#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA9	10350	genome.wustl.edu	37	17	67020435	67020435	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:67020435A>G	ENST00000340001.4	-	17	2412	c.2201T>C	c.(2200-2202)aTc>aCc	p.I734T	ABCA9_ENST00000370732.2_Missense_Mutation_p.I734T|ABCA9_ENST00000453985.2_Missense_Mutation_p.I734T	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	734					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GGCATCAGAGATGTGCTGCTT	0.323																																						dbGAP											0													70.0	62.0	65.0					17																	67020435		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2201T>C	17.37:g.67020435A>G	ENSP00000342216:p.Ile734Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I734T	ENST00000340001.4	37	c.2201	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	A	18.04	3.535215	0.64972	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.86297	-2.1;-2.1	4.68	4.68	0.58851	.	0.136342	0.32473	N	0.006055	D	0.95506	0.8540	H	0.97340	3.985	0.46725	D	0.999179	D;D	0.76494	0.999;0.981	D;P	0.70487	0.969;0.852	D	0.96771	0.9568	10	0.87932	D	0	.	13.2291	0.59931	1.0:0.0:0.0:0.0	.	734;734	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	T	734;717;734;729	ENSP00000342216:I734T;ENSP00000359767:I734T	ENSP00000342216:I734T	I	-	2	0	ABCA9	64532030	1.000000	0.71417	0.997000	0.53966	0.865000	0.49528	8.196000	0.89725	1.875000	0.54330	0.443000	0.29094	ATC	ABCA9	-	NULL	ENSG00000154258		0.323	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	111	0.00	0	A	NM_172386		67020435	67020435	-1	no_errors	ENST00000340001	ensembl	human	known	69_37n	missense	75	24.24	24	SNP	1.000	G
ABCA9	10350	genome.wustl.edu	37	17	67020435	67020435	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr17:67020435A>G	ENST00000340001.4	-	17	2412	c.2201T>C	c.(2200-2202)aTc>aCc	p.I734T	ABCA9_ENST00000370732.2_Missense_Mutation_p.I734T|ABCA9_ENST00000453985.2_Missense_Mutation_p.I734T	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	734					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GGCATCAGAGATGTGCTGCTT	0.323																																						dbGAP											0													70.0	62.0	65.0					17																	67020435		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2201T>C	17.37:g.67020435A>G	ENSP00000342216:p.Ile734Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I734T	ENST00000340001.4	37	c.2201	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	A	18.04	3.535215	0.64972	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.86297	-2.1;-2.1	4.68	4.68	0.58851	.	0.136342	0.32473	N	0.006055	D	0.95506	0.8540	H	0.97340	3.985	0.46725	D	0.999179	D;D	0.76494	0.999;0.981	D;P	0.70487	0.969;0.852	D	0.96771	0.9568	10	0.87932	D	0	.	13.2291	0.59931	1.0:0.0:0.0:0.0	.	734;734	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	T	734;717;734;729	ENSP00000342216:I734T;ENSP00000359767:I734T	ENSP00000342216:I734T	I	-	2	0	ABCA9	64532030	1.000000	0.71417	0.997000	0.53966	0.865000	0.49528	8.196000	0.89725	1.875000	0.54330	0.443000	0.29094	ATC	ABCA9	-	NULL	ENSG00000154258		0.323	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	183	0.00	0	A	NM_172386		67020435	67020435	-1	no_errors	ENST00000340001	ensembl	human	known	69_37n	missense	75	24.24	24	SNP	1.000	G
AGFG2	3268	genome.wustl.edu	37	7	100159886	100159886	+	Silent	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:100159886C>T	ENST00000300176.4	+	7	1004	c.882C>T	c.(880-882)agC>agT	p.S294S	AGFG2_ENST00000474713.1_3'UTR|AGFG2_ENST00000262935.4_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	294					regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCCAGGGAGCAGCCAGGGGA	0.637																																						dbGAP											0													48.0	53.0	51.0					7																	100159886		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.882C>T	7.37:g.100159886C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75429|Q96AB9|Q96GL4	Missense_Mutation	SNP	NULL	p.A36V	ENST00000300176.4	37	c.107	CCDS5697.1	7	.	.	.	.	.	.	.	.	.	.	C	8.822	0.937713	0.18206	.	.	ENSG00000106351	ENST00000429987	.	.	.	4.8	2.98	0.34508	.	.	.	.	.	T	0.55417	0.1919	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47923	-0.9079	4	.	.	.	-26.2451	7.0708	0.25177	0.0:0.8152:0.0:0.1848	.	.	.	.	V	36	.	.	A	+	2	0	AGFG2	99997822	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	0.739000	0.26173	0.624000	0.30286	0.555000	0.69702	GCA	AGFG2	-	NULL	ENSG00000106351		0.637	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGFG2	HGNC	protein_coding	OTTHUMT00000342769.1	78	0.00	0	C	NM_006076		100159886	100159886	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429987	ensembl	human	putative	69_37n	missense	59	20.27	15	SNP	1.000	T
AGFG2	3268	genome.wustl.edu	37	7	100159886	100159886	+	Silent	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:100159886C>T	ENST00000300176.4	+	7	1004	c.882C>T	c.(880-882)agC>agT	p.S294S	AGFG2_ENST00000474713.1_3'UTR|AGFG2_ENST00000262935.4_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	294					regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCCAGGGAGCAGCCAGGGGA	0.637																																						dbGAP											0													48.0	53.0	51.0					7																	100159886		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.882C>T	7.37:g.100159886C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75429|Q96AB9|Q96GL4	Missense_Mutation	SNP	NULL	p.A36V	ENST00000300176.4	37	c.107	CCDS5697.1	7	.	.	.	.	.	.	.	.	.	.	C	8.822	0.937713	0.18206	.	.	ENSG00000106351	ENST00000429987	.	.	.	4.8	2.98	0.34508	.	.	.	.	.	T	0.55417	0.1919	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47923	-0.9079	4	.	.	.	-26.2451	7.0708	0.25177	0.0:0.8152:0.0:0.1848	.	.	.	.	V	36	.	.	A	+	2	0	AGFG2	99997822	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	0.739000	0.26173	0.624000	0.30286	0.555000	0.69702	GCA	AGFG2	-	NULL	ENSG00000106351		0.637	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGFG2	HGNC	protein_coding	OTTHUMT00000342769.1	26	0.00	0	C	NM_006076		100159886	100159886	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429987	ensembl	human	putative	69_37n	missense	59	20.27	15	SNP	1.000	T
ANK1	286	genome.wustl.edu	37	8	41615631	41615631	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr8:41615631T>A	ENST00000347528.4	-	2	135	c.52A>T	c.(52-54)Aga>Tga	p.R18*	ANK1_ENST00000265709.8_Nonsense_Mutation_p.R51*|ANK1_ENST00000379758.2_Nonsense_Mutation_p.R18*|ANK1_ENST00000352337.4_Nonsense_Mutation_p.R18*|ANK1_ENST00000396942.1_Nonsense_Mutation_p.R18*|ANK1_ENST00000396945.1_Nonsense_Mutation_p.R18*|ANK1_ENST00000289734.7_Nonsense_Mutation_p.R18*	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	18	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTTGCTGCTCTCAGAAAGCTG	0.522																																						dbGAP											0													252.0	241.0	245.0					8																	41615631		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.52A>T	8.37:g.41615631T>A	ENSP00000339620:p.Arg18*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.R18*	ENST00000347528.4	37	c.52	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	T	39	7.430392	0.98279	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	.	.	.	5.54	1.41	0.22369	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0779	0.72090	0.0:0.0:0.6006:0.3994	.	.	.	.	X	18;18;18;18;18;18;51;18	.	ENSP00000265709:R51X	R	-	1	2	ANK1	41734788	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	1.127000	0.31357	0.426000	0.26116	0.460000	0.39030	AGA	ANK1	-	smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.522	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	1132	0.18	2	T	NM_020475		41615631	41615631	-1	no_errors	ENST00000396942	ensembl	human	known	69_37n	nonsense	366	20.04	92	SNP	1.000	A
ANK1	286	genome.wustl.edu	37	8	41615631	41615631	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr8:41615631T>A	ENST00000347528.4	-	2	135	c.52A>T	c.(52-54)Aga>Tga	p.R18*	ANK1_ENST00000265709.8_Nonsense_Mutation_p.R51*|ANK1_ENST00000379758.2_Nonsense_Mutation_p.R18*|ANK1_ENST00000352337.4_Nonsense_Mutation_p.R18*|ANK1_ENST00000396942.1_Nonsense_Mutation_p.R18*|ANK1_ENST00000396945.1_Nonsense_Mutation_p.R18*|ANK1_ENST00000289734.7_Nonsense_Mutation_p.R18*	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	18	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTTGCTGCTCTCAGAAAGCTG	0.522																																						dbGAP											0													252.0	241.0	245.0					8																	41615631		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.52A>T	8.37:g.41615631T>A	ENSP00000339620:p.Arg18*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.R18*	ENST00000347528.4	37	c.52	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	T	39	7.430392	0.98279	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	.	.	.	5.54	1.41	0.22369	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0779	0.72090	0.0:0.0:0.6006:0.3994	.	.	.	.	X	18;18;18;18;18;18;51;18	.	ENSP00000265709:R51X	R	-	1	2	ANK1	41734788	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	1.127000	0.31357	0.426000	0.26116	0.460000	0.39030	AGA	ANK1	-	smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.522	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	282	0.00	0	T	NM_020475		41615631	41615631	-1	no_errors	ENST00000396942	ensembl	human	known	69_37n	nonsense	366	20.04	92	SNP	1.000	A
ANLN	54443	genome.wustl.edu	37	7	36438976	36438976	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:36438976G>C	ENST00000265748.2	+	3	682	c.461G>C	c.(460-462)cGc>cCc	p.R154P	ANLN_ENST00000396068.2_Missense_Mutation_p.R154P	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	154	Interaction with CD2AP.|Nuclear localization.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GAGCAACGGCGCCGTTGGGAT	0.433																																						dbGAP											0													55.0	53.0	53.0					7																	36438976		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.461G>C	7.37:g.36438976G>C	ENSP00000265748:p.Arg154Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R154P	ENST00000265748.2	37	c.461	CCDS5447.1	7	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854510	0.71719	.	.	ENSG00000011426	ENST00000265748;ENST00000396068;ENST00000424865	T;T;T	0.02863	4.13;4.13;4.13	5.56	5.56	0.83823	.	0.203094	0.53938	D	0.000051	T	0.14356	0.0347	L	0.58669	1.825	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.87578	0.998;0.949;0.977;0.949	T	0.00045	-1.2216	10	0.72032	D	0.01	-9.0278	19.91	0.97023	0.0:0.0:1.0:0.0	.	31;154;154;154	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	P	154;154;132	ENSP00000265748:R154P;ENSP00000379380:R154P;ENSP00000404979:R132P	ENSP00000265748:R154P	R	+	2	0	ANLN	36405501	1.000000	0.71417	0.915000	0.36163	0.637000	0.38172	5.323000	0.65858	2.782000	0.95742	0.655000	0.94253	CGC	ANLN	-	NULL	ENSG00000011426		0.433	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	HGNC	protein_coding	OTTHUMT00000218582.3	275	0.00	0	G	NM_018685		36438976	36438976	+1	no_errors	ENST00000265748	ensembl	human	known	69_37n	missense	106	20.90	28	SNP	0.990	C
ANLN	54443	genome.wustl.edu	37	7	36438976	36438976	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:36438976G>C	ENST00000265748.2	+	3	682	c.461G>C	c.(460-462)cGc>cCc	p.R154P	ANLN_ENST00000396068.2_Missense_Mutation_p.R154P	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	154	Interaction with CD2AP.|Nuclear localization.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GAGCAACGGCGCCGTTGGGAT	0.433																																						dbGAP											0													55.0	53.0	53.0					7																	36438976		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.461G>C	7.37:g.36438976G>C	ENSP00000265748:p.Arg154Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R154P	ENST00000265748.2	37	c.461	CCDS5447.1	7	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854510	0.71719	.	.	ENSG00000011426	ENST00000265748;ENST00000396068;ENST00000424865	T;T;T	0.02863	4.13;4.13;4.13	5.56	5.56	0.83823	.	0.203094	0.53938	D	0.000051	T	0.14356	0.0347	L	0.58669	1.825	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.87578	0.998;0.949;0.977;0.949	T	0.00045	-1.2216	10	0.72032	D	0.01	-9.0278	19.91	0.97023	0.0:0.0:1.0:0.0	.	31;154;154;154	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	P	154;154;132	ENSP00000265748:R154P;ENSP00000379380:R154P;ENSP00000404979:R132P	ENSP00000265748:R154P	R	+	2	0	ANLN	36405501	1.000000	0.71417	0.915000	0.36163	0.637000	0.38172	5.323000	0.65858	2.782000	0.95742	0.655000	0.94253	CGC	ANLN	-	NULL	ENSG00000011426		0.433	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	HGNC	protein_coding	OTTHUMT00000218582.3	168	0.59	1	G	NM_018685		36438976	36438976	+1	no_errors	ENST00000265748	ensembl	human	known	69_37n	missense	106	20.90	28	SNP	0.990	C
ATP6V1C1	528	genome.wustl.edu	37	8	104078638	104078638	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr8:104078638A>G	ENST00000395862.3	+	12	1175	c.1016A>G	c.(1015-1017)tAt>tGt	p.Y339C	ATP6V1C1_ENST00000518857.1_Missense_Mutation_p.Y264C|ATP6V1C1_ENST00000518738.1_Missense_Mutation_p.Y339C|ATP6V1C1_ENST00000521514.1_Missense_Mutation_p.Y264C	NM_001695.4	NP_001686.1	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1	339					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			CATGAATTGTATAAACATCTA	0.338																																						dbGAP											0													76.0	76.0	76.0					8																	104078638		2203	4300	6503	-	-	-	SO:0001583	missense	0			X69151	CCDS6296.1	8p22.3	2011-05-24	2006-01-13	2002-05-10	ENSG00000155097	ENSG00000155097	3.6.3.14	"""ATPases / V-type"""	856	protein-coding gene	gene with protein product		603097	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 42kD"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1"""	ATP6D, ATP6C		8250920, 14580332	Standard	NM_001695		Approved	VATC, Vma5	uc003ykz.4	P21283	OTTHUMG00000164761	ENST00000395862.3:c.1016A>G	8.37:g.104078638A>G	ENSP00000379203:p.Tyr339Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ATPase_V1-cplx_csu	p.Y339C	ENST00000395862.3	37	c.1016	CCDS6296.1	8	.	.	.	.	.	.	.	.	.	.	A	19.28	3.797332	0.70567	.	.	ENSG00000155097	ENST00000518857;ENST00000395862;ENST00000521514;ENST00000518738	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.68604	0.3019	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.71199	-0.4663	10	0.46703	T	0.11	.	14.9215	0.70841	1.0:0.0:0.0:0.0	.	339	P21283	VATC1_HUMAN	C	264;339;264;339	ENSP00000428204:Y264C;ENSP00000379203:Y339C;ENSP00000430129:Y264C;ENSP00000430282:Y339C	ENSP00000379203:Y339C	Y	+	2	0	ATP6V1C1	104147814	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.458000	0.80787	1.913000	0.55393	0.477000	0.44152	TAT	ATP6V1C1	-	pfam_ATPase_V1-cplx_csu	ENSG00000155097		0.338	ATP6V1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1C1	HGNC	protein_coding	OTTHUMT00000380101.1	126	0.00	0	A	NM_001695		104078638	104078638	+1	no_errors	ENST00000395862	ensembl	human	known	69_37n	missense	83	43.54	64	SNP	1.000	G
ATP6V1C1	528	genome.wustl.edu	37	8	104078638	104078638	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr8:104078638A>G	ENST00000395862.3	+	12	1175	c.1016A>G	c.(1015-1017)tAt>tGt	p.Y339C	ATP6V1C1_ENST00000518857.1_Missense_Mutation_p.Y264C|ATP6V1C1_ENST00000518738.1_Missense_Mutation_p.Y339C|ATP6V1C1_ENST00000521514.1_Missense_Mutation_p.Y264C	NM_001695.4	NP_001686.1	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1	339					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			CATGAATTGTATAAACATCTA	0.338																																						dbGAP											0													76.0	76.0	76.0					8																	104078638		2203	4300	6503	-	-	-	SO:0001583	missense	0			X69151	CCDS6296.1	8p22.3	2011-05-24	2006-01-13	2002-05-10	ENSG00000155097	ENSG00000155097	3.6.3.14	"""ATPases / V-type"""	856	protein-coding gene	gene with protein product		603097	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 42kD"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1"""	ATP6D, ATP6C		8250920, 14580332	Standard	NM_001695		Approved	VATC, Vma5	uc003ykz.4	P21283	OTTHUMG00000164761	ENST00000395862.3:c.1016A>G	8.37:g.104078638A>G	ENSP00000379203:p.Tyr339Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ATPase_V1-cplx_csu	p.Y339C	ENST00000395862.3	37	c.1016	CCDS6296.1	8	.	.	.	.	.	.	.	.	.	.	A	19.28	3.797332	0.70567	.	.	ENSG00000155097	ENST00000518857;ENST00000395862;ENST00000521514;ENST00000518738	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.68604	0.3019	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.71199	-0.4663	10	0.46703	T	0.11	.	14.9215	0.70841	1.0:0.0:0.0:0.0	.	339	P21283	VATC1_HUMAN	C	264;339;264;339	ENSP00000428204:Y264C;ENSP00000379203:Y339C;ENSP00000430129:Y264C;ENSP00000430282:Y339C	ENSP00000379203:Y339C	Y	+	2	0	ATP6V1C1	104147814	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.458000	0.80787	1.913000	0.55393	0.477000	0.44152	TAT	ATP6V1C1	-	pfam_ATPase_V1-cplx_csu	ENSG00000155097		0.338	ATP6V1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1C1	HGNC	protein_coding	OTTHUMT00000380101.1	226	0.00	0	A	NM_001695		104078638	104078638	+1	no_errors	ENST00000395862	ensembl	human	known	69_37n	missense	83	43.54	64	SNP	1.000	G
BCHE	590	genome.wustl.edu	37	3	165491226	165491226	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:165491226A>T	ENST00000264381.3	-	4	1919	c.1753T>A	c.(1753-1755)Tgg>Agg	p.W585R	BCHE_ENST00000540653.1_Missense_Mutation_p.W47R	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	585					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TGATTTTTCCAGTCCATCATG	0.323																																						dbGAP											0													124.0	119.0	121.0					3																	165491226		2202	4300	6502	-	-	-	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1753T>A	3.37:g.165491226A>T	ENSP00000264381:p.Trp585Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.W585R	ENST00000264381.3	37	c.1753	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	A	20.5	3.995953	0.74703	.	.	ENSG00000114200	ENST00000264381;ENST00000479451;ENST00000540653	T;D;D	0.85629	-0.35;-1.79;-2.01	5.18	5.18	0.71444	Acetylcholinesterase, tetramerisation (2);	0.339384	0.28977	N	0.013530	D	0.92234	0.7537	M	0.80183	2.485	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	D	0.93261	0.6643	10	0.87932	D	0	.	14.4975	0.67700	1.0:0.0:0.0:0.0	.	585	P06276	CHLE_HUMAN	R	585;115;47	ENSP00000264381:W585R;ENSP00000418325:W115R;ENSP00000443583:W47R	ENSP00000264381:W585R	W	-	1	0	BCHE	166973920	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.797000	0.85911	2.063000	0.61619	0.528000	0.53228	TGG	BCHE	-	pfam_AChE_tetra	ENSG00000114200		0.323	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	80	0.00	0	A			165491226	165491226	-1	no_errors	ENST00000264381	ensembl	human	known	69_37n	missense	133	15.29	24	SNP	1.000	T
BCHE	590	genome.wustl.edu	37	3	165491226	165491226	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:165491226A>T	ENST00000264381.3	-	4	1919	c.1753T>A	c.(1753-1755)Tgg>Agg	p.W585R	BCHE_ENST00000540653.1_Missense_Mutation_p.W47R	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	585					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TGATTTTTCCAGTCCATCATG	0.323																																						dbGAP											0													124.0	119.0	121.0					3																	165491226		2202	4300	6502	-	-	-	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1753T>A	3.37:g.165491226A>T	ENSP00000264381:p.Trp585Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.W585R	ENST00000264381.3	37	c.1753	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	A	20.5	3.995953	0.74703	.	.	ENSG00000114200	ENST00000264381;ENST00000479451;ENST00000540653	T;D;D	0.85629	-0.35;-1.79;-2.01	5.18	5.18	0.71444	Acetylcholinesterase, tetramerisation (2);	0.339384	0.28977	N	0.013530	D	0.92234	0.7537	M	0.80183	2.485	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	D	0.93261	0.6643	10	0.87932	D	0	.	14.4975	0.67700	1.0:0.0:0.0:0.0	.	585	P06276	CHLE_HUMAN	R	585;115;47	ENSP00000264381:W585R;ENSP00000418325:W115R;ENSP00000443583:W47R	ENSP00000264381:W585R	W	-	1	0	BCHE	166973920	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.797000	0.85911	2.063000	0.61619	0.528000	0.53228	TGG	BCHE	-	pfam_AChE_tetra	ENSG00000114200		0.323	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	153	0.00	0	A			165491226	165491226	-1	no_errors	ENST00000264381	ensembl	human	known	69_37n	missense	133	15.29	24	SNP	1.000	T
BPTF	2186	genome.wustl.edu	37	17	65955782	65955783	+	In_Frame_Ins	INS	-	-	GCC	rs60308484		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:65955782_65955783insGCC	ENST00000321892.4	+	26	8491_8492	c.8430_8431insGCC	c.(8431-8433)cct>GCCcct	p.2810_2811insA	BPTF_ENST00000424123.3_In_Frame_Ins_p.2528_2529insA|BPTF_ENST00000335221.5_In_Frame_Ins_p.2667_2668insA|BPTF_ENST00000306378.6_In_Frame_Ins_p.2684_2685insA			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2810	Pro-rich.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			cagcccctccaCCTTCACCTCC	0.589																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	Exception_encountered	17.37:g.65955782_65955783insGCC	ENSP00000315454:p.Pro2810_Pro2811insAla	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	In_Frame_Ins	INS	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.2810in_frame_insA	ENST00000321892.4	37	c.8430_8431		17																																																																																			BPTF	-	superfamily_Bromodomain	ENSG00000171634		0.589	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		88	0.00	0	-	NM_182641, NM_004459		65955782	65955783	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	in_frame_ins	92	10.68	11	INS	0.069:0.577	GCC
CAMTA2	23125	genome.wustl.edu	37	17	4875737	4875738	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr17:4875737_4875738insG	ENST00000348066.3	-	16	2720_2721	c.2597_2598insC	c.(2596-2598)cctfs	p.P866fs	CAMTA2_ENST00000358183.4_Frame_Shift_Ins_p.P866fs|CAMTA2_ENST00000381311.5_Frame_Shift_Ins_p.P868fs|CAMTA2_ENST00000414043.3_Frame_Shift_Ins_p.P889fs|CAMTA2_ENST00000572543.1_Frame_Shift_Ins_p.P871fs|RP5-1050D4.2_ENST00000430920.1_RNA|CAMTA2_ENST00000361571.5_Frame_Shift_Ins_p.P865fs	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	866					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GCAGAGGTGCAGGGGGGGGACT	0.614																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.2598dupC	17.37:g.4875745_4875745dupG	ENSP00000321813:p.Pro866fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Frame_Shift_Ins	INS	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.A890fs	ENST00000348066.3	37	c.2667_2666	CCDS11063.1	17																																																																																			CAMTA2	-	NULL	ENSG00000108509		0.614	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	15	0.00	0	-	NM_015099		4875737	4875738	-1	no_errors	ENST00000414043	ensembl	human	known	69_37n	frame_shift_ins	40	14.89	7	INS	0.999:1.000	G
