6	37	c.1307	CCDS11775.1	17	.	.	.	.	.	.	.	.	.	.	A	14.70	2.612701	0.46631	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411;ENST00000416299	T;T;T;T;T;T	0.34275	1.75;1.77;1.37;1.37;1.81;1.39	5.16	5.16	0.70880	Src homology-3 domain (3);	0.108221	0.64402	D	0.000007	T	0.29223	0.0727	L	0.35542	1.07	0.58432	D	0.999999	P;P;P;B;P;B;B;B;B	0.45902	0.868;0.622;0.868;0.349;0.622;0.452;0.317;0.317;0.452	B;B;B;B;B;B;B;B;B	0.40410	0.164;0.164;0.328;0.05;0.164;0.164;0.108;0.108;0.164	T	0.04427	-1.0952	10	0.37606	T	0.19	-1.8668	13.9665	0.64211	1.0:0.0:0.0:0.0	.	299;358;437;436;436;436;436;437;436	B4DWA1;F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;.;BAIP2_HUMAN;.;.;.;.;.	V	436;436;436;436;358;299	ENSP00000316338:D436V;ENSP00000401022:D436V;ENSP00000413069:D436V;ENSP00000315685:D436V;ENSP00000376211:D358V;ENSP00000391837:D299V	ENSP00000315685:D436V	D	+	2	0	BAIAP2	76694511	0.997000	0.39634	0.991000	0.47740	0.632000	0.37999	3.420000	0.52735	1.966000	0.57179	0.260000	0.18958	GAC	BAIAP2	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000175866		0.647	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	BAIAP2	HGNC	protein_coding	OTTHUMT00000438553.1	52	0.00	0	A			79079916	79079916	+1	no_errors	ENST00000321300	ensembl	human	known	69_37n	missense	60	21.79	17	SNP	1.000	T
BBS12	166379	genome.wustl.edu	37	4	123664881	123664881	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr4:123664881G>T	ENST00000314218.3	+	2	2027	c.1834G>T	c.(1834-1836)Gaa>Taa	p.E612*	BBS12_ENST00000542236.1_Nonsense_Mutation_p.E612*	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	612					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						TTACTCATCAGAATTTGAAGC	0.378									Bardet-Biedl syndrome																													dbGAP											0													85.0	83.0	83.0					4																	123664881		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1834G>T	4.37:g.123664881G>T	ENSP00000319062:p.Glu612*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Nonsense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	p.E612*	ENST00000314218.3	37	c.1834	CCDS3728.1	4	.	.	.	.	.	.	.	.	.	.	G	40	8.505213	0.98841	.	.	ENSG00000181004	ENST00000314218;ENST00000542236	.	.	.	5.81	4.97	0.65823	.	0.282205	0.39274	N	0.001417	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-34.5508	16.4957	0.84242	0.0:0.1415:0.8585:0.0	.	.	.	.	X	612	.	ENSP00000319062:E612X	E	+	1	0	BBS12	123884331	1.000000	0.71417	0.698000	0.30274	0.872000	0.50106	3.556000	0.53734	1.427000	0.47276	0.591000	0.81541	GAA	BBS12	-	superfamily_Cpn60/TCP-1	ENSG00000181004		0.378	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS12	HGNC	protein_coding	OTTHUMT00000256710.1	36	0.00	0	G	NM_152618		123664881	123664881	+1	no_errors	ENST00000314218	ensembl	human	known	69_37n	nonsense	25	10.71	3	SNP	0.997	T
MYRF	745	genome.wustl.edu	37	11	61537881	61537881	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr11:61537881G>A	ENST00000278836.5	+	5	720	c.624G>A	c.(622-624)aaG>aaA	p.K208K	TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000265460.5_Silent_p.K199K	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	208	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGTACATGAAGGCCGAGCCCC	0.682																																						dbGAP											0													13.0	12.0	12.0					11																	61537881		2163	4253	6416	-	-	-	SO:0001819	synonymous_variant	0				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.624G>A	11.37:g.61537881G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43582|Q9P1Q6	Silent	SNP	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	p.K208	ENST00000278836.5	37	c.624	CCDS44622.1	11																																																																																			C11orf9	-	NULL	ENSG00000124920		0.682	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf9	HGNC	protein_coding	OTTHUMT00000398519.2	25	0.00	0	G	NM_013279		61537881	61537881	+1	no_errors	ENST00000278836	ensembl	human	known	69_37n	silent	24	31.43	11	SNP	1.000	A
C9orf57	138240	genome.wustl.edu	37	9	74674237	74674237	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:74674237A>G	ENST00000377024.3	-	2	172	c.77T>C	c.(76-78)aTt>aCt	p.I26T	C9orf57_ENST00000424431.2_Intron	NM_001128618.1	NP_001122090.1	Q5W0N0	CI057_HUMAN	chromosome 9 open reading frame 57	26						integral component of membrane (GO:0016021)				endometrium(1)	1						AGCAAAAACAATCCTTCTCAT	0.408																																						dbGAP											0													118.0	99.0	105.0					9																	74674237		692	1591	2283	-	-	-	SO:0001583	missense	0			BC036255	CCDS47980.1	9q21.2	2012-03-15			ENSG00000204669	ENSG00000204669			27037	protein-coding gene	gene with protein product						12477932	Standard	NM_001128618		Approved		uc004aip.3	Q5W0N0	OTTHUMG00000020003	ENST00000377024.3:c.77T>C	9.37:g.74674237A>G	ENSP00000366223:p.Ile26Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L456	Missense_Mutation	SNP	NULL	p.I26T	ENST00000377024.3	37	c.77	CCDS47980.1	9	.	.	.	.	.	.	.	.	.	.	A	8.156	0.788409	0.16258	.	.	ENSG00000204669	ENST00000377024	.	.	.	3.61	-4.34	0.03666	.	.	.	.	.	T	0.20981	0.0505	N	0.08118	0	0.09310	N	1	B	0.24576	0.106	B	0.15484	0.013	T	0.19128	-1.0315	8	0.87932	D	0	.	11.4326	0.50050	0.2936:0.0:0.7064:0.0	.	26	Q5W0N0	CI057_HUMAN	T	26	.	ENSP00000366223:I26T	I	-	2	0	C9orf57	73864057	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.200000	0.09478	-0.834000	0.04239	-0.312000	0.09012	ATT	C9orf57	-	NULL	ENSG00000204669		0.408	C9orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf57	HGNC	protein_coding	OTTHUMT00000052631.1	35	0.00	0	A	NM_001128618		74674237	74674237	-1	no_errors	ENST00000377024	ensembl	human	known	69_37n	missense	10	61.54	16	SNP	0.000	G
CASP8AP2	9994	genome.wustl.edu	37	6	90566870	90566870	+	RNA	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr6:90566870G>T	ENST00000551025.1	+	0	1805									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AAAACTGCCAGAGTGGAAATA	0.333																																					Colon(187;1656 2025 17045 31481 39901)	dbGAP											0													53.0	48.0	50.0					6																	90566870		1819	4073	5892	-	-	-			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90566870G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.333	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		53	0.00	0	G	NM_001137667		90566870	90566870	+1	no_errors	ENST00000237177	ensembl	human	known	69_37n	rna	53	29.33	22	SNP	1.000	T
CBWD1	55871	genome.wustl.edu	37	9	121751	121751	+	Intron	SNP	T	T	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:121751T>A	ENST00000356521.4	-	15	1170				CBWD1_ENST00000382447.4_Intron|CBWD1_ENST00000377400.4_Intron|CBWD1_ENST00000314367.10_Intron|CBWD1_ENST00000475411.1_5'Flank	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1								ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CATTGGTCCTTGGATTAACCA	0.323																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.1082-178A>T	9.37:g.121751T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	RNA	SNP	-	NULL	ENST00000356521.4	37	NULL	CCDS6438.1	9																																																																																			CBWD1	-	-	ENSG00000172785		0.323	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	HGNC	protein_coding	OTTHUMT00000051463.1	34	0.00	0	T	NM_018491		121751	121751	-1	no_errors	ENST00000475990	ensembl	human	known	69_37n	rna	26	18.18	6	SNP	0.071	A
CD19	930	genome.wustl.edu	37	16	28948386	28948386	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr16:28948386C>G	ENST00000324662.3	+	8	1171	c.1127C>G	c.(1126-1128)cCg>cGg	p.P376R	CD19_ENST00000538922.1_Missense_Mutation_p.P376R|CD19_ENST00000567541.1_Missense_Mutation_p.P376R			P15391	CD19_HUMAN	CD19 molecule	376					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						GGCACTGCCCCGTCTTATGGA	0.667																																						dbGAP											0													16.0	18.0	17.0					16																	28948386		2187	4293	6480	-	-	-	SO:0001583	missense	0				CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.1127C>G	16.37:g.28948386C>G	ENSP00000313419:p.Pro376Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.P376R	ENST00000324662.3	37	c.1127	CCDS10644.1	16	.	.	.	.	.	.	.	.	.	.	C	13.31	2.199863	0.38905	.	.	ENSG00000177455	ENST00000538922;ENST00000380673;ENST00000324662;ENST00000537306	T;T	0.71817	-0.6;-0.6	3.81	-7.62	0.01294	.	1.863580	0.02668	N	0.108246	T	0.47893	0.1470	N	0.19112	0.55	0.09310	N	1	B;B	0.18863	0.031;0.018	B;B	0.12156	0.007;0.003	T	0.31364	-0.9946	10	0.46703	T	0.11	2.3495	0.8275	0.01124	0.3989:0.1244:0.2406:0.2361	.	376;376	F5H635;P15391	.;CD19_HUMAN	R	376;183;376;225	ENSP00000437940:P376R;ENSP00000313419:P376R	ENSP00000313419:P376R	P	+	2	0	CD19	28855887	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.625000	0.00875	-2.667000	0.00416	-0.502000	0.04539	CCG	CD19	-	NULL	ENSG00000177455		0.667	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD19	HGNC	protein_coding	OTTHUMT00000214152.2	41	0.00	0	C			28948386	28948386	+1	no_errors	ENST00000538922	ensembl	human	known	69_37n	missense	31	38.00	19	SNP	0.000	G
CHAMP1	283489	genome.wustl.edu	37	13	115091669	115091669	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr13:115091669A>C	ENST00000361283.1	+	3	2661	c.2352A>C	c.(2350-2352)ttA>ttC	p.L784F		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	784	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										AGAAACATTTAACTCATTGTC	0.383																																						dbGAP											0													42.0	43.0	43.0					13																	115091669		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.2352A>C	13.37:g.115091669A>C	ENSP00000354730:p.Leu784Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L784F	ENST00000361283.1	37	c.2352	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	a	15.78	2.935572	0.52866	.	.	ENSG00000198824	ENST00000361283	T	0.01455	4.87	5.92	3.49	0.39957	Zinc finger, C2H2-like (1);	0.000000	0.46758	D	0.000278	T	0.11153	0.0272	M	0.88181	2.935	0.37663	D	0.922841	D	0.89917	1.0	D	0.83275	0.996	T	0.00912	-1.1517	9	.	.	.	-7.6287	10.1128	0.42572	0.8649:0.0:0.1351:0.0	.	784	Q96JM3	ZN828_HUMAN	F	784	ENSP00000354730:L784F	.	L	+	3	2	ZNF828	114109771	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.202000	0.58446	0.492000	0.27815	0.533000	0.62120	TTA	CHAMP1	-	smart_Znf_C2H2-like	ENSG00000198824		0.383	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2	22	0.00	0	A	NM_032436		115091669	115091669	+1	no_errors	ENST00000361283	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	1.000	C
CMYA5	202333	genome.wustl.edu	37	5	79084846	79084846	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr5:79084846G>C	ENST00000446378.2	+	10	11639	c.11608G>C	c.(11608-11610)Gat>Cat	p.D3870H	CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3870	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CCAACCCAATGATAACTACTT	0.393																																						dbGAP											0													165.0	163.0	164.0					5																	79084846		1892	4112	6004	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.11608G>C	5.37:g.79084846G>C	ENSP00000394770:p.Asp3870His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.D3870H	ENST00000446378.2	37	c.11608	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	25.0	4.593314	0.86953	.	.	ENSG00000164309	ENST00000446378	T	0.52983	0.64	5.75	5.75	0.90469	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56470	0.1987	N	0.19112	0.55	0.46954	D	0.999261	D	0.89917	1.0	D	0.69307	0.963	T	0.61282	-0.7094	9	0.87932	D	0	.	19.5514	0.95322	0.0:0.0:1.0:0.0	.	3870	Q8N3K9	CMYA5_HUMAN	H	3870	ENSP00000394770:D3870H	ENSP00000394770:D3870H	D	+	1	0	CMYA5	79120602	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.817000	0.91985	2.708000	0.92522	0.650000	0.86243	GAT	CMYA5	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000164309		0.393	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	49	0.00	0	G	NM_153610		79084846	79084846	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	1.000	C
COG7	91949	genome.wustl.edu	37	16	23457182	23457182	+	Silent	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr16:23457182G>T	ENST00000307149.5	-	2	455	c.270C>A	c.(268-270)gtC>gtA	p.V90V	CTD-2270L9.2_ENST00000561624.2_RNA	NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	90					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		TGTCCTCCTTGACAAGAATCA	0.428																																						dbGAP											0													149.0	133.0	138.0					16																	23457182		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.270C>A	16.37:g.23457182G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWU7	Silent	SNP	pfam_COG_su7	p.V90	ENST00000307149.5	37	c.270	CCDS10610.1	16																																																																																			COG7	-	pfam_COG_su7	ENSG00000168434		0.428	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG7	HGNC	protein_coding	OTTHUMT00000211625.1	51	0.00	0	G			23457182	23457182	-1	no_errors	ENST00000307149	ensembl	human	known	69_37n	silent	61	23.75	19	SNP	0.999	T
COPA	1314	genome.wustl.edu	37	1	160261648	160261648	+	Silent	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:160261648C>T	ENST00000241704.7	-	30	3448	c.3219G>A	c.(3217-3219)ctG>ctA	p.L1073L	COPA_ENST00000368069.3_Silent_p.L1082L	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	1073					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCTCTTTGGGCAGCTTCTTCC	0.517											OREG0013929	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													244.0	245.0	245.0					1																	160261648		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.3219G>A	1.37:g.160261648C>T		Somatic	1807	WXS	Illumina GAIIx	Phase_IV	Q5T201|Q8IXZ9	Silent	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1082	ENST00000241704.7	37	c.3246	CCDS1202.1	1																																																																																			COPA	-	pfam_Coatomer_asu_C,pirsf_Coatomer_asu	ENSG00000122218		0.517	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1	101	0.00	0	C	NM_004371		160261648	160261648	-1	no_errors	ENST00000368069	ensembl	human	known	69_37n	silent	95	22.76	28	SNP	1.000	T
CSF3	1440	genome.wustl.edu	37	17	38172764	38172764	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr17:38172764C>G	ENST00000225474.2	+	4	370	c.339C>G	c.(337-339)agC>agG	p.S113R	CSF3_ENST00000394149.3_Missense_Mutation_p.S110R|CSF3_ENST00000577675.1_Missense_Mutation_p.S70R|CSF3_ENST00000331769.2_Missense_Mutation_p.S106R|RP11-387H17.6_ENST00000583462.1_lincRNA|CSF3_ENST00000394148.3_Missense_Mutation_p.S77R			P09919	CSF3_HUMAN	colony stimulating factor 3 (granulocyte)	113					cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|granulocyte differentiation (GO:0030851)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of neuron death (GO:1901215)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|granulocyte colony-stimulating factor receptor binding (GO:0005130)			endometrium(1)|ovary(1)|prostate(1)	3	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)				AACTCCATAGCGGCCTTTTCC	0.617																																						dbGAP											0													98.0	109.0	105.0					17																	38172764		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11357.1, CCDS11358.1, CCDS42314.1, CCDS11358.2	17q11.2-q12	2014-01-30			ENSG00000108342	ENSG00000108342		"""Endogenous ligands"""	2438	protein-coding gene	gene with protein product	"""granulocyte colony stimulating factor"", ""pluripoietin"", ""filgrastim"", ""lenograstim"""	138970	"""chromosome 17 open reading frame 33"""	GCSF, G-CSF, C17orf33		3499671, 3501046	Standard	NM_000759		Approved	MGC45931	uc002htp.3	P09919	OTTHUMG00000133247	ENST00000225474.2:c.339C>G	17.37:g.38172764C>G	ENSP00000225474:p.Ser113Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXR7	Missense_Mutation	SNP	pfam_IL6_MGF_GCSF,superfamily_4_helix_cytokine-like_core,smart_IL6_MGF_GCSF,pirsf_IL6_MGF_GCSF,prints_IL6_MGF_GCSF	p.S113R	ENST00000225474.2	37	c.339	CCDS11357.1	17	.	.	.	.	.	.	.	.	.	.	C	12.03	1.815848	0.32145	.	.	ENSG00000108342	ENST00000394149;ENST00000225474;ENST00000331769;ENST00000394148	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.04	-10.1	0.00402	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.034200	0.07525	N	0.911219	T	0.14270	0.0345	L	0.46157	1.445	0.22127	N	0.999346	B;B;B;B	0.16603	0.014;0.018;0.006;0.006	B;B;B;B	0.19391	0.015;0.025;0.025;0.025	T	0.20739	-1.0266	10	0.39692	T	0.17	-0.2715	7.4896	0.27454	0.0804:0.2309:0.0799:0.6088	.	70;106;113;110	B4DNY7;Q8N4W3;P09919;Q6FH65	.;.;CSF3_HUMAN;.	R	110;113;106;77	ENSP00000377705:S110R;ENSP00000225474:S113R;ENSP00000327766:S106R;ENSP00000377704:S77R	ENSP00000225474:S113R	S	+	3	2	CSF3	35426290	0.000000	0.05858	0.006000	0.13384	0.249000	0.25844	-2.984000	0.00661	-2.528000	0.00493	-0.493000	0.04662	AGC	CSF3	-	pfam_IL6_MGF_GCSF,superfamily_4_helix_cytokine-like_core,smart_IL6_MGF_GCSF,pirsf_IL6_MGF_GCSF,prints_IL6_MGF_GCSF	ENSG00000108342		0.617	CSF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSF3	HGNC	protein_coding	OTTHUMT00000256988.2	56	0.00	0	C	NM_172220		38172764	38172764	+1	no_errors	ENST00000225474	ensembl	human	known	69_37n	missense	18	54.76	23	SNP	0.000	G
CSMD1	64478	genome.wustl.edu	37	8	2824186	2824186	+	Silent	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr8:2824186G>T	ENST00000520002.1	-	59	9564	c.9009C>A	c.(9007-9009)atC>atA	p.I3003I	CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000537824.1_Silent_p.I3002I|CSMD1_ENST00000602557.1_Silent_p.I3003I|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3003	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGCAGGCATAGATGACCGAGC	0.547																																						dbGAP											0													73.0	76.0	75.0					8																	2824186		2078	4212	6290	-	-	-	SO:0001819	synonymous_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9009C>A	8.37:g.2824186G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.L2420I	ENST00000520002.1	37	c.7258		8	.	.	.	.	.	.	.	.	.	.	G	9.372	1.070774	0.20147	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	T	0.65004	0.2650	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63019	-0.6730	4	.	.	.	.	13.0608	0.59005	0.0831:0.0:0.9169:0.0	.	.	.	.	I	2420	.	.	L	-	1	2	CSMD1	2811593	1.000000	0.71417	0.964000	0.40570	0.888000	0.51559	0.961000	0.29267	2.557000	0.86248	0.655000	0.94253	CTA	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.547	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	64	0.00	0	G	NM_033225		2824186	2824186	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000335551	ensembl	human	novel	69_37n	missense	35	12.50	5	SNP	1.000	T
CYP2D7	1564	genome.wustl.edu	37	22	42540319	42540319	+	RNA	SNP	A	A	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr22:42540319A>C	ENST00000358097.4	-	0	231				CYP2D7P1_ENST00000433992.1_RNA|CYP2D7P1_ENST00000424775.1_RNA																endometrium(1)	1						CTGGAAGTCCACATGCAGCAA	0.647																																					GBM(91;329 1845 13264 22235)	dbGAP											0																																										-	-	-			0																															22.37:g.42540319A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C49W	ENST00000358097.4	37	c.147		22	.	.	.	.	.	.	.	.	.	.	A	8.393	0.840112	0.16891	.	.	ENSG00000205702	ENST00000428297;ENST00000354609	.	.	.	3.02	3.02	0.34903	.	0.911994	0.09196	N	0.835298	T	0.63604	0.2525	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63703	-0.6577	6	0.87932	D	0	.	7.8969	0.29712	1.0:0.0:0.0:0.0	.	.	.	.	G	48	.	ENSP00000442416:V48G	V	-	2	0	CYP2D7P1	40870263	0.931000	0.31567	0.937000	0.37676	0.036000	0.12997	2.438000	0.44837	1.636000	0.50526	0.416000	0.27883	GTG	CYP2D7P1	-	NULL	ENSG00000205702		0.647	CYP2D7P1-002	KNOWN	basic	polymorphic_pseudogene	CYP2D7P1	HGNC	polymorphic_pseudogene	OTTHUMT00000075076.3	121	0.00	0	A			42540319	42540319	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433992	ensembl	human	known	69_37n	missense	49	41.67	35	SNP	0.950	C
DAPK1	1612	genome.wustl.edu	37	9	90301529	90301529	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:90301529T>C	ENST00000408954.3	+	21	2623	c.2288T>C	c.(2287-2289)aTg>aCg	p.M763T	DAPK1_ENST00000358077.5_Missense_Mutation_p.M763T|DAPK1_ENST00000491893.1_Missense_Mutation_p.M763T|DAPK1_ENST00000469640.2_Missense_Mutation_p.M763T|DAPK1_ENST00000472284.1_Missense_Mutation_p.M763T	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	763					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						AGCCGCAGCATGATGTTCGAG	0.587									Chronic Lymphocytic Leukemia, Familial Clustering of																													dbGAP											0													72.0	87.0	82.0					9																	90301529		2136	4248	6384	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2288T>C	9.37:g.90301529T>C	ENSP00000386135:p.Met763Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt	p.M763T	ENST00000408954.3	37	c.2288	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	T	7.338	0.620399	0.14193	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.65732	-0.17;-0.17;-0.15;-0.17;-0.12	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000009	T	0.69142	0.3078	L	0.47716	1.5	0.80722	D	1	P;P	0.50156	0.932;0.932	P;P	0.58391	0.838;0.838	T	0.66712	-0.5854	10	0.32370	T	0.25	.	14.8043	0.69942	0.0:0.0:0.0:1.0	.	763;763	B7ZLE7;P53355	.;DAPK1_HUMAN	T	763	ENSP00000350785:M763T;ENSP00000417076:M763T;ENSP00000418885:M763T;ENSP00000386135:M763T;ENSP00000419026:M763T	ENSP00000350785:M763T	M	+	2	0	DAPK1	89491349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.839000	0.86812	2.159000	0.67721	0.533000	0.62120	ATG	DAPK1	-	NULL	ENSG00000196730		0.587	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	95	0.00	0	T	NM_004938		90301529	90301529	+1	no_errors	ENST00000469640	ensembl	human	known	69_37n	missense	53	32.05	25	SNP	1.000	C
DCHS2	54798	genome.wustl.edu	37	4	155219402	155219402	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr4:155219402C>T	ENST00000357232.4	-	18	4698	c.4699G>A	c.(4699-4701)Gta>Ata	p.V1567I		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1567	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTTATAATTACAGTGGTGCTT	0.443																																						dbGAP											0													103.0	102.0	102.0					4																	155219402		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4699G>A	4.37:g.155219402C>T	ENSP00000349768:p.Val1567Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V1567I	ENST00000357232.4	37	c.4699	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088531	0.36855	.	.	ENSG00000197410	ENST00000357232	T	0.52983	0.64	5.66	3.9	0.45041	Cadherin (4);Cadherin-like (1);	0.179687	0.37219	N	0.002193	T	0.47021	0.1423	M	0.71871	2.18	0.42283	D	0.992106	B	0.28419	0.211	B	0.30029	0.11	T	0.41910	-0.9482	10	0.38643	T	0.18	.	11.3688	0.49687	0.0:0.7997:0.1312:0.0692	.	1567	Q6V1P9	PCD23_HUMAN	I	1567	ENSP00000349768:V1567I	ENSP00000349768:V1567I	V	-	1	0	DCHS2	155438852	0.009000	0.17119	0.003000	0.11579	0.238000	0.25445	1.329000	0.33770	0.820000	0.34516	0.650000	0.86243	GTA	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.443	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	58	0.00	0	C	NM_001142552		155219402	155219402	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	0.062	T
DMBX1	127343	genome.wustl.edu	37	1	46977811	46977811	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:46977811G>A	ENST00000360032.3	+	4	793	c.779G>A	c.(778-780)cGt>cAt	p.R260H	DMBX1_ENST00000371956.4_Missense_Mutation_p.R265H	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					AGCCTCTTCCGTCTGCAGGAG	0.667																																						dbGAP											0													66.0	69.0	68.0					1																	46977811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.779G>A	1.37:g.46977811G>A	ENSP00000353132:p.Arg260His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.R265H	ENST00000360032.3	37	c.794	CCDS536.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.246459	0.95305	.	.	ENSG00000197587	ENST00000371956;ENST00000360032	D;D	0.94280	-3.29;-3.39	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.95271	0.8466	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94407	0.7628	10	0.37606	T	0.19	.	17.9191	0.88961	0.0:0.0:1.0:0.0	.	265;260	Q8NFW5;Q8NFW5-2	DMBX1_HUMAN;.	H	265;260	ENSP00000361024:R265H;ENSP00000353132:R260H	ENSP00000353132:R260H	R	+	2	0	DMBX1	46750398	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.720000	0.98763	2.560000	0.86352	0.655000	0.94253	CGT	DMBX1	-	NULL	ENSG00000197587		0.667	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DMBX1	HGNC	protein_coding	OTTHUMT00000021895.1	133	0.00	0	G			46977811	46977811	+1	no_errors	ENST00000371956	ensembl	human	known	69_37n	missense	37	50.00	37	SNP	1.000	A
DMBX1	127343	genome.wustl.edu	37	1	46977813	46977813	+	Silent	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:46977813C>T	ENST00000360032.3	+	4	795	c.781C>T	c.(781-783)Ctg>Ttg	p.L261L	DMBX1_ENST00000371956.4_Silent_p.L266L	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					CCTCTTCCGTCTGCAGGAGCA	0.667																																						dbGAP											0													65.0	68.0	67.0					1																	46977813		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.781C>T	1.37:g.46977813C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.L266	ENST00000360032.3	37	c.796	CCDS536.1	1																																																																																			DMBX1	-	NULL	ENSG00000197587		0.667	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DMBX1	HGNC	protein_coding	OTTHUMT00000021895.1	135	0.00	0	C			46977813	46977813	+1	no_errors	ENST00000371956	ensembl	human	known	69_37n	silent	40	48.72	38	SNP	1.000	T
EEF1B2	1933	genome.wustl.edu	37	2	207026111	207026111	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:207026111C>T	ENST00000392222.2	+	3	620	c.245C>T	c.(244-246)gCc>gTc	p.A82V	NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000423725.1_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.A82V|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|SNORA41_ENST00000384675.1_RNA|EEF1B2_ENST00000236957.5_Missense_Mutation_p.A82V|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000455934.2_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	82	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						TATGGTCCTGCCGATGTGGAA	0.413																																						dbGAP											0													158.0	149.0	152.0					2																	207026111		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.245C>T	2.37:g.207026111C>T	ENSP00000376056:p.Ala82Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K795|Q6IBH9	Missense_Mutation	SNP	pfam_Transl_elong_fac_EF1B_bsu/dsu,pfam_EF-1_beta_acid_region_euk,superfamily_Transl_elong_fac_EF1B_bsu/dsu,superfamily_Glutathione-S-Trfase_C-like,smart_Transl_elong_fac_EF1B_bsu/dsu	p.A82V	ENST00000392222.2	37	c.245	CCDS2367.1	2	.	.	.	.	.	.	.	.	.	.	C	13.00	2.105461	0.37145	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.17	2.38	0.29361	.	0.333654	0.34906	N	0.003596	T	0.28200	0.0696	L	0.36672	1.1	0.32568	N	0.530112	B	0.15930	0.015	B	0.18263	0.021	T	0.20306	-1.0279	10	0.29301	T	0.29	-1.9653	5.9743	0.19369	0.0:0.6418:0.137:0.2211	.	82	P24534	EF1B_HUMAN	V	82	ENSP00000236957:A82V;ENSP00000376055:A82V;ENSP00000376056:A82V;ENSP00000407730:A82V	ENSP00000236957:A82V	A	+	2	0	EEF1B2	206734356	0.588000	0.26799	0.255000	0.24374	0.734000	0.41952	1.178000	0.31981	0.197000	0.20387	-0.263000	0.10527	GCC	EEF1B2	-	NULL	ENSG00000114942		0.413	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EEF1B2	HGNC	protein_coding	OTTHUMT00000336436.1	76	0.00	0	C	NM_001037663		207026111	207026111	+1	no_errors	ENST00000236957	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.884	T
EGFR	1956	genome.wustl.edu	37	7	55223574	55223574	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr7:55223574A>G	ENST00000275493.2	+	8	1118	c.941A>G	c.(940-942)gAc>gGc	p.D314G	EGFR_ENST00000455089.1_Missense_Mutation_p.D269G|EGFR_ENST00000344576.2_Missense_Mutation_p.D314G|EGFR_ENST00000442591.1_Missense_Mutation_p.D314G|EGFR_ENST00000420316.2_Missense_Mutation_p.D314G|EGFR_ENST00000342916.3_Missense_Mutation_p.D314G|EGFR_ENST00000454757.2_Missense_Mutation_p.D261G	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	314					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGTGGGGCCGACAGCTATGAG	0.592		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												dbGAP	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0													52.0	49.0	50.0					7																	55223574		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.941A>G	7.37:g.55223574A>G	ENSP00000275493:p.Asp314Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D314G	ENST00000275493.2	37	c.941	CCDS5514.1	7	.	.	.	.	.	.	.	.	.	.	A	6.827	0.521678	0.13005	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.64	5.64	0.86602	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	0.139334	0.64402	D	0.000004	T	0.25901	0.0631	N	0.02973	-0.45	0.47374	D	0.999401	B;B;B;B;B	0.06786	0.001;0.0;0.001;0.001;0.001	B;B;B;B;B	0.17979	0.003;0.02;0.004;0.007;0.003	T	0.10917	-1.0609	10	0.25751	T	0.34	.	14.6824	0.69028	1.0:0.0:0.0:0.0	.	269;314;314;314;314	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	G	269;314;184;314;314;314;314;261;108	ENSP00000415559:D269G;ENSP00000342376:D314G;ENSP00000345973:D314G;ENSP00000413843:D314G;ENSP00000275493:D314G;ENSP00000410031:D314G;ENSP00000395243:D261G	ENSP00000275493:D314G	D	+	2	0	EGFR	55191068	1.000000	0.71417	0.996000	0.52242	0.171000	0.22731	6.326000	0.72905	2.145000	0.66743	0.533000	0.62120	GAC	EGFR	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt	ENSG00000146648		0.592	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	HGNC	protein_coding	OTTHUMT00000251456.2	85	0.00	0	A	NM_005228		55223574	55223574	+1	no_errors	ENST00000275493	ensembl	human	known	69_37n	missense	69	28.57	28	SNP	1.000	G
ENG	2022	genome.wustl.edu	37	9	130578203	130578203	+	Intron	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:130578203G>T	ENST00000373203.4	-	14	2253				ENG_ENST00000480266.1_5'Flank|RP11-228B15.4_ENST00000425991.1_RNA|ENG_ENST00000344849.3_Missense_Mutation_p.P624Q|RP11-228B15.4_ENST00000439298.1_RNA	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin						artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						TGCTCACTGTGGGGGCCTGGG	0.677									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																													dbGAP											0													37.0	28.0	31.0					9																	130578203		2192	4290	6482	-	-	-	SO:0001627	intron_variant	0	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.1852+18C>A	9.37:g.130578203G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14248|Q14926|Q5T9C0	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105	p.P624Q	ENST00000373203.4	37	c.1871	CCDS48029.1	9	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813611	0.50527	.	.	ENSG00000106991	ENST00000344849	T	0.33216	1.42	5.25	4.34	0.51931	.	.	.	.	.	T	0.11537	0.0281	N	0.08118	0	0.41368	D	0.987478	P	0.38827	0.649	B	0.32211	0.142	T	0.11891	-1.0569	9	0.14656	T	0.56	.	6.4067	0.21668	0.0854:0.0:0.5884:0.3262	.	624	Q5T9B9	.	Q	624	ENSP00000341917:P624Q	ENSP00000341917:P624Q	P	-	2	0	ENG	129618024	0.990000	0.36364	0.735000	0.30896	0.713000	0.41058	0.328000	0.19681	1.169000	0.42739	0.462000	0.41574	CCA	ENG	-	NULL	ENSG00000106991		0.677	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENG	HGNC	protein_coding	OTTHUMT00000054313.1	36	0.00	0	G			130578203	130578203	-1	no_errors	ENST00000344849	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.600	T
EXOC6B	23233	genome.wustl.edu	37	2	72802668	72802668	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:72802668G>A	ENST00000272427.6	-	7	929	c.799C>T	c.(799-801)Cag>Tag	p.Q267*	EXOC6B_ENST00000410104.1_Nonsense_Mutation_p.Q267*	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	267					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						CCTGAATCCTGTTCAGACTTC	0.363																																						dbGAP											0													179.0	166.0	170.0					2																	72802668		1864	4094	5958	-	-	-	SO:0001587	stop_gained	0			AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.799C>T	2.37:g.72802668G>A	ENSP00000272427:p.Gln267*	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZY3	Nonsense_Mutation	SNP	pfam_Sec15,pirsf_Sec15	p.Q267*	ENST00000272427.6	37	c.799	CCDS46333.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.570936	0.97671	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	.	.	.	6.16	6.16	0.99307	.	0.190862	0.47093	D	0.000251	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	19.4236	0.94732	0.0:0.0:1.0:0.0	.	.	.	.	X	267	.	ENSP00000272427:Q267X	Q	-	1	0	EXOC6B	72656176	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.716000	0.74702	2.937000	0.99478	0.650000	0.86243	CAG	EXOC6B	-	pirsf_Sec15	ENSG00000144036		0.363	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6B	HGNC	protein_coding	OTTHUMT00000327558.1	94	0.00	0	G	XM_039570		72802668	72802668	-1	no_errors	ENST00000272427	ensembl	human	known	69_37n	nonsense	37	36.21	21	SNP	1.000	A