CCDC9	26093	genome.wustl.edu	37	19	47769965	47769965	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:47769965A>T	ENST00000221922.6	+	8	1040	c.818A>T	c.(817-819)aAg>aTg	p.K273M		NM_015603.2	NP_056418.1	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	273							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	12		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		GAGAGGGAGAAGATCGACCAG	0.672																																						dbGAP											0													45.0	36.0	39.0					19																	47769965		2198	4297	6495	-	-	-	SO:0001583	missense	0			AL050284	CCDS12698.1	19q13.33	2008-02-05				ENSG00000105321			24560	protein-coding gene	gene with protein product						11230166	Standard	NM_015603		Approved	DKFZP586M1019	uc010xym.2	Q9Y3X0		ENST00000221922.6:c.818A>T	19.37:g.47769965A>T	ENSP00000221922:p.Lys273Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.K273M	ENST00000221922.6	37	c.818	CCDS12698.1	19	.	.	.	.	.	.	.	.	.	.	.	14.73	2.621971	0.46840	.	.	ENSG00000105321	ENST00000221922;ENST00000504556	T	0.47528	0.84	4.29	0.862	0.19056	.	0.333539	0.32106	N	0.006569	T	0.51075	0.1653	L	0.57536	1.79	0.34679	D	0.724468	D	0.54964	0.969	P	0.54100	0.742	T	0.62153	-0.6914	10	0.72032	D	0.01	-31.4281	8.1356	0.31052	0.6982:0.0:0.3018:0.0	.	273	Q9Y3X0	CCDC9_HUMAN	M	273;255	ENSP00000221922:K273M	ENSP00000221922:K273M	K	+	2	0	CCDC9	52461805	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.832000	0.39151	0.226000	0.20979	0.379000	0.24179	AAG	CCDC9	-	NULL	ENSG00000105321		0.672	CCDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC9	HGNC	protein_coding	OTTHUMT00000466917.1	23	0.00	0	A	NM_015603		47769965	47769965	+1	no_errors	ENST00000221922	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.998	T
CDC42BPA	8476	genome.wustl.edu	37	1	227198691	227198691	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:227198691T>C	ENST00000334218.5	-	34	5768	c.4826A>G	c.(4825-4827)tAt>tGt	p.Y1609C	CDC42BPA_ENST00000366766.2_Intron|CDC42BPA_ENST00000366769.3_Intron|CDC42BPA_ENST00000366767.3_Intron|CDC42BPA_ENST00000535525.1_Intron|CDC42BPA_ENST00000366764.2_Intron|CDC42BPA_ENST00000366765.3_Intron					CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				AGTCATGTGATAGATGTGTTC	0.428																																						dbGAP											0													34.0	31.0	32.0					1																	227198691		876	1991	2867	-	-	-	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000334218.5:c.4826A>G	1.37:g.227198691T>C	ENSP00000335341:p.Tyr1609Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.Y1609C	ENST00000334218.5	37	c.4826		1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009791	0.54361	.	.	ENSG00000143776	ENST00000334218	T	0.70749	-0.51	5.46	5.46	0.80206	.	.	.	.	.	D	0.83825	0.5338	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.84749	0.0755	8	0.48119	T	0.1	.	15.825	0.78698	0.0:0.0:0.0:1.0	.	811	Q5T799	.	C	1609	ENSP00000335341:Y1609C	ENSP00000335341:Y1609C	Y	-	2	0	CDC42BPA	225265314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.430000	0.66501	2.198000	0.70561	0.528000	0.53228	TAT	CDC42BPA	-	smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd	ENSG00000143776		0.428	CDC42BPA-201	KNOWN	basic	protein_coding	CDC42BPA	HGNC	protein_coding		79	0.00	0	T	NM_014826		227198691	227198691	-1	no_errors	ENST00000334218	ensembl	human	known	69_37n	missense	50	30.56	22	SNP	1.000	C
CDC42BPA	8476	genome.wustl.edu	37	1	227198691	227198691	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:227198691T>C	ENST00000334218.5	-	34	5768	c.4826A>G	c.(4825-4827)tAt>tGt	p.Y1609C	CDC42BPA_ENST00000366766.2_Intron|CDC42BPA_ENST00000366769.3_Intron|CDC42BPA_ENST00000366767.3_Intron|CDC42BPA_ENST00000535525.1_Intron|CDC42BPA_ENST00000366764.2_Intron|CDC42BPA_ENST00000366765.3_Intron					CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				AGTCATGTGATAGATGTGTTC	0.428																																						dbGAP											0													34.0	31.0	32.0					1																	227198691		876	1991	2867	-	-	-	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000334218.5:c.4826A>G	1.37:g.227198691T>C	ENSP00000335341:p.Tyr1609Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.Y1609C	ENST00000334218.5	37	c.4826		1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009791	0.54361	.	.	ENSG00000143776	ENST00000334218	T	0.70749	-0.51	5.46	5.46	0.80206	.	.	.	.	.	D	0.83825	0.5338	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.84749	0.0755	8	0.48119	T	0.1	.	15.825	0.78698	0.0:0.0:0.0:1.0	.	811	Q5T799	.	C	1609	ENSP00000335341:Y1609C	ENSP00000335341:Y1609C	Y	-	2	0	CDC42BPA	225265314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.430000	0.66501	2.198000	0.70561	0.528000	0.53228	TAT	CDC42BPA	-	smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd	ENSG00000143776		0.428	CDC42BPA-201	KNOWN	basic	protein_coding	CDC42BPA	HGNC	protein_coding		60	0.00	0	T	NM_014826		227198691	227198691	-1	no_errors	ENST00000334218	ensembl	human	known	69_37n	missense	50	30.56	22	SNP	1.000	C
CDC5L	988	genome.wustl.edu	37	6	44360503	44360503	+	Silent	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr6:44360503G>A	ENST00000371477.3	+	3	548	c.249G>A	c.(247-249)agG>agA	p.R83R		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	83	HTH myb-type 2. {ECO:0000255|PROSITE- ProRule:PRU00625}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTCAGTGGAGGACCATTGCTC	0.428																																						dbGAP											0													86.0	80.0	82.0					6																	44360503		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.249G>A	6.37:g.44360503G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76N46|Q99974	Silent	SNP	pfam_DUF3351,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R83	ENST00000371477.3	37	c.249	CCDS4912.1	6																																																																																			CDC5L	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000096401		0.428	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC5L	HGNC	protein_coding	OTTHUMT00000040743.1	176	0.00	0	G			44360503	44360503	+1	no_errors	ENST00000371477	ensembl	human	known	69_37n	silent	76	51.90	82	SNP	1.000	A
CDC5L	988	genome.wustl.edu	37	6	44360503	44360503	+	Silent	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr6:44360503G>A	ENST00000371477.3	+	3	548	c.249G>A	c.(247-249)agG>agA	p.R83R		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	83	HTH myb-type 2. {ECO:0000255|PROSITE- ProRule:PRU00625}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTCAGTGGAGGACCATTGCTC	0.428																																						dbGAP											0													86.0	80.0	82.0					6																	44360503		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.249G>A	6.37:g.44360503G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76N46|Q99974	Silent	SNP	pfam_DUF3351,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R83	ENST00000371477.3	37	c.249	CCDS4912.1	6																																																																																			CDC5L	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000096401		0.428	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC5L	HGNC	protein_coding	OTTHUMT00000040743.1	163	0.00	0	G			44360503	44360503	+1	no_errors	ENST00000371477	ensembl	human	known	69_37n	silent	76	51.90	82	SNP	1.000	A
CDC7	8317	genome.wustl.edu	37	1	91989621	91989621	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:91989621G>C	ENST00000428239.1	+	12	1613	c.1354G>C	c.(1354-1356)Gaa>Caa	p.E452Q	CDC7_ENST00000234626.6_Missense_Mutation_p.E452Q|CDC7_ENST00000430031.2_Missense_Mutation_p.E424Q	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	452	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		ATGTAGCAAAGAAGTTCCAGC	0.348																																						dbGAP											0													57.0	57.0	57.0					1																	91989621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.1354G>C	1.37:g.91989621G>C	ENSP00000393139:p.Glu452Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E452Q	ENST00000428239.1	37	c.1354	CCDS734.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037255	0.75617	.	.	ENSG00000097046	ENST00000370415;ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.06449	3.3;3.3;3.3	5.84	5.84	0.93424	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.106561	0.64402	D	0.000006	T	0.10809	0.0264	N	0.25890	0.77	0.51767	D	0.999935	D;P;D	0.89917	1.0;0.629;1.0	D;B;D	0.78314	0.991;0.309;0.984	T	0.23440	-1.0188	10	0.46703	T	0.11	-21.1837	20.1535	0.98095	0.0:0.0:1.0:0.0	.	424;452;452	B7Z5H7;B2R6V2;O00311	.;.;CDC7_HUMAN	Q	65;424;452;452	ENSP00000407477:E424Q;ENSP00000234626:E452Q;ENSP00000393139:E452Q	ENSP00000234626:E452Q	E	+	1	0	CDC7	91762209	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.512000	0.90538	2.764000	0.94973	0.650000	0.86243	GAA	CDC7	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000097046		0.348	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC7	HGNC	protein_coding	OTTHUMT00000027928.1	274	0.00	0	G	NM_003503		91989621	91989621	+1	no_errors	ENST00000234626	ensembl	human	known	69_37n	missense	366	22.95	109	SNP	1.000	C
CDC7	8317	genome.wustl.edu	37	1	91989621	91989621	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:91989621G>C	ENST00000428239.1	+	12	1613	c.1354G>C	c.(1354-1356)Gaa>Caa	p.E452Q	CDC7_ENST00000234626.6_Missense_Mutation_p.E452Q|CDC7_ENST00000430031.2_Missense_Mutation_p.E424Q	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	452	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		ATGTAGCAAAGAAGTTCCAGC	0.348																																						dbGAP											0													57.0	57.0	57.0					1																	91989621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.1354G>C	1.37:g.91989621G>C	ENSP00000393139:p.Glu452Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E452Q	ENST00000428239.1	37	c.1354	CCDS734.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037255	0.75617	.	.	ENSG00000097046	ENST00000370415;ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.06449	3.3;3.3;3.3	5.84	5.84	0.93424	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.106561	0.64402	D	0.000006	T	0.10809	0.0264	N	0.25890	0.77	0.51767	D	0.999935	D;P;D	0.89917	1.0;0.629;1.0	D;B;D	0.78314	0.991;0.309;0.984	T	0.23440	-1.0188	10	0.46703	T	0.11	-21.1837	20.1535	0.98095	0.0:0.0:1.0:0.0	.	424;452;452	B7Z5H7;B2R6V2;O00311	.;.;CDC7_HUMAN	Q	65;424;452;452	ENSP00000407477:E424Q;ENSP00000234626:E452Q;ENSP00000393139:E452Q	ENSP00000234626:E452Q	E	+	1	0	CDC7	91762209	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.512000	0.90538	2.764000	0.94973	0.650000	0.86243	GAA	CDC7	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000097046		0.348	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC7	HGNC	protein_coding	OTTHUMT00000027928.1	379	0.00	0	G	NM_003503		91989621	91989621	+1	no_errors	ENST00000234626	ensembl	human	known	69_37n	missense	366	22.95	109	SNP	1.000	C
CDK14	5218	genome.wustl.edu	37	7	90741993	90741993	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:90741993G>A	ENST00000380050.3	+	13	1422	c.1291G>A	c.(1291-1293)Gac>Aac	p.D431N	CDK14_ENST00000436577.2_Missense_Mutation_p.D302N|CDK14_ENST00000265741.3_Missense_Mutation_p.D413N|CDK14_ENST00000406263.1_Missense_Mutation_p.D385N			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	431					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GGAACTCACCGACAGTGAGTA	0.468																																					GBM(83;1228 1256 8311 16577 31299)	dbGAP											0													68.0	59.0	62.0					7																	90741993		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.1291G>A	7.37:g.90741993G>A	ENSP00000369390:p.Asp431Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D431N	ENST00000380050.3	37	c.1291		7	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725973	0.89298	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.71579	-0.49;-0.48;-0.47;-0.58	6.07	5.19	0.71726	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.57359	0.2048	L	0.38175	1.15	0.58432	D	0.999996	B;P;B	0.47604	0.027;0.898;0.027	B;B;B	0.33690	0.005;0.168;0.005	T	0.65734	-0.6096	10	0.62326	D	0.03	-15.4895	14.8195	0.70062	0.0683:0.0:0.9317:0.0	.	302;413;431	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	N	431;413;385;302	ENSP00000369390:D431N;ENSP00000265741:D413N;ENSP00000385034:D385N;ENSP00000398936:D302N	ENSP00000265741:D413N	D	+	1	0	CDK14	90579929	1.000000	0.71417	0.983000	0.44433	0.656000	0.38851	7.024000	0.76443	2.885000	0.99019	0.655000	0.94253	GAC	CDK14	-	superfamily_Kinase-like_dom	ENSG00000058091		0.468	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	210	0.47	1	G	NM_012395		90741993	90741993	+1	no_errors	ENST00000380050	ensembl	human	known	69_37n	missense	337	13.14	51	SNP	0.998	A
CDK14	5218	genome.wustl.edu	37	7	90741993	90741993	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:90741993G>A	ENST00000380050.3	+	13	1422	c.1291G>A	c.(1291-1293)Gac>Aac	p.D431N	CDK14_ENST00000436577.2_Missense_Mutation_p.D302N|CDK14_ENST00000265741.3_Missense_Mutation_p.D413N|CDK14_ENST00000406263.1_Missense_Mutation_p.D385N			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	431					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GGAACTCACCGACAGTGAGTA	0.468																																					GBM(83;1228 1256 8311 16577 31299)	dbGAP											0													68.0	59.0	62.0					7																	90741993		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.1291G>A	7.37:g.90741993G>A	ENSP00000369390:p.Asp431Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D431N	ENST00000380050.3	37	c.1291		7	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725973	0.89298	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.71579	-0.49;-0.48;-0.47;-0.58	6.07	5.19	0.71726	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.57359	0.2048	L	0.38175	1.15	0.58432	D	0.999996	B;P;B	0.47604	0.027;0.898;0.027	B;B;B	0.33690	0.005;0.168;0.005	T	0.65734	-0.6096	10	0.62326	D	0.03	-15.4895	14.8195	0.70062	0.0683:0.0:0.9317:0.0	.	302;413;431	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	N	431;413;385;302	ENSP00000369390:D431N;ENSP00000265741:D413N;ENSP00000385034:D385N;ENSP00000398936:D302N	ENSP00000265741:D413N	D	+	1	0	CDK14	90579929	1.000000	0.71417	0.983000	0.44433	0.656000	0.38851	7.024000	0.76443	2.885000	0.99019	0.655000	0.94253	GAC	CDK14	-	superfamily_Kinase-like_dom	ENSG00000058091		0.468	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	623	0.16	1	G	NM_012395		90741993	90741993	+1	no_errors	ENST00000380050	ensembl	human	known	69_37n	missense	337	13.14	51	SNP	0.998	A
CEACAM5	1048	genome.wustl.edu	37	19	42213656	42213656	+	Missense_Mutation	SNP	C	C	G	rs111403501	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:42213656C>G	ENST00000221992.6	+	2	236	c.122C>G	c.(121-123)aCg>aGg	p.T41R	CEACAM5_ENST00000398599.4_Missense_Mutation_p.T41R|CEACAM7_ENST00000599715.1_5'Flank|CEA_ENST00000598976.1_Missense_Mutation_p.T41R|CEACAM5_ENST00000405816.1_Missense_Mutation_p.T41R	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	41	Ig-like 1.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		ATTGAATCCACGCCGTTCAAT	0.517																																						dbGAP											0													162.0	148.0	153.0					19																	42213656		2203	4300	6503	-	-	-	SO:0001583	missense	0			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.122C>G	19.37:g.42213656C>G	ENSP00000221992:p.Thr41Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	H9KVA7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T41R	ENST00000221992.6	37	c.122	CCDS12584.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	2.217|2.217	-0.379224|-0.379224	0.05000|0.05000	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816;ENST00000378181	.|T;T	.|0.62941	.|-0.01;-0.01	3.09|3.09	-0.719|-0.719	0.11201|0.11201	.|Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.31327|0.31327	0.0793|0.0793	N|N	0.02539|0.02539	-0.55|-0.55	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.21309	.|0.054;0.0;0.054	.|B;B;B	.|0.32465	.|0.146;0.012;0.146	T|T	0.28138|0.28138	-1.0053|-1.0053	5|9	.|0.23891	.|T	.|0.37	.|.	1.5682|1.5682	0.02609|0.02609	0.1649:0.1144:0.1705:0.5503|0.1649:0.1144:0.1705:0.5503	.|.	.|41;41;41	.|Q8N4D0;P06731;Q53G30	.|.;CEAM5_HUMAN;.	Q|R	37|41	.|ENSP00000221992:T41R;ENSP00000385072:T41R	.|ENSP00000221992:T41R	H|T	+|+	3|2	2|0	CEACAM5|CEACAM5	46905496|46905496	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.249000|-0.249000	0.08842|0.08842	-0.313000|-0.313000	0.08728|0.08728	-3.925000|-3.925000	0.00016|0.00016	CAC|ACG	CEACAM5	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000105388		0.517	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	HGNC	protein_coding	OTTHUMT00000321132.2	472	0.00	0	C	NM_004363		42213656	42213656	+1	no_errors	ENST00000221992	ensembl	human	known	69_37n	missense	356	22.44	103	SNP	0.000	G
CEACAM5	1048	genome.wustl.edu	37	19	42213656	42213656	+	Missense_Mutation	SNP	C	C	G	rs111403501	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:42213656C>G	ENST00000221992.6	+	2	236	c.122C>G	c.(121-123)aCg>aGg	p.T41R	CEACAM5_ENST00000398599.4_Missense_Mutation_p.T41R|CEACAM7_ENST00000599715.1_5'Flank|CEA_ENST00000598976.1_Missense_Mutation_p.T41R|CEACAM5_ENST00000405816.1_Missense_Mutation_p.T41R	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	41	Ig-like 1.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		ATTGAATCCACGCCGTTCAAT	0.517																																						dbGAP											0													162.0	148.0	153.0					19																	42213656		2203	4300	6503	-	-	-	SO:0001583	missense	0			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.122C>G	19.37:g.42213656C>G	ENSP00000221992:p.Thr41Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	H9KVA7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T41R	ENST00000221992.6	37	c.122	CCDS12584.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	2.217|2.217	-0.379224|-0.379224	0.05000|0.05000	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816;ENST00000378181	.|T;T	.|0.62941	.|-0.01;-0.01	3.09|3.09	-0.719|-0.719	0.11201|0.11201	.|Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.31327|0.31327	0.0793|0.0793	N|N	0.02539|0.02539	-0.55|-0.55	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.21309	.|0.054;0.0;0.054	.|B;B;B	.|0.32465	.|0.146;0.012;0.146	T|T	0.28138|0.28138	-1.0053|-1.0053	5|9	.|0.23891	.|T	.|0.37	.|.	1.5682|1.5682	0.02609|0.02609	0.1649:0.1144:0.1705:0.5503|0.1649:0.1144:0.1705:0.5503	.|.	.|41;41;41	.|Q8N4D0;P06731;Q53G30	.|.;CEAM5_HUMAN;.	Q|R	37|41	.|ENSP00000221992:T41R;ENSP00000385072:T41R	.|ENSP00000221992:T41R	H|T	+|+	3|2	2|0	CEACAM5|CEACAM5	46905496|46905496	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.249000|-0.249000	0.08842|0.08842	-0.313000|-0.313000	0.08728|0.08728	-3.925000|-3.925000	0.00016|0.00016	CAC|ACG	CEACAM5	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000105388		0.517	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	HGNC	protein_coding	OTTHUMT00000321132.2	401	0.00	0	C	NM_004363		42213656	42213656	+1	no_errors	ENST00000221992	ensembl	human	known	69_37n	missense	356	22.44	103	SNP	0.000	G
COL28A1	340267	genome.wustl.edu	37	7	7571011	7571011	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:7571011G>A	ENST00000399429.3	-	3	789	c.649C>T	c.(649-651)Cca>Tca	p.P217S		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	217	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ACAAGGGTTGGATCACTCAAC	0.363																																						dbGAP											0													77.0	70.0	72.0					7																	7571011		1841	4086	5927	-	-	-	SO:0001583	missense	0			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.649C>T	7.37:g.7571011G>A	ENSP00000382356:p.Pro217Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.P217S	ENST00000399429.3	37	c.649	CCDS43553.1	7	.	.	.	.	.	.	.	.	.	.	G	0.066	-1.211736	0.01555	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	T	0.54479	0.57	3.88	0.888	0.19206	von Willebrand factor, type A (2);	0.981172	0.08297	N	0.967546	T	0.39682	0.1087	L	0.40543	1.245	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.27434	-1.0074	10	0.25751	T	0.34	0.0118	5.3053	0.15801	0.187:0.0:0.6521:0.1609	.	217	Q2UY09	COSA1_HUMAN	S	217	ENSP00000382356:P217S	ENSP00000382347:P217S	P	-	1	0	COL28A1	7537536	0.880000	0.30214	0.019000	0.16419	0.027000	0.11550	0.355000	0.20163	0.064000	0.16427	-0.140000	0.14226	CCA	COL28A1	-	smart_VWF_A,pfscan_VWF_A	ENSG00000215018		0.363	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	217	0.00	0	G	NM_001037763		7571011	7571011	-1	no_errors	ENST00000399429	ensembl	human	known	69_37n	missense	275	17.42	58	SNP	0.048	A
COL28A1	340267	genome.wustl.edu	37	7	7571011	7571011	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:7571011G>A	ENST00000399429.3	-	3	789	c.649C>T	c.(649-651)Cca>Tca	p.P217S		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	217	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ACAAGGGTTGGATCACTCAAC	0.363																																						dbGAP											0													77.0	70.0	72.0					7																	7571011		1841	4086	5927	-	-	-	SO:0001583	missense	0			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.649C>T	7.37:g.7571011G>A	ENSP00000382356:p.Pro217Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.P217S	ENST00000399429.3	37	c.649	CCDS43553.1	7	.	.	.	.	.	.	.	.	.	.	G	0.066	-1.211736	0.01555	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	T	0.54479	0.57	3.88	0.888	0.19206	von Willebrand factor, type A (2);	0.981172	0.08297	N	0.967546	T	0.39682	0.1087	L	0.40543	1.245	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.27434	-1.0074	10	0.25751	T	0.34	0.0118	5.3053	0.15801	0.187:0.0:0.6521:0.1609	.	217	Q2UY09	COSA1_HUMAN	S	217	ENSP00000382356:P217S	ENSP00000382347:P217S	P	-	1	0	COL28A1	7537536	0.880000	0.30214	0.019000	0.16419	0.027000	0.11550	0.355000	0.20163	0.064000	0.16427	-0.140000	0.14226	CCA	COL28A1	-	smart_VWF_A,pfscan_VWF_A	ENSG00000215018		0.363	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	252	0.00	0	G	NM_001037763		7571011	7571011	-1	no_errors	ENST00000399429	ensembl	human	known	69_37n	missense	275	17.42	58	SNP	0.048	A