FAM198A	729085	genome.wustl.edu	37	3	43074558	43074558	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:43074558T>G	ENST00000430121.2	+	2	898	c.803T>G	c.(802-804)aTg>aGg	p.M268R	KRBOX1_ENST00000443313.1_Intron	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	268						extracellular region (GO:0005576)				endometrium(1)	1						GATGTGCAGATGCTCCGTCTG	0.617																																						dbGAP											0													29.0	36.0	34.0					3																	43074558		692	1591	2283	-	-	-	SO:0001583	missense	0			AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.803T>G	3.37:g.43074558T>G	ENSP00000407301:p.Met268Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR48	Missense_Mutation	SNP	NULL	p.M268R	ENST00000430121.2	37	c.803	CCDS46808.1	3	.	.	.	.	.	.	.	.	.	.	T	7.528	0.658092	0.14645	.	.	ENSG00000144649	ENST00000430121	T	0.27402	1.67	5.11	-5.09	0.02920	.	0.590530	0.16170	N	0.226334	T	0.11452	0.0279	N	0.16368	0.405	0.09310	N	0.999994	B	0.20164	0.042	B	0.21917	0.037	T	0.18903	-1.0322	9	.	.	.	-14.5421	1.7353	0.02941	0.221:0.2117:0.0967:0.4706	.	268	Q9UFP1	F198A_HUMAN	R	268	ENSP00000407301:M268R	.	M	+	2	0	FAM198A	43049562	0.135000	0.22499	0.000000	0.03702	0.012000	0.07955	-0.032000	0.12266	-0.618000	0.05656	-0.248000	0.11899	ATG	FAM198A	-	NULL	ENSG00000144649		0.617	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM198A	HGNC	protein_coding	OTTHUMT00000344240.3	56	0.00	0	T	NM_001129908		43074558	43074558	+1	no_errors	ENST00000273146	ensembl	human	known	69_37n	missense	18	53.85	21	SNP	0.371	G
FAM24A	118670	genome.wustl.edu	37	10	124672467	124672467	+	Silent	SNP	C	C	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr10:124672467C>A	ENST00000368894.1	+	3	436	c.315C>A	c.(313-315)ctC>ctA	p.L105L		NM_001029888.1	NP_001025059.1	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A	105						extracellular region (GO:0005576)				large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	9		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		ATGAGGGCCTCTGACTTGGGA	0.408																																						dbGAP											0													93.0	74.0	80.0					10																	124672467		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31304.1	10q26.13	2008-08-27			ENSG00000203795	ENSG00000203795			23470	protein-coding gene	gene with protein product							Standard	NM_001029888		Approved	AC073585.4	uc001lgv.3	A6NFZ4	OTTHUMG00000019193	ENST00000368894.1:c.315C>A	10.37:g.124672467C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L105	ENST00000368894.1	37	c.315	CCDS31304.1	10																																																																																			FAM24A	-	NULL	ENSG00000203795		0.408	FAM24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM24A	HGNC	protein_coding	OTTHUMT00000050824.1	68	0.00	0	C	XM_058332		124672467	124672467	+1	no_errors	ENST00000368894	ensembl	human	known	69_37n	silent	50	31.51	23	SNP	0.088	A
FAM26D	221301	genome.wustl.edu	37	6	116875493	116875493	+	Silent	SNP	T	T	C	rs9387420	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr6:116875493T>C	ENST00000368596.3	+	1	581	c.537T>C	c.(535-537)ctT>ctC	p.L179L	FAM26D_ENST00000368597.2_Intron|FAM26D_ENST00000416171.2_Silent_p.L35L|FAM26D_ENST00000405399.1_Silent_p.L36L			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	179					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		AAATAGCTCTTCTGCACAGAT	0.408													T|||	1127	0.22504	0.1528	0.1542	5008	,	,		21118	0.3482		0.17	False		,,,				2504	0.3027					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.537T>C	6.37:g.116875493T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Silent	SNP	NULL	p.L179	ENST00000368596.3	37	c.537		6																																																																																			FAM26D	-	NULL	ENSG00000164451		0.408	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	32	0.00	0	T	NM_153036		116875493	116875493	+1	no_errors	ENST00000368596	ensembl	human	known	69_37n	silent	21	12.50	3	SNP	1.000	C
FATE1	89885	genome.wustl.edu	37	X	150884628	150884628	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chrX:150884628G>T	ENST00000370350.3	+	1	122	c.37G>T	c.(37-39)Gaa>Taa	p.E13*		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	13						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GGCGGAGATGGAAATGTCCCT	0.537																																						dbGAP											0													85.0	64.0	72.0					X																	150884628		2030	3766	5796	-	-	-	SO:0001587	stop_gained	0			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.37G>T	X.37:g.150884628G>T	ENSP00000359375:p.Glu13*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.E13*	ENST00000370350.3	37	c.37	CCDS14700.1	X	.	.	.	.	.	.	.	.	.	.	G	18.54	3.647130	0.67358	.	.	ENSG00000147378	ENST00000370350;ENST00000417321	.	.	.	4.18	2.39	0.29439	.	0.777035	0.11327	N	0.575438	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	4.8205	0.13389	0.1215:0.2161:0.6624:0.0	.	.	.	.	X	13;5	.	ENSP00000359375:E13X	E	+	1	0	FATE1	150635284	0.012000	0.17670	0.001000	0.08648	0.012000	0.07955	0.949000	0.29109	0.521000	0.28445	0.600000	0.82982	GAA	FATE1	-	NULL	ENSG00000147378		0.537	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	40	0.00	0	G	NM_033085		150884628	150884628	+1	no_errors	ENST00000370350	ensembl	human	known	69_37n	nonsense	35	10.26	4	SNP	0.001	T
FBXL2	25827	genome.wustl.edu	37	3	33416911	33416911	+	Splice_Site	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:33416911G>T	ENST00000484457.1	+	10	879		c.e10+1		FBXL2_ENST00000283627.6_Splice_Site|FBXL2_ENST00000538892.1_Splice_Site|FBXL2_ENST00000446237.3_Splice_Site|FBXL2_ENST00000507198.1_Splice_Site|FBXL2_ENST00000542085.1_Splice_Site|FBXL2_ENST00000538181.1_Splice_Site	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2											endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						CGCGACTGCAGTGAGTACACT	0.562																																						dbGAP											0													93.0	88.0	90.0					3																	33416911		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.788+1G>T	3.37:g.33416911G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e10+1	ENST00000484457.1	37	c.788+1	CCDS2658.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185411	0.78677	.	.	ENSG00000153558	ENST00000484457;ENST00000538892;ENST00000538181;ENST00000507198	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4115	0.87487	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FBXL2	33391915	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	9.362000	0.97126	2.718000	0.92993	0.644000	0.83932	.	FBXL2	-	-	ENSG00000153558		0.562	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL2	HGNC	protein_coding	OTTHUMT00000253245.2	58	0	0	G	NM_012157	Intron	33416911	33416911	+1	no_errors	ENST00000484457	ensembl	human	known	69_37n	splice_site	53	44.79	43	SNP	1.000	T
FBXL2	25827	genome.wustl.edu	37	3	33416911	33416911	+	Splice_Site	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:33416911G>T	ENST00000484457.1	+	10	879		c.e10+1		FBXL2_ENST00000283627.6_Splice_Site|FBXL2_ENST00000538892.1_Splice_Site|FBXL2_ENST00000446237.3_Splice_Site|FBXL2_ENST00000507198.1_Splice_Site|FBXL2_ENST00000542085.1_Splice_Site|FBXL2_ENST00000538181.1_Splice_Site	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2											endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						CGCGACTGCAGTGAGTACACT	0.562																																						dbGAP											0													93.0	88.0	90.0					3																	33416911		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.788+1G>T	3.37:g.33416911G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e10+1	ENST00000484457.1	37	c.788+1	CCDS2658.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185411	0.78677	.	.	ENSG00000153558	ENST00000484457;ENST00000538892;ENST00000538181;ENST00000507198	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4115	0.87487	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FBXL2	33391915	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	9.362000	0.97126	2.718000	0.92993	0.644000	0.83932	.	FBXL2	-	-	ENSG00000153558		0.562	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL2	HGNC	protein_coding	OTTHUMT00000253245.2	58	0.00	0	G	NM_012157	Intron	33416911	33416911	+1	no_errors	ENST00000484457	ensembl	human	known	69_37n	splice_site	53	44.79	43	SNP	1.000	T
FGFR1	2260	genome.wustl.edu	37	8	38273484	38273484	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr8:38273484G>A	ENST00000447712.2	-	13	2699	c.1758C>T	c.(1756-1758)aaC>aaT	p.N586N	FGFR1_ENST00000335922.5_Silent_p.N576N|FGFR1_ENST00000397091.5_Silent_p.N584N|FGFR1_ENST00000397103.1_Silent_p.N497N|FGFR1_ENST00000532791.1_Silent_p.N584N|FGFR1_ENST00000356207.5_Silent_p.N497N|FGFR1_ENST00000397108.4_Silent_p.N584N|FGFR1_ENST00000425967.3_Silent_p.N617N|FGFR1_ENST00000341462.5_Silent_p.N586N|FGFR1_ENST00000397113.2_Silent_p.N584N|FGFR1_ENST00000326324.6_Silent_p.N495N	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	586	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGTGGCTGGGGTTGTAGCAGT	0.622		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														Melanoma(146;1153 1840 21453 21841 43625)	dbGAP		Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	0													45.0	55.0	52.0					8																	38273484		2140	4273	6413	-	-	-	SO:0001819	synonymous_variant	0			M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.1758C>T	8.37:g.38273484G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.N617	ENST00000447712.2	37	c.1851	CCDS6107.2	8																																																																																			FGFR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfscan_Prot_kinase_cat_dom	ENSG00000077782		0.622	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	HGNC	protein_coding		62	0.00	0	G			38273484	38273484	-1	no_errors	ENST00000425967	ensembl	human	known	69_37n	silent	111	13.95	18	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186627943	186627943	+	Missense_Mutation	SNP	T	T	C	rs17228441	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:186627943T>C	ENST00000424728.1	+	12	1274	c.1274T>C	c.(1273-1275)aTt>aCt	p.I425T	FSIP2_ENST00000546113.1_3'UTR|FSIP2_ENST00000343098.5_Missense_Mutation_p.I514T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	425										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGTTCAATTATTTCAGCGCAG	0.353													T|||	2706	0.540335	0.5582	0.4928	5008	,	,		17696	0.4702		0.5089	False		,,,				2504	0.6544					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.1274T>C	2.37:g.186627943T>C	ENSP00000401306:p.Ile425Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.I514T	ENST00000424728.1	37	c.1541		2	1107	0.5068681318681318	275	0.5589430894308943	185	0.511049723756906	268	0.46853146853146854	379	0.5	T	11.18	1.562444	0.27915	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.57273	0.41;0.42	3.18	3.18	0.36537	.	1.289890	0.05751	N	0.603170	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	P	0.42518	0.782	B	0.37144	0.242	T	0.42464	-0.9450	9	0.59425	D	0.04	.	8.15	0.31134	0.0:0.0:0.0:1.0	rs17228441	425	Q5CZC0	FSIP2_HUMAN	T	514;425;425	ENSP00000344403:I514T;ENSP00000401306:I425T	ENSP00000321903:I425T	I	+	2	0	FSIP2	186336188	0.013000	0.17824	0.116000	0.21606	0.027000	0.11550	0.187000	0.16998	1.711000	0.51337	0.477000	0.44152	ATT	FSIP2	-	NULL	ENSG00000188738		0.353	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	34	0.00	0	T	NM_173651		186627943	186627943	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.149	C
FXYD3	5349	genome.wustl.edu	37	19	35613803	35613803	+	Intron	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr19:35613803A>G	ENST00000344013.6	+	7	368				FXYD3_ENST00000535103.1_Intron|FXYD3_ENST00000604804.1_Intron|FXYD3_ENST00000406242.3_Missense_Mutation_p.T78A|FXYD3_ENST00000605550.1_Intron|FXYD3_ENST00000604404.1_Intron|FXYD3_ENST00000346446.5_Missense_Mutation_p.T78A|FXYD3_ENST00000604621.1_Intron|FXYD3_ENST00000435734.2_Missense_Mutation_p.T78A|FXYD3_ENST00000604255.1_Intron|FXYD3_ENST00000603181.1_Intron|FXYD3_ENST00000406988.1_Intron|LGI4_ENST00000493050.1_5'Flank|FXYD3_ENST00000605677.1_Missense_Mutation_p.T78A|FXYD3_ENST00000603524.1_Intron			Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of catalytic activity (GO:0050790)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			endometrium(1)|lung(2)|prostate(1)	4	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			TCCCCTGACCACTCAGCTCTC	0.627																																						dbGAP											0													41.0	46.0	45.0					19																	35613803		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			X93036	CCDS12442.1, CCDS12443.1, CCDS46048.1, CCDS46049.1, CCDS46050.1	19q13.11-q13.12	2008-05-14	2002-01-14			ENSG00000089356			4027	protein-coding gene	gene with protein product		604996	"""FXYD domain-containing ion transport regulator 3"""	PLML		7836447, 10950925	Standard	NM_005971		Approved	MAT-8	uc010xsm.2	Q14802		ENST00000344013.6:c.173-19A>G	19.37:g.35613803A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDE0|C9JDU2|F5H174|F8WB34|Q13211|Q6IB59	Missense_Mutation	SNP	pfam_Ion-transport_regulator_FXYD	p.T78A	ENST00000344013.6	37	c.232	CCDS12442.1	19	.	.	.	.	.	.	.	.	.	.	A	14.96	2.690197	0.48097	.	.	ENSG00000089356	ENST00000406242;ENST00000346446	T;T	0.63417	-0.04;0.09	4.65	-5.37	0.02681	.	1.004840	0.08026	N	0.992665	T	0.34221	0.0890	.	.	.	0.09310	N	0.999999	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.14504	-1.0470	8	.	.	.	.	1.8004	0.03070	0.2682:0.2558:0.3414:0.1347	.	78;78	F8WB34;Q14802-2	.;.	A	78	ENSP00000385412:T78A;ENSP00000328259:T78A	.	T	+	1	0	FXYD3	40305643	0.000000	0.05858	0.000000	0.03702	0.893000	0.52053	-2.264000	0.01173	-1.026000	0.03330	0.528000	0.53228	ACT	FXYD3	-	NULL	ENSG00000089356		0.627	FXYD3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FXYD3	HGNC	protein_coding	OTTHUMT00000468985.1	29	0.00	0	A	NM_021910		35613803	35613803	+1	no_errors	ENST00000346446	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	0.000	G
GP5	2814	genome.wustl.edu	37	3	194118419	194118419	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:194118419C>G	ENST00000401815.1	-	1	664	c.593G>C	c.(592-594)aGa>aCa	p.R198T	GP5_ENST00000323007.3_Missense_Mutation_p.R198T			P40197	GPV_HUMAN	glycoprotein V (platelet)	198					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		GAGCAGAAGTCTCTCGAGCTT	0.557																																						dbGAP											0													75.0	81.0	79.0					3																	194118419		2203	4300	6503	-	-	-	SO:0001583	missense	0			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.593G>C	3.37:g.194118419C>G	ENSP00000383931:p.Arg198Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D1MER9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R198T	ENST00000401815.1	37	c.593	CCDS3307.1	3	.	.	.	.	.	.	.	.	.	.	C	2.115	-0.402847	0.04865	.	.	ENSG00000178732	ENST00000401815;ENST00000323007	T;T	0.56103	0.48;0.48	4.66	-1.3	0.09259	.	0.349704	0.20844	N	0.084649	T	0.19886	0.0478	N	0.05510	-0.035	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.10064	-1.0646	10	0.10902	T	0.67	.	0.5057	0.00587	0.2529:0.1894:0.1302:0.4275	.	198	P40197	GPV_HUMAN	T	198	ENSP00000383931:R198T;ENSP00000319286:R198T	ENSP00000319286:R198T	R	-	2	0	GP5	195599708	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-1.716000	0.01878	-0.305000	0.08831	-0.378000	0.06908	AGA	GP5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000178732		0.557	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP5	HGNC	protein_coding	OTTHUMT00000317710.1	31	0.00	0	C	NM_004488		194118419	194118419	-1	no_errors	ENST00000323007	ensembl	human	known	69_37n	missense	25	34.21	13	SNP	0.001	G