CORO1C	23603	genome.wustl.edu	37	12	109051186	109051186	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr12:109051186G>A	ENST00000261401.3	-	6	816	c.644C>T	c.(643-645)gCa>gTa	p.A215V	CORO1C_ENST00000541050.1_Missense_Mutation_p.A215V|CORO1C_ENST00000549384.1_Intron|CORO1C_ENST00000421578.2_Missense_Mutation_p.A110V|CORO1C_ENST00000549772.1_Missense_Mutation_p.A221V|CORO1C_ENST00000420959.2_Missense_Mutation_p.A268V	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	215					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						TCCTTCATGTGCTTTCTCCTT	0.542																																						dbGAP											0													89.0	81.0	84.0					12																	109051186		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.644C>T	12.37:g.109051186G>A	ENSP00000261401:p.Ala215Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MAP0|A7MAP1|B3KU12|Q9NSK5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A268V	ENST00000261401.3	37	c.803	CCDS9120.1	12	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097389	0.56075	.	.	ENSG00000110880	ENST00000261401;ENST00000541050;ENST00000421578;ENST00000549772;ENST00000420959;ENST00000552871	T;T;T;T;T;D	0.81739	4.89;4.89;4.89;4.89;4.89;-1.53	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.050749	0.85682	D	0.000000	D	0.84419	0.5468	M	0.85299	2.745	0.80722	D	1	B;B;B	0.23854	0.003;0.048;0.092	B;B;B	0.27170	0.013;0.052;0.077	T	0.83285	-0.0036	10	0.56958	D	0.05	-10.6702	18.8822	0.92360	0.0:0.0:1.0:0.0	.	178;268;215	B4DMH3;A7MAP1;Q9ULV4	.;.;COR1C_HUMAN	V	215;215;110;221;268;110	ENSP00000261401:A215V;ENSP00000438341:A215V;ENSP00000415554:A110V;ENSP00000447534:A221V;ENSP00000394496:A268V;ENSP00000449658:A110V	ENSP00000261401:A215V	A	-	2	0	CORO1C	107575315	1.000000	0.71417	0.965000	0.40720	0.429000	0.31625	9.866000	0.99616	2.444000	0.82710	0.637000	0.83480	GCA	CORO1C	-	superfamily_WD40_repeat_dom	ENSG00000110880		0.542	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1C	HGNC	protein_coding	OTTHUMT00000403802.1	80	0.00	0	G	NM_014325		109051186	109051186	-1	no_errors	ENST00000420959	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	1.000	A
CORO1C	23603	genome.wustl.edu	37	12	109051186	109051186	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr12:109051186G>A	ENST00000261401.3	-	6	816	c.644C>T	c.(643-645)gCa>gTa	p.A215V	CORO1C_ENST00000541050.1_Missense_Mutation_p.A215V|CORO1C_ENST00000549384.1_Intron|CORO1C_ENST00000421578.2_Missense_Mutation_p.A110V|CORO1C_ENST00000549772.1_Missense_Mutation_p.A221V|CORO1C_ENST00000420959.2_Missense_Mutation_p.A268V	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	215					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						TCCTTCATGTGCTTTCTCCTT	0.542																																						dbGAP											0													89.0	81.0	84.0					12																	109051186		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.644C>T	12.37:g.109051186G>A	ENSP00000261401:p.Ala215Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MAP0|A7MAP1|B3KU12|Q9NSK5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A268V	ENST00000261401.3	37	c.803	CCDS9120.1	12	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097389	0.56075	.	.	ENSG00000110880	ENST00000261401;ENST00000541050;ENST00000421578;ENST00000549772;ENST00000420959;ENST00000552871	T;T;T;T;T;D	0.81739	4.89;4.89;4.89;4.89;4.89;-1.53	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.050749	0.85682	D	0.000000	D	0.84419	0.5468	M	0.85299	2.745	0.80722	D	1	B;B;B	0.23854	0.003;0.048;0.092	B;B;B	0.27170	0.013;0.052;0.077	T	0.83285	-0.0036	10	0.56958	D	0.05	-10.6702	18.8822	0.92360	0.0:0.0:1.0:0.0	.	178;268;215	B4DMH3;A7MAP1;Q9ULV4	.;.;COR1C_HUMAN	V	215;215;110;221;268;110	ENSP00000261401:A215V;ENSP00000438341:A215V;ENSP00000415554:A110V;ENSP00000447534:A221V;ENSP00000394496:A268V;ENSP00000449658:A110V	ENSP00000261401:A215V	A	-	2	0	CORO1C	107575315	1.000000	0.71417	0.965000	0.40720	0.429000	0.31625	9.866000	0.99616	2.444000	0.82710	0.637000	0.83480	GCA	CORO1C	-	superfamily_WD40_repeat_dom	ENSG00000110880		0.542	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1C	HGNC	protein_coding	OTTHUMT00000403802.1	45	0.00	0	G	NM_014325		109051186	109051186	-1	no_errors	ENST00000420959	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	1.000	A
CRB2	286204	genome.wustl.edu	37	9	126132756	126132757	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr9:126132756_126132757insT	ENST00000373631.3	+	7	1425_1426	c.1424_1425insT	c.(1423-1428)gccactfs	p.T476fs	CRB2_ENST00000373629.2_Frame_Shift_Ins_p.T144fs|CRB2_ENST00000359999.3_Frame_Shift_Ins_p.T476fs	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	476	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						GGGACCTTGGCCACTCGCAATG	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	Exception_encountered	9.37:g.126132756_126132757insT	ENSP00000362734:p.Thr476fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Frame_Shift_Ins	INS	pfam_EGF-like_dom,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.T476fs	ENST00000373631.3	37	c.1424_1425	CCDS6852.2	9																																																																																			CRB2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000148204		0.609	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB2	HGNC	protein_coding	OTTHUMT00000053990.3	21	0.00	0	-	NM_173689		126132756	126132757	+1	no_errors	ENST00000373631	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.997:0.945	T
CXorf66	347487	genome.wustl.edu	37	X	139038828	139038828	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chrX:139038828A>T	ENST00000370540.1	-	3	336	c.313T>A	c.(313-315)Tgc>Agc	p.C105S		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	105	Ser-rich.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						TCTGGACTGCATTGAGAGGCT	0.413																																						dbGAP											0													188.0	159.0	169.0					X																	139038828		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.313T>A	X.37:g.139038828A>T	ENSP00000359571:p.Cys105Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C105S	ENST00000370540.1	37	c.313	CCDS35411.1	X	.	.	.	.	.	.	.	.	.	.	A	4.055	0.007963	0.07866	.	.	ENSG00000203933	ENST00000370540	T	0.54071	0.59	4.21	-3.72	0.04411	.	1.089460	0.07188	N	0.855269	T	0.39655	0.1086	L	0.27053	0.805	0.09310	N	1	P	0.50528	0.936	P	0.47645	0.553	T	0.34601	-0.9822	9	.	.	.	3.0983	5.6131	0.17416	0.2449:0.4628:0.0:0.2923	.	105	Q5JRM2	CX066_HUMAN	S	105	ENSP00000359571:C105S	.	C	-	1	0	CXorf66	138866494	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.055000	0.14229	-0.827000	0.04278	0.446000	0.29264	TGC	CXorf66	-	NULL	ENSG00000203933		0.413	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf66	HGNC	protein_coding	OTTHUMT00000058572.1	523	0.00	0	A	NM_001013403		139038828	139038828	-1	no_errors	ENST00000370540	ensembl	human	known	69_37n	missense	349	20.09	88	SNP	0.000	T
CXorf66	347487	genome.wustl.edu	37	X	139038828	139038828	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chrX:139038828A>T	ENST00000370540.1	-	3	336	c.313T>A	c.(313-315)Tgc>Agc	p.C105S		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	105	Ser-rich.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						TCTGGACTGCATTGAGAGGCT	0.413																																						dbGAP											0													188.0	159.0	169.0					X																	139038828		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.313T>A	X.37:g.139038828A>T	ENSP00000359571:p.Cys105Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C105S	ENST00000370540.1	37	c.313	CCDS35411.1	X	.	.	.	.	.	.	.	.	.	.	A	4.055	0.007963	0.07866	.	.	ENSG00000203933	ENST00000370540	T	0.54071	0.59	4.21	-3.72	0.04411	.	1.089460	0.07188	N	0.855269	T	0.39655	0.1086	L	0.27053	0.805	0.09310	N	1	P	0.50528	0.936	P	0.47645	0.553	T	0.34601	-0.9822	9	.	.	.	3.0983	5.6131	0.17416	0.2449:0.4628:0.0:0.2923	.	105	Q5JRM2	CX066_HUMAN	S	105	ENSP00000359571:C105S	.	C	-	1	0	CXorf66	138866494	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.055000	0.14229	-0.827000	0.04278	0.446000	0.29264	TGC	CXorf66	-	NULL	ENSG00000203933		0.413	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf66	HGNC	protein_coding	OTTHUMT00000058572.1	695	0.00	0	A	NM_001013403		139038828	139038828	-1	no_errors	ENST00000370540	ensembl	human	known	69_37n	missense	349	20.09	88	SNP	0.000	T
CYP4F8	11283	genome.wustl.edu	37	19	15730493	15730493	+	RNA	SNP	C	C	T	rs558107890	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:15730493C>T	ENST00000441682.2	+	0	509							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R149C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						ACACCACCGTCGCTTGTGACG	0.512													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		20575	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	large_intestine(1)											71.0	71.0	71.0					19																	15730493		2203	4300	6503	-	-	-			0			AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15730493C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000441682.2	37	NULL		19	.	.	.	.	.	.	.	.	.	.	.	6.599	0.478848	0.12581	.	.	ENSG00000186526	ENST00000441682	.	.	.	2.98	1.91	0.25777	.	0.083137	0.49305	U	0.000160	T	0.54565	0.1866	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65557	-0.6139	5	0.87932	D	0	.	7.723	0.28744	0.0:0.8657:0.0:0.1343	.	.	.	.	C	149	.	ENSP00000409702:R149C	R	+	1	0	CYP4F8	15591493	0.980000	0.34600	0.221000	0.23827	0.033000	0.12548	2.489000	0.45285	0.595000	0.29777	0.313000	0.20887	CGC	CYP4F8	-	-	ENSG00000186526		0.512	CYP4F8-201	KNOWN	basic	processed_transcript	CYP4F8	HGNC	processed_transcript		95	0.00	0	C	NM_007253		15730493	15730493	+1	no_errors	ENST00000441682	ensembl	human	known	69_37n	rna	43	26.67	16	SNP	0.924	T
CYP4F8	11283	genome.wustl.edu	37	19	15730493	15730493	+	RNA	SNP	C	C	T	rs558107890	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:15730493C>T	ENST00000441682.2	+	0	509							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R149C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						ACACCACCGTCGCTTGTGACG	0.512													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		20575	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	large_intestine(1)											71.0	71.0	71.0					19																	15730493		2203	4300	6503	-	-	-			0			AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15730493C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000441682.2	37	NULL		19	.	.	.	.	.	.	.	.	.	.	.	6.599	0.478848	0.12581	.	.	ENSG00000186526	ENST00000441682	.	.	.	2.98	1.91	0.25777	.	0.083137	0.49305	U	0.000160	T	0.54565	0.1866	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65557	-0.6139	5	0.87932	D	0	.	7.723	0.28744	0.0:0.8657:0.0:0.1343	.	.	.	.	C	149	.	ENSP00000409702:R149C	R	+	1	0	CYP4F8	15591493	0.980000	0.34600	0.221000	0.23827	0.033000	0.12548	2.489000	0.45285	0.595000	0.29777	0.313000	0.20887	CGC	CYP4F8	-	-	ENSG00000186526		0.512	CYP4F8-201	KNOWN	basic	processed_transcript	CYP4F8	HGNC	processed_transcript		29	0.00	0	C	NM_007253		15730493	15730493	+1	no_errors	ENST00000441682	ensembl	human	known	69_37n	rna	43	26.67	16	SNP	0.924	T
CYSLTR1	10800	genome.wustl.edu	37	X	77528443	77528443	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chrX:77528443A>C	ENST00000373304.3	-	3	1093	c.801T>G	c.(799-801)tgT>tgG	p.C267W		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	267					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	GGACAGAATCACAGGGTTTAG	0.418																																						dbGAP											0													84.0	78.0	80.0					X																	77528443		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.801T>G	X.37:g.77528443A>C	ENSP00000362401:p.Cys267Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Cyst_leuk_rcpt,prints_CLT1_recept,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.C267W	ENST00000373304.3	37	c.801	CCDS14439.1	X	.	.	.	.	.	.	.	.	.	.	A	13.30	2.195764	0.38806	.	.	ENSG00000173198	ENST00000373304	T	0.38887	1.11	4.04	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	M	0.86573	2.825	0.53688	D	0.999979	D	0.89917	1.0	D	0.79108	0.992	T	0.62849	-0.6767	10	0.87932	D	0	.	6.5362	0.22355	0.8782:0.0:0.1217:0.0	.	267	Q9Y271	CLTR1_HUMAN	W	267	ENSP00000362401:C267W	ENSP00000362401:C267W	C	-	3	2	CYSLTR1	77415099	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	1.165000	0.31822	0.457000	0.26962	0.381000	0.24937	TGT	CYSLTR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,prints_CLT1_recept,pfscan_GPCR_Rhodpsn_supfam	ENSG00000173198		0.418	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	HGNC	protein_coding	OTTHUMT00000057315.1	201	0.49	1	A			77528443	77528443	-1	no_errors	ENST00000373304	ensembl	human	known	69_37n	missense	97	32.41	47	SNP	0.999	C
CYSLTR1	10800	genome.wustl.edu	37	X	77528443	77528443	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chrX:77528443A>C	ENST00000373304.3	-	3	1093	c.801T>G	c.(799-801)tgT>tgG	p.C267W		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	267					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	GGACAGAATCACAGGGTTTAG	0.418																																						dbGAP											0													84.0	78.0	80.0					X																	77528443		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.801T>G	X.37:g.77528443A>C	ENSP00000362401:p.Cys267Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Cyst_leuk_rcpt,prints_CLT1_recept,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.C267W	ENST00000373304.3	37	c.801	CCDS14439.1	X	.	.	.	.	.	.	.	.	.	.	A	13.30	2.195764	0.38806	.	.	ENSG00000173198	ENST00000373304	T	0.38887	1.11	4.04	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	M	0.86573	2.825	0.53688	D	0.999979	D	0.89917	1.0	D	0.79108	0.992	T	0.62849	-0.6767	10	0.87932	D	0	.	6.5362	0.22355	0.8782:0.0:0.1217:0.0	.	267	Q9Y271	CLTR1_HUMAN	W	267	ENSP00000362401:C267W	ENSP00000362401:C267W	C	-	3	2	CYSLTR1	77415099	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	1.165000	0.31822	0.457000	0.26962	0.381000	0.24937	TGT	CYSLTR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,prints_CLT1_recept,pfscan_GPCR_Rhodpsn_supfam	ENSG00000173198		0.418	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	HGNC	protein_coding	OTTHUMT00000057315.1	202	0.00	0	A			77528443	77528443	-1	no_errors	ENST00000373304	ensembl	human	known	69_37n	missense	97	32.41	47	SNP	0.999	C
CYTH4	27128	genome.wustl.edu	37	22	37699430	37699430	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr22:37699430A>G	ENST00000248901.6	+	8	870	c.683A>G	c.(682-684)gAg>gGg	p.E228G		NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	228	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						GACCTGCCCGAGGACCAGCTG	0.647																																						dbGAP											0													44.0	40.0	41.0					22																	37699430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.683A>G	22.37:g.37699430A>G	ENSP00000248901:p.Glu228Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3F9|Q9UGT6	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.E228G	ENST00000248901.6	37	c.683	CCDS13946.1	22	.	.	.	.	.	.	.	.	.	.	A	16.36	3.101179	0.56183	.	.	ENSG00000100055	ENST00000248901;ENST00000422721	T	0.56776	0.44	4.65	4.65	0.58169	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.367729	0.30771	N	0.008906	T	0.64724	0.2624	M	0.88310	2.945	0.80722	D	1	P;P	0.47253	0.777;0.892	B;P	0.47251	0.444;0.542	T	0.72616	-0.4239	10	0.62326	D	0.03	.	11.9317	0.52849	1.0:0.0:0.0:0.0	.	228;241	Q9UIA0;Q9H7Q0	CYH4_HUMAN;.	G	228;241	ENSP00000248901:E228G	ENSP00000248901:E228G	E	+	2	0	CYTH4	36029376	0.998000	0.40836	0.955000	0.39395	0.424000	0.31475	5.657000	0.67996	1.858000	0.53909	0.459000	0.35465	GAG	CYTH4	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000100055		0.647	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH4	HGNC	protein_coding	OTTHUMT00000318917.1	31	0.00	0	A			37699430	37699430	+1	no_errors	ENST00000248901	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.999	G
CYTH4	27128	genome.wustl.edu	37	22	37699430	37699430	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr22:37699430A>G	ENST00000248901.6	+	8	870	c.683A>G	c.(682-684)gAg>gGg	p.E228G		NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	228	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						GACCTGCCCGAGGACCAGCTG	0.647																																						dbGAP											0													44.0	40.0	41.0					22																	37699430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.683A>G	22.37:g.37699430A>G	ENSP00000248901:p.Glu228Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3F9|Q9UGT6	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.E228G	ENST00000248901.6	37	c.683	CCDS13946.1	22	.	.	.	.	.	.	.	.	.	.	A	16.36	3.101179	0.56183	.	.	ENSG00000100055	ENST00000248901;ENST00000422721	T	0.56776	0.44	4.65	4.65	0.58169	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.367729	0.30771	N	0.008906	T	0.64724	0.2624	M	0.88310	2.945	0.80722	D	1	P;P	0.47253	0.777;0.892	B;P	0.47251	0.444;0.542	T	0.72616	-0.4239	10	0.62326	D	0.03	.	11.9317	0.52849	1.0:0.0:0.0:0.0	.	228;241	Q9UIA0;Q9H7Q0	CYH4_HUMAN;.	G	228;241	ENSP00000248901:E228G	ENSP00000248901:E228G	E	+	2	0	CYTH4	36029376	0.998000	0.40836	0.955000	0.39395	0.424000	0.31475	5.657000	0.67996	1.858000	0.53909	0.459000	0.35465	GAG	CYTH4	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000100055		0.647	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH4	HGNC	protein_coding	OTTHUMT00000318917.1	14	0.00	0	A			37699430	37699430	+1	no_errors	ENST00000248901	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.999	G
DCC	1630	genome.wustl.edu	37	18	50976883	50976883	+	Silent	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr18:50976883A>T	ENST00000442544.2	+	23	3859	c.3243A>T	c.(3241-3243)ggA>ggT	p.G1081G	DCC_ENST00000581580.1_Silent_p.G716G	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1081					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CGCCAATTGGACAAATGCACC	0.488																																						dbGAP											0													92.0	81.0	84.0					18																	50976883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3243A>T	18.37:g.50976883A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G1081	ENST00000442544.2	37	c.3243	CCDS11952.1	18																																																																																			DCC	-	pfam_Neogenin_C	ENSG00000187323		0.488	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	169	0.00	0	A	NM_005215		50976883	50976883	+1	no_errors	ENST00000442544	ensembl	human	known	69_37n	silent	124	21.52	34	SNP	0.866	T
DCC	1630	genome.wustl.edu	37	18	50976883	50976883	+	Silent	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr18:50976883A>T	ENST00000442544.2	+	23	3859	c.3243A>T	c.(3241-3243)ggA>ggT	p.G1081G	DCC_ENST00000581580.1_Silent_p.G716G	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1081					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CGCCAATTGGACAAATGCACC	0.488																																						dbGAP											0													92.0	81.0	84.0					18																	50976883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3243A>T	18.37:g.50976883A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G1081	ENST00000442544.2	37	c.3243	CCDS11952.1	18																																																																																			DCC	-	pfam_Neogenin_C	ENSG00000187323		0.488	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	214	0.00	0	A	NM_005215		50976883	50976883	+1	no_errors	ENST00000442544	ensembl	human	known	69_37n	silent	124	21.52	34	SNP	0.866	T
DRAM1	55332	genome.wustl.edu	37	12	102302031	102302031	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr12:102302031C>G	ENST00000258534.8	+	4	849	c.410C>G	c.(409-411)aCg>aGg	p.T137R	DRAM1_ENST00000544152.1_Intron	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	137					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						GTCGTGTACACGCTCCTACAG	0.502																																						dbGAP											0													201.0	203.0	202.0					12																	102302031		2100	4232	6332	-	-	-	SO:0001583	missense	0			BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.410C>G	12.37:g.102302031C>G	ENSP00000258534:p.Thr137Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4T0|Q7L3E3|Q9NUN1	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.T137R	ENST00000258534.8	37	c.410	CCDS41823.1	12	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122393	0.56613	.	.	ENSG00000136048	ENST00000258534	T	0.46063	0.88	5.64	5.64	0.86602	.	0.243845	0.41194	D	0.000936	T	0.46268	0.1384	L	0.55481	1.735	0.80722	D	1	D	0.54397	0.966	P	0.52598	0.703	T	0.40553	-0.9557	10	0.41790	T	0.15	.	7.7632	0.28965	0.0:0.8024:0.0:0.1976	.	137	Q8N682	DRAM1_HUMAN	R	137	ENSP00000258534:T137R	ENSP00000258534:T137R	T	+	2	0	DRAM1	100826162	0.991000	0.36638	0.986000	0.45419	0.214000	0.24535	2.597000	0.46214	2.653000	0.90120	0.643000	0.83706	ACG	DRAM1	-	pfam_Frag1/DRAM/Sfk1	ENSG00000136048		0.502	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM1	HGNC	protein_coding	OTTHUMT00000409195.1	226	0.00	0	C	NM_018370		102302031	102302031	+1	no_errors	ENST00000258534	ensembl	human	known	69_37n	missense	138	27.37	52	SNP	0.972	G
DRAM1	55332	genome.wustl.edu	37	12	102302031	102302031	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr12:102302031C>G	ENST00000258534.8	+	4	849	c.410C>G	c.(409-411)aCg>aGg	p.T137R	DRAM1_ENST00000544152.1_Intron	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	137					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						GTCGTGTACACGCTCCTACAG	0.502																																						dbGAP											0													201.0	203.0	202.0					12																	102302031		2100	4232	6332	-	-	-	SO:0001583	missense	0			BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.410C>G	12.37:g.102302031C>G	ENSP00000258534:p.Thr137Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4T0|Q7L3E3|Q9NUN1	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.T137R	ENST00000258534.8	37	c.410	CCDS41823.1	12	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122393	0.56613	.	.	ENSG00000136048	ENST00000258534	T	0.46063	0.88	5.64	5.64	0.86602	.	0.243845	0.41194	D	0.000936	T	0.46268	0.1384	L	0.55481	1.735	0.80722	D	1	D	0.54397	0.966	P	0.52598	0.703	T	0.40553	-0.9557	10	0.41790	T	0.15	.	7.7632	0.28965	0.0:0.8024:0.0:0.1976	.	137	Q8N682	DRAM1_HUMAN	R	137	ENSP00000258534:T137R	ENSP00000258534:T137R	T	+	2	0	DRAM1	100826162	0.991000	0.36638	0.986000	0.45419	0.214000	0.24535	2.597000	0.46214	2.653000	0.90120	0.643000	0.83706	ACG	DRAM1	-	pfam_Frag1/DRAM/Sfk1	ENSG00000136048		0.502	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM1	HGNC	protein_coding	OTTHUMT00000409195.1	188	0.00	0	C	NM_018370		102302031	102302031	+1	no_errors	ENST00000258534	ensembl	human	known	69_37n	missense	138	27.37	52	SNP	0.972	G
DUSP7	1849	genome.wustl.edu	37	3	52088078	52088078	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:52088078A>C	ENST00000495880.1	-	2	1013	c.830T>G	c.(829-831)gTc>gGc	p.V277G	DUSP7_ENST00000296483.6_Missense_Mutation_p.V226G			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	277					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GTTGGGTGTGACATTGAGGAT	0.572																																						dbGAP											0													343.0	300.0	315.0					3																	52088078		2203	4300	6503	-	-	-	SO:0001583	missense	0			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.830T>G	3.37:g.52088078A>C	ENSP00000417183:p.Val277Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.V226G	ENST00000495880.1	37	c.677	CCDS33766.2	3	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228400	0.79576	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	T;T;T	0.64085	-0.08;-0.08;-0.08	5.42	5.42	0.78866	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.86368	0.5916	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.91234	0.5016	10	0.87932	D	0	.	15.1265	0.72486	1.0:0.0:0.0:0.0	.	226;277	Q16829-2;Q16829	.;DUS7_HUMAN	G	277;226;210	ENSP00000417183:V277G;ENSP00000296483:V226G;ENSP00000418566:V210G	ENSP00000296483:V226G	V	-	2	0	DUSP7	52063118	1.000000	0.71417	0.999000	0.59377	0.532000	0.34746	9.260000	0.95568	2.044000	0.60594	0.448000	0.29417	GTC	DUSP7	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000164086		0.572	DUSP7-001	NOVEL	basic|CCDS	protein_coding	DUSP7	HGNC	protein_coding	OTTHUMT00000349697.1	50	0.00	0	A	NM_001947		52088078	52088078	-1	no_errors	ENST00000296483	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	C
DUSP7	1849	genome.wustl.edu	37	3	52088078	52088078	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:52088078A>C	ENST00000495880.1	-	2	1013	c.830T>G	c.(829-831)gTc>gGc	p.V277G	DUSP7_ENST00000296483.6_Missense_Mutation_p.V226G			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	277					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GTTGGGTGTGACATTGAGGAT	0.572																																						dbGAP											0													343.0	300.0	315.0					3																	52088078		2203	4300	6503	-	-	-	SO:0001583	missense	0			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.830T>G	3.37:g.52088078A>C	ENSP00000417183:p.Val277Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.V226G	ENST00000495880.1	37	c.677	CCDS33766.2	3	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228400	0.79576	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	T;T;T	0.64085	-0.08;-0.08;-0.08	5.42	5.42	0.78866	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.86368	0.5916	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.91234	0.5016	10	0.87932	D	0	.	15.1265	0.72486	1.0:0.0:0.0:0.0	.	226;277	Q16829-2;Q16829	.;DUS7_HUMAN	G	277;226;210	ENSP00000417183:V277G;ENSP00000296483:V226G;ENSP00000418566:V210G	ENSP00000296483:V226G	V	-	2	0	DUSP7	52063118	1.000000	0.71417	0.999000	0.59377	0.532000	0.34746	9.260000	0.95568	2.044000	0.60594	0.448000	0.29417	GTC	DUSP7	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000164086		0.572	DUSP7-001	NOVEL	basic|CCDS	protein_coding	DUSP7	HGNC	protein_coding	OTTHUMT00000349697.1	26	0.00	0	A	NM_001947		52088078	52088078	-1	no_errors	ENST00000296483	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	C
DYSF	8291	genome.wustl.edu	37	2	71743347	71743347	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr2:71743347T>G	ENST00000258104.3	+	8	1107	c.830T>G	c.(829-831)cTg>cGg	p.L277R	DYSF_ENST00000409762.1_Missense_Mutation_p.L308R|DYSF_ENST00000410020.3_Missense_Mutation_p.L309R|DYSF_ENST00000429174.2_Missense_Mutation_p.L277R|DYSF_ENST00000409651.1_Missense_Mutation_p.L309R|DYSF_ENST00000410041.1_Missense_Mutation_p.L309R|DYSF_ENST00000409582.3_Missense_Mutation_p.L308R|DYSF_ENST00000413539.2_Missense_Mutation_p.L308R|DYSF_ENST00000409366.1_Missense_Mutation_p.L278R|DYSF_ENST00000409744.1_Missense_Mutation_p.L278R|DYSF_ENST00000394120.2_Missense_Mutation_p.L278R	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	277	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CCTGGGGAGCTGTTTGATGAG	0.502																																						dbGAP											0													226.0	185.0	199.0					2																	71743347		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.830T>G	2.37:g.71743347T>G	ENSP00000258104:p.Leu277Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_MFS_dom_general_subst_transpt,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.L308R	ENST00000258104.3	37	c.923	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	T	17.42	3.385891	0.61956	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	4.46	4.46	0.54185	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.257041	0.28566	N	0.014897	D	0.83445	0.5256	M	0.90759	3.145	0.50039	D	0.999849	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.998;0.998;0.995;0.995;0.999;0.999;1.0;0.997;0.998;0.998;0.997;0.99;0.995;0.996	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76575	0.962;0.962;0.962;0.962;0.988;0.988;0.988;0.972;0.962;0.984;0.972;0.962;0.962;0.978	D	0.86621	0.1879	10	0.87932	D	0	-14.2549	12.0132	0.53299	0.0:0.0:0.0:1.0	.	309;309;278;278;309;278;308;277;308;308;277;277;278;277	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	R	308;308;308;277;277;309;278;278;278;309;309	ENSP00000407046:L308R;ENSP00000387137:L308R;ENSP00000386547:L308R;ENSP00000398305:L277R;ENSP00000258104:L277R;ENSP00000386683:L309R;ENSP00000377678:L278R;ENSP00000386285:L278R;ENSP00000386512:L278R;ENSP00000386881:L309R;ENSP00000386617:L309R	ENSP00000258104:L277R	L	+	2	0	DYSF	71596855	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	7.440000	0.80464	1.800000	0.52685	0.448000	0.29417	CTG	DYSF	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000135636		0.502	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	52	0.00	0	T	NM_003494		71743347	71743347	+1	no_errors	ENST00000413539	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	1.000	G
DYSF	8291	genome.wustl.edu	37	2	71743347	71743347	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr2:71743347T>G	ENST00000258104.3	+	8	1107	c.830T>G	c.(829-831)cTg>cGg	p.L277R	DYSF_ENST00000409762.1_Missense_Mutation_p.L308R|DYSF_ENST00000410020.3_Missense_Mutation_p.L309R|DYSF_ENST00000429174.2_Missense_Mutation_p.L277R|DYSF_ENST00000409651.1_Missense_Mutation_p.L309R|DYSF_ENST00000410041.1_Missense_Mutation_p.L309R|DYSF_ENST00000409582.3_Missense_Mutation_p.L308R|DYSF_ENST00000413539.2_Missense_Mutation_p.L308R|DYSF_ENST00000409366.1_Missense_Mutation_p.L278R|DYSF_ENST00000409744.1_Missense_Mutation_p.L278R|DYSF_ENST00000394120.2_Missense_Mutation_p.L278R	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	277	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CCTGGGGAGCTGTTTGATGAG	0.502																																						dbGAP											0													226.0	185.0	199.0					2																	71743347		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.830T>G	2.37:g.71743347T>G	ENSP00000258104:p.Leu277Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_MFS_dom_general_subst_transpt,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.L308R	ENST00000258104.3	37	c.923	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	T	17.42	3.385891	0.61956	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	4.46	4.46	0.54185	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.257041	0.28566	N	0.014897	D	0.83445	0.5256	M	0.90759	3.145	0.50039	D	0.999849	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.998;0.998;0.995;0.995;0.999;0.999;1.0;0.997;0.998;0.998;0.997;0.99;0.995;0.996	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76575	0.962;0.962;0.962;0.962;0.988;0.988;0.988;0.972;0.962;0.984;0.972;0.962;0.962;0.978	D	0.86621	0.1879	10	0.87932	D	0	-14.2549	12.0132	0.53299	0.0:0.0:0.0:1.0	.	309;309;278;278;309;278;308;277;308;308;277;277;278;277	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	R	308;308;308;277;277;309;278;278;278;309;309	ENSP00000407046:L308R;ENSP00000387137:L308R;ENSP00000386547:L308R;ENSP00000398305:L277R;ENSP00000258104:L277R;ENSP00000386683:L309R;ENSP00000377678:L278R;ENSP00000386285:L278R;ENSP00000386512:L278R;ENSP00000386881:L309R;ENSP00000386617:L309R	ENSP00000258104:L277R	L	+	2	0	DYSF	71596855	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	7.440000	0.80464	1.800000	0.52685	0.448000	0.29417	CTG	DYSF	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000135636		0.502	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	34	0.00	0	T	NM_003494		71743347	71743347	+1	no_errors	ENST00000413539	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	1.000	G
FAM117B	150864	genome.wustl.edu	37	2	203591010	203591010	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr2:203591010A>G	ENST00000392238.2	+	4	884	c.884A>G	c.(883-885)cAc>cGc	p.H295R	FAM117B_ENST00000303116.6_Missense_Mutation_p.H51R			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	295										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						AGAAGTAAACACAGCAGTCGG	0.398																																						dbGAP											0													151.0	143.0	146.0					2																	203591010		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.884A>G	2.37:g.203591010A>G	ENSP00000376071:p.His295Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Missense_Mutation	SNP	NULL	p.H295R	ENST00000392238.2	37	c.884	CCDS33362.2	2	.	.	.	.	.	.	.	.	.	.	A	12.74	2.028167	0.35797	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.71	5.71	0.89125	.	0.139628	0.64402	D	0.000003	T	0.42426	0.1202	L	0.27053	0.805	0.51012	D	0.999903	B	0.28082	0.2	B	0.26416	0.069	T	0.34700	-0.9818	9	0.07175	T	0.84	-16.9222	15.6579	0.77158	1.0:0.0:0.0:0.0	.	295	Q6P1L5	F117B_HUMAN	R	51;295	.	ENSP00000306299:H51R	H	+	2	0	FAM117B	203299255	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.928000	0.70088	2.174000	0.68829	0.460000	0.39030	CAC	FAM117B	-	NULL	ENSG00000138439		0.398	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM117B	HGNC	protein_coding	OTTHUMT00000335888.3	480	0.00	0	A	NM_173511		203591010	203591010	+1	no_errors	ENST00000392238	ensembl	human	known	69_37n	missense	105	28.08	41	SNP	1.000	G
FAM117B	150864	genome.wustl.edu	37	2	203591010	203591010	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr2:203591010A>G	ENST00000392238.2	+	4	884	c.884A>G	c.(883-885)cAc>cGc	p.H295R	FAM117B_ENST00000303116.6_Missense_Mutation_p.H51R			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	295										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						AGAAGTAAACACAGCAGTCGG	0.398																																						dbGAP											0													151.0	143.0	146.0					2																	203591010		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.884A>G	2.37:g.203591010A>G	ENSP00000376071:p.His295Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Missense_Mutation	SNP	NULL	p.H295R	ENST00000392238.2	37	c.884	CCDS33362.2	2	.	.	.	.	.	.	.	.	.	.	A	12.74	2.028167	0.35797	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.71	5.71	0.89125	.	0.139628	0.64402	D	0.000003	T	0.42426	0.1202	L	0.27053	0.805	0.51012	D	0.999903	B	0.28082	0.2	B	0.26416	0.069	T	0.34700	-0.9818	9	0.07175	T	0.84	-16.9222	15.6579	0.77158	1.0:0.0:0.0:0.0	.	295	Q6P1L5	F117B_HUMAN	R	51;295	.	ENSP00000306299:H51R	H	+	2	0	FAM117B	203299255	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.928000	0.70088	2.174000	0.68829	0.460000	0.39030	CAC	FAM117B	-	NULL	ENSG00000138439		0.398	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM117B	HGNC	protein_coding	OTTHUMT00000335888.3	201	0.00	0	A	NM_173511		203591010	203591010	+1	no_errors	ENST00000392238	ensembl	human	known	69_37n	missense	105	28.08	41	SNP	1.000	G
FAM171A1	221061	genome.wustl.edu	37	10	15255345	15255345	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr10:15255345C>A	ENST00000378116.4	-	8	2248	c.2242G>T	c.(2242-2244)Gaa>Taa	p.E748*	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	748						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GATTTTGGTTCATTCATATCT	0.517																																						dbGAP											0													111.0	84.0	93.0					10																	15255345		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2242G>T	10.37:g.15255345C>A	ENSP00000367356:p.Glu748*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Nonsense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.E748*	ENST00000378116.4	37	c.2242	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933648	0.92458	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-27.0037	19.0487	0.93032	0.0:1.0:0.0:0.0	.	.	.	.	X	748;747	.	ENSP00000367356:E748X	E	-	1	0	FAM171A1	15295351	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	7.590000	0.82653	2.724000	0.93272	0.563000	0.77884	GAA	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.517	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	169	0.00	0	C	XM_167709		15255345	15255345	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	nonsense	59	18.06	13	SNP	1.000	A
FAM171A1	221061	genome.wustl.edu	37	10	15255345	15255345	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr10:15255345C>A	ENST00000378116.4	-	8	2248	c.2242G>T	c.(2242-2244)Gaa>Taa	p.E748*	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	748						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GATTTTGGTTCATTCATATCT	0.517																																						dbGAP											0													111.0	84.0	93.0					10																	15255345		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2242G>T	10.37:g.15255345C>A	ENSP00000367356:p.Glu748*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Nonsense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.E748*	ENST00000378116.4	37	c.2242	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933648	0.92458	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-27.0037	19.0487	0.93032	0.0:1.0:0.0:0.0	.	.	.	.	X	748;747	.	ENSP00000367356:E748X	E	-	1	0	FAM171A1	15295351	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	7.590000	0.82653	2.724000	0.93272	0.563000	0.77884	GAA	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.517	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	48	0.00	0	C	XM_167709		15255345	15255345	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	nonsense	59	18.06	13	SNP	1.000	A
FCGBP	8857	genome.wustl.edu	37	19	40392553	40392553	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:40392553C>T	ENST00000221347.6	-	16	7958	c.7951G>A	c.(7951-7953)Gag>Aag	p.E2651K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2651	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TTCTCCAGCTCGGGAGGACAC	0.667																																						dbGAP											0													69.0	75.0	73.0					19																	40392553		2197	4300	6497	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7951G>A	19.37:g.40392553C>T	ENSP00000221347:p.Glu2651Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.E2651K	ENST00000221347.6	37	c.7951	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	2.606	-0.291958	0.05568	.	.	ENSG00000090920	ENST00000221347	T	0.19250	2.16	2.66	2.66	0.31614	von Willebrand factor, type D domain (1);	0.699209	0.13412	N	0.389784	T	0.31606	0.0802	L	0.47716	1.5	0.09310	N	1	D	0.65815	0.995	P	0.58266	0.836	T	0.11251	-1.0595	10	0.25751	T	0.34	.	12.5273	0.56093	0.0:1.0:0.0:0.0	.	2651	Q9Y6R7	FCGBP_HUMAN	K	2651	ENSP00000221347:E2651K	ENSP00000221347:E2651K	E	-	1	0	FCGBP	45084393	0.001000	0.12720	0.194000	0.23346	0.029000	0.11900	1.319000	0.33655	1.495000	0.48549	0.298000	0.19748	GAG	FCGBP	-	NULL	ENSG00000090920		0.667	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	107	0.00	0	C	NM_003890		40392553	40392553	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	0.100	T
FCGBP	8857	genome.wustl.edu	37	19	40392553	40392553	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:40392553C>T	ENST00000221347.6	-	16	7958	c.7951G>A	c.(7951-7953)Gag>Aag	p.E2651K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2651	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TTCTCCAGCTCGGGAGGACAC	0.667																																						dbGAP											0													69.0	75.0	73.0					19																	40392553		2197	4300	6497	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7951G>A	19.37:g.40392553C>T	ENSP00000221347:p.Glu2651Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.E2651K	ENST00000221347.6	37	c.7951	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	2.606	-0.291958	0.05568	.	.	ENSG00000090920	ENST00000221347	T	0.19250	2.16	2.66	2.66	0.31614	von Willebrand factor, type D domain (1);	0.699209	0.13412	N	0.389784	T	0.31606	0.0802	L	0.47716	1.5	0.09310	N	1	D	0.65815	0.995	P	0.58266	0.836	T	0.11251	-1.0595	10	0.25751	T	0.34	.	12.5273	0.56093	0.0:1.0:0.0:0.0	.	2651	Q9Y6R7	FCGBP_HUMAN	K	2651	ENSP00000221347:E2651K	ENSP00000221347:E2651K	E	-	1	0	FCGBP	45084393	0.001000	0.12720	0.194000	0.23346	0.029000	0.11900	1.319000	0.33655	1.495000	0.48549	0.298000	0.19748	GAG	FCGBP	-	NULL	ENSG00000090920		0.667	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	21	0.00	0	C	NM_003890		40392553	40392553	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	0.100	T
FMO2	2327	genome.wustl.edu	37	1	171174757	171174757	+	Silent	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:171174757G>C	ENST00000209929.7	+	7	1325	c.1167G>C	c.(1165-1167)gtG>gtC	p.V389V	FMO2_ENST00000441535.1_Silent_p.V389V|RP1-127D3.4_ENST00000422841.1_RNA|FMO2_ENST00000529935.1_3'UTR|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	388					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTCGTTGGGTGACAAGAGTTT	0.468																																						dbGAP											0													40.0	39.0	40.0					1																	171174757		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.1167G>C	1.37:g.171174757G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XR0	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_2,prints_Flavin_mOase_1,prints_Flavin_mOase_5	p.V389	ENST00000209929.7	37	c.1167	CCDS1293.1	1																																																																																			FMO2	-	pfam_Flavin_mOase-like,prints_Flavin_mOase	ENSG00000094963		0.468	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO2	HGNC	protein_coding	OTTHUMT00000086216.2	123	0.00	0	G	NM_001460		171174757	171174757	+1	no_errors	ENST00000209929	ensembl	human	known	69_37n	silent	153	17.30	32	SNP	0.065	C
FMO2	2327	genome.wustl.edu	37	1	171174757	171174757	+	Silent	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:171174757G>C	ENST00000209929.7	+	7	1325	c.1167G>C	c.(1165-1167)gtG>gtC	p.V389V	FMO2_ENST00000441535.1_Silent_p.V389V|RP1-127D3.4_ENST00000422841.1_RNA|FMO2_ENST00000529935.1_3'UTR|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	388					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTCGTTGGGTGACAAGAGTTT	0.468																																						dbGAP											0													40.0	39.0	40.0					1																	171174757		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.1167G>C	1.37:g.171174757G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XR0	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_2,prints_Flavin_mOase_1,prints_Flavin_mOase_5	p.V389	ENST00000209929.7	37	c.1167	CCDS1293.1	1																																																																																			FMO2	-	pfam_Flavin_mOase-like,prints_Flavin_mOase	ENSG00000094963		0.468	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO2	HGNC	protein_coding	OTTHUMT00000086216.2	146	0.00	0	G	NM_001460		171174757	171174757	+1	no_errors	ENST00000209929	ensembl	human	known	69_37n	silent	153	17.30	32	SNP	0.065	C
FXR1	8087	genome.wustl.edu	37	3	180685864	180685864	+	Silent	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:180685864C>T	ENST00000357559.4	+	14	1608	c.1224C>T	c.(1222-1224)ccC>ccT	p.P408P	FXR1_ENST00000305586.7_Silent_p.P323P|FXR1_ENST00000445140.2_Silent_p.P408P|FXR1_ENST00000480918.1_Silent_p.P395P|FXR1_ENST00000491062.1_Silent_p.P359P|FXR1_ENST00000468861.1_Silent_p.P323P	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	408					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TGTCTAACCCCTCTGAAACGG	0.423																																						dbGAP											0													93.0	95.0	94.0					3																	180685864		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1224C>T	3.37:g.180685864C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam	p.P9L	ENST00000357559.4	37	c.26	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	C	10.34	1.323114	0.24080	.	.	ENSG00000114416	ENST00000482125	T	0.29397	1.57	5.51	2.71	0.32032	.	0.097992	0.64402	D	0.000001	T	0.34279	0.0892	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.09164	-1.0687	7	0.56958	D	0.05	-28.5484	3.8521	0.08959	0.1432:0.5941:0.124:0.1386	.	.	.	.	L	9	ENSP00000418027:P9L	ENSP00000418027:P9L	P	+	2	0	FXR1	182168558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.103000	0.31062	0.357000	0.24183	0.591000	0.81541	CCT	FXR1	-	pfam_Frag_X_MRP_fam	ENSG00000114416		0.423	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	193	0.00	0	C			180685864	180685864	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000482125	ensembl	human	novel	69_37n	missense	157	24.52	51	SNP	1.000	T
FXR1	8087	genome.wustl.edu	37	3	180685864	180685864	+	Silent	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:180685864C>T	ENST00000357559.4	+	14	1608	c.1224C>T	c.(1222-1224)ccC>ccT	p.P408P	FXR1_ENST00000305586.7_Silent_p.P323P|FXR1_ENST00000445140.2_Silent_p.P408P|FXR1_ENST00000480918.1_Silent_p.P395P|FXR1_ENST00000491062.1_Silent_p.P359P|FXR1_ENST00000468861.1_Silent_p.P323P	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	408					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TGTCTAACCCCTCTGAAACGG	0.423																																						dbGAP											0													93.0	95.0	94.0					3																	180685864		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1224C>T	3.37:g.180685864C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam	p.P9L	ENST00000357559.4	37	c.26	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	C	10.34	1.323114	0.24080	.	.	ENSG00000114416	ENST00000482125	T	0.29397	1.57	5.51	2.71	0.32032	.	0.097992	0.64402	D	0.000001	T	0.34279	0.0892	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.09164	-1.0687	7	0.56958	D	0.05	-28.5484	3.8521	0.08959	0.1432:0.5941:0.124:0.1386	.	.	.	.	L	9	ENSP00000418027:P9L	ENSP00000418027:P9L	P	+	2	0	FXR1	182168558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.103000	0.31062	0.357000	0.24183	0.591000	0.81541	CCT	FXR1	-	pfam_Frag_X_MRP_fam	ENSG00000114416		0.423	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	239	0.00	0	C			180685864	180685864	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000482125	ensembl	human	novel	69_37n	missense	157	24.52	51	SNP	1.000	T