GRXCR1	389207	genome.wustl.edu	37	4	43032455	43032455	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr4:43032455G>T	ENST00000399770.2	+	4	771	c.771G>T	c.(769-771)aaG>aaT	p.K257N		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	257					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						ATGGGAGCAAGATGTCCATGT	0.488																																						dbGAP											0													167.0	159.0	161.0					4																	43032455		1955	4155	6110	-	-	-	SO:0001583	missense	0				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.771G>T	4.37:g.43032455G>T	ENSP00000382670:p.Lys257Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,superfamily_HSP_DnaJ_Cys-rich_dom	p.K257N	ENST00000399770.2	37	c.771	CCDS43225.1	4	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833995	0.71373	.	.	ENSG00000215203	ENST00000399770	T	0.26660	1.72	5.53	4.69	0.59074	.	0.081266	0.46145	U	0.000306	T	0.47135	0.1429	M	0.63843	1.955	0.58432	D	0.99999	D	0.71674	0.998	D	0.78314	0.991	T	0.43114	-0.9411	10	0.49607	T	0.09	-8.3504	13.7142	0.62687	0.0745:0.0:0.9255:0.0	.	257	A8MXD5	GRCR1_HUMAN	N	257	ENSP00000382670:K257N	ENSP00000382670:K257N	K	+	3	2	GRXCR1	42727212	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	4.484000	0.60271	1.341000	0.45600	0.579000	0.79373	AAG	GRXCR1	-	superfamily_HSP_DnaJ_Cys-rich_dom	ENSG00000215203		0.488	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRXCR1	HGNC	protein_coding	OTTHUMT00000360576.1	79	0.00	0	G	NM_001080476		43032455	43032455	+1	no_errors	ENST00000399770	ensembl	human	known	69_37n	missense	69	26.60	25	SNP	1.000	T
HIRIP3	8479	genome.wustl.edu	37	16	30005877	30005877	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr16:30005877C>T	ENST00000279392.3	-	4	1419	c.589G>A	c.(589-591)Gag>Aag	p.E197K	INO80E_ENST00000567705.1_5'Flank|INO80E_ENST00000304516.7_5'Flank|HIRIP3_ENST00000566471.1_5'Flank|HIRIP3_ENST00000564026.1_Intron|INO80E_ENST00000567254.1_5'Flank|INO80E_ENST00000563197.1_5'Flank	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	197	Glu-rich.				chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						TCGCTCTCCTCACTTTCTTCC	0.512																																						dbGAP											0													241.0	240.0	240.0					16																	30005877		2197	4300	6497	-	-	-	SO:0001583	missense	0			AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.589G>A	16.37:g.30005877C>T	ENSP00000279392:p.Glu197Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BSR3|O75707|O75708	Missense_Mutation	SNP	pfam_Histone_chaperone_domain_CHZ	p.E197K	ENST00000279392.3	37	c.589	CCDS10664.1	16	.	.	.	.	.	.	.	.	.	.	C	13.41	2.228310	0.39399	.	.	ENSG00000149929	ENST00000279392	T	0.32023	1.47	4.4	3.44	0.39384	.	0.998711	0.08102	N	0.997530	T	0.30947	0.0781	L	0.54323	1.7	0.20074	N	0.999938	B	0.22800	0.075	B	0.17098	0.017	T	0.21415	-1.0246	10	0.41790	T	0.15	-3.611	9.9917	0.41874	0.0:0.8998:0.0:0.1002	.	197	Q9BW71	HIRP3_HUMAN	K	197	ENSP00000279392:E197K	ENSP00000279392:E197K	E	-	1	0	HIRIP3	29913378	0.020000	0.18652	0.039000	0.18376	0.227000	0.25037	2.239000	0.43079	1.208000	0.43306	0.591000	0.81541	GAG	HIRIP3	-	NULL	ENSG00000149929		0.512	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRIP3	HGNC	protein_coding	OTTHUMT00000255160.2	163	0.00	0	C	NM_003609		30005877	30005877	-1	no_errors	ENST00000279392	ensembl	human	known	69_37n	missense	142	29.35	59	SNP	0.008	T
HIST1H1E	3008	genome.wustl.edu	37	6	26156885	26156885	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr6:26156885C>G	ENST00000304218.3	+	1	327	c.267C>G	c.(265-267)agC>agG	p.S89R	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	89	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCCTGGTGAGCAAGGGCACCC	0.592																																						dbGAP											0													54.0	57.0	56.0					6																	26156885		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.267C>G	6.37:g.26156885C>G	ENSP00000307705:p.Ser89Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VB25	Missense_Mutation	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.S89R	ENST00000304218.3	37	c.267	CCDS4586.1	6	.	.	.	.	.	.	.	.	.	.	.	23.7	4.451158	0.84209	.	.	ENSG00000168298	ENST00000304218	T	0.10099	2.91	5.35	5.35	0.76521	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.505343	0.22959	N	0.053571	T	0.19565	0.0470	M	0.78344	2.41	0.52099	D	0.999946	P	0.46987	0.888	P	0.57009	0.811	T	0.00111	-1.2045	10	0.62326	D	0.03	-2.5128	11.8409	0.52353	0.0:0.9195:0.0:0.0805	.	89	P10412	H14_HUMAN	R	89	ENSP00000307705:S89R	ENSP00000307705:S89R	S	+	3	2	HIST1H1E	26264864	0.266000	0.24112	1.000000	0.80357	0.975000	0.68041	0.889000	0.28282	2.658000	0.90341	0.561000	0.74099	AGC	HIST1H1E	-	pfam_Histone_H1/H5,smart_Histone_H1/H5	ENSG00000168298		0.592	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1	92	0.00	0	C	NM_005321		26156885	26156885	+1	no_errors	ENST00000304218	ensembl	human	known	69_37n	missense	63	28.41	25	SNP	1.000	G
HOXA3	3200	genome.wustl.edu	37	7	27147487	27147487	+	3'UTR	SNP	A	A	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr7:27147487A>T	ENST00000396352.4	-	0	1578				HOXA3_ENST00000521401.1_5'Flank|HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_3'UTR	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3						angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						caaagaaaaaaGGTGGGTGGG	0.512																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	dbGAP											0													25.0	31.0	29.0					7																	27147487		2162	4240	6402	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.*47T>A	7.37:g.27147487A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D181	RNA	SNP	-	NULL	ENST00000396352.4	37	NULL	CCDS5404.1	7																																																																																			HOXA-AS2	-	-	ENSG00000253552		0.512	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA-AS2	HGNC	protein_coding	OTTHUMT00000358708.2	39	0.00	0	A			27147487	27147487	+1	no_errors	ENST00000518088	ensembl	human	known	69_37n	rna	22	25.81	8	SNP	0.211	T
HS3ST1	9957	genome.wustl.edu	37	4	11401364	11401364	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr4:11401364A>T	ENST00000002596.5	-	2	1440	c.266T>A	c.(265-267)tTc>tAc	p.F89Y		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	89					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						CCAGTCGAAGAAGTGGACCTC	0.657																																						dbGAP											0													78.0	67.0	71.0					4																	11401364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.266T>A	4.37:g.11401364A>T	ENSP00000002596:p.Phe89Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUA6|Q6PEY8	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.F89Y	ENST00000002596.5	37	c.266	CCDS3408.1	4	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456471	0.84317	.	.	ENSG00000002587	ENST00000002596	T	0.59364	0.27	5.81	4.58	0.56647	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.56441	0.1985	M	0.66297	2.02	0.58432	D	0.999999	B	0.23854	0.092	B	0.28849	0.095	T	0.57849	-0.7740	10	0.45353	T	0.12	.	11.6319	0.51181	0.8674:0.0:0.0:0.1326	.	89	O14792	HS3S1_HUMAN	Y	89	ENSP00000002596:F89Y	ENSP00000002596:F89Y	F	-	2	0	HS3ST1	11010462	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.485000	0.81204	2.217000	0.71921	0.533000	0.62120	TTC	HS3ST1	-	pfam_Sulfotransferase_dom	ENSG00000002587		0.657	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST1	HGNC	protein_coding	OTTHUMT00000207073.3	57	0.00	0	A	NM_005114		11401364	11401364	-1	no_errors	ENST00000002596	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	T
IL18R1	8809	genome.wustl.edu	37	2	103013176	103013176	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:103013176C>A	ENST00000409599.1	+	12	1812	c.1456C>A	c.(1456-1458)Ccc>Acc	p.P486T	IL18R1_ENST00000233957.1_Missense_Mutation_p.P486T			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	486	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CACATTCTTGCCCCAATCACT	0.358																																						dbGAP											0													90.0	95.0	93.0					2																	103013176		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.1456C>A	2.37:g.103013176C>A	ENSP00000387211:p.Pro486Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Y5|Q52LC9	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.P486T	ENST00000409599.1	37	c.1456	CCDS2060.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401441	0.83120	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957	T;T;T	0.02369	4.32;4.32;4.32	5.59	5.59	0.84812	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.64402	D	0.000002	T	0.19725	0.0474	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.989	T	0.00138	-1.2002	10	0.72032	D	0.01	.	19.9595	0.97236	0.0:1.0:0.0:0.0	.	485;486	B7ZKV7;Q13478	.;IL18R_HUMAN	T	486	ENSP00000386663:P486T;ENSP00000387211:P486T;ENSP00000233957:P486T	ENSP00000233957:P486T	P	+	1	0	IL18R1	102379608	1.000000	0.71417	0.869000	0.34112	0.913000	0.54294	3.726000	0.54977	2.797000	0.96272	0.563000	0.77884	CCC	IL18R1	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000115604		0.358	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL18R1	HGNC	protein_coding	OTTHUMT00000253294.2	54	0.00	0	C	NM_003855		103013176	103013176	+1	no_errors	ENST00000233957	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	1.000	A
INTS9	55756	genome.wustl.edu	37	8	28627466	28627466	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr8:28627466G>A	ENST00000521022.1	-	16	1821	c.1740C>T	c.(1738-1740)gtC>gtT	p.V580V	INTS9_ENST00000521777.1_Silent_p.V556V|INTS9_ENST00000416984.2_Silent_p.V559V|INTS9_ENST00000397363.4_Silent_p.V474V	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	580					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AAGGCTTCAGGACTTTGCAGT	0.597											OREG0018682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													149.0	110.0	123.0					8																	28627466		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.1740C>T	8.37:g.28627466G>A		Somatic	803	WXS	Illumina GAIIx	Phase_IV	B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	NULL	p.S54F	ENST00000521022.1	37	c.161	CCDS34873.1	8	.	.	.	.	.	.	.	.	.	.	G	0.151	-1.091568	0.01858	.	.	ENSG00000104299	ENST00000517383	.	.	.	5.69	-9.45	0.00600	.	.	.	.	.	T	0.29126	0.0724	.	.	.	0.31361	N	0.681369	.	.	.	.	.	.	T	0.27872	-1.0061	4	.	.	.	-8.2263	6.1891	0.20513	0.2554:0.4918:0.1768:0.0761	.	.	.	.	F	54	.	.	S	-	2	0	INTS9	28683385	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.023000	0.03607	-1.614000	0.01575	-2.032000	0.00423	TCC	INTS9	-	NULL	ENSG00000104299		0.597	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS9	HGNC	protein_coding	OTTHUMT00000376846.1	56	0.00	0	G	NM_018250		28627466	28627466	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000517383	ensembl	human	novel	69_37n	missense	23	53.06	26	SNP	0.001	A
ITPR1	3708	genome.wustl.edu	37	3	4836817	4836817	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:4836817G>A	ENST00000443694.2	+	50	6832	c.6832G>A	c.(6832-6834)Gtc>Atc	p.V2278I	ITPR1_ENST00000357086.4_Missense_Mutation_p.V2245I|ITPR1_ENST00000302640.8_Missense_Mutation_p.V2278I|ITPR1_ENST00000456211.2_Missense_Mutation_p.V2230I|ITPR1_ENST00000354582.6_Missense_Mutation_p.V2278I|ITPR1_ENST00000423119.2_Missense_Mutation_p.V2245I|ITPR1_ENST00000544951.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2293					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TAACCTGGCCGTCCTGATGAA	0.512																																						dbGAP											0													125.0	122.0	123.0					3																	4836817		2051	4197	6248	-	-	-	SO:0001583	missense	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.6832G>A	3.37:g.4836817G>A	ENSP00000401671:p.Val2278Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.V2278I	ENST00000443694.2	37	c.6832	CCDS54551.1	3	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422821	0.62733	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.90955	-2.75;-2.75;-2.76;-2.76;-2.76;-2.75	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.90075	0.6900	M	0.77103	2.36	0.80722	D	1	P;B	0.42973	0.796;0.258	B;B	0.34301	0.179;0.08	D	0.91442	0.5174	10	0.59425	D	0.04	.	19.2069	0.93734	0.0:0.0:1.0:0.0	.	2293;2245	Q14643;G5E9P1	ITPR1_HUMAN;.	I	2293;2278;2278;2245;739;2245;2230;2278	ENSP00000306253:V2278I;ENSP00000346595:V2278I;ENSP00000405934:V2245I;ENSP00000349597:V2245I;ENSP00000397885:V2230I;ENSP00000401671:V2278I	ENSP00000306253:V2278I	V	+	1	0	ITPR1	4811817	1.000000	0.71417	0.999000	0.59377	0.735000	0.41995	6.577000	0.74027	2.520000	0.84964	0.561000	0.74099	GTC	ITPR1	-	NULL	ENSG00000150995		0.512	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	114	0.00	0	G	NM_002222		4836817	4836817	+1	no_errors	ENST00000302640	ensembl	human	known	69_37n	missense	134	22.54	39	SNP	1.000	A
KCNN3	3782	genome.wustl.edu	37	1	154680665	154680665	+	Silent	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:154680665C>T	ENST00000271915.4	-	8	2298	c.1983G>A	c.(1981-1983)tcG>tcA	p.S661S	KCNN3_ENST00000361147.4_Silent_p.S356S|KCNN3_ENST00000515643.1_5'UTR|KCNN3_ENST00000358505.2_Silent_p.S348S	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	666					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GCTCCAGCTTCGACTCCAGGC	0.567																																						dbGAP											0													124.0	137.0	133.0					1																	154680665		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1983G>A	1.37:g.154680665C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.S661	ENST00000271915.4	37	c.1983	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.567	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	49	0.00	0	C	NM_002249		154680665	154680665	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent	36	34.55	19	SNP	0.426	T
KIAA0753	9851	genome.wustl.edu	37	17	6503709	6503709	+	Silent	SNP	G	G	C	rs562050096		TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr17:6503709G>C	ENST00000361413.3	-	13	2437	c.2079C>G	c.(2077-2079)gtC>gtG	p.V693V	KIAA0753_ENST00000575027.1_5'UTR|RNA5SP435_ENST00000364044.1_RNA|KIAA0753_ENST00000572370.1_Silent_p.V394V|KIAA0753_ENST00000542606.1_Silent_p.V394V|KIAA0753_ENST00000589033.1_Silent_p.V149V	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	693						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		CCTGGGCCTTGACCAAGAGAG	0.398																																						dbGAP											0													122.0	121.0	122.0					17																	6503709		1875	4107	5982	-	-	-	SO:0001819	synonymous_variant	0				CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.2079C>G	17.37:g.6503709G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Silent	SNP	NULL	p.V693	ENST00000361413.3	37	c.2079	CCDS42247.1	17																																																																																			KIAA0753	-	NULL	ENSG00000198920		0.398	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0753	HGNC	protein_coding	OTTHUMT00000439769.3	48	0.00	0	G	NM_014804		6503709	6503709	-1	no_errors	ENST00000361413	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.929	C
KRT8P11	347265	genome.wustl.edu	37	9	102067452	102067452	+	IGR	SNP	C	C	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:102067452C>A								RN7SKP225 (20797 upstream) : NAMA (50239 downstream)																							ACTCCTGCCTCCATCACATCC	0.562																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.102067452C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S20Y		37	c.59		9	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488097	0.26686	.	.	ENSG00000222039	ENST00000409686	D	0.82167	-1.58	0.522	0.522	0.17053	.	.	.	.	.	T	0.80314	0.4600	.	.	.	0.22354	N	0.999171	.	.	.	.	.	.	T	0.71321	-0.4628	6	0.72032	D	0.01	.	6.7831	0.23657	0.0:0.9999:0.0:1.0E-4	.	.	.	.	Y	20	ENSP00000404011:S20Y	ENSP00000404011:S20Y	S	+	2	0	KRT8P11	101107273	0.000000	0.05858	0.028000	0.17463	0.017000	0.09413	-0.355000	0.07671	0.508000	0.28173	0.313000	0.20887	TCC	KRT8P11	-	NULL	ENSG00000259197	0	0.562					KRT8P11	HGNC			46	0.00	0	C			102067452	102067452	+1	no_errors	ENST00000409686	ensembl	human	known	69_37n	missense	11	50.00	11	SNP	0.413	A