FYB	2533	genome.wustl.edu	37	5	39135064	39135064	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr5:39135064T>A	ENST00000351578.6	-	8	1758	c.1568A>T	c.(1567-1569)aAa>aTa	p.K523I	FYB_ENST00000512982.1_Missense_Mutation_p.K523I|FYB_ENST00000505428.1_Missense_Mutation_p.K523I|FYB_ENST00000515010.1_Missense_Mutation_p.K523I|FYB_ENST00000540520.1_Missense_Mutation_p.K533I	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	523	SH3.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTTTCCTCCTTTGACATCACA	0.398																																						dbGAP											0													182.0	164.0	170.0					5																	39135064		1860	4116	5976	-	-	-	SO:0001583	missense	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1568A>T	5.37:g.39135064T>A	ENSP00000316460:p.Lys523Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.K533I	ENST00000351578.6	37	c.1598	CCDS47200.1	5	.	.	.	.	.	.	.	.	.	.	T	25.6	4.651029	0.88056	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.08458	3.09;3.09;3.09;3.09;3.09	5.67	5.67	0.87782	Src homology-3 domain (2);Variant SH3 (1);	0.064020	0.64402	D	0.000010	T	0.27629	0.0679	L	0.61218	1.895	0.51767	D	0.999932	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.00677	-1.1614	10	0.87932	D	0	-25.7732	15.91	0.79467	0.0:0.0:0.0:1.0	.	533;523	B4DLN2;O15117	.;FYB_HUMAN	I	523;523;523;523;533;523	ENSP00000316460:K523I;ENSP00000426346:K523I;ENSP00000425845:K523I;ENSP00000427114:K523I;ENSP00000442840:K533I	ENSP00000316460:K523I	K	-	2	0	FYB	39170821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.446000	0.73460	2.141000	0.66446	0.533000	0.62120	AAA	FYB	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	ENSG00000082074		0.398	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	301	0.00	0	T	NM_001465		39135064	39135064	-1	no_errors	ENST00000540520	ensembl	human	known	69_37n	missense	385	25.24	130	SNP	1.000	A
FYB	2533	genome.wustl.edu	37	5	39135064	39135064	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr5:39135064T>A	ENST00000351578.6	-	8	1758	c.1568A>T	c.(1567-1569)aAa>aTa	p.K523I	FYB_ENST00000512982.1_Missense_Mutation_p.K523I|FYB_ENST00000505428.1_Missense_Mutation_p.K523I|FYB_ENST00000515010.1_Missense_Mutation_p.K523I|FYB_ENST00000540520.1_Missense_Mutation_p.K533I	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	523	SH3.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTTTCCTCCTTTGACATCACA	0.398																																						dbGAP											0													182.0	164.0	170.0					5																	39135064		1860	4116	5976	-	-	-	SO:0001583	missense	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1568A>T	5.37:g.39135064T>A	ENSP00000316460:p.Lys523Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.K533I	ENST00000351578.6	37	c.1598	CCDS47200.1	5	.	.	.	.	.	.	.	.	.	.	T	25.6	4.651029	0.88056	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.08458	3.09;3.09;3.09;3.09;3.09	5.67	5.67	0.87782	Src homology-3 domain (2);Variant SH3 (1);	0.064020	0.64402	D	0.000010	T	0.27629	0.0679	L	0.61218	1.895	0.51767	D	0.999932	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.00677	-1.1614	10	0.87932	D	0	-25.7732	15.91	0.79467	0.0:0.0:0.0:1.0	.	533;523	B4DLN2;O15117	.;FYB_HUMAN	I	523;523;523;523;533;523	ENSP00000316460:K523I;ENSP00000426346:K523I;ENSP00000425845:K523I;ENSP00000427114:K523I;ENSP00000442840:K533I	ENSP00000316460:K523I	K	-	2	0	FYB	39170821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.446000	0.73460	2.141000	0.66446	0.533000	0.62120	AAA	FYB	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	ENSG00000082074		0.398	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	847	0.00	0	T	NM_001465		39135064	39135064	-1	no_errors	ENST00000540520	ensembl	human	known	69_37n	missense	385	25.24	130	SNP	1.000	A
GLG1	2734	genome.wustl.edu	37	16	74514249	74514249	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:74514249G>C	ENST00000422840.2	-	11	1716	c.1717C>G	c.(1717-1719)Cgt>Ggt	p.R573G	GLG1_ENST00000205061.5_Missense_Mutation_p.R573G|GLG1_ENST00000447066.2_Missense_Mutation_p.R562G	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	573					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TGGCAAAGACGAGAAGCGTCT	0.468																																						dbGAP											0													90.0	79.0	83.0					16																	74514249		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1717C>G	16.37:g.74514249G>C	ENSP00000405984:p.Arg573Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	pfam_Cys-rich_GLG1_repeat	p.R573G	ENST00000422840.2	37	c.1717	CCDS45527.1	16	.	.	.	.	.	.	.	.	.	.	G	35	5.479516	0.96307	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	6.02	6.02	0.97574	.	0.062056	0.64402	D	0.000003	T	0.72510	0.3469	M	0.64997	1.995	0.80722	D	1	B;P;P	0.47484	0.327;0.873;0.896	P;P;P	0.50970	0.452;0.524;0.655	T	0.72690	-0.4217	9	0.62326	D	0.03	-4.5089	20.6011	0.99457	0.0:0.0:1.0:0.0	.	573;573;562	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	G	573;562;573	.	ENSP00000205061:R573G	R	-	1	0	GLG1	73071750	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.572000	0.82409	2.878000	0.98634	0.650000	0.86243	CGT	GLG1	-	pfam_Cys-rich_GLG1_repeat	ENSG00000090863		0.468	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	HGNC	protein_coding	OTTHUMT00000435750.1	123	0.00	0	G	NM_012201		74514249	74514249	-1	no_errors	ENST00000205061	ensembl	human	known	69_37n	missense	86	46.58	75	SNP	1.000	C
GLG1	2734	genome.wustl.edu	37	16	74514249	74514249	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr16:74514249G>C	ENST00000422840.2	-	11	1716	c.1717C>G	c.(1717-1719)Cgt>Ggt	p.R573G	GLG1_ENST00000205061.5_Missense_Mutation_p.R573G|GLG1_ENST00000447066.2_Missense_Mutation_p.R562G	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	573					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TGGCAAAGACGAGAAGCGTCT	0.468																																						dbGAP											0													90.0	79.0	83.0					16																	74514249		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1717C>G	16.37:g.74514249G>C	ENSP00000405984:p.Arg573Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	pfam_Cys-rich_GLG1_repeat	p.R573G	ENST00000422840.2	37	c.1717	CCDS45527.1	16	.	.	.	.	.	.	.	.	.	.	G	35	5.479516	0.96307	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	6.02	6.02	0.97574	.	0.062056	0.64402	D	0.000003	T	0.72510	0.3469	M	0.64997	1.995	0.80722	D	1	B;P;P	0.47484	0.327;0.873;0.896	P;P;P	0.50970	0.452;0.524;0.655	T	0.72690	-0.4217	9	0.62326	D	0.03	-4.5089	20.6011	0.99457	0.0:0.0:1.0:0.0	.	573;573;562	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	G	573;562;573	.	ENSP00000205061:R573G	R	-	1	0	GLG1	73071750	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.572000	0.82409	2.878000	0.98634	0.650000	0.86243	CGT	GLG1	-	pfam_Cys-rich_GLG1_repeat	ENSG00000090863		0.468	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	HGNC	protein_coding	OTTHUMT00000435750.1	188	0.00	0	G	NM_012201		74514249	74514249	-1	no_errors	ENST00000205061	ensembl	human	known	69_37n	missense	86	46.58	75	SNP	1.000	C
GRK1	6011	genome.wustl.edu	37	13	114325966	114325966	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr13:114325966A>C	ENST00000335678.6	+	3	1212	c.980A>C	c.(979-981)aAt>aCt	p.N327T		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	327	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			CTGCTGGACAATGACGGTAGG	0.413																																						dbGAP											0													14.0	15.0	15.0					13																	114325966		2025	4166	6191	-	-	-	SO:0001583	missense	0					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.980A>C	13.37:g.114325966A>C	ENSP00000334876:p.Asn327Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X14	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_GPCR_kinase,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom	p.N327T	ENST00000335678.6	37	c.980		13	.	.	.	.	.	.	.	.	.	.	a	15.43	2.830050	0.50845	.	.	ENSG00000185974	ENST00000335678	T	0.66280	-0.2	4.43	3.22	0.36961	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.096864	0.64402	D	0.000002	T	0.53867	0.1823	.	.	.	0.43662	D	0.996083	B	0.27882	0.192	B	0.31614	0.133	T	0.53556	-0.8422	9	0.87932	D	0	-26.3378	8.4069	0.32621	0.9028:0.0:0.0972:0.0	.	327	Q15835	RK_HUMAN	T	327	ENSP00000334876:N327T	ENSP00000334876:N327T	N	+	2	0	GRK1	113373967	0.988000	0.35896	0.282000	0.24776	0.716000	0.41182	8.279000	0.89901	0.639000	0.30564	0.414000	0.27820	AAT	GRK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000185974		0.413	GRK1-001	KNOWN	basic|appris_principal	protein_coding	GRK1	HGNC	protein_coding	OTTHUMT00000470655.1	50	0.00	0	A	NM_002929		114325966	114325966	+1	no_errors	ENST00000335678	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.989	C
HCLS1	3059	genome.wustl.edu	37	3	121361820	121361820	+	Silent	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:121361820G>A	ENST00000314583.3	-	6	499	c.408C>T	c.(406-408)gtC>gtT	p.V136V	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Silent_p.V136V	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	136					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		AATCAAAGCCGACTGCTGACT	0.507																																						dbGAP											0													148.0	150.0	150.0					3																	121361820		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.408C>T	3.37:g.121361820G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Silent	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.V136	ENST00000314583.3	37	c.408	CCDS3003.1	3																																																																																			HCLS1	-	pfam_Hs1_Cortactin,pfscan_Hs1_Cortactin	ENSG00000180353		0.507	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	HGNC	protein_coding	OTTHUMT00000355144.1	168	0.00	0	G	NM_005335		121361820	121361820	-1	no_errors	ENST00000314583	ensembl	human	known	69_37n	silent	180	23.73	56	SNP	0.999	A
HCLS1	3059	genome.wustl.edu	37	3	121361820	121361820	+	Silent	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:121361820G>A	ENST00000314583.3	-	6	499	c.408C>T	c.(406-408)gtC>gtT	p.V136V	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Silent_p.V136V	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	136					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		AATCAAAGCCGACTGCTGACT	0.507																																						dbGAP											0													148.0	150.0	150.0					3																	121361820		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.408C>T	3.37:g.121361820G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Silent	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.V136	ENST00000314583.3	37	c.408	CCDS3003.1	3																																																																																			HCLS1	-	pfam_Hs1_Cortactin,pfscan_Hs1_Cortactin	ENSG00000180353		0.507	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	HGNC	protein_coding	OTTHUMT00000355144.1	312	0.00	0	G	NM_005335		121361820	121361820	-1	no_errors	ENST00000314583	ensembl	human	known	69_37n	silent	180	23.73	56	SNP	0.999	A
HECW1	23072	genome.wustl.edu	37	7	43546850	43546850	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:43546850A>T	ENST00000395891.2	+	22	4351	c.3746A>T	c.(3745-3747)aAa>aTa	p.K1249I	HECW1_ENST00000453890.1_Missense_Mutation_p.K1215I|AC011738.4_ENST00000436105.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1249					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GGTCCGGGGAAAATTAAGTGA	0.473																																						dbGAP											0													100.0	106.0	104.0					7																	43546850		1846	4081	5927	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3746A>T	7.37:g.43546850A>T	ENSP00000379228:p.Lys1249Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.K1249I	ENST00000395891.2	37	c.3746	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	A	28.5	4.929021	0.92389	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.42131	0.98;0.98	5.71	5.71	0.89125	HECT (1);	0.043362	0.85682	D	0.000000	T	0.60625	0.2283	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.982;0.993	T	0.63386	-0.6649	10	0.87932	D	0	.	15.6331	0.76926	1.0:0.0:0.0:0.0	.	1215;1249	B4DH42;Q76N89	.;HECW1_HUMAN	I	1249;1215;1249	ENSP00000379228:K1249I;ENSP00000407774:K1215I	ENSP00000265522:K1249I	K	+	2	0	HECW1	43513375	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.298000	0.96132	2.177000	0.69029	0.443000	0.29094	AAA	HECW1	-	superfamily_HECT	ENSG00000002746		0.473	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	198	0.00	0	A	NM_015052		43546850	43546850	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	146	25.89	51	SNP	1.000	T
HECW1	23072	genome.wustl.edu	37	7	43546850	43546850	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:43546850A>T	ENST00000395891.2	+	22	4351	c.3746A>T	c.(3745-3747)aAa>aTa	p.K1249I	HECW1_ENST00000453890.1_Missense_Mutation_p.K1215I|AC011738.4_ENST00000436105.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1249					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GGTCCGGGGAAAATTAAGTGA	0.473																																						dbGAP											0													100.0	106.0	104.0					7																	43546850		1846	4081	5927	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3746A>T	7.37:g.43546850A>T	ENSP00000379228:p.Lys1249Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.K1249I	ENST00000395891.2	37	c.3746	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	A	28.5	4.929021	0.92389	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.42131	0.98;0.98	5.71	5.71	0.89125	HECT (1);	0.043362	0.85682	D	0.000000	T	0.60625	0.2283	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.982;0.993	T	0.63386	-0.6649	10	0.87932	D	0	.	15.6331	0.76926	1.0:0.0:0.0:0.0	.	1215;1249	B4DH42;Q76N89	.;HECW1_HUMAN	I	1249;1215;1249	ENSP00000379228:K1249I;ENSP00000407774:K1215I	ENSP00000265522:K1249I	K	+	2	0	HECW1	43513375	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.298000	0.96132	2.177000	0.69029	0.443000	0.29094	AAA	HECW1	-	superfamily_HECT	ENSG00000002746		0.473	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	302	0.00	0	A	NM_015052		43546850	43546850	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	146	25.89	51	SNP	1.000	T
HERC1	8925	genome.wustl.edu	37	15	63901449	63901449	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr15:63901449delG	ENST00000443617.2	-	78	14504	c.14417delC	c.(14416-14418)cctfs	p.P4806fs		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4806	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CTGTGAGGTAGGCAGACTGTC	0.622																																						dbGAP											0													40.0	44.0	43.0					15																	63901449		2091	4217	6308	-	-	-	SO:0001589	frameshift_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.14417delC	15.37:g.63901449delG	ENSP00000390158:p.Pro4806fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW65	Frame_Shift_Del	DEL	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.P4806fs	ENST00000443617.2	37	c.14417	CCDS45277.1	15																																																																																			HERC1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000103657		0.622	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	26	0.00	0	G	NM_003922		63901449	63901449	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	frame_shift_del	13	18.75	3	DEL	1.000	-
HERC1	8925	genome.wustl.edu	37	15	63901449	63901449	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr15:63901449delG	ENST00000443617.2	-	78	14504	c.14417delC	c.(14416-14418)cctfs	p.P4806fs		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4806	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CTGTGAGGTAGGCAGACTGTC	0.622																																						dbGAP											0													40.0	44.0	43.0					15																	63901449		2091	4217	6308	-	-	-	SO:0001589	frameshift_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.14417delC	15.37:g.63901449delG	ENSP00000390158:p.Pro4806fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW65	Frame_Shift_Del	DEL	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.P4806fs	ENST00000443617.2	37	c.14417	CCDS45277.1	15																																																																																			HERC1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000103657		0.622	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	17	0.00	0	G	NM_003922		63901449	63901449	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	frame_shift_del	13	18.75	3	DEL	1.000	-
HERC2P4	100289574	genome.wustl.edu	37	16	32163507	32163507	+	IGR	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:32163507C>T								RP11-1166P10.6 (67401 upstream) : HERC2P4 (17797 downstream)																							TTTTGCCCTTCGGGGTGATGC	0.542																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.32163507C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		16																																																																																			HERC2P4	-	-	ENSG00000230267	0	0.542					HERC2P4	HGNC			131	0.00	0	C			32163507	32163507	-1	no_errors	ENST00000563904	ensembl	human	known	69_37n	rna	55	40.86	38	SNP	0.979	T
HERC2P4	100289574	genome.wustl.edu	37	16	32163507	32163507	+	IGR	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr16:32163507C>T								RP11-1166P10.6 (67401 upstream) : HERC2P4 (17797 downstream)																							TTTTGCCCTTCGGGGTGATGC	0.542																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.32163507C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		16																																																																																			HERC2P4	-	-	ENSG00000230267	0	0.542					HERC2P4	HGNC			85	0.00	0	C			32163507	32163507	-1	no_errors	ENST00000563904	ensembl	human	known	69_37n	rna	55	40.86	38	SNP	0.979	T
HLF	3131	genome.wustl.edu	37	17	53398079	53398079	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:53398079C>G	ENST00000226067.5	+	4	1200	c.727C>G	c.(727-729)Cgc>Ggc	p.R243G	HLF_ENST00000430986.2_Missense_Mutation_p.R158G|HLF_ENST00000573945.1_Missense_Mutation_p.R158G|HLF_ENST00000575307.1_3'UTR|HLF_ENST00000575345.1_Missense_Mutation_p.R158G	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	243	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(2)	3						CAAGCGCTCCCGCGACGCCCG	0.542			T	TCF3	ALL																																	dbGAP		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	0													36.0	40.0	39.0					17																	53398079		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.727C>G	17.37:g.53398079C>G	ENSP00000226067:p.Arg243Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X8|Q6FHS9	Missense_Mutation	SNP	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.R243G	ENST00000226067.5	37	c.727	CCDS11585.1	17	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253359	0.80135	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	T;T	0.72051	-0.62;-0.62	5.64	5.64	0.86602	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.000000	0.85682	D	0.000000	D	0.90648	0.7067	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93764	0.7069	10	0.87932	D	0	.	18.6863	0.91565	0.0:1.0:0.0:0.0	.	191;243	B4DIQ5;Q16534	.;HLF_HUMAN	G	243;158	ENSP00000226067:R243G;ENSP00000402496:R158G	ENSP00000226067:R243G	R	+	1	0	HLF	50753078	0.876000	0.30132	0.998000	0.56505	0.318000	0.28184	1.425000	0.34859	2.659000	0.90383	0.563000	0.77884	CGC	HLF	-	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	ENSG00000108924		0.542	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLF	HGNC	protein_coding	OTTHUMT00000439185.1	66	0.00	0	C	NM_002126		53398079	53398079	+1	no_errors	ENST00000226067	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	1.000	G
HLF	3131	genome.wustl.edu	37	17	53398079	53398079	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr17:53398079C>G	ENST00000226067.5	+	4	1200	c.727C>G	c.(727-729)Cgc>Ggc	p.R243G	HLF_ENST00000430986.2_Missense_Mutation_p.R158G|HLF_ENST00000573945.1_Missense_Mutation_p.R158G|HLF_ENST00000575307.1_3'UTR|HLF_ENST00000575345.1_Missense_Mutation_p.R158G	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	243	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(2)	3						CAAGCGCTCCCGCGACGCCCG	0.542			T	TCF3	ALL																																	dbGAP		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	0													36.0	40.0	39.0					17																	53398079		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.727C>G	17.37:g.53398079C>G	ENSP00000226067:p.Arg243Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X8|Q6FHS9	Missense_Mutation	SNP	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.R243G	ENST00000226067.5	37	c.727	CCDS11585.1	17	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253359	0.80135	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	T;T	0.72051	-0.62;-0.62	5.64	5.64	0.86602	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.000000	0.85682	D	0.000000	D	0.90648	0.7067	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93764	0.7069	10	0.87932	D	0	.	18.6863	0.91565	0.0:1.0:0.0:0.0	.	191;243	B4DIQ5;Q16534	.;HLF_HUMAN	G	243;158	ENSP00000226067:R243G;ENSP00000402496:R158G	ENSP00000226067:R243G	R	+	1	0	HLF	50753078	0.876000	0.30132	0.998000	0.56505	0.318000	0.28184	1.425000	0.34859	2.659000	0.90383	0.563000	0.77884	CGC	HLF	-	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	ENSG00000108924		0.542	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLF	HGNC	protein_coding	OTTHUMT00000439185.1	95	0.00	0	C	NM_002126		53398079	53398079	+1	no_errors	ENST00000226067	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	1.000	G
HNF1A	6927	genome.wustl.edu	37	12	121432116	121432117	+	Frame_Shift_Ins	INS	-	-	C	rs56348580	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr12:121432116_121432117insC	ENST00000257555.6	+	4	1089_1090	c.863_864insC	c.(862-867)gggcccfs	p.P289fs	HNF1A_ENST00000543427.1_Frame_Shift_Ins_p.P172fs|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000400024.2_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000541395.1_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000402929.1_Frame_Shift_Ins_p.P289fs			P20823	HNF1A_HUMAN	HNF1 homeobox A	289					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACGTACAGCGGGCCCCCCCCAG	0.668									Hepatic Adenoma, Familial Clustering of																													dbGAP											0			GRCh37	CI064741|CM067044	HNF1A	I|M	rs56348580																																			-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	Exception_encountered	12.37:g.121432116_121432117insC	ENSP00000257555:p.Pro289fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Ins	INS	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.P289fs	ENST00000257555.6	37	c.863_864	CCDS9209.1	12																																																																																			HNF1A	-	pfam_HNF1b_C,superfamily_Homeodomain-like	ENSG00000135100		0.668	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	18	0.00	0	-	NM_000545		121432116	121432117	+1	no_errors	ENST00000257555	ensembl	human	known	69_37n	frame_shift_ins	9	30.77	4	INS	0.997:0.998	C
HTR3E	285242	genome.wustl.edu	37	3	183823579	183823579	+	Silent	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:183823579C>A	ENST00000415389.2	+	7	1213	c.747C>A	c.(745-747)ctC>ctA	p.L249L	HTR3E_ENST00000425359.2_Silent_p.L234L|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000440596.2_Silent_p.L275L|HTR3E_ENST00000335304.2_Silent_p.L264L|HTR3E_ENST00000436361.2_Silent_p.L249L	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	249					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	GGCCCAGTCTCTATGTCATAA	0.532																																					Melanoma(7;227 727 6634 44770)	dbGAP											0													109.0	98.0	102.0					3																	183823579		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.747C>A	3.37:g.183823579C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	p.L264	ENST00000415389.2	37	c.792	CCDS58868.1	3																																																																																			HTR3E	-	superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	ENSG00000186038		0.532	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HTR3E	HGNC	protein_coding	OTTHUMT00000346284.1	246	0.00	0	C	NM_182589		183823579	183823579	+1	no_errors	ENST00000335304	ensembl	human	known	69_37n	silent	213	24.20	68	SNP	0.903	A
HTR3E	285242	genome.wustl.edu	37	3	183823579	183823579	+	Silent	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:183823579C>A	ENST00000415389.2	+	7	1213	c.747C>A	c.(745-747)ctC>ctA	p.L249L	HTR3E_ENST00000425359.2_Silent_p.L234L|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000440596.2_Silent_p.L275L|HTR3E_ENST00000335304.2_Silent_p.L264L|HTR3E_ENST00000436361.2_Silent_p.L249L	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	249					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	GGCCCAGTCTCTATGTCATAA	0.532																																					Melanoma(7;227 727 6634 44770)	dbGAP											0													109.0	98.0	102.0					3																	183823579		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.747C>A	3.37:g.183823579C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	p.L264	ENST00000415389.2	37	c.792	CCDS58868.1	3																																																																																			HTR3E	-	superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	ENSG00000186038		0.532	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HTR3E	HGNC	protein_coding	OTTHUMT00000346284.1	111	0.00	0	C	NM_182589		183823579	183823579	+1	no_errors	ENST00000335304	ensembl	human	known	69_37n	silent	213	24.20	68	SNP	0.903	A
HYDIN	54768	genome.wustl.edu	37	16	71052178	71052178	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:71052178G>T	ENST00000393567.2	-	23	3648	c.3498C>A	c.(3496-3498)aaC>aaA	p.N1166K	HYDIN_ENST00000448089.2_Missense_Mutation_p.N1118K	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1166					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CAAAGCTGAGGTTGGGGTAAT	0.488																																						dbGAP											0													1.0	1.0	1.0					16																	71052178		530	1148	1678	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.3498C>A	16.37:g.71052178G>T	ENSP00000377197:p.Asn1166Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.N1166K	ENST00000393567.2	37	c.3498	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807308	0.50421	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089	T;T	0.44482	0.92;0.92	5.37	2.3	0.28687	.	0.000000	0.35096	U	0.003442	T	0.62036	0.2395	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59558	-0.7432	10	0.23302	T	0.38	.	9.7746	0.40612	0.2935:0.0:0.7065:0.0	.	1166	F8WD23	.	K	1166;1166;1118	ENSP00000377197:N1166K;ENSP00000398544:N1118K	ENSP00000313052:N1166K	N	-	3	2	HYDIN	69609679	1.000000	0.71417	0.998000	0.56505	0.163000	0.22366	1.880000	0.39628	0.251000	0.21505	0.505000	0.49811	AAC	HYDIN	-	NULL	ENSG00000157423		0.488	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	25	0.00	0	G			71052178	71052178	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	71052178	71052178	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr16:71052178G>T	ENST00000393567.2	-	23	3648	c.3498C>A	c.(3496-3498)aaC>aaA	p.N1166K	HYDIN_ENST00000448089.2_Missense_Mutation_p.N1118K	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1166					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CAAAGCTGAGGTTGGGGTAAT	0.488																																						dbGAP											0													1.0	1.0	1.0					16																	71052178		530	1148	1678	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.3498C>A	16.37:g.71052178G>T	ENSP00000377197:p.Asn1166Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.N1166K	ENST00000393567.2	37	c.3498	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807308	0.50421	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089	T;T	0.44482	0.92;0.92	5.37	2.3	0.28687	.	0.000000	0.35096	U	0.003442	T	0.62036	0.2395	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59558	-0.7432	10	0.23302	T	0.38	.	9.7746	0.40612	0.2935:0.0:0.7065:0.0	.	1166	F8WD23	.	K	1166;1166;1118	ENSP00000377197:N1166K;ENSP00000398544:N1118K	ENSP00000313052:N1166K	N	-	3	2	HYDIN	69609679	1.000000	0.71417	0.998000	0.56505	0.163000	0.22366	1.880000	0.39628	0.251000	0.21505	0.505000	0.49811	AAC	HYDIN	-	NULL	ENSG00000157423		0.488	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	49	0.00	0	G			71052178	71052178	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	T
IGHMBP2	3508	genome.wustl.edu	37	11	68678969	68678969	+	Silent	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:68678969G>A	ENST00000255078.3	+	5	720	c.609G>A	c.(607-609)gcG>gcA	p.A203A	IGHMBP2_ENST00000539224.1_Missense_Mutation_p.A171T	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	203					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TTTTATTTGCGCTGTCTCAGA	0.512																																						dbGAP											0													102.0	89.0	93.0					11																	68678969		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.609G>A	11.37:g.68678969G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	NULL	p.A171T	ENST00000255078.3	37	c.511	CCDS8187.1	11	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.468743	0.01053	.	.	ENSG00000132740	ENST00000539224	T	0.67698	-0.28	4.93	-9.87	0.00470	.	0.140177	0.46145	D	0.000306	T	0.45438	0.1342	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.41378	-0.9512	7	0.45353	T	0.12	-9.569	1.4757	0.02425	0.3956:0.2712:0.1093:0.2238	.	.	.	.	T	171	ENSP00000440465:A171T	ENSP00000440465:A171T	A	+	1	0	IGHMBP2	68435545	0.000000	0.05858	0.183000	0.23137	0.396000	0.30629	-2.996000	0.00655	-2.735000	0.00382	-0.362000	0.07510	GCT	IGHMBP2	-	NULL	ENSG00000132740		0.512	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	29	0.00	0	G	NM_002180		68678969	68678969	+1	no_errors	ENST00000539224	ensembl	human	novel	69_37n	missense	25	34.21	13	SNP	0.012	A
IGHMBP2	3508	genome.wustl.edu	37	11	68704370	68704370	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:68704370delG	ENST00000255078.3	+	13	2533	c.2422delG	c.(2422-2424)gtgfs	p.V808fs		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	808	Gln/Pro-rich.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCTCCAGCCAGTGCCCCCTAC	0.687																																						dbGAP											0													13.0	15.0	14.0					11																	68704370		2177	4277	6454	-	-	-	SO:0001589	frameshift_variant	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.2422delG	11.37:g.68704370delG	ENSP00000255078:p.Val808fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJD2|Q00443|Q14177	Frame_Shift_Del	DEL	pfam_R3H_ss-bd,pfam_Znf_AN1,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_R3H_ss-bd,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_R3H_ss-bd,tigrfam_DNA_helicase_put	p.V808fs	ENST00000255078.3	37	c.2422	CCDS8187.1	11																																																																																			IGHMBP2	-	NULL	ENSG00000132740		0.687	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	16	0.00	0	G	NM_002180		68704370	68704370	+1	no_errors	ENST00000255078	ensembl	human	known	69_37n	frame_shift_del	7	41.67	5	DEL	0.000	-
IGHMBP2	3508	genome.wustl.edu	37	11	68704370	68704370	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:68704370delG	ENST00000255078.3	+	13	2533	c.2422delG	c.(2422-2424)gtgfs	p.V808fs		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	808	Gln/Pro-rich.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCTCCAGCCAGTGCCCCCTAC	0.687																																						dbGAP											0													13.0	15.0	14.0					11																	68704370		2177	4277	6454	-	-	-	SO:0001589	frameshift_variant	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.2422delG	11.37:g.68704370delG	ENSP00000255078:p.Val808fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJD2|Q00443|Q14177	Frame_Shift_Del	DEL	pfam_R3H_ss-bd,pfam_Znf_AN1,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_R3H_ss-bd,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_R3H_ss-bd,tigrfam_DNA_helicase_put	p.V808fs	ENST00000255078.3	37	c.2422	CCDS8187.1	11																																																																																			IGHMBP2	-	NULL	ENSG00000132740		0.687	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	9	0.00	0	G	NM_002180		68704370	68704370	+1	no_errors	ENST00000255078	ensembl	human	known	69_37n	frame_shift_del	7	41.67	5	DEL	0.000	-
NDUFAF3	25915	genome.wustl.edu	37	3	49062341	49062341	+	IGR	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:49062341T>C	ENST00000326925.6	+	0	2012				DALRD3_ENST00000496568.1_5'Flank|IMPDH2_ENST00000326739.4_Missense_Mutation_p.N428S	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3						mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						GAAATATCTGTTCTGGCTGCT	0.542																																						dbGAP											0													97.0	87.0	91.0					3																	49062341		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0				CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773		3.37:g.49062341T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IMP_DH_GMPRt,pfam_Cysta_beta_synth_core,pfam_2Npropane_dOase,pfam_FMN-dep_DH,pfam_NanE,smart_Cysta_beta_synth_core,pirsf_IMP_DH-rel,tigrfam_IMP_DH	p.N428S	ENST00000326925.6	37	c.1283	CCDS2784.1	3	.	.	.	.	.	.	.	.	.	.	T	2.474	-0.321179	0.05386	.	.	ENSG00000178035	ENST00000326739	T	0.77620	-1.11	5.49	5.49	0.81192	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.126728	0.64402	D	0.000001	T	0.49253	0.1546	N	0.00602	-1.34	0.40721	D	0.982664	B	0.02656	0.0	B	0.06405	0.002	T	0.52200	-0.8607	10	0.21540	T	0.41	-31.4703	15.5881	0.76502	0.0:0.0:0.0:1.0	.	428	P12268	IMDH2_HUMAN	S	428	ENSP00000321584:N428S	ENSP00000321584:N428S	N	-	2	0	IMPDH2	49037345	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.390000	0.34464	2.079000	0.62486	0.533000	0.62120	AAC	IMPDH2	-	pfam_IMP_DH_GMPRt,pirsf_IMP_DH-rel,tigrfam_IMP_DH	ENSG00000178035		0.542	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPDH2	HGNC	protein_coding	OTTHUMT00000345683.2	72	0.00	0	T	NM_199069		49062341	49062341	-1	no_errors	ENST00000326739	ensembl	human	known	69_37n	missense	20	42.86	15	SNP	0.998	C
NDUFAF3	25915	genome.wustl.edu	37	3	49062341	49062341	+	IGR	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:49062341T>C	ENST00000326925.6	+	0	2012				DALRD3_ENST00000496568.1_5'Flank|IMPDH2_ENST00000326739.4_Missense_Mutation_p.N428S	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3						mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						GAAATATCTGTTCTGGCTGCT	0.542																																						dbGAP											0													97.0	87.0	91.0					3																	49062341		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0				CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773		3.37:g.49062341T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IMP_DH_GMPRt,pfam_Cysta_beta_synth_core,pfam_2Npropane_dOase,pfam_FMN-dep_DH,pfam_NanE,smart_Cysta_beta_synth_core,pirsf_IMP_DH-rel,tigrfam_IMP_DH	p.N428S	ENST00000326925.6	37	c.1283	CCDS2784.1	3	.	.	.	.	.	.	.	.	.	.	T	2.474	-0.321179	0.05386	.	.	ENSG00000178035	ENST00000326739	T	0.77620	-1.11	5.49	5.49	0.81192	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.126728	0.64402	D	0.000001	T	0.49253	0.1546	N	0.00602	-1.34	0.40721	D	0.982664	B	0.02656	0.0	B	0.06405	0.002	T	0.52200	-0.8607	10	0.21540	T	0.41	-31.4703	15.5881	0.76502	0.0:0.0:0.0:1.0	.	428	P12268	IMDH2_HUMAN	S	428	ENSP00000321584:N428S	ENSP00000321584:N428S	N	-	2	0	IMPDH2	49037345	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.390000	0.34464	2.079000	0.62486	0.533000	0.62120	AAC	IMPDH2	-	pfam_IMP_DH_GMPRt,pirsf_IMP_DH-rel,tigrfam_IMP_DH	ENSG00000178035		0.542	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPDH2	HGNC	protein_coding	OTTHUMT00000345683.2	36	0.00	0	T	NM_199069		49062341	49062341	-1	no_errors	ENST00000326739	ensembl	human	known	69_37n	missense	20	42.86	15	SNP	0.998	C
IPP	3652	genome.wustl.edu	37	1	46206690	46206690	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:46206690C>A	ENST00000396478.3	-	3	709	c.607G>T	c.(607-609)Gct>Tct	p.A203S		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	203						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TGCATTGCAGCTAAGAAGACC	0.413																																						dbGAP											0													180.0	174.0	176.0					1																	46206690		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.607G>T	1.37:g.46206690C>A	ENSP00000379739:p.Ala203Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A203S	ENST00000396478.3	37	c.607	CCDS30702.1	1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792736	0.50102	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.73897	-0.79;-0.79	5.17	5.17	0.71159	BTB/Kelch-associated (2);	0.100771	0.64402	D	0.000003	T	0.75642	0.3877	M	0.62723	1.935	0.58432	D	0.999992	B;B	0.33120	0.398;0.106	B;B	0.39935	0.314;0.102	T	0.76777	-0.2834	10	0.54805	T	0.06	.	14.7306	0.69379	0.1454:0.8546:0.0:0.0	.	203;203	Q9Y573;A2A6V3	IPP_HUMAN;.	S	203	ENSP00000353024:A203S;ENSP00000379739:A203S	ENSP00000353024:A203S	A	-	1	0	IPP	45979277	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	3.654000	0.54453	2.577000	0.86979	0.643000	0.83706	GCT	IPP	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.413	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3	210	0.00	0	C	NM_005897		46206690	46206690	-1	no_errors	ENST00000396478	ensembl	human	known	69_37n	missense	89	15.24	16	SNP	1.000	A
IPP	3652	genome.wustl.edu	37	1	46206690	46206690	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:46206690C>A	ENST00000396478.3	-	3	709	c.607G>T	c.(607-609)Gct>Tct	p.A203S		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	203						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TGCATTGCAGCTAAGAAGACC	0.413																																						dbGAP											0													180.0	174.0	176.0					1																	46206690		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.607G>T	1.37:g.46206690C>A	ENSP00000379739:p.Ala203Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A203S	ENST00000396478.3	37	c.607	CCDS30702.1	1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792736	0.50102	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.73897	-0.79;-0.79	5.17	5.17	0.71159	BTB/Kelch-associated (2);	0.100771	0.64402	D	0.000003	T	0.75642	0.3877	M	0.62723	1.935	0.58432	D	0.999992	B;B	0.33120	0.398;0.106	B;B	0.39935	0.314;0.102	T	0.76777	-0.2834	10	0.54805	T	0.06	.	14.7306	0.69379	0.1454:0.8546:0.0:0.0	.	203;203	Q9Y573;A2A6V3	IPP_HUMAN;.	S	203	ENSP00000353024:A203S;ENSP00000379739:A203S	ENSP00000353024:A203S	A	-	1	0	IPP	45979277	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	3.654000	0.54453	2.577000	0.86979	0.643000	0.83706	GCT	IPP	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.413	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3	114	0.87	1	C	NM_005897		46206690	46206690	-1	no_errors	ENST00000396478	ensembl	human	known	69_37n	missense	89	15.24	16	SNP	1.000	A
ISM2	145501	genome.wustl.edu	37	14	77950743	77950743	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr14:77950743T>A	ENST00000342219.4	-	3	606	c.550A>T	c.(550-552)Act>Tct	p.T184S	ISM2_ENST00000393684.3_Missense_Mutation_p.T96S|ISM2_ENST00000412904.1_Intron|ISM2_ENST00000493585.1_Missense_Mutation_p.T184S|ISM2_ENST00000429906.1_Missense_Mutation_p.T103S	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	184						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						AGCAAGGGAGTAACCTCCTGG	0.592																																						dbGAP											0													107.0	99.0	102.0					14																	77950743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.550A>T	14.37:g.77950743T>A	ENSP00000341490:p.Thr184Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Missense_Mutation	SNP	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.T184S	ENST00000342219.4	37	c.550	CCDS9864.1	14	.	.	.	.	.	.	.	.	.	.	T	9.682	1.149544	0.21288	.	.	ENSG00000100593	ENST00000342219;ENST00000429906;ENST00000393684;ENST00000493585;ENST00000554801	T;T;T;T	0.44881	1.95;1.97;2.28;0.91	2.47	-2.35	0.06684	.	1.064550	0.07388	U	0.888589	T	0.23054	0.0557	N	0.25647	0.755	0.09310	N	1	B;B	0.25312	0.123;0.075	B;B	0.19666	0.026;0.004	T	0.21075	-1.0256	10	0.22706	T	0.39	-1.9492	3.0588	0.06193	0.1805:0.247:0.0:0.5725	.	184;184	Q6H9L7-2;Q6H9L7	.;ISM2_HUMAN	S	184;103;96;184;103	ENSP00000341490:T184S;ENSP00000395387:T103S;ENSP00000377289:T96S;ENSP00000420452:T184S	ENSP00000341490:T184S	T	-	1	0	ISM2	77020496	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	-0.277000	0.08502	-0.145000	0.11294	0.254000	0.18369	ACT	ISM2	-	NULL	ENSG00000100593		0.592	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ISM2	HGNC	protein_coding	OTTHUMT00000351309.1	192	0.00	0	T	NM_182509		77950743	77950743	-1	no_errors	ENST00000342219	ensembl	human	known	69_37n	missense	41	50.60	42	SNP	0.000	A
ISM2	145501	genome.wustl.edu	37	14	77950743	77950743	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr14:77950743T>A	ENST00000342219.4	-	3	606	c.550A>T	c.(550-552)Act>Tct	p.T184S	ISM2_ENST00000393684.3_Missense_Mutation_p.T96S|ISM2_ENST00000412904.1_Intron|ISM2_ENST00000493585.1_Missense_Mutation_p.T184S|ISM2_ENST00000429906.1_Missense_Mutation_p.T103S	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	184						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						AGCAAGGGAGTAACCTCCTGG	0.592																																						dbGAP											0													107.0	99.0	102.0					14																	77950743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.550A>T	14.37:g.77950743T>A	ENSP00000341490:p.Thr184Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Missense_Mutation	SNP	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.T184S	ENST00000342219.4	37	c.550	CCDS9864.1	14	.	.	.	.	.	.	.	.	.	.	T	9.682	1.149544	0.21288	.	.	ENSG00000100593	ENST00000342219;ENST00000429906;ENST00000393684;ENST00000493585;ENST00000554801	T;T;T;T	0.44881	1.95;1.97;2.28;0.91	2.47	-2.35	0.06684	.	1.064550	0.07388	U	0.888589	T	0.23054	0.0557	N	0.25647	0.755	0.09310	N	1	B;B	0.25312	0.123;0.075	B;B	0.19666	0.026;0.004	T	0.21075	-1.0256	10	0.22706	T	0.39	-1.9492	3.0588	0.06193	0.1805:0.247:0.0:0.5725	.	184;184	Q6H9L7-2;Q6H9L7	.;ISM2_HUMAN	S	184;103;96;184;103	ENSP00000341490:T184S;ENSP00000395387:T103S;ENSP00000377289:T96S;ENSP00000420452:T184S	ENSP00000341490:T184S	T	-	1	0	ISM2	77020496	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	-0.277000	0.08502	-0.145000	0.11294	0.254000	0.18369	ACT	ISM2	-	NULL	ENSG00000100593		0.592	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ISM2	HGNC	protein_coding	OTTHUMT00000351309.1	42	0.00	0	T	NM_182509		77950743	77950743	-1	no_errors	ENST00000342219	ensembl	human	known	69_37n	missense	41	50.60	42	SNP	0.000	A
ITGAX	3687	genome.wustl.edu	37	16	31373464	31373464	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:31373464T>A	ENST00000268296.4	+	11	1276	c.1155T>A	c.(1153-1155)aaT>aaA	p.N385K	ITGAX_ENST00000562522.1_Missense_Mutation_p.N385K	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	385					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						ACCCCCCAAATATGAGCCCTA	0.577																																						dbGAP											0													106.0	107.0	106.0					16																	31373464		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1155T>A	16.37:g.31373464T>A	ENSP00000268296:p.Asn385Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVA6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.N385K	ENST00000268296.4	37	c.1155	CCDS10711.1	16	.	.	.	.	.	.	.	.	.	.	t	0.944	-0.708719	0.03230	.	.	ENSG00000140678	ENST00000268296	T	0.71341	-0.56	4.5	-9.0	0.00747	.	.	.	.	.	T	0.33731	0.0873	N	0.05124	-0.11	0.09310	N	1	B	0.12013	0.005	B	0.12837	0.008	T	0.31558	-0.9939	9	0.07030	T	0.85	.	2.4959	0.04621	0.1169:0.3434:0.3008:0.2388	.	385	P20702	ITAX_HUMAN	K	385	ENSP00000268296:N385K	ENSP00000268296:N385K	N	+	3	2	ITGAX	31280965	0.000000	0.05858	0.000000	0.03702	0.544000	0.35116	-3.329000	0.00510	-1.507000	0.01803	-0.369000	0.07265	AAT	ITGAX	-	NULL	ENSG00000140678		0.577	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	78	0.00	0	T	NM_000887		31373464	31373464	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	0.000	A
ITGAX	3687	genome.wustl.edu	37	16	31373464	31373464	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr16:31373464T>A	ENST00000268296.4	+	11	1276	c.1155T>A	c.(1153-1155)aaT>aaA	p.N385K	ITGAX_ENST00000562522.1_Missense_Mutation_p.N385K	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	385					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						ACCCCCCAAATATGAGCCCTA	0.577																																						dbGAP											0													106.0	107.0	106.0					16																	31373464		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1155T>A	16.37:g.31373464T>A	ENSP00000268296:p.Asn385Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVA6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.N385K	ENST00000268296.4	37	c.1155	CCDS10711.1	16	.	.	.	.	.	.	.	.	.	.	t	0.944	-0.708719	0.03230	.	.	ENSG00000140678	ENST00000268296	T	0.71341	-0.56	4.5	-9.0	0.00747	.	.	.	.	.	T	0.33731	0.0873	N	0.05124	-0.11	0.09310	N	1	B	0.12013	0.005	B	0.12837	0.008	T	0.31558	-0.9939	9	0.07030	T	0.85	.	2.4959	0.04621	0.1169:0.3434:0.3008:0.2388	.	385	P20702	ITAX_HUMAN	K	385	ENSP00000268296:N385K	ENSP00000268296:N385K	N	+	3	2	ITGAX	31280965	0.000000	0.05858	0.000000	0.03702	0.544000	0.35116	-3.329000	0.00510	-1.507000	0.01803	-0.369000	0.07265	AAT	ITGAX	-	NULL	ENSG00000140678		0.577	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	41	0.00	0	T	NM_000887		31373464	31373464	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	0.000	A