KRTAP17-1	83902	genome.wustl.edu	37	17	39471766	39471767	+	Frame_Shift_Ins	INS	-	-	C	rs572148015|rs386797077	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr17:39471766_39471767insC	ENST00000334202.3	-	1	180_181	c.136_137insG	c.(136-138)tctfs	p.S46fs		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	46						intermediate filament (GO:0005882)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			cccgcagccagagcccccgcag	0.683																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.136_137insG	17.37:g.39471766_39471767insC	ENSP00000333993:p.Ser46fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	NULL	p.S46fs	ENST00000334202.3	37	c.137_136	CCDS11387.1	17																																																																																			KRTAP17-1	-	NULL	ENSG00000186860		0.683	KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP17-1	HGNC	protein_coding	OTTHUMT00000257296.1	18	0.00	0	-			39471766	39471767	-1	no_errors	ENST00000334202	ensembl	human	known	69_37n	frame_shift_ins	14	17.65	3	INS	0.000:0.001	C
LAMA1	284217	genome.wustl.edu	37	18	7013948	7013948	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr18:7013948A>C	ENST00000389658.3	-	23	3322	c.3229T>G	c.(3229-3231)Tgt>Ggt	p.C1077G		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1077	Laminin EGF-like 12. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCCAAGGAACACTGATCGCAG	0.597																																						dbGAP											0													53.0	44.0	47.0					18																	7013948		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3229T>G	18.37:g.7013948A>C	ENSP00000374309:p.Cys1077Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.C1077G	ENST00000389658.3	37	c.3229	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	A	21.2	4.119563	0.77323	.	.	ENSG00000101680	ENST00000389658	D	0.94280	-3.39	5.91	5.91	0.95273	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.98194	0.9403	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99731	1.1012	10	0.87932	D	0	.	16.3385	0.83074	1.0:0.0:0.0:0.0	.	1077	P25391	LAMA1_HUMAN	G	1077	ENSP00000374309:C1077G	ENSP00000374309:C1077G	C	-	1	0	LAMA1	7003948	1.000000	0.71417	0.984000	0.44739	0.490000	0.33462	8.712000	0.91403	2.250000	0.74265	0.523000	0.50628	TGT	LAMA1	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EGF-like,pfscan_EGF_laminin	ENSG00000101680		0.597	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	52	0.00	0	A	NM_005559		7013948	7013948	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	C
LRAT	9227	genome.wustl.edu	37	4	155665479	155665479	+	Splice_Site	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr4:155665479A>G	ENST00000336356.3	+	2	254	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	LRAT_ENST00000507827.1_Splice_Site_p.M1V	NM_004744.3	NP_004735.2	O95237	LRAT_HUMAN	lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)	1					phototransduction, visible light (GO:0007603)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)	phosphatidylcholine-retinol O-acyltransferase activity (GO:0047173)|retinoic acid binding (GO:0001972)|retinol binding (GO:0019841)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)	16	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	TCCCTGCAGGATGAAGAACCC	0.632																																						dbGAP											0													46.0	43.0	44.0					4																	155665479		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF071510	CCDS3789.1	4q32.1	2014-01-28			ENSG00000121207	ENSG00000121207	2.3.1.135		6685	protein-coding gene	gene with protein product		604863				9920938	Standard	XM_006714412		Approved	LCA14	uc003ion.1	O95237	OTTHUMG00000161418	ENST00000336356.3:c.1-1A>G	4.37:g.155665479A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K983|Q8N716	Missense_Mutation	SNP	pfam_LRAT-like_dom	p.M1V	ENST00000336356.3	37	c.1	CCDS3789.1	4	.	.	.	.	.	.	.	.	.	.	A	13.86	2.362267	0.41902	.	.	ENSG00000121207	ENST00000502525;ENST00000507827;ENST00000336356	T;T	0.46063	0.88;0.88	5.11	5.11	0.69529	.	0.296247	0.36628	N	0.002496	T	0.60117	0.2244	.	.	.	0.25765	N	0.984909	P	0.49447	0.924	P	0.60682	0.878	T	0.57266	-0.7841	9	0.87932	D	0	.	14.7086	0.69211	1.0:0.0:0.0:0.0	.	1	O95237	LRAT_HUMAN	V	1	ENSP00000426761:M1V;ENSP00000337224:M1V	ENSP00000337224:M1V	M	+	1	0	LRAT	155884929	.	.	1.000000	0.80357	0.621000	0.37620	.	.	2.136000	0.66102	0.533000	0.62120	ATG	LRAT	-	NULL	ENSG00000121207		0.632	LRAT-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRAT	HGNC	protein_coding	OTTHUMT00000365246.1	42	0.00	0	A	NM_004744	Missense_Mutation	155665479	155665479	+1	no_errors	ENST00000336356	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	G
MDM1	56890	genome.wustl.edu	37	12	68696589	68696589	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr12:68696589G>A	ENST00000303145.7	-	12	1869	c.1783C>T	c.(1783-1785)Ctg>Ttg	p.L595L	MDM1_ENST00000540418.1_Silent_p.L315L|MDM1_ENST00000411698.2_Silent_p.L560L	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	595					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		CGCAAAGGCAGAGGATCAACT	0.383																																						dbGAP											0													100.0	103.0	102.0					12																	68696589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.1783C>T	12.37:g.68696589G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Silent	SNP	NULL	p.L595	ENST00000303145.7	37	c.1783	CCDS8983.1	12																																																																																			MDM1	-	NULL	ENSG00000111554		0.383	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDM1	HGNC	protein_coding	OTTHUMT00000402402.1	35	0.00	0	G	NM_020128		68696589	68696589	-1	no_errors	ENST00000303145	ensembl	human	known	69_37n	silent	27	35.71	15	SNP	0.820	A
MEG3	55384	genome.wustl.edu	37	14	101300843	101300843	+	RNA	SNP	G	G	A	rs77658190	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr14:101300843G>A	ENST00000554041.1	-	0	214																											GAGGGGTCTCGTTGCTCCCTT	0.527													g|||	939	0.1875	0.0643	0.0893	5008	,	,		18511	0.4266		0.1004	False		,,,				2504	0.2669					dbGAP											0																																										-	-	-			0																															14.37:g.101300843G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000554041.1	37	NULL		14																																																																																			MEG3	-	-	ENSG00000214548		0.527	RP11-123M6.2-001	KNOWN	basic	antisense	MEG3	HGNC	antisense	OTTHUMT00000414687.1	34	0.00	0	G			101300843	101300843	+1	no_errors	ENST00000398461	ensembl	human	known	69_37n	rna	23	14.81	4	SNP	0.000	A
MGLL	11343	genome.wustl.edu	37	3	127434754	127434754	+	Intron	SNP	T	T	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:127434754T>G	ENST00000434178.2	-	5	1377				MGLL_ENST00000265052.5_Intron|MGLL_ENST00000398101.3_Intron|MGLL_ENST00000476682.1_5'Flank|MGLL_ENST00000398104.1_Intron|MGLL_ENST00000453507.2_Intron			Q99685	MGLL_HUMAN	monoglyceride lipase						acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						CATCAAGTGTTTCAAAATCCT	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.480+5141A>C	3.37:g.127434754T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Missense_Mutation	SNP	NULL	p.N47H	ENST00000434178.2	37	c.139	CCDS43148.1	3	.	.	.	.	.	.	.	.	.	.	T	8.717	0.913382	0.17907	.	.	ENSG00000074416	ENST00000496306	.	.	.	3.15	-4.19	0.03835	.	.	.	.	.	T	0.17152	0.0412	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24728	-1.0152	4	.	.	.	.	0.8488	0.01167	0.1627:0.2201:0.3326:0.2846	.	.	.	.	H	47	.	.	N	-	1	0	MGLL	128917444	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.721000	0.01870	-0.929000	0.03757	-0.389000	0.06534	AAC	MGLL	-	NULL	ENSG00000074416		0.517	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGLL	HGNC	protein_coding	OTTHUMT00000356637.2	47	0.00	0	T	NM_007283		127434754	127434754	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000496306	ensembl	human	novel	69_37n	missense	23	25.81	8	SNP	0.000	G
FASTKD2	22868	genome.wustl.edu	37	2	207647981	207647981	+	Intron	SNP	C	C	T	rs2241347	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:207647981C>T	ENST00000236980.6	+	8	1775				FASTKD2_ENST00000403094.3_Intron|FASTKD2_ENST00000402774.3_Intron|MIR3130-1_ENST00000579223.1_RNA	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2						cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		ACCCAGTCTCCGGTGCAGCCT	0.498													N|||	2129	0.42512	0.3381	0.3876	5008	,	,		11320	0.7054		0.1998	False		,,,				2504	0.5123					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1428-3476C>T	2.37:g.207647981C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVX6|Q9Y2H7	RNA	SNP	-	NULL	ENST00000236980.6	37	NULL	CCDS2371.1	2																																																																																			MIR3130-1	-	-	ENSG00000263468		0.498	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3130-1	HGNC	protein_coding	OTTHUMT00000256428.2	23	0.00	0	C	NM_014929		207647981	207647981	+1	no_errors	ENST00000579223	ensembl	human	known	69_37n	rna	17	19.05	4	SNP	0.029	T
MTERF2	80298	genome.wustl.edu	37	12	107371522	107371522	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr12:107371522T>A	ENST00000552029.1	-	2	3039	c.971A>T	c.(970-972)gAa>gTa	p.E324V	MTERFD3_ENST00000392830.2_Missense_Mutation_p.E324V|C12orf23_ENST00000551237.1_Intron|MTERFD3_ENST00000240050.4_Missense_Mutation_p.E324V			Q49AM1	MTEF2_HUMAN		324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	transcription regulatory region DNA binding (GO:0044212)			breast(1)|kidney(1)|large_intestine(2)|lung(3)	7						TGGTGTTAATTCAAGAACCAT	0.353																																						dbGAP											0													208.0	212.0	211.0					12																	107371522		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000552029.1:c.971A>T	12.37:g.107371522T>A	ENSP00000447651:p.Glu324Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HM2|Q9H4L6|Q9H7Y9	Missense_Mutation	SNP	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.E324V	ENST00000552029.1	37	c.971	CCDS9111.1	12	.	.	.	.	.	.	.	.	.	.	T	22.1	4.240894	0.79912	.	.	ENSG00000120832	ENST00000392830;ENST00000240050;ENST00000552029	T;T;T	0.11821	2.74;2.74;2.74	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.37100	0.0991	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04053	-1.0981	10	0.33940	T	0.23	-14.071	16.1616	0.81721	0.0:0.0:0.0:1.0	.	324	Q49AM1	MTER3_HUMAN	V	324	ENSP00000376575:E324V;ENSP00000240050:E324V;ENSP00000447651:E324V	ENSP00000240050:E324V	E	-	2	0	MTERFD3	105895652	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	5.964000	0.70379	2.218000	0.71995	0.377000	0.23210	GAA	MTERFD3	-	pfam_Mit_transcrip_term-rel	ENSG00000120832		0.353	MTERFD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MTERFD3	HGNC	protein_coding	OTTHUMT00000406835.1	98	0.00	0	T			107371522	107371522	-1	no_errors	ENST00000240050	ensembl	human	known	69_37n	missense	88	30.71	39	SNP	1.000	A
MUC4	4585	genome.wustl.edu	37	3	195506483	195506483	+	Missense_Mutation	SNP	T	T	C	rs201375109	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:195506483T>C	ENST00000463781.3	-	2	12427	c.11968A>G	c.(11968-11970)Act>Gct	p.T3990A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3990A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3990P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGTGTCGGTGACA	0.592																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											10.0	7.0	8.0					3																	195506483		622	1355	1977	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11968A>G	3.37:g.195506483T>C	ENSP00000417498:p.Thr3990Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T3990A	ENST00000463781.3	37	c.11968	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	8.956	0.969412	0.18659	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.41;1.5	0.481	-0.864	0.10666	.	0.562686	0.09843	U	0.748557	T	0.21718	0.0523	N	0.14661	0.345	0.09310	N	1	B	0.31790	0.34	B	0.43274	0.414	T	0.40478	-0.9561	9	.	.	.	.	5.8902	0.18909	0.0:0.618:0.0:0.382	.	3862	E7ESK3	.	A	3990	ENSP00000417498:T3990A;ENSP00000420243:T3990A	.	T	-	1	0	MUC4	196991262	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	-2.288000	0.01150	-2.052000	0.00902	-2.075000	0.00382	ACT	MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	12	0.00	0	T	NM_018406		195506483	195506483	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	18	31.03	9	SNP	0.002	C
MYO5A	4644	genome.wustl.edu	37	15	52659300	52659300	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr15:52659300C>T	ENST00000399231.3	-	23	3331	c.3088G>A	c.(3088-3090)Gaa>Aaa	p.E1030K	MYO5A_ENST00000399233.2_Missense_Mutation_p.E1030K|MYO5A_ENST00000553916.1_Missense_Mutation_p.E1030K|MYO5A_ENST00000358212.6_Missense_Mutation_p.E1030K|MYO5A_ENST00000356338.6_Missense_Mutation_p.E1030K	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1030					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		AAAGTATTTTCTTCCTTCAGA	0.433																																						dbGAP											0													163.0	152.0	156.0					15																	52659300		1917	4135	6052	-	-	-	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3088G>A	15.37:g.52659300C>T	ENSP00000382177:p.Glu1030Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1030K	ENST00000399231.3	37	c.3088	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	C	18.59	3.655924	0.67586	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13	5.58	4.6	0.57074	.	0.052912	0.85682	D	0.000000	T	0.16214	0.0390	L	0.28400	0.85	0.42852	D	0.994084	B;B	0.12013	0.005;0.0	B;B	0.12837	0.008;0.001	T	0.03840	-1.0999	10	0.30078	T	0.28	.	13.7325	0.62797	0.0:0.6805:0.3195:0.0	.	1030;1030	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	K	1030;564;1030;1030;1030;660;1030	ENSP00000382177:E1030K;ENSP00000382179:E1030K;ENSP00000348693:E1030K;ENSP00000350945:E1030K;ENSP00000451109:E1030K	ENSP00000348693:E1030K	E	-	1	0	MYO5A	50446592	0.552000	0.26505	1.000000	0.80357	0.991000	0.79684	0.347000	0.20014	2.789000	0.95967	0.655000	0.94253	GAA	MYO5A	-	NULL	ENSG00000197535		0.433	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	116	0.00	0	C	NM_000259		52659300	52659300	-1	no_errors	ENST00000358212	ensembl	human	known	69_37n	missense	43	38.57	27	SNP	1.000	T
OR13J1	392309	genome.wustl.edu	37	9	35870121	35870121	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:35870121G>A	ENST00000377981.2	-	1	340	c.278C>T	c.(277-279)tCc>tTc	p.S93F		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			GACAGCAAAGGAGATGGTCTT	0.587																																						dbGAP											0													120.0	115.0	116.0					9																	35870121		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.278C>T	9.37:g.35870121G>A	ENSP00000367219:p.Ser93Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN66|Q6IF20|Q96R40	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S93F	ENST00000377981.2	37	c.278	CCDS35011.1	9	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682740	0.68157	.	.	ENSG00000168828	ENST00000377981	T	0.00745	5.75	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000057	T	0.07818	0.0196	H	0.95645	3.7	0.43667	D	0.996092	D	0.76494	0.999	D	0.83275	0.996	T	0.00252	-1.1876	10	0.87932	D	0	.	15.9177	0.79535	0.0:0.0:1.0:0.0	.	93	Q8NGT2	O13J1_HUMAN	F	93	ENSP00000367219:S93F	ENSP00000367219:S93F	S	-	2	0	OR13J1	35860121	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.404000	0.73268	2.890000	0.99128	0.650000	0.86243	TCC	OR13J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000168828		0.587	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13J1	HGNC	protein_coding	OTTHUMT00000052381.1	37	0.00	0	G			35870121	35870121	-1	no_errors	ENST00000377981	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	1.000	A
OR2Y1	134083	genome.wustl.edu	37	5	180166248	180166248	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr5:180166248T>C	ENST00000307832.2	-	1	851	c.811A>G	c.(811-813)Aaa>Gaa	p.K271E		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAACAAATTTTCCCTCACGC	0.418																																						dbGAP											0													87.0	99.0	95.0					5																	180166248		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.811A>G	5.37:g.180166248T>C	ENSP00000312403:p.Lys271Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K271E	ENST00000307832.2	37	c.811	CCDS34323.1	5	.	.	.	.	.	.	.	.	.	.	t	16.27	3.074843	0.55646	.	.	ENSG00000174339	ENST00000307832	T	0.00183	8.6	4.41	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000294	T	0.00637	0.0021	M	0.88906	2.99	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.27054	-1.0085	10	0.87932	D	0	.	11.9052	0.52708	0.0:0.0:0.0:1.0	.	271	Q8NGV0	OR2Y1_HUMAN	E	271	ENSP00000312403:K271E	ENSP00000312403:K271E	K	-	1	0	OR2Y1	180098854	0.018000	0.18449	0.026000	0.17262	0.007000	0.05969	1.590000	0.36654	1.968000	0.57251	0.418000	0.28097	AAA	OR2Y1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000174339		0.418	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Y1	HGNC	protein_coding	OTTHUMT00000368059.2	53	0.00	0	T	XM_068682		180166248	180166248	-1	no_errors	ENST00000307832	ensembl	human	known	69_37n	missense	28	39.13	18	SNP	0.158	C
OR7A17	26333	genome.wustl.edu	37	19	14991371	14991371	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr19:14991371T>C	ENST00000327462.2	-	1	893	c.797A>G	c.(796-798)cAc>cGc	p.H266R		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					GTGTGAGTTGTGGGTTGCAGC	0.478																																						dbGAP											0													112.0	95.0	101.0					19																	14991371		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.797A>G	19.37:g.14991371T>C	ENSP00000328144:p.His266Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFQ6|Q96R98	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H266R	ENST00000327462.2	37	c.797	CCDS12319.1	19	.	.	.	.	.	.	.	.	.	.	t	8.124	0.781580	0.16120	.	.	ENSG00000185385	ENST00000327462	T	0.00084	8.75	3.36	-0.398	0.12418	GPCR, rhodopsin-like superfamily (1);	0.416938	0.17272	U	0.180358	T	0.00144	0.0004	L	0.44542	1.39	0.09310	N	1	B	0.18741	0.03	B	0.32928	0.155	T	0.39941	-0.9589	10	0.51188	T	0.08	.	1.6237	0.02719	0.1667:0.1044:0.1721:0.5568	.	266	O14581	OR7AH_HUMAN	R	266	ENSP00000328144:H266R	ENSP00000328144:H266R	H	-	2	0	OR7A17	14852371	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.517000	0.06275	-0.275000	0.09219	-0.747000	0.03512	CAC	OR7A17	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000185385		0.478	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A17	HGNC	protein_coding	OTTHUMT00000466523.1	81	0.00	0	T	NM_030901		14991371	14991371	-1	no_errors	ENST00000327462	ensembl	human	known	69_37n	missense	62	27.91	24	SNP	0.000	C
OXR1	55074	genome.wustl.edu	37	8	107715274	107715274	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr8:107715274G>A	ENST00000442977.2	+	7	918	c.819G>A	c.(817-819)atG>atA	p.M273I	OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000445937.1_Missense_Mutation_p.M272I|OXR1_ENST00000517566.2_Missense_Mutation_p.M272I|OXR1_ENST00000312046.6_Missense_Mutation_p.M265I|OXR1_ENST00000497705.1_Missense_Mutation_p.M205I|OXR1_ENST00000531443.1_Missense_Mutation_p.M272I	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	273	GRAM.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			CAGCTGCAATGTACAAAGAAA	0.353																																						dbGAP											0													109.0	105.0	106.0					8																	107715274		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.819G>A	8.37:g.107715274G>A	ENSP00000405424:p.Met273Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	pfam_TLDc,pfam_Peptidoglycan-bd_lysin,pfam_GRAM,smart_Peptidoglycan-bd_Lysin_subgr,smart_TLDc	p.M273I	ENST00000442977.2	37	c.819	CCDS56548.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.41|14.41	2.525745|2.525745	0.44969|0.44969	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000517455|ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977;ENST00000497705;ENST00000312046	.|T;T;T;T;T;T	.|0.24350	.|2.76;2.76;2.77;2.77;1.86;2.8	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.237283	.|0.47852	.|D	.|0.000207	T|T	0.16557|0.16557	0.0398|0.0398	N|N	0.11789|0.11789	0.175|0.175	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.27853	.|0.012;0.016;0.191;0.012	.|B;B;B;B	.|0.26416	.|0.041;0.068;0.069;0.041	T|T	0.09422|0.09422	-1.0675|-1.0675	5|10	.|0.10377	.|T	.|0.69	-12.3313|-12.3313	20.0845|20.0845	0.97795|0.97795	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|265;273;205;272	.|Q8N573-2;Q8N573;Q8N573-3;Q8N573-5	.|.;OXR1_HUMAN;.;.	Y|I	189|272;272;272;273;205;265	.|ENSP00000402918:M272I;ENSP00000431966:M272I;ENSP00000429205:M272I;ENSP00000405424:M273I;ENSP00000431014:M205I;ENSP00000311026:M265I	.|ENSP00000311026:M265I	C|M	+|+	2|3	0|0	OXR1|OXR1	107784450|107784450	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.089000|5.089000	0.64492|0.64492	2.821000|2.821000	0.97095|0.97095	0.650000|0.650000	0.86243|0.86243	TGT|ATG	OXR1	-	NULL	ENSG00000164830		0.353	OXR1-201	KNOWN	basic|CCDS	protein_coding	OXR1	HGNC	protein_coding		59	0.00	0	G	NM_181354		107715274	107715274	+1	no_errors	ENST00000442977	ensembl	human	known	69_37n	missense	58	25.64	20	SNP	1.000	A
PPIG	9360	genome.wustl.edu	37	2	170470979	170470979	+	Missense_Mutation	SNP	C	C	G	rs375348808		TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:170470979C>G	ENST00000260970.3	+	8	603	c.383C>G	c.(382-384)aCg>aGg	p.T128R	PPIG_ENST00000409714.3_Missense_Mutation_p.T113R|PPIG_ENST00000462903.1_Missense_Mutation_p.T128R|PPIG_ENST00000448752.2_Missense_Mutation_p.T128R	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	128	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	AAAAGAACAACGAAACCAACT	0.234																																						dbGAP											0													56.0	60.0	59.0					2																	170470979		2173	4273	6446	-	-	-	SO:0001583	missense	0			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.383C>G	2.37:g.170470979C>G	ENSP00000260970:p.Thr128Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.T128R	ENST00000260970.3	37	c.383	CCDS2235.1	2	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545275	0.65198	.	.	ENSG00000138398	ENST00000260970;ENST00000530133;ENST00000433207;ENST00000409714;ENST00000462903;ENST00000448752;ENST00000414307	T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83	5.24	5.24	0.73138	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.77935	0.4205	M	0.93898	3.47	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;1.0	D	0.84365	0.0540	10	0.87932	D	0	-12.741	18.8105	0.92056	0.0:1.0:0.0:0.0	.	124;113;113;128;128	C9JM79;E9PG73;Q2NKQ6;Q13427-2;Q13427	.;.;.;.;PPIG_HUMAN	R	128;128;124;113;128;128;128	ENSP00000260970:T128R;ENSP00000408683:T124R;ENSP00000386245:T113R;ENSP00000435987:T128R;ENSP00000407083:T128R;ENSP00000402222:T128R	ENSP00000260970:T128R	T	+	2	0	PPIG	170179225	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	7.526000	0.81920	2.449000	0.82847	0.491000	0.48974	ACG	PPIG	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	ENSG00000138398		0.234	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIG	HGNC	protein_coding	OTTHUMT00000255264.2	35	0.00	0	C			170470979	170470979	+1	no_errors	ENST00000260970	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	G
HELZ2	85441	genome.wustl.edu	37	20	62195420	62195420	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr20:62195420G>A	ENST00000467148.1	-	8	4824	c.4755C>T	c.(4753-4755)caC>caT	p.H1585H	HELZ2_ENST00000427522.2_Silent_p.H1016H	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1585					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CCCCGCCGCCGTGCAGGTGGT	0.697																																						dbGAP											0													17.0	16.0	17.0					20																	62195420		2179	4285	6464	-	-	-	SO:0001819	synonymous_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.4755C>T	20.37:g.62195420G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.H1585	ENST00000467148.1	37	c.4755	CCDS33508.1	20																																																																																			RP4-697K14.7	-	pfam_RNase_II/R,smart_RNase_II/R	ENSG00000130589		0.697	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	64	0.00	0	G	NM_001037335		62195420	62195420	-1	no_errors	ENST00000467148	ensembl	human	known	69_37n	silent	32	28.89	13	SNP	0.000	A
PRKCB	5579	genome.wustl.edu	37	16	24196452	24196452	+	Silent	SNP	T	T	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr16:24196452T>C	ENST00000321728.7	+	14	1729	c.1554T>C	c.(1552-1554)taT>taC	p.Y518Y	PRKCB_ENST00000303531.7_Silent_p.Y518Y	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	518	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	ATCAGCCCTATGGGAAGTCCG	0.433																																						dbGAP											0													184.0	171.0	176.0					16																	24196452		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1554T>C	16.37:g.24196452T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.Y518	ENST00000321728.7	37	c.1554	CCDS10618.1	16																																																																																			PRKCB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000166501		0.433	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	116	0.00	0	T	NM_212535		24196452	24196452	+1	no_errors	ENST00000303531	ensembl	human	known	69_37n	silent	79	29.46	33	SNP	1.000	C
PSPC1	55269	genome.wustl.edu	37	13	20283700	20283700	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr13:20283700C>A	ENST00000338910.4	-	7	1357	c.1198G>T	c.(1198-1200)Gga>Tga	p.G400*		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	400	Gly-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		TTTATTGCTCCACGGGGACCC	0.398																																						dbGAP											0													206.0	178.0	187.0					13																	20283700		1814	4068	5882	-	-	-	SO:0001587	stop_gained	0			AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.1198G>T	13.37:g.20283700C>A	ENSP00000343966:p.Gly400*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.G400*	ENST00000338910.4	37	c.1198	CCDS41870.1	13	.	.	.	.	.	.	.	.	.	.	C	38	6.722702	0.97788	.	.	ENSG00000121390	ENST00000338910;ENST00000422828	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-21.0121	18.8473	0.92212	0.0:1.0:0.0:0.0	.	.	.	.	X	400;340	.	ENSP00000343966:G400X	G	-	1	0	PSPC1	19181700	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.842000	0.75379	2.521000	0.84997	0.591000	0.81541	GGA	PSPC1	-	NULL	ENSG00000121390		0.398	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSPC1	HGNC	protein_coding	OTTHUMT00000044037.2	98	0.00	0	C			20283700	20283700	-1	no_errors	ENST00000338910	ensembl	human	known	69_37n	nonsense	77	38.40	48	SNP	1.000	A
PTGFRN	5738	genome.wustl.edu	37	1	117504034	117504034	+	Silent	SNP	C	C	T	rs147606477		TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:117504034C>T	ENST00000393203.2	+	5	1530	c.1383C>T	c.(1381-1383)agC>agT	p.S461S	RNA5SP55_ENST00000516701.1_RNA	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	461	Ig-like C2-type 4.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		TGGTGACCAGCGAGCTGCTTG	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		18240	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													104.0	84.0	90.0					1																	117504034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1383C>T	1.37:g.117504034C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVU9|Q8N2K6	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S461	ENST00000393203.2	37	c.1383	CCDS890.1	1																																																																																			PTGFRN	-	smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000134247		0.547	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1	66	0.00	0	C	NM_020440		117504034	117504034	+1	no_errors	ENST00000393203	ensembl	human	known	69_37n	silent	47	26.56	17	SNP	0.683	T
PTPN7	5778	genome.wustl.edu	37	1	202130671	202130671	+	5'Flank	SNP	G	G	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:202130671G>T	ENST00000308986.5	-	0	0				PTPN7_ENST00000544762.1_5'Flank|PTPN7_ENST00000492977.1_5'Flank|PTPN7_ENST00000543735.1_5'Flank|PTPN7_ENST00000367279.4_5'Flank|PTPN7_ENST00000309017.3_De_novo_Start_OutOfFrame			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						TTGCGGGCCAGCAGCCCAGCC	0.632																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931		1.37:g.202130671G>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt	p.C13*	ENST00000308986.5	37	c.39		1	.	.	.	.	.	.	.	.	.	.	G	35	5.440178	0.96168	.	.	ENSG00000143851	ENST00000477554	.	.	.	3.65	1.63	0.23807	.	.	.	.	.	.	.	.	.	.	.	0.22754	N	0.998779	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.2158	0.10533	0.1294:0.0:0.6337:0.2368	.	.	.	.	X	13	.	ENSP00000418416:C13X	C	-	3	2	PTPN7	200397294	0.001000	0.12720	0.771000	0.31576	0.652000	0.38707	0.495000	0.22483	0.131000	0.18576	0.305000	0.20034	TGC	PTPN7	-	NULL	ENSG00000143851		0.632	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	PTPN7	HGNC	protein_coding		52	0.00	0	G	NM_002832		202130671	202130671	-1	no_start_codon	ENST00000477554	ensembl	human	putative	69_37n	nonsense	62	12.68	9	SNP	0.242	T
PTPRVP	148713	genome.wustl.edu	37	1	202158370	202158370	+	RNA	SNP	C	C	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:202158370C>G	ENST00000482597.1	+	0	3888					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		AGCAGTATATCTACCTCTACA	0.582																																						dbGAP											0																																										-	-	-			0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202158370C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.582	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	87	0.00	0	C	XM_086287		202158370	202158370	+1	no_errors	ENST00000482597	ensembl	human	known	69_37n	rna	57	32.94	28	SNP	0.623	G
RGL3	57139	genome.wustl.edu	37	19	11507967	11507967	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr19:11507967G>A	ENST00000380456.3	-	18	2030	c.1967C>T	c.(1966-1968)cCc>cTc	p.P656L	RGL3_ENST00000393423.3_Missense_Mutation_p.P662L|RGL3_ENST00000568628.1_5'UTR	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	656	Interaction with HRAS, MRAS and RIT1. {ECO:0000250}.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						ACAGGCCCAGGGCTGGGGCAC	0.652																																					GBM(174;751 2067 17998 27979 33959)	dbGAP											0													84.0	85.0	85.0					19																	11507967		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.1967C>T	19.37:g.11507967G>A	ENSP00000369823:p.Pro656Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME84|B7ZL22|Q0P6G0	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.P662L	ENST00000380456.3	37	c.1985	CCDS32910.1	19	.	.	.	.	.	.	.	.	.	.	G	11.56	1.675475	0.29783	.	.	ENSG00000205517	ENST00000342684;ENST00000393423;ENST00000380456	T;T	0.17370	2.28;2.28	4.7	1.15	0.20763	Ras-association (3);	0.806631	0.11827	N	0.525616	T	0.29914	0.0748	L	0.51422	1.61	0.20563	N	0.999887	B;B;B;D	0.58620	0.245;0.131;0.072;0.983	B;B;B;D	0.65233	0.138;0.039;0.098;0.933	T	0.09618	-1.0666	10	0.59425	D	0.04	.	7.9817	0.30188	0.0876:0.3055:0.6069:0.0	.	656;662;662;453	Q3MIN7;B5ME84;B7ZL22;Q8TEP0	RGL3_HUMAN;.;.;.	L	453;662;656	ENSP00000377075:P662L;ENSP00000369823:P656L	ENSP00000344665:P453L	P	-	2	0	RGL3	11368967	0.001000	0.12720	0.054000	0.19295	0.617000	0.37484	0.844000	0.27654	0.241000	0.21283	0.555000	0.69702	CCC	RGL3	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000205517		0.652	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	HGNC	protein_coding	OTTHUMT00000421208.3	61	0.00	0	G	XM_290867		11507967	11507967	-1	no_errors	ENST00000393423	ensembl	human	known	69_37n	missense	60	20.00	15	SNP	0.113	A
RIN3	79890	genome.wustl.edu	37	14	93107614	93107614	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr14:93107614C>A	ENST00000216487.7	+	5	631	c.472C>A	c.(472-474)Cag>Aag	p.Q158K	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	158	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				GCGGCTACCCCAGGCCATCCT	0.602																																						dbGAP											0													123.0	97.0	106.0					14																	93107614		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.472C>A	14.37:g.93107614C>A	ENSP00000216487:p.Gln158Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	pfam_VPS9,smart_SH2,smart_VPS9_subgr,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.Q158K	ENST00000216487.7	37	c.472	CCDS32144.1	14	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003218	0.54254	.	.	ENSG00000100599	ENST00000216487;ENST00000428147	T	0.28895	1.59	4.9	4.9	0.64082	SH2 motif (1);	0.216529	0.39210	N	0.001430	T	0.33933	0.0880	L	0.55481	1.735	0.80722	D	1	B;B	0.27971	0.196;0.147	B;B	0.34385	0.181;0.033	T	0.11767	-1.0574	10	0.37606	T	0.19	-14.675	14.8055	0.69952	0.0:1.0:0.0:0.0	.	83;158	Q6ZRC2;Q8TB24	.;RIN3_HUMAN	K	158	ENSP00000216487:Q158K	ENSP00000216487:Q158K	Q	+	1	0	RIN3	92177367	0.982000	0.34865	1.000000	0.80357	0.924000	0.55760	2.853000	0.48317	2.268000	0.75426	0.462000	0.41574	CAG	RIN3	-	pfscan_SH2	ENSG00000100599		0.602	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN3	HGNC	protein_coding	OTTHUMT00000412269.1	78	0.00	0	C			93107614	93107614	+1	no_errors	ENST00000216487	ensembl	human	known	69_37n	missense	28	44.00	22	SNP	1.000	A