KIF17	57576	genome.wustl.edu	37	1	20991082	20991082	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:20991082G>C	ENST00000247986.2	-	15	3395	c.3085C>G	c.(3085-3087)Ctg>Gtg	p.L1029V	KIF17_ENST00000375044.1_Missense_Mutation_p.L929V|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000400463.3_Missense_Mutation_p.L1028V			Q9P2E2	KIF17_HUMAN	kinesin family member 17	1029					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGTGCTCACAGAGGCTCACTG	0.597																																						dbGAP											0													83.0	84.0	84.0					1																	20991082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.3085C>G	1.37:g.20991082G>C	ENSP00000247986:p.Leu1029Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L1029V	ENST00000247986.2	37	c.3085	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134321	0.56828	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.74209	-0.82;-0.67;-0.67	5.08	5.08	0.68730	.	0.000000	0.27253	U	0.020207	T	0.67221	0.2870	N	0.08118	0	0.24648	N	0.993534	D;D;D	0.58268	0.97;0.982;0.97	P;P;P	0.58013	0.681;0.831;0.681	T	0.61855	-0.6977	10	0.66056	D	0.02	.	9.8971	0.41324	0.0932:0.0:0.9068:0.0	.	1029;1028;1029	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	V	929;1028;1029;410	ENSP00000364184:L929V;ENSP00000383311:L1028V;ENSP00000247986:L1029V	ENSP00000247986:L1029V	L	-	1	2	KIF17	20863669	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	2.902000	0.48703	2.529000	0.85273	0.655000	0.94253	CTG	KIF17	-	NULL	ENSG00000117245		0.597	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	73	0.00	0	G	NM_020816		20991082	20991082	-1	no_errors	ENST00000247986	ensembl	human	known	69_37n	missense	32	23.26	10	SNP	1.000	C
KIF17	57576	genome.wustl.edu	37	1	20991082	20991082	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:20991082G>C	ENST00000247986.2	-	15	3395	c.3085C>G	c.(3085-3087)Ctg>Gtg	p.L1029V	KIF17_ENST00000375044.1_Missense_Mutation_p.L929V|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000400463.3_Missense_Mutation_p.L1028V			Q9P2E2	KIF17_HUMAN	kinesin family member 17	1029					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGTGCTCACAGAGGCTCACTG	0.597																																						dbGAP											0													83.0	84.0	84.0					1																	20991082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.3085C>G	1.37:g.20991082G>C	ENSP00000247986:p.Leu1029Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L1029V	ENST00000247986.2	37	c.3085	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134321	0.56828	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.74209	-0.82;-0.67;-0.67	5.08	5.08	0.68730	.	0.000000	0.27253	U	0.020207	T	0.67221	0.2870	N	0.08118	0	0.24648	N	0.993534	D;D;D	0.58268	0.97;0.982;0.97	P;P;P	0.58013	0.681;0.831;0.681	T	0.61855	-0.6977	10	0.66056	D	0.02	.	9.8971	0.41324	0.0932:0.0:0.9068:0.0	.	1029;1028;1029	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	V	929;1028;1029;410	ENSP00000364184:L929V;ENSP00000383311:L1028V;ENSP00000247986:L1029V	ENSP00000247986:L1029V	L	-	1	2	KIF17	20863669	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	2.902000	0.48703	2.529000	0.85273	0.655000	0.94253	CTG	KIF17	-	NULL	ENSG00000117245		0.597	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	39	0.00	0	G	NM_020816		20991082	20991082	-1	no_errors	ENST00000247986	ensembl	human	known	69_37n	missense	32	23.26	10	SNP	1.000	C
KDM5B	10765	genome.wustl.edu	37	1	202722080	202722080	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:202722080G>C	ENST00000367265.3	-	12	2818	c.1654C>G	c.(1654-1656)Ctt>Gtt	p.L552V	KDM5B_ENST00000456180.1_5'Flank|KDM5B_ENST00000367264.2_Missense_Mutation_p.L588V	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	552	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						ATGGTCACAAGCTGATGGAGG	0.478																																						dbGAP											0													117.0	120.0	119.0					1																	202722080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.1654C>G	1.37:g.202722080G>C	ENSP00000356234:p.Leu552Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.L552V	ENST00000367265.3	37	c.1654	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772322	0.90108	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	T;T;T	0.72505	-0.66;-0.66;-0.66	5.98	5.98	0.97165	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.88489	0.6450	M	0.91249	3.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.89784	0.3963	10	0.87932	D	0	-17.609	20.4581	0.99154	0.0:0.0:1.0:0.0	.	588;552	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	V	552;394;588;394	ENSP00000356234:L552V;ENSP00000356233:L588V;ENSP00000235790:L394V	ENSP00000235790:L394V	L	-	1	0	KDM5B	200988703	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.058000	0.89460	2.835000	0.97688	0.650000	0.86243	CTT	KDM5B	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000117139		0.478	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	127	0.00	0	G	NM_006618		202722080	202722080	-1	no_errors	ENST00000367265	ensembl	human	known	69_37n	missense	114	34.29	60	SNP	1.000	C
KDM5B	10765	genome.wustl.edu	37	1	202722080	202722080	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:202722080G>C	ENST00000367265.3	-	12	2818	c.1654C>G	c.(1654-1656)Ctt>Gtt	p.L552V	KDM5B_ENST00000456180.1_5'Flank|KDM5B_ENST00000367264.2_Missense_Mutation_p.L588V	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	552	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						ATGGTCACAAGCTGATGGAGG	0.478																																						dbGAP											0													117.0	120.0	119.0					1																	202722080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.1654C>G	1.37:g.202722080G>C	ENSP00000356234:p.Leu552Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.L552V	ENST00000367265.3	37	c.1654	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772322	0.90108	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	T;T;T	0.72505	-0.66;-0.66;-0.66	5.98	5.98	0.97165	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.88489	0.6450	M	0.91249	3.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.89784	0.3963	10	0.87932	D	0	-17.609	20.4581	0.99154	0.0:0.0:1.0:0.0	.	588;552	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	V	552;394;588;394	ENSP00000356234:L552V;ENSP00000356233:L588V;ENSP00000235790:L394V	ENSP00000235790:L394V	L	-	1	0	KDM5B	200988703	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.058000	0.89460	2.835000	0.97688	0.650000	0.86243	CTT	KDM5B	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000117139		0.478	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	128	0.78	1	G	NM_006618		202722080	202722080	-1	no_errors	ENST00000367265	ensembl	human	known	69_37n	missense	114	34.29	60	SNP	1.000	C
KLF14	136259	genome.wustl.edu	37	7	130418081	130418082	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:130418081_130418082insC	ENST00000310992.4	-	1	806_807	c.779_780insG	c.(778-780)tgcfs	p.C260fs		NM_138693.2	NP_619638.2	Q8TD94	KLF14_HUMAN	Kruppel-like factor 14	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(18;0.0435)					ACTGCTTGGGGCAGAGGGGGCA	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF490374	CCDS5825.1	7q32.3	2014-05-06			ENSG00000174595	ENSG00000266265		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	23025	protein-coding gene	gene with protein product		609393				17480121	Standard	NM_138693		Approved	BTEB5	uc003vqk.2	Q8TD94	OTTHUMG00000188298	ENST00000310992.4:c.780dupG	7.37:g.130418082_130418082dupC	ENSP00000310878:p.Cys260fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q19A42|Q19A43	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C260fs	ENST00000310992.4	37	c.780_779	CCDS5825.1	7																																																																																			KLF14	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000174595		0.624	KLF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF14	HGNC	protein_coding	OTTHUMT00000338013.1	33	0.00	0	-	NM_138693		130418081	130418082	-1	no_errors	ENST00000310992	ensembl	human	known	69_37n	frame_shift_ins	5	37.50	3	INS	1.000:1.000	C
LDB2	9079	genome.wustl.edu	37	4	16587601	16587601	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr4:16587601G>T	ENST00000304523.5	-	5	882	c.559C>A	c.(559-561)Ctg>Atg	p.L187M	LDB2_ENST00000441778.2_Missense_Mutation_p.L187M|LDB2_ENST00000503829.1_5'UTR|LDB2_ENST00000503178.2_Missense_Mutation_p.L63M|LDB2_ENST00000515064.1_Missense_Mutation_p.L187M|LDB2_ENST00000502640.1_Missense_Mutation_p.L187M	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	187					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						TTTTTGGACAGCTGATCCAGG	0.418																																						dbGAP											0													129.0	123.0	125.0					4																	16587601		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.559C>A	4.37:g.16587601G>T	ENSP00000306772:p.Leu187Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O60619|O75480	Missense_Mutation	SNP	NULL	p.L187M	ENST00000304523.5	37	c.559	CCDS3420.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.194046|5.194046	0.94960|0.94960	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000503178;ENST00000506732|ENST00000507464	.|.	.|.	.|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.56097|.	D|.	0.000035|.	T|T	0.67730|0.67730	0.2924|0.2924	L|L	0.39566|0.39566	1.225|1.225	0.80722|0.80722	D|D	1|1	P;P;D;P;D;D|.	0.89917|.	0.943;0.89;0.996;0.929;1.0;0.999|.	P;P;D;P;D;D|.	0.97110|.	0.74;0.596;0.962;0.729;1.0;0.999|.	T|T	0.60151|0.60151	-0.7319|-0.7319	9|5	0.32370|.	T|.	0.25|.	-12.5703|-12.5703	19.848|19.848	0.96722|0.96722	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	63;187;187;187;187;163|.	B7Z2D3;E9PFI4;G5E9Y7;O43679-2;O43679;O43679-3|.	.;.;.;.;LDB2_HUMAN;.|.	M|R	187;187;187;187;63;163|108	.|.	ENSP00000306772:L187M|.	L|S	-|-	1|3	2|2	LDB2|LDB2	16196699|16196699	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.969000|7.969000	0.87988|0.87988	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CTG|AGC	LDB2	-	NULL	ENSG00000169744		0.418	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	220	0.00	0	G			16587601	16587601	-1	no_errors	ENST00000304523	ensembl	human	known	69_37n	missense	124	27.06	46	SNP	1.000	T
LDB2	9079	genome.wustl.edu	37	4	16587601	16587601	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr4:16587601G>T	ENST00000304523.5	-	5	882	c.559C>A	c.(559-561)Ctg>Atg	p.L187M	LDB2_ENST00000441778.2_Missense_Mutation_p.L187M|LDB2_ENST00000503829.1_5'UTR|LDB2_ENST00000503178.2_Missense_Mutation_p.L63M|LDB2_ENST00000515064.1_Missense_Mutation_p.L187M|LDB2_ENST00000502640.1_Missense_Mutation_p.L187M	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	187					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						TTTTTGGACAGCTGATCCAGG	0.418																																						dbGAP											0													129.0	123.0	125.0					4																	16587601		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.559C>A	4.37:g.16587601G>T	ENSP00000306772:p.Leu187Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O60619|O75480	Missense_Mutation	SNP	NULL	p.L187M	ENST00000304523.5	37	c.559	CCDS3420.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.194046|5.194046	0.94960|0.94960	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000503178;ENST00000506732|ENST00000507464	.|.	.|.	.|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.56097|.	D|.	0.000035|.	T|T	0.67730|0.67730	0.2924|0.2924	L|L	0.39566|0.39566	1.225|1.225	0.80722|0.80722	D|D	1|1	P;P;D;P;D;D|.	0.89917|.	0.943;0.89;0.996;0.929;1.0;0.999|.	P;P;D;P;D;D|.	0.97110|.	0.74;0.596;0.962;0.729;1.0;0.999|.	T|T	0.60151|0.60151	-0.7319|-0.7319	9|5	0.32370|.	T|.	0.25|.	-12.5703|-12.5703	19.848|19.848	0.96722|0.96722	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	63;187;187;187;187;163|.	B7Z2D3;E9PFI4;G5E9Y7;O43679-2;O43679;O43679-3|.	.;.;.;.;LDB2_HUMAN;.|.	M|R	187;187;187;187;63;163|108	.|.	ENSP00000306772:L187M|.	L|S	-|-	1|3	2|2	LDB2|LDB2	16196699|16196699	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.969000|7.969000	0.87988|0.87988	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CTG|AGC	LDB2	-	NULL	ENSG00000169744		0.418	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	382	0.26	1	G			16587601	16587601	-1	no_errors	ENST00000304523	ensembl	human	known	69_37n	missense	124	27.06	46	SNP	1.000	T
LDLRAD2	401944	genome.wustl.edu	37	1	22140944	22140945	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:22140944_22140945insA	ENST00000344642.2	+	2	326_327	c.139_140insA	c.(139-141)cgcfs	p.R47fs	LDLRAD2_ENST00000543870.1_Frame_Shift_Ins_p.R47fs	NM_001013693.2	NP_001013715.2	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain containing 2	47						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(3)	6		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		GCTGCTGCTGCGCTCGCACGCC	0.728																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL590103	CCDS30624.1	1p36.12	2008-02-05	2005-10-07		ENSG00000187942	ENSG00000187942			32071	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 2"""				Standard	NM_001013693		Approved		uc001bfg.1	Q5SZI1	OTTHUMG00000002675	Exception_encountered	1.37:g.22140944_22140945insA	ENSP00000340988:p.Arg47fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJB3|Q6ZSN5	Frame_Shift_Ins	INS	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,superfamily_CUB,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	p.R47fs	ENST00000344642.2	37	c.139_140	CCDS30624.1	1																																																																																			LDLRAD2	-	superfamily_CUB	ENSG00000187942		0.728	LDLRAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAD2	HGNC	protein_coding	OTTHUMT00000007601.1	20	0.00	0	-	NM_001013693		22140944	22140945	+1	no_errors	ENST00000344642	ensembl	human	known	69_37n	frame_shift_ins	7	30.00	3	INS	1.000:1.000	A
LDLRAP1	26119	genome.wustl.edu	37	1	25889626	25889627	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:25889626_25889627insC	ENST00000374338.4	+	6	717_718	c.598_599insC	c.(598-600)accfs	p.T200fs	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	200					amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		CCAAGACTGCACCCCCTCCTTG	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.603dupC	1.37:g.25889631_25889631dupC	ENSP00000363458:p.Thr200fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Frame_Shift_Ins	INS	pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.S202fs	ENST00000374338.4	37	c.598_599	CCDS30639.1	1																																																																																			LDLRAP1	-	NULL	ENSG00000157978		0.634	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAP1	HGNC	protein_coding	OTTHUMT00000019350.3	44	0.00	0	-	NM_015627		25889626	25889627	+1	no_errors	ENST00000374338	ensembl	human	known	69_37n	frame_shift_ins	44	13.73	7	INS	0.384:0.477	C
LHCGR	3973	genome.wustl.edu	37	2	48958413	48958413	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr2:48958413T>G	ENST00000294954.7	-	2	207	c.186A>C	c.(184-186)aaA>aaC	p.K62N	LHCGR_ENST00000401907.1_Missense_Mutation_p.K62N|LHCGR_ENST00000344775.3_Missense_Mutation_p.K62N|LHCGR_ENST00000405626.1_Missense_Mutation_p.K62N|LHCGR_ENST00000403273.1_Missense_Mutation_p.K62N|STON1-GTF2A1L_ENST00000402114.2_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	62	LRRNT.				activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	ATGGGATCACTTTGACAGGGA	0.333																																						dbGAP											0													87.0	89.0	88.0					2																	48958413		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.186A>C	2.37:g.48958413T>G	ENSP00000294954:p.Lys62Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.K62N	ENST00000294954.7	37	c.186	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	T	18.23	3.577866	0.65878	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907;ENST00000428232	D;D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52;-2.52	5.89	4.73	0.59995	Leucine-rich repeat-containing N-terminal (1);	0.102877	0.64402	D	0.000004	D	0.92231	0.7536	M	0.82056	2.57	0.42341	D	0.992334	D	0.56968	0.978	P	0.56751	0.805	D	0.91671	0.5350	9	.	.	.	.	9.7494	0.40466	0.0:0.0781:0.0:0.9219	.	62	P22888	LSHR_HUMAN	N	62;62;62;62;62;28	ENSP00000344301:K62N;ENSP00000294954:K62N;ENSP00000386033:K62N;ENSP00000385847:K62N;ENSP00000385406:K62N;ENSP00000403748:K28N	.	K	-	3	2	LHCGR	48811917	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.303000	0.51858	1.045000	0.40225	0.482000	0.46254	AAA	LHCGR	-	prints_LSH_rcpt	ENSG00000138039		0.333	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	163	0.00	0	T	NM_000233.3		48958413	48958413	-1	no_errors	ENST00000294954	ensembl	human	known	69_37n	missense	196	20.97	52	SNP	1.000	G
LHCGR	3973	genome.wustl.edu	37	2	48958413	48958413	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr2:48958413T>G	ENST00000294954.7	-	2	207	c.186A>C	c.(184-186)aaA>aaC	p.K62N	LHCGR_ENST00000401907.1_Missense_Mutation_p.K62N|LHCGR_ENST00000344775.3_Missense_Mutation_p.K62N|LHCGR_ENST00000405626.1_Missense_Mutation_p.K62N|LHCGR_ENST00000403273.1_Missense_Mutation_p.K62N|STON1-GTF2A1L_ENST00000402114.2_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	62	LRRNT.				activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	ATGGGATCACTTTGACAGGGA	0.333																																						dbGAP											0													87.0	89.0	88.0					2																	48958413		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.186A>C	2.37:g.48958413T>G	ENSP00000294954:p.Lys62Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.K62N	ENST00000294954.7	37	c.186	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	T	18.23	3.577866	0.65878	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907;ENST00000428232	D;D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52;-2.52	5.89	4.73	0.59995	Leucine-rich repeat-containing N-terminal (1);	0.102877	0.64402	D	0.000004	D	0.92231	0.7536	M	0.82056	2.57	0.42341	D	0.992334	D	0.56968	0.978	P	0.56751	0.805	D	0.91671	0.5350	9	.	.	.	.	9.7494	0.40466	0.0:0.0781:0.0:0.9219	.	62	P22888	LSHR_HUMAN	N	62;62;62;62;62;28	ENSP00000344301:K62N;ENSP00000294954:K62N;ENSP00000386033:K62N;ENSP00000385847:K62N;ENSP00000385406:K62N;ENSP00000403748:K28N	.	K	-	3	2	LHCGR	48811917	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.303000	0.51858	1.045000	0.40225	0.482000	0.46254	AAA	LHCGR	-	prints_LSH_rcpt	ENSG00000138039		0.333	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	264	0.00	0	T	NM_000233.3		48958413	48958413	-1	no_errors	ENST00000294954	ensembl	human	known	69_37n	missense	196	20.97	52	SNP	1.000	G
LILRA1	11024	genome.wustl.edu	37	19	55107753	55107753	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:55107753A>T	ENST00000251372.3	+	7	1240	c.1058A>T	c.(1057-1059)cAc>cTc	p.H353L	LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRA1_ENST00000453777.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	353	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		GGGCCGTTCCACACTTTCCTT	0.582																																						dbGAP											0													106.0	103.0	104.0					19																	55107753		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1058A>T	19.37:g.55107753A>T	ENSP00000251372:p.His353Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75018|Q3MJA6	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.H353L	ENST00000251372.3	37	c.1058	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	A	9.406	1.079196	0.20227	.	.	ENSG00000104974	ENST00000251372	T	0.02709	4.19	1.4	-1.33	0.09172	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.940520	0.02676	N	0.109148	T	0.05456	0.0144	L	0.58101	1.795	0.09310	N	1	B	0.29671	0.254	B	0.36030	0.216	T	0.41734	-0.9492	10	0.72032	D	0.01	.	4.5494	0.12105	0.5731:0.0:0.4269:0.0	.	353	O75019	LIRA1_HUMAN	L	353	ENSP00000251372:H353L	ENSP00000251372:H353L	H	+	2	0	LILRA1	59799565	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.401000	0.20948	-0.510000	0.06523	0.172000	0.16884	CAC	LILRA1	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000104974		0.582	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	79	0.00	0	A	NM_006863		55107753	55107753	+1	no_errors	ENST00000251372	ensembl	human	known	69_37n	missense	64	32.63	31	SNP	0.000	T
LILRA1	11024	genome.wustl.edu	37	19	55107753	55107753	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:55107753A>T	ENST00000251372.3	+	7	1240	c.1058A>T	c.(1057-1059)cAc>cTc	p.H353L	LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRA1_ENST00000453777.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	353	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		GGGCCGTTCCACACTTTCCTT	0.582																																						dbGAP											0													106.0	103.0	104.0					19																	55107753		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1058A>T	19.37:g.55107753A>T	ENSP00000251372:p.His353Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75018|Q3MJA6	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.H353L	ENST00000251372.3	37	c.1058	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	A	9.406	1.079196	0.20227	.	.	ENSG00000104974	ENST00000251372	T	0.02709	4.19	1.4	-1.33	0.09172	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.940520	0.02676	N	0.109148	T	0.05456	0.0144	L	0.58101	1.795	0.09310	N	1	B	0.29671	0.254	B	0.36030	0.216	T	0.41734	-0.9492	10	0.72032	D	0.01	.	4.5494	0.12105	0.5731:0.0:0.4269:0.0	.	353	O75019	LIRA1_HUMAN	L	353	ENSP00000251372:H353L	ENSP00000251372:H353L	H	+	2	0	LILRA1	59799565	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.401000	0.20948	-0.510000	0.06523	0.172000	0.16884	CAC	LILRA1	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000104974		0.582	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	70	0.00	0	A	NM_006863		55107753	55107753	+1	no_errors	ENST00000251372	ensembl	human	known	69_37n	missense	64	32.63	31	SNP	0.000	T
LOXL3	84695	genome.wustl.edu	37	2	74763923	74763924	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr2:74763923_74763924insC	ENST00000264094.3	-	5	895_896	c.824_825insG	c.(823-825)ggcfs	p.G275fs	LOXL3_ENST00000484369.1_5'Flank|LOXL3_ENST00000409986.1_Intron|LOXL3_ENST00000393937.2_Intron|LOXL3_ENST00000409249.1_Frame_Shift_Ins_p.G275fs|LOXL3_ENST00000409549.1_Frame_Shift_Ins_p.G275fs	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	275	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.A277fs*57(1)		endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CCACTGCAGGGCCCCCCCCAGG	0.649																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.825dupG	2.37:g.74763931_74763931dupC	ENSP00000264094:p.Gly275fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Frame_Shift_Ins	INS	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Lysyl_oxidase,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.A277fs	ENST00000264094.3	37	c.825_824	CCDS1953.1	2																																																																																			LOXL3	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000115318		0.649	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	HGNC	protein_coding	OTTHUMT00000252215.1	35	0.00	0	-	NM_032603		74763923	74763924	-1	no_errors	ENST00000264094	ensembl	human	known	69_37n	frame_shift_ins	62	12.68	9	INS	0.118:0.001	C