RPAP2	79871	genome.wustl.edu	37	1	92789425	92789425	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:92789425A>T	ENST00000610020.1	+	8	1057	c.948A>T	c.(946-948)gaA>gaT	p.E316D	RPAP2_ENST00000484158.1_3'UTR	NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	316					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		AAAATTCTGAAAGTGAATACA	0.343																																						dbGAP											0													59.0	66.0	63.0					1																	92789425		2199	4299	6498	-	-	-	SO:0001583	missense	0			AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.948A>T	1.37:g.92789425A>T	ENSP00000476948:p.Glu316Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	pfam_DUF408	p.E316D	ENST00000610020.1	37	c.948	CCDS740.1	1	.	.	.	.	.	.	.	.	.	.	A	6.333	0.429577	0.11987	.	.	ENSG00000122484	ENST00000370343;ENST00000394482	.	.	.	6.07	0.684	0.18003	.	0.762456	0.13061	N	0.416917	T	0.15262	0.0368	L	0.40543	1.245	0.28526	N	0.912802	B	0.09022	0.002	B	0.06405	0.002	T	0.12941	-1.0528	8	0.24483	T	0.36	-5.4968	6.9487	0.24532	0.4245:0.2353:0.0:0.3401	.	316	Q8IXW5	RPAP2_HUMAN	D	316	.	ENSP00000359368:E316D	E	+	3	2	RPAP2	92562013	0.132000	0.22450	0.451000	0.26982	0.428000	0.31595	0.493000	0.22451	0.131000	0.18576	-0.336000	0.08194	GAA	RPAP2	-	NULL	ENSG00000122484		0.343	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP2	HGNC	protein_coding	OTTHUMT00000028368.2	19	0.00	0	A	NM_024813		92789425	92789425	+1	no_errors	ENST00000370343	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	0.076	T
SERINC5	256987	genome.wustl.edu	37	5	79439630	79439630	+	Intron	SNP	G	G	A	rs12652646	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr5:79439630G>A	ENST00000507668.2	-	11	1389				SERINC5_ENST00000509193.1_Intron|CTC-458I2.2_ENST00000511484.1_RNA|SERINC5_ENST00000512721.1_Silent_p.Y414Y|SERINC5_ENST00000512972.2_Intron	NM_001174071.1|NM_178276.5	NP_001167542.1|NP_840060.1	Q86VE9	SERC5_HUMAN	serine incorporator 5						myelination (GO:0042552)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(3)|kidney(1)|lung(3)|ovary(1)	8		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)		TGGCACTTTCGTAGCTGTGGA	0.463													G|||	638	0.127396	0.0386	0.0994	5008	,	,		16478	0.2659		0.1103	False		,,,				2504	0.1421					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF498273	CCDS54874.1	5q14.1	2014-01-28	2005-10-14	2005-10-14		ENSG00000164300			18825	protein-coding gene	gene with protein product		614551	"""chromosome 5 open reading frame 12"""	C5orf12		12688535	Standard	NM_178276		Approved	TPO1	uc011ctj.2	Q86VE9		ENST00000507668.2:c.1238+2282C>T	5.37:g.79439630G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMH7|Q495A4|Q495A6	Silent	SNP	pfam_TMS_TDE	p.Y414	ENST00000507668.2	37	c.1242	CCDS54873.1	5																																																																																			SERINC5	-	pfam_TMS_TDE	ENSG00000164300		0.463	SERINC5-201	KNOWN	basic|CCDS	protein_coding	SERINC5	HGNC	protein_coding		24	0.00	0	G	NM_178276		79439630	79439630	-1	no_errors	ENST00000512721	ensembl	human	novel	69_37n	silent	10	28.57	4	SNP	0.984	A
SERPINC1	462	genome.wustl.edu	37	1	173878701	173878701	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:173878701G>C	ENST00000367698.3	-	5	1260	c.1142C>G	c.(1141-1143)tCc>tGc	p.S381C	SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	381			S -> P (in AT3D; type-I).		blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	TGGGAGTTTGGACTTTTCAGG	0.522																																						dbGAP											0													60.0	63.0	62.0					1																	173878701		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.1142C>G	1.37:g.173878701G>C	ENSP00000356671:p.Ser381Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.S381C	ENST00000367698.3	37	c.1142	CCDS1313.1	1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689512	0.29962	.	.	ENSG00000117601	ENST00000367698	D	0.83250	-1.7	5.32	5.32	0.75619	Serpin domain (3);	0.111407	0.64402	D	0.000009	T	0.70859	0.3272	L	0.35723	1.085	0.49130	D	0.999756	B	0.18166	0.026	B	0.20955	0.032	T	0.70691	-0.4802	10	0.72032	D	0.01	.	17.8643	0.88791	0.0:0.0:1.0:0.0	.	381	P01008	ANT3_HUMAN	C	381	ENSP00000356671:S381C	ENSP00000356671:S381C	S	-	2	0	SERPINC1	172145324	1.000000	0.71417	0.490000	0.27465	0.004000	0.04260	9.398000	0.97281	2.512000	0.84698	0.650000	0.86243	TCC	SERPINC1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000117601		0.522	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINC1	HGNC	protein_coding	OTTHUMT00000090734.1	31	0.00	0	G	NM_000488		173878701	173878701	-1	no_errors	ENST00000367698	ensembl	human	known	69_37n	missense	37	11.63	5	SNP	1.000	C
SLC25A14	9016	genome.wustl.edu	37	X	129506981	129506981	+	3'UTR	SNP	C	C	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chrX:129506981C>A	ENST00000218197.5	+	0	1262					NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14						aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						TTGCCCTTTTCCCGTGTTCTA	0.428																																						dbGAP											0													81.0	60.0	66.0					X																	129506981		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.*57C>A	X.37:g.129506981C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	RNA	SNP	-	NULL	ENST00000218197.5	37	NULL	CCDS14623.1	X																																																																																			SLC25A14	-	-	ENSG00000102078		0.428	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A14	HGNC	protein_coding	OTTHUMT00000058253.1	113	0.00	0	C	NM_022810, NM_003951		129506981	129506981	+1	no_errors	ENST00000465988	ensembl	human	known	69_37n	rna	67	12.99	10	SNP	0.003	A
SLC34A2	10568	genome.wustl.edu	37	4	25664351	25664351	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr4:25664351C>T	ENST00000382051.3	+	3	187	c.137C>T	c.(136-138)aCc>aTc	p.T46I	SLC34A2_ENST00000504570.1_Missense_Mutation_p.T45I|SLC34A2_ENST00000503434.1_Missense_Mutation_p.T45I	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	46					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GCACCTGTAACCAAGATTGAA	0.532			T	ROS1	NSCLC																																	dbGAP		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0													157.0	160.0	159.0					4																	25664351		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.137C>T	4.37:g.25664351C>T	ENSP00000371483:p.Thr46Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	pfam_Na/Pi_transpt,superfamily_ABC_transptrTM_dom_typ1,tigrfam_Na/Pi_transpt	p.T46I	ENST00000382051.3	37	c.137	CCDS3435.1	4	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964188	0.34659	.	.	ENSG00000157765	ENST00000513204;ENST00000504570;ENST00000382051;ENST00000503434;ENST00000507530	T;T;T;T;T	0.56103	0.49;1.9;1.9;1.9;0.48	5.45	3.39	0.38822	.	0.861022	0.10566	N	0.659670	T	0.47358	0.1441	L	0.57536	1.79	0.09310	N	1	P;P	0.43094	0.799;0.698	B;B	0.38954	0.286;0.148	T	0.37478	-0.9704	10	0.38643	T	0.18	-19.6719	9.5192	0.39124	0.2472:0.6407:0.1121:0.0	.	45;46	O95436-2;O95436	.;NPT2B_HUMAN	I	45;45;46;45;46	ENSP00000423038:T45I;ENSP00000425501:T45I;ENSP00000371483:T46I;ENSP00000423021:T45I;ENSP00000424266:T46I	ENSP00000371483:T46I	T	+	2	0	SLC34A2	25273449	0.001000	0.12720	0.721000	0.30653	0.043000	0.13939	0.187000	0.16998	2.568000	0.86640	0.650000	0.86243	ACC	SLC34A2	-	NULL	ENSG00000157765		0.532	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A2	HGNC	protein_coding	OTTHUMT00000214990.1	43	0.00	0	C	NM_006424		25664351	25664351	+1	no_errors	ENST00000382051	ensembl	human	known	69_37n	missense	35	32.69	17	SNP	0.005	T
SLC35F1	222553	genome.wustl.edu	37	6	118588284	118588284	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr6:118588284G>A	ENST00000360388.4	+	4	805	c.604G>A	c.(604-606)Gca>Aca	p.A202T		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	202					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		CATGGTGGGAGCAGATGTGCT	0.537																																						dbGAP											0													339.0	286.0	304.0					6																	118588284		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.604G>A	6.37:g.118588284G>A	ENSP00000353557:p.Ala202Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	pfam_DUF914_euk,pfam_DMT	p.A202T	ENST00000360388.4	37	c.604	CCDS34524.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.755424	0.96898	.	.	ENSG00000196376	ENST00000360388	.	.	.	4.99	4.99	0.66335	.	0.056706	0.64402	D	0.000002	T	0.70020	0.3176	L	0.45698	1.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69379	-0.5161	9	0.51188	T	0.08	.	18.8278	0.92125	0.0:0.0:1.0:0.0	.	202	Q5T1Q4	S35F1_HUMAN	T	202	.	ENSP00000353557:A202T	A	+	1	0	SLC35F1	118694977	1.000000	0.71417	0.990000	0.47175	0.990000	0.78478	9.208000	0.95075	2.756000	0.94617	0.561000	0.74099	GCA	SLC35F1	-	pfam_DUF914_euk	ENSG00000196376		0.537	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F1	HGNC	protein_coding	OTTHUMT00000041991.2	130	0.00	0	G	XM_167044		118588284	118588284	+1	no_errors	ENST00000360388	ensembl	human	known	69_37n	missense	110	27.15	41	SNP	1.000	A
SLC45A1	50651	genome.wustl.edu	37	1	8385447	8385447	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr1:8385447A>G	ENST00000471889.1	+	3	872	c.487A>G	c.(487-489)Ata>Gta	p.I163V	Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000377479.2_Missense_Mutation_p.I197V|SLC45A1_ENST00000289877.8_Missense_Mutation_p.I163V			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	163					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TGTCCTGGCTATAGGTCTGTT	0.438																																						dbGAP											0													140.0	126.0	131.0					1																	8385447		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.487A>G	1.37:g.8385447A>G	ENSP00000418096:p.Ile163Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VY46|Q5VY49	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.I197V	ENST00000471889.1	37	c.589	CCDS30577.1	1	.	.	.	.	.	.	.	.	.	.	A	9.210	1.030639	0.19512	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.94828	-3.53;-3.53;-3.53	5.56	4.41	0.53225	Major facilitator superfamily domain, general substrate transporter (1);	0.175207	0.56097	D	0.000021	D	0.87176	0.6112	N	0.21583	0.68	0.40964	D	0.984642	B	0.15930	0.015	B	0.20955	0.032	T	0.78056	-0.2353	10	0.13853	T	0.58	-14.8988	6.6876	0.23154	0.7598:0.1563:0.0839:0.0	.	163	Q9Y2W3	S45A1_HUMAN	V	163;197;163	ENSP00000418096:I163V;ENSP00000366699:I197V;ENSP00000289877:I163V	ENSP00000289877:I163V	I	+	1	0	SLC45A1	8308034	0.933000	0.31639	0.895000	0.35142	0.995000	0.86356	2.060000	0.41394	0.912000	0.36772	0.533000	0.62120	ATA	SLC45A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000162426		0.438	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A1	HGNC	protein_coding	OTTHUMT00000001245.5	53	0.00	0	A			8385447	8385447	+1	no_errors	ENST00000377479	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	0.725	G
SPATA2	9825	genome.wustl.edu	37	20	48524761	48524761	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr20:48524761G>A	ENST00000422556.1	-	2	616	c.267C>T	c.(265-267)ttC>ttT	p.F89F	SPATA2_ENST00000289431.5_Silent_p.F89F|SPATA2_ENST00000543716.1_Intron	NM_001135773.1	NP_001129245.1	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	89					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	20	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CCAGCATGCTGAAGGCGCCGT	0.577																																						dbGAP											0													94.0	90.0	92.0					20																	48524761		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018300	CCDS13422.1	20q13.13	2014-06-13			ENSG00000158480	ENSG00000158480			14681	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 145"""	607662					Standard	NM_001135773		Approved	KIAA0757, PD1, tamo, PPP1R145	uc002xuw.3	Q9UM82	OTTHUMG00000032704	ENST00000422556.1:c.267C>T	20.37:g.48524761G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P626|O94857	Silent	SNP	NULL	p.F89	ENST00000422556.1	37	c.267	CCDS13422.1	20																																																																																			SPATA2	-	NULL	ENSG00000158480		0.577	SPATA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA2	HGNC	protein_coding	OTTHUMT00000079658.1	32	0.00	0	G	NM_006038		48524761	48524761	-1	no_errors	ENST00000289431	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	0.994	A
TMEM245	23731	genome.wustl.edu	37	9	111849489	111849489	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr9:111849489G>A	ENST00000374586.3	-	6	1315	c.1284C>T	c.(1282-1284)gtC>gtT	p.V428V		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	428						integral component of membrane (GO:0016021)											TTCCAAGCCCGACAATGGGCC	0.438																																						dbGAP											0													93.0	92.0	92.0					9																	111849489		1827	4087	5914	-	-	-	SO:0001819	synonymous_variant	0			AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1284C>T	9.37:g.111849489G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	pfam_UPF0118	p.R29W	ENST00000374586.3	37	c.85	CCDS43858.1	9	.	.	.	.	.	.	.	.	.	.	G	7.376	0.627743	0.14257	.	.	ENSG00000106771	ENST00000413712	.	.	.	5.83	-11.7	0.00046	.	.	.	.	.	T	0.43166	0.1235	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53683	-0.8404	4	.	.	.	-2.8289	7.2659	0.26229	0.1676:0.0762:0.5889:0.1673	.	.	.	.	W	29	.	.	R	-	1	2	C9orf5	110889310	0.047000	0.20315	0.003000	0.11579	0.792000	0.44763	-0.572000	0.05881	-1.980000	0.00990	-1.259000	0.01468	CGG	TMEM245	-	NULL	ENSG00000106771		0.438	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM245	HGNC	protein_coding	OTTHUMT00000053587.2	36	0.00	0	G	NM_032012		111849489	111849489	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000413712	ensembl	human	novel	69_37n	missense	11	59.26	16	SNP	0.004	A
TMEM25	84866	genome.wustl.edu	37	11	118404580	118404580	+	Silent	SNP	C	C	A	rs199815386		TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr11:118404580C>A	ENST00000313236.5	+	6	867	c.814C>A	c.(814-816)Cgg>Agg	p.R272R	TMEM25_ENST00000411589.2_Silent_p.R228R|TMEM25_ENST00000442938.2_Silent_p.R228R|TMEM25_ENST00000544878.1_Silent_p.R175R|TMEM25_ENST00000354064.7_Silent_p.R124R|TMEM25_ENST00000533102.1_Silent_p.R272R|TMEM25_ENST00000524725.1_Silent_p.R228R|TMEM25_ENST00000354284.4_Silent_p.R272R|TMEM25_ENST00000359862.4_Silent_p.R228R|RP11-770J1.3_ENST00000556583.1_RNA	NM_032780.3	NP_116169.2	Q86YD3	TMM25_HUMAN	transmembrane protein 25	272						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		AGGCCCCTCCCGGCACCCATC	0.582																																						dbGAP											0													125.0	128.0	127.0					11																	118404580		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AK075437	CCDS8398.1, CCDS44745.1, CCDS44746.1, CCDS44747.1, CCDS44748.1	11q23.3	2013-01-11			ENSG00000149582	ENSG00000149582		"""Immunoglobulin superfamily / C2-set domain containing"""	25890	protein-coding gene	gene with protein product		613934				15254712, 12975309	Standard	NM_001144034		Approved	FLJ14399	uc010rye.2	Q86YD3	OTTHUMG00000166339	ENST00000313236.5:c.814C>A	11.37:g.118404580C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8J4|B0YJA6|B0YJA7|B0YJA9|G5E9U4|Q6UW89|Q86UA7|Q8NBL5|Q96KA6|Q96MW9	Missense_Mutation	SNP	NULL	p.P106Q	ENST00000313236.5	37	c.317	CCDS8398.1	11	.	.	.	.	.	.	.	.	.	.	C	8.704	0.910456	0.17833	.	.	ENSG00000149582	ENST00000526853	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	T	0.72128	0.3422	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69465	-0.5138	4	.	.	.	-22.4677	15.7568	0.78037	0.0:1.0:0.0:0.0	.	.	.	.	Q	106	.	.	P	+	2	0	TMEM25	117909790	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	4.015000	0.57152	2.793000	0.96121	0.561000	0.74099	CCG	TMEM25	-	NULL	ENSG00000149582		0.582	TMEM25-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM25	HGNC	protein_coding	OTTHUMT00000389266.1	72	0.00	0	C	NM_032780		118404580	118404580	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000526853	ensembl	human	putative	69_37n	missense	28	46.15	24	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578536	7578536	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr17:7578536T>C	ENST00000269305.4	-	5	583	c.394A>G	c.(394-396)Aag>Gag	p.K132E	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.K132E|TP53_ENST00000420246.2_Missense_Mutation_p.K132E|TP53_ENST00000445888.2_Missense_Mutation_p.K132E|TP53_ENST00000359597.4_Missense_Mutation_p.K132E|TP53_ENST00000455263.2_Missense_Mutation_p.K132E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132E(20)|p.K132Q(13)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.N131del(3)|p.K132*(3)|p.N131fs*27(2)|p.K132fs*38(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.L130fs*16(1)|p.K132W(1)|p.K39E(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAAACATCTTGTTGAGGGCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(35)|Deletion - In frame(13)|Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Nonsense(3)	breast(11)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(7)|ovary(6)|large_intestine(5)|urinary_tract(5)|lung(5)|bone(4)|upper_aerodigestive_tract(3)|adrenal_gland(2)|stomach(2)|oesophagus(2)|prostate(2)|soft_tissue(1)|cervix(1)|kidney(1)|biliary_tract(1)|pancreas(1)|liver(1)	GRCh37	CM086989|CM973641	TP53	M							46.0	47.0	46.0					17																	7578536		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.394A>G	17.37:g.7578536T>C	ENSP00000269305:p.Lys132Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K132E	ENST00000269305.4	37	c.394	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	25.8	4.670498	0.88348	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	M	0.91768	3.24	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.991;0.999;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.992;0.992;0.953;0.98;0.995;0.989;1.0	D	0.96352	0.9259	10	0.87932	D	0	-14.0777	13.8301	0.63375	0.0:0.0:0.0:1.0	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132E;ENSP00000352610:K132E;ENSP00000269305:K132E;ENSP00000398846:K132E;ENSP00000391127:K132E;ENSP00000391478:K132E;ENSP00000423862:K39E;ENSP00000424104:K132E	ENSP00000269305:K132E	K	-	1	0	TP53	7519261	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.993000	0.88291	2.206000	0.71126	0.533000	0.62120	AAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	33	0.00	0	T	NM_000546		7578536	7578536	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	1.000	C
TRIM43	129868	genome.wustl.edu	37	2	96265165	96265165	+	Silent	SNP	C	C	T	rs200456827		TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:96265165C>T	ENST00000272395.2	+	7	1321	c.1185C>T	c.(1183-1185)taC>taT	p.Y395Y		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	395	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						TTCCTCACTACATAGAGAAAC	0.418																																						dbGAP											0													1.0	1.0	1.0					2																	96265165		500	1208	1708	-	-	-	SO:0001819	synonymous_variant	0			BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.1185C>T	2.37:g.96265165C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TJ7	Silent	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.Y395	ENST00000272395.2	37	c.1185	CCDS2015.1	2																																																																																			TRIM43	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000144015		0.418	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM43	HGNC	protein_coding	OTTHUMT00000252784.1	8	0.00	0	C	NM_138800		96265165	96265165	+1	no_errors	ENST00000272395	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	0.000	T
TRIM9	114088	genome.wustl.edu	37	14	51561358	51561358	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr14:51561358G>A	ENST00000298355.3	-	1	1421	c.300C>T	c.(298-300)cgC>cgT	p.R100R	TRIM9_ENST00000338969.5_Silent_p.R100R|TRIM9_ENST00000360392.4_Silent_p.R100R	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	100					negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					GGGGAAACACGCGGACGCCGT	0.692																																						dbGAP											0													10.0	16.0	14.0					14																	51561358		2175	4268	6443	-	-	-	SO:0001819	synonymous_variant	0			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.300C>T	14.37:g.51561358G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Silent	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.R100	ENST00000298355.3	37	c.300	CCDS9703.1	14																																																																																			TRIM9	-	smart_Znf_RING	ENSG00000100505		0.692	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1	68	0.00	0	G	NM_015163		51561358	51561358	-1	no_errors	ENST00000338969	ensembl	human	known	69_37n	silent	35	31.37	16	SNP	0.191	A
VSNL1	7447	genome.wustl.edu	37	2	17836578	17836578	+	Missense_Mutation	SNP	C	C	G	rs369837808		TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:17836578C>G	ENST00000406397.1	+	4	1018	c.493C>G	c.(493-495)Cag>Gag	p.Q165E	VSNL1_ENST00000295156.4_Missense_Mutation_p.Q165E|VSNL1_ENST00000404666.2_Missense_Mutation_p.Q165E			P62760	VISL1_HUMAN	visinin-like 1	165	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)		calcium ion binding (GO:0005509)			NS(1)|breast(1)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CAAAGATGACCAGATTACACT	0.438																																						dbGAP											0													130.0	112.0	118.0					2																	17836578		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1689.1	2p24.3	2013-01-10			ENSG00000163032	ENSG00000163032		"""EF-hand domain containing"""	12722	protein-coding gene	gene with protein product	"""hippocalcin-like protein 3"""	600817				8530085, 2202488	Standard	NM_003385		Approved	VILIP, HPCAL3, HUVISL1, HLP3, VILIP-1	uc002rcm.3	P62760	OTTHUMG00000090645	ENST00000406397.1:c.493C>G	2.37:g.17836578C>G	ENSP00000384719:p.Gln165Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W515|P28677|P29103|P42323|Q9UM20	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.Q165E	ENST00000406397.1	37	c.493	CCDS1689.1	2	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566672	0.45694	.	.	ENSG00000163032	ENST00000404666;ENST00000295156;ENST00000406397	T;T;T	0.71341	-0.56;-0.56;-0.56	5.58	4.69	0.59074	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.54951	0.1890	N	0.13272	0.32	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47959	-0.9076	10	0.31617	T	0.26	.	15.7578	0.78051	0.1376:0.8623:0.0:0.0	.	165	P62760	VISL1_HUMAN	E	165	ENSP00000384014:Q165E;ENSP00000295156:Q165E;ENSP00000384719:Q165E	ENSP00000295156:Q165E	Q	+	1	0	VSNL1	17700059	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	1.334000	0.45468	0.650000	0.86243	CAG	VSNL1	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000163032		0.438	VSNL1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSNL1	HGNC	protein_coding	OTTHUMT00000323803.1	8	0.00	0	C	NM_003385		17836578	17836578	+1	no_errors	ENST00000295156	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	G
WDFY3	23001	genome.wustl.edu	37	4	85887858	85887858	+	5'Flank	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr4:85887858A>G	ENST00000295888.4	-	0	0				WDFY3_ENST00000322366.6_5'Flank|WDFY3-AS2_ENST00000451762.1_RNA	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3						aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GACTGACTGGATCCTCCTCTT	0.582																																						dbGAP											0													87.0	86.0	86.0					4																	85887858		692	1591	2283	-	-	-	SO:0001631	upstream_gene_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424		4.37:g.85887858A>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	RNA	SNP	-	NULL	ENST00000295888.4	37	NULL	CCDS3609.1	4																																																																																			WDFY3-AS2	-	-	ENSG00000180769		0.582	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3-AS2	HGNC	protein_coding	OTTHUMT00000252811.2	62	0.00	0	A	NM_014991		85887858	85887858	+1	no_errors	ENST00000451762	ensembl	human	known	69_37n	rna	21	46.15	18	SNP	1.000	G
WDR44	54521	genome.wustl.edu	37	X	117527021	117527021	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chrX:117527021G>A	ENST00000254029.3	+	4	1008	c.613G>A	c.(613-615)Gct>Act	p.A205T	WDR44_ENST00000371822.5_Missense_Mutation_p.A180T|WDR44_ENST00000493448.1_3'UTR|WDR44_ENST00000371825.3_Missense_Mutation_p.A205T	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	205						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.A205T(2)		breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AGATTTTGCCGCTGTGGAAGA	0.493																																						dbGAP											2	Substitution - Missense(2)	ovary(2)											143.0	124.0	131.0					X																	117527021		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.613G>A	X.37:g.117527021G>A	ENSP00000254029:p.Ala205Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A205T	ENST00000254029.3	37	c.613	CCDS14572.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.075|0.075	-1.194118|-1.194118	0.01594|0.01594	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825|ENST00000371848	T;T;T|.	0.73047|.	-0.71;-0.12;0.01|.	5.17|5.17	2.41|2.41	0.29592|0.29592	.|.	0.818750|.	0.11442|.	N|.	0.563695|.	T|T	0.17831|0.17831	0.0428|0.0428	N|N	0.12182|0.12182	0.205|0.205	0.19775|0.19775	N|N	0.999953|0.999953	B;B;B|.	0.06786|.	0.001;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.0;0.0|.	T|T	0.25152|0.25152	-1.0140|-1.0140	10|5	0.16896|.	T|.	0.51|.	-2.4172|-2.4172	4.2889|4.2889	0.10869|0.10869	0.3396:0.0:0.5056:0.1548|0.3396:0.0:0.5056:0.1548	.|.	180;205;205|.	F8W913;Q5JSH3-2;Q5JSH3|.	.;.;WDR44_HUMAN|.	T|H	180;205;205|104	ENSP00000360887:A180T;ENSP00000254029:A205T;ENSP00000360890:A205T|.	ENSP00000254029:A205T|.	A|R	+|+	1|2	0|0	WDR44|WDR44	117411049|117411049	0.901000|0.901000	0.30685|0.30685	0.108000|0.108000	0.21378|0.21378	0.125000|0.125000	0.20455|0.20455	0.149000|0.149000	0.16243|0.16243	0.177000|0.177000	0.19895|0.19895	-0.190000|-0.190000	0.12839|0.12839	GCT|CGC	WDR44	-	NULL	ENSG00000131725		0.493	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR44	HGNC	protein_coding	OTTHUMT00000058001.1	30	0.00	0	G	NM_019045		117527021	117527021	+1	no_errors	ENST00000254029	ensembl	human	known	69_37n	missense	13	62.86	22	SNP	0.637	A
ZKSCAN7	55888	genome.wustl.edu	37	3	44612064	44612064	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr3:44612064A>G	ENST00000273320.3	+	6	1891	c.1462A>G	c.(1462-1464)Acc>Gcc	p.T488A	RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000431636.1_Intron|ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.T488A|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000341840.3_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	488					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCACCAGAGAACCCATACTGG	0.453																																						dbGAP											0													101.0	103.0	102.0					3																	44612064		2203	4300	6503	-	-	-	SO:0001583	missense	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1462A>G	3.37:g.44612064A>G	ENSP00000273320:p.Thr488Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T488A	ENST00000273320.3	37	c.1462	CCDS2715.1	3	.	.	.	.	.	.	.	.	.	.	.	3.765	-0.048898	0.07407	.	.	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000447279	T;T;T	0.00966	5.49;5.49;5.49	4.26	1.71	0.24356	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.506093	0.14801	N	0.297628	T	0.01092	0.0036	L	0.41961	1.31	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.0	T	0.45411	-0.9263	10	0.62326	D	0.03	-1.7773	6.0221	0.19634	0.602:0.3095:0.0885:0.0	.	358;488	A7MAY2;Q9P0L1	.;ZN167_HUMAN	A	488;488;337	ENSP00000395524:T488A;ENSP00000273320:T488A;ENSP00000405034:T337A	ENSP00000273320:T488A	T	+	1	0	ZNF167	44587068	0.000000	0.05858	0.439000	0.26833	0.641000	0.38312	0.716000	0.25836	0.170000	0.19704	-0.323000	0.08544	ACC	ZNF167	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196345		0.453	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF167	HGNC	protein_coding	OTTHUMT00000256752.4	37	0.00	0	A	NM_018651		44612064	44612064	+1	no_errors	ENST00000273320	ensembl	human	known	69_37n	missense	24	31.43	11	SNP	0.012	G
ZNF239	8187	genome.wustl.edu	37	10	44053585	44053585	+	5'UTR	SNP	C	C	T	rs2999278	byFrequency	TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr10:44053585C>T	ENST00000306006.6	-	0	595				ZNF239_ENST00000426961.1_5'UTR|ZNF239_ENST00000374446.2_5'UTR|ZNF239_ENST00000491188.1_5'UTR|ZNF239_ENST00000535642.1_5'UTR	NM_005674.2	NP_005665.2	Q16600	ZN239_HUMAN	zinc finger protein 239						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GTGTTTTCTGCTGAAGATTCT	0.413													C|||	2729	0.544928	0.4917	0.513	5008	,	,		20336	0.5506		0.5308	False		,,,				2504	0.6483					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			X82125	CCDS41502.1	10q11.22-q11.23	2013-01-08			ENSG00000196793	ENSG00000196793		"""Zinc fingers, C2H2-type"""	13031	protein-coding gene	gene with protein product		601069				8903737, 8587123	Standard	NM_005674		Approved	MOK2, HOK-2	uc009xmk.3	Q16600	OTTHUMG00000018033	ENST00000306006.6:c.-58G>A	10.37:g.44053585C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1G9|Q8TAS5	RNA	SNP	-	NULL	ENST00000306006.6	37	NULL	CCDS41502.1	10																																																																																			ZNF239	-	-	ENSG00000196793		0.413	ZNF239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF239	HGNC	protein_coding	OTTHUMT00000047710.1	26	0.00	0	C			44053585	44053585	-1	no_errors	ENST00000491188	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.654	T
ZNF638	27332	genome.wustl.edu	37	2	71576941	71576941	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:71576941C>T	ENST00000409544.1	+	2	1487	c.857C>T	c.(856-858)tCa>tTa	p.S286L	ZNF638_ENST00000264447.4_Missense_Mutation_p.S286L|ZNF638_ENST00000377802.2_Missense_Mutation_p.S286L|ZNF638_ENST00000355812.3_Missense_Mutation_p.S286L|ZNF638_ENST00000410075.1_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	286					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TCCTTTTTCTCAGTTGAGAGT	0.428																																						dbGAP											0													137.0	135.0	135.0					2																	71576941		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.857C>T	2.37:g.71576941C>T	ENSP00000386433:p.Ser286Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.S286L	ENST00000409544.1	37	c.857	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335898	0.41398	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.73363	-0.15;-0.74;0.45;-0.12;1.47;1.47	5.77	5.77	0.91146	.	0.286268	0.35495	N	0.003174	T	0.57961	0.2089	N	0.08118	0	0.24417	N	0.994631	B;B;B;B;B	0.15473	0.013;0.004;0.0;0.0;0.002	B;B;B;B;B	0.08055	0.003;0.001;0.001;0.0;0.001	T	0.56577	-0.7956	10	0.87932	D	0	-2.7839	15.5004	0.75695	0.0:1.0:0.0:0.0	.	392;286;286;286;286	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	L	286;392;286;286;286;286	ENSP00000386669:S286L;ENSP00000438189:S392L;ENSP00000348066:S286L;ENSP00000367033:S286L;ENSP00000264447:S286L;ENSP00000386433:S286L	ENSP00000264447:S286L	S	+	2	0	ZNF638	71430449	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.252000	0.65445	2.723000	0.93209	0.655000	0.94253	TCA	ZNF638	-	NULL	ENSG00000075292		0.428	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	53	0.00	0	C	NM_014497		71576941	71576941	+1	no_errors	ENST00000264447	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
ZNF804A	91752	genome.wustl.edu	37	2	185800789	185800789	+	Silent	SNP	G	G	A			TCGA-A2-A4S3-01A-21D-A25Q-09	TCGA-A2-A4S3-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9f84743b-291f-4338-a7a8-0f2752236f22	d14e8c5a-fad9-4325-ac04-adaed184bd97	g.chr2:185800789G>A	ENST00000302277.6	+	4	1260	c.666G>A	c.(664-666)gcG>gcA	p.A222A		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	222							metal ion binding (GO:0046872)	p.A222A(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CAAAGAAAGCGTCCGTGAAGC	0.433																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											69.0	70.0	70.0					2																	185800789		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.666G>A	2.37:g.185800789G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E253|Q6ZN26	Silent	SNP	pfam_Znf_C2H2_jaz	p.A222	ENST00000302277.6	37	c.666	CCDS2291.1	2																																																																																			ZNF804A	-	NULL	ENSG00000170396		0.433	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	42	0.00	0	G	NM_194250		185800789	185800789	+1	no_errors	ENST00000302277	ensembl	human	known	69_37n	silent	23	48.89	22	SNP	0.003	A