LRRC37A2	474170	genome.wustl.edu	37	17	44627117	44627117	+	Missense_Mutation	SNP	A	A	G	rs202124484		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:44627117A>G	ENST00000576629.1	+	10	5107	c.4612A>G	c.(4612-4614)Aag>Gag	p.K1538E	ARL17A_ENST00000337845.7_Intron|LRRC37A2_ENST00000333412.3_Missense_Mutation_p.K1538E|ARL17A_ENST00000573185.1_Intron|ARL17A_ENST00000445552.2_Intron|ARL17A_ENST00000329240.4_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1538						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		AAAGGCATCCAAGATAGAATG	0.512																																						dbGAP											0													1.0	1.0	1.0					17																	44627117		44	106	150	-	-	-	SO:0001583	missense	0			AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.4612A>G	17.37:g.44627117A>G	ENSP00000459551:p.Lys1538Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMC3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K1538E	ENST00000576629.1	37	c.4612	CCDS42353.1	17	.	.	.	.	.	.	.	.	.	.	a	14.24	2.476543	0.44044	.	.	ENSG00000238083	ENST00000333412	T	0.51817	0.69	3.19	-1.07	0.09968	.	.	.	.	.	T	0.58177	0.2104	M	0.61703	1.905	0.20563	N	0.999889	P;P	0.52842	0.956;0.938	P;P	0.62184	0.899;0.495	T	0.51631	-0.8681	9	0.66056	D	0.02	.	8.8713	0.35318	0.3817:0.6183:0.0:0.0	.	1538;1538	C9JSP5;A6NM11	.;L37A2_HUMAN	E	1538	ENSP00000333071:K1538E	ENSP00000333071:K1538E	K	+	1	0	LRRC37A2	41982433	0.000000	0.05858	0.017000	0.16124	0.012000	0.07955	-0.323000	0.07997	0.016000	0.14998	0.147000	0.16070	AAG	LRRC37A2	-	NULL	ENSG00000238083		0.512	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A2	HGNC	protein_coding	OTTHUMT00000440299.2	37	0.00	0	A	NM_001006607		44627117	44627117	+1	no_errors	ENST00000333412	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	0.005	G
LZTS2	84445	genome.wustl.edu	37	10	102763592	102763592	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr10:102763592delA	ENST00000370220.1	+	2	3800	c.737delA	c.(736-738)cacfs	p.H246fs	LZTS2_ENST00000370223.3_Frame_Shift_Del_p.H246fs					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		CCAGGCGGGCACCTGCCTTCC	0.692																																					Esophageal Squamous(8;38 437 13604 19902 37640)	dbGAP											0													36.0	46.0	43.0					10																	102763592		2200	4296	6496	-	-	-	SO:0001589	frameshift_variant	0			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.737delA	10.37:g.102763592delA	ENSP00000359240:p.His246fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Fez1	p.H246fs	ENST00000370220.1	37	c.737	CCDS7507.1	10																																																																																			LZTS2	-	NULL	ENSG00000107816		0.692	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LZTS2	HGNC	protein_coding	OTTHUMT00000049872.1	90	0.00	0	A	XM_046743		102763592	102763592	+1	no_errors	ENST00000370220	ensembl	human	known	69_37n	frame_shift_del	6	70.83	17	DEL	0.986	-
LZTS2	84445	genome.wustl.edu	37	10	102763592	102763592	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr10:102763592delA	ENST00000370220.1	+	2	3800	c.737delA	c.(736-738)cacfs	p.H246fs	LZTS2_ENST00000370223.3_Frame_Shift_Del_p.H246fs					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		CCAGGCGGGCACCTGCCTTCC	0.692																																					Esophageal Squamous(8;38 437 13604 19902 37640)	dbGAP											0													36.0	46.0	43.0					10																	102763592		2200	4296	6496	-	-	-	SO:0001589	frameshift_variant	0			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.737delA	10.37:g.102763592delA	ENSP00000359240:p.His246fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Fez1	p.H246fs	ENST00000370220.1	37	c.737	CCDS7507.1	10																																																																																			LZTS2	-	NULL	ENSG00000107816		0.692	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LZTS2	HGNC	protein_coding	OTTHUMT00000049872.1	19	0.00	0	A	XM_046743		102763592	102763592	+1	no_errors	ENST00000370220	ensembl	human	known	69_37n	frame_shift_del	6	70.83	17	DEL	0.986	-
MAN2C1	4123	genome.wustl.edu	37	15	75653492	75653493	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr15:75653492_75653493insT	ENST00000267978.5	-	12	1400_1401	c.1354_1355insA	c.(1354-1356)gccfs	p.A452fs	MAN2C1_ENST00000569482.1_Frame_Shift_Ins_p.A452fs|MAN2C1_ENST00000565683.1_Frame_Shift_Ins_p.A452fs|MAN2C1_ENST00000563539.1_5'Flank|MAN2C1_ENST00000563622.1_Frame_Shift_Ins_p.A353fs	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	452					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						ACTGTGGTTGGCCCGCCCCTTG	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1354_1355insA	15.37:g.75653492_75653493insT	ENSP00000267978:p.Ala452fs	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Frame_Shift_Ins	INS	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.A452fs	ENST00000267978.5	37	c.1355_1354	CCDS32298.1	15																																																																																			MAN2C1	-	pfam_Glyco_hydro_38_core,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000140400		0.639	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1	8	0.00	0	-			75653492	75653493	-1	no_errors	ENST00000267978	ensembl	human	known	69_37n	frame_shift_ins	5	37.50	3	INS	1.000:0.999	T
MAPK4	5596	genome.wustl.edu	37	18	48252421	48252421	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr18:48252421T>A	ENST00000400384.2	+	5	1979	c.943T>A	c.(943-945)Tac>Aac	p.Y315N	MAPK4_ENST00000540640.1_Missense_Mutation_p.Y104N|MAPK4_ENST00000592595.1_Intron	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	315					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		CATGAGCCCATACTCGTGCCC	0.577																																						dbGAP											0													118.0	122.0	121.0					18																	48252421		2082	4212	6294	-	-	-	SO:0001583	missense	0			X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.943T>A	18.37:g.48252421T>A	ENSP00000383234:p.Tyr315Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C4|Q0VG04	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.Y315N	ENST00000400384.2	37	c.943	CCDS42437.1	18	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109069	0.77096	.	.	ENSG00000141639	ENST00000400384;ENST00000540640	T;T	0.44083	0.93;0.93	4.75	4.75	0.60458	Protein kinase-like domain (1);	0.000000	0.53938	D	0.000051	T	0.60856	0.2301	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64892	-0.6300	10	0.87932	D	0	-4.3694	13.2607	0.60102	0.0:0.0:0.0:1.0	.	315	P31152	MK04_HUMAN	N	315;104	ENSP00000383234:Y315N;ENSP00000439231:Y104N	ENSP00000383234:Y315N	Y	+	1	0	MAPK4	46506419	1.000000	0.71417	0.738000	0.30950	0.707000	0.40811	8.020000	0.88740	1.793000	0.52555	0.533000	0.62120	TAC	MAPK4	-	superfamily_Kinase-like_dom	ENSG00000141639		0.577	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK4	HGNC	protein_coding	OTTHUMT00000448631.2	160	0.00	0	T	NM_002747		48252421	48252421	+1	no_errors	ENST00000400384	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.997	A
MAPK4	5596	genome.wustl.edu	37	18	48252421	48252421	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr18:48252421T>A	ENST00000400384.2	+	5	1979	c.943T>A	c.(943-945)Tac>Aac	p.Y315N	MAPK4_ENST00000540640.1_Missense_Mutation_p.Y104N|MAPK4_ENST00000592595.1_Intron	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	315					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		CATGAGCCCATACTCGTGCCC	0.577																																						dbGAP											0													118.0	122.0	121.0					18																	48252421		2082	4212	6294	-	-	-	SO:0001583	missense	0			X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.943T>A	18.37:g.48252421T>A	ENSP00000383234:p.Tyr315Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C4|Q0VG04	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.Y315N	ENST00000400384.2	37	c.943	CCDS42437.1	18	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109069	0.77096	.	.	ENSG00000141639	ENST00000400384;ENST00000540640	T;T	0.44083	0.93;0.93	4.75	4.75	0.60458	Protein kinase-like domain (1);	0.000000	0.53938	D	0.000051	T	0.60856	0.2301	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64892	-0.6300	10	0.87932	D	0	-4.3694	13.2607	0.60102	0.0:0.0:0.0:1.0	.	315	P31152	MK04_HUMAN	N	315;104	ENSP00000383234:Y315N;ENSP00000439231:Y104N	ENSP00000383234:Y315N	Y	+	1	0	MAPK4	46506419	1.000000	0.71417	0.738000	0.30950	0.707000	0.40811	8.020000	0.88740	1.793000	0.52555	0.533000	0.62120	TAC	MAPK4	-	superfamily_Kinase-like_dom	ENSG00000141639		0.577	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK4	HGNC	protein_coding	OTTHUMT00000448631.2	47	0.00	0	T	NM_002747		48252421	48252421	+1	no_errors	ENST00000400384	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.997	A
MAVS	57506	genome.wustl.edu	37	20	3846668	3846668	+	Silent	SNP	G	G	C	rs534161992		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr20:3846668G>C	ENST00000428216.2	+	7	1625	c.1497G>C	c.(1495-1497)cgG>cgC	p.R499R	MAVS_ENST00000358134.6_3'UTR|MAVS_ENST00000416600.2_Silent_p.R358R	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	499					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						AAGCCGACCGGAAGTTCCAGG	0.672																																						dbGAP											0													24.0	26.0	25.0					20																	3846668		2198	4296	6494	-	-	-	SO:0001819	synonymous_variant	0			DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.1497G>C	20.37:g.3846668G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Silent	SNP	NULL	p.R499	ENST00000428216.2	37	c.1497	CCDS33437.1	20																																																																																			MAVS	-	NULL	ENSG00000088888		0.672	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAVS	HGNC	protein_coding	OTTHUMT00000077784.3	19	0.00	0	G	NM_020746		3846668	3846668	+1	no_errors	ENST00000428216	ensembl	human	known	69_37n	silent	8	55.56	10	SNP	0.000	C
MED12	9968	genome.wustl.edu	37	X	70357092	70357092	+	Silent	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chrX:70357092C>T	ENST00000374080.3	+	39	5639	c.5607C>T	c.(5605-5607)ccC>ccT	p.P1869P	MED12_ENST00000333646.6_Silent_p.P1869P|MED12_ENST00000374102.1_Silent_p.P1869P			Q93074	MED12_HUMAN	mediator complex subunit 12	1869	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGAAGCTGCCCACCCGACCAA	0.572			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													68.0	66.0	66.0					X																	70357092		2076	4183	6259	-	-	-	SO:0001819	synonymous_variant	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.5607C>T	X.37:g.70357092C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_catenin-bd	p.P90L	ENST00000374080.3	37	c.269	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	-	2.750	-0.260220	0.05791	.	.	ENSG00000184634	ENST00000444034	.	.	.	4.63	-9.25	0.00666	.	0.194613	0.44688	D	0.000438	T	0.13200	0.0320	.	.	.	0.37576	D	0.919619	.	.	.	.	.	.	T	0.50575	-0.8812	6	0.02654	T	1	-3.3774	2.8065	0.05429	0.2304:0.0888:0.4244:0.2564	.	.	.	.	L	90	.	ENSP00000404373:P90L	P	+	2	0	MED12	70273817	0.000000	0.05858	0.046000	0.18839	0.703000	0.40648	-0.782000	0.04643	-2.459000	0.00537	-1.176000	0.01726	CCA	MED12	-	pfam_Mediator_Med12_catenin-bd	ENSG00000184634		0.572	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	111	0.00	0	C	NM_005120		70357092	70357092	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444034	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	0.001	T
MED12	9968	genome.wustl.edu	37	X	70357092	70357092	+	Silent	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chrX:70357092C>T	ENST00000374080.3	+	39	5639	c.5607C>T	c.(5605-5607)ccC>ccT	p.P1869P	MED12_ENST00000333646.6_Silent_p.P1869P|MED12_ENST00000374102.1_Silent_p.P1869P			Q93074	MED12_HUMAN	mediator complex subunit 12	1869	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGAAGCTGCCCACCCGACCAA	0.572			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													68.0	66.0	66.0					X																	70357092		2076	4183	6259	-	-	-	SO:0001819	synonymous_variant	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.5607C>T	X.37:g.70357092C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_catenin-bd	p.P90L	ENST00000374080.3	37	c.269	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	-	2.750	-0.260220	0.05791	.	.	ENSG00000184634	ENST00000444034	.	.	.	4.63	-9.25	0.00666	.	0.194613	0.44688	D	0.000438	T	0.13200	0.0320	.	.	.	0.37576	D	0.919619	.	.	.	.	.	.	T	0.50575	-0.8812	6	0.02654	T	1	-3.3774	2.8065	0.05429	0.2304:0.0888:0.4244:0.2564	.	.	.	.	L	90	.	ENSP00000404373:P90L	P	+	2	0	MED12	70273817	0.000000	0.05858	0.046000	0.18839	0.703000	0.40648	-0.782000	0.04643	-2.459000	0.00537	-1.176000	0.01726	CCA	MED12	-	pfam_Mediator_Med12_catenin-bd	ENSG00000184634		0.572	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	29	0.00	0	C	NM_005120		70357092	70357092	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444034	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	0.001	T
MGAT4A	11320	genome.wustl.edu	37	2	99279578	99279578	+	Silent	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr2:99279578A>C	ENST00000264968.3	-	4	831	c.468T>G	c.(466-468)ctT>ctG	p.L156L	MGAT4A_ENST00000409391.1_Silent_p.L156L|MGAT4A_ENST00000414521.2_Silent_p.L28L|MGAT4A_ENST00000393487.1_Silent_p.L156L|MGAT4A_ENST00000461884.1_5'UTR			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	156					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						TAAGGGAATGAAGAGTTTCTA	0.313																																						dbGAP											0													132.0	148.0	142.0					2																	99279578		2203	4289	6492	-	-	-	SO:0001819	synonymous_variant	0			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.468T>G	2.37:g.99279578A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Silent	SNP	pfam_Glyco_transf_54	p.L156	ENST00000264968.3	37	c.468	CCDS2036.1	2																																																																																			MGAT4A	-	pfam_Glyco_transf_54	ENSG00000071073		0.313	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4A	HGNC	protein_coding	OTTHUMT00000252988.2	410	0.00	0	A	NM_012214		99279578	99279578	-1	no_errors	ENST00000264968	ensembl	human	known	69_37n	silent	348	32.69	169	SNP	0.999	C
MGAT4A	11320	genome.wustl.edu	37	2	99279578	99279578	+	Silent	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr2:99279578A>C	ENST00000264968.3	-	4	831	c.468T>G	c.(466-468)ctT>ctG	p.L156L	MGAT4A_ENST00000409391.1_Silent_p.L156L|MGAT4A_ENST00000414521.2_Silent_p.L28L|MGAT4A_ENST00000393487.1_Silent_p.L156L|MGAT4A_ENST00000461884.1_5'UTR			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	156					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						TAAGGGAATGAAGAGTTTCTA	0.313																																						dbGAP											0													132.0	148.0	142.0					2																	99279578		2203	4289	6492	-	-	-	SO:0001819	synonymous_variant	0			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.468T>G	2.37:g.99279578A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Silent	SNP	pfam_Glyco_transf_54	p.L156	ENST00000264968.3	37	c.468	CCDS2036.1	2																																																																																			MGAT4A	-	pfam_Glyco_transf_54	ENSG00000071073		0.313	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4A	HGNC	protein_coding	OTTHUMT00000252988.2	904	0.00	0	A	NM_012214		99279578	99279578	-1	no_errors	ENST00000264968	ensembl	human	known	69_37n	silent	348	32.69	169	SNP	0.999	C
MOV10L1	54456	genome.wustl.edu	37	22	50528920	50528920	+	Intron	DEL	G	G	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr22:50528920delG	ENST00000262794.5	+	1	180				MOV10L1_ENST00000540615.1_Frame_Shift_Del_p.V6fs|MOV10L1_ENST00000395843.1_Intron|MOV10L1_ENST00000545383.1_Intron|MOV10L1_ENST00000395858.3_Intron|MOV10L1_ENST00000475190.1_Intron	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1						ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GTTCCTCCCTGTCCGCAGCGT	0.622																																						dbGAP											0													46.0	47.0	47.0					22																	50528920		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.97+306G>-	22.37:g.50528920delG		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Frame_Shift_Del	DEL	superfamily_NA-bd_OB-fold-like	p.V6fs	ENST00000262794.5	37	c.16	CCDS14084.1	22																																																																																			MOV10L1	-	NULL	ENSG00000073146		0.622	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	11	0.00	0	G	NM_018995		50528920	50528920	+1	no_errors	ENST00000540615	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.002	-
MTMR4	9110	genome.wustl.edu	37	17	56581186	56581186	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:56581186C>T	ENST00000323456.5	-	15	1854	c.1730G>A	c.(1729-1731)tGc>tAc	p.C577Y	MTMR4_ENST00000579925.1_Missense_Mutation_p.C520Y	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	577					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCAAGTGTGCATGGAGATGA	0.537																																						dbGAP											0													137.0	134.0	135.0					17																	56581186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1730G>A	17.37:g.56581186C>T	ENSP00000325285:p.Cys577Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotub-related,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-specificity_Pase	p.C577Y	ENST00000323456.5	37	c.1730	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866043	0.51588	.	.	ENSG00000108389	ENST00000323456	D	0.92805	-3.11	5.98	5.98	0.97165	.	0.452591	0.27609	N	0.018618	D	0.87669	0.6235	L	0.39397	1.21	0.43622	D	0.996001	P	0.48640	0.913	B	0.42062	0.374	D	0.87385	0.2359	10	0.66056	D	0.02	.	8.7928	0.34861	0.0:0.8418:0.0:0.1582	.	577	Q9NYA4	MTMR4_HUMAN	Y	577	ENSP00000325285:C577Y	ENSP00000325285:C577Y	C	-	2	0	MTMR4	53936185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.557000	0.67313	2.837000	0.97791	0.591000	0.81541	TGC	MTMR4	-	NULL	ENSG00000108389		0.537	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	356	0.00	0	C	NM_004687		56581186	56581186	-1	no_errors	ENST00000323456	ensembl	human	known	69_37n	missense	176	57.89	242	SNP	1.000	T
MTMR4	9110	genome.wustl.edu	37	17	56581186	56581186	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr17:56581186C>T	ENST00000323456.5	-	15	1854	c.1730G>A	c.(1729-1731)tGc>tAc	p.C577Y	MTMR4_ENST00000579925.1_Missense_Mutation_p.C520Y	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	577					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCAAGTGTGCATGGAGATGA	0.537																																						dbGAP											0													137.0	134.0	135.0					17																	56581186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1730G>A	17.37:g.56581186C>T	ENSP00000325285:p.Cys577Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotub-related,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-specificity_Pase	p.C577Y	ENST00000323456.5	37	c.1730	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866043	0.51588	.	.	ENSG00000108389	ENST00000323456	D	0.92805	-3.11	5.98	5.98	0.97165	.	0.452591	0.27609	N	0.018618	D	0.87669	0.6235	L	0.39397	1.21	0.43622	D	0.996001	P	0.48640	0.913	B	0.42062	0.374	D	0.87385	0.2359	10	0.66056	D	0.02	.	8.7928	0.34861	0.0:0.8418:0.0:0.1582	.	577	Q9NYA4	MTMR4_HUMAN	Y	577	ENSP00000325285:C577Y	ENSP00000325285:C577Y	C	-	2	0	MTMR4	53936185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.557000	0.67313	2.837000	0.97791	0.591000	0.81541	TGC	MTMR4	-	NULL	ENSG00000108389		0.537	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	210	0.00	0	C	NM_004687		56581186	56581186	-1	no_errors	ENST00000323456	ensembl	human	known	69_37n	missense	176	57.89	242	SNP	1.000	T
MYCT1	80177	genome.wustl.edu	37	6	153043116	153043116	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr6:153043116C>T	ENST00000367245.5	+	2	444	c.436C>T	c.(436-438)Cga>Tga	p.R146*	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	146						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		CACCTTCCAGCGACAAGCTTC	0.498																																						dbGAP											0													110.0	110.0	110.0					6																	153043116		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.436C>T	6.37:g.153043116C>T	ENSP00000356214:p.Arg146*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N396|Q8TBE8|Q9H763	Nonsense_Mutation	SNP	NULL	p.R146*	ENST00000367245.5	37	c.436	CCDS5239.1	6	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264082	0.80358	.	.	ENSG00000120279	ENST00000367245	.	.	.	5.78	2.64	0.31445	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.9758	15.7999	0.78447	0.6825:0.3175:0.0:0.0	.	.	.	.	X	146	.	ENSP00000356214:R146X	R	+	1	2	MYCT1	153084809	0.993000	0.37304	1.000000	0.80357	0.985000	0.73830	0.239000	0.18023	0.177000	0.19895	-0.313000	0.08912	CGA	MYCT1	-	NULL	ENSG00000120279		0.498	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYCT1	HGNC	protein_coding	OTTHUMT00000042750.2	506	0.00	0	C	NM_025107		153043116	153043116	+1	no_errors	ENST00000367245	ensembl	human	known	69_37n	nonsense	291	21.35	79	SNP	0.999	T
MYCT1	80177	genome.wustl.edu	37	6	153043116	153043116	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr6:153043116C>T	ENST00000367245.5	+	2	444	c.436C>T	c.(436-438)Cga>Tga	p.R146*	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	146						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		CACCTTCCAGCGACAAGCTTC	0.498																																						dbGAP											0													110.0	110.0	110.0					6																	153043116		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.436C>T	6.37:g.153043116C>T	ENSP00000356214:p.Arg146*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N396|Q8TBE8|Q9H763	Nonsense_Mutation	SNP	NULL	p.R146*	ENST00000367245.5	37	c.436	CCDS5239.1	6	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264082	0.80358	.	.	ENSG00000120279	ENST00000367245	.	.	.	5.78	2.64	0.31445	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.9758	15.7999	0.78447	0.6825:0.3175:0.0:0.0	.	.	.	.	X	146	.	ENSP00000356214:R146X	R	+	1	2	MYCT1	153084809	0.993000	0.37304	1.000000	0.80357	0.985000	0.73830	0.239000	0.18023	0.177000	0.19895	-0.313000	0.08912	CGA	MYCT1	-	NULL	ENSG00000120279		0.498	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYCT1	HGNC	protein_coding	OTTHUMT00000042750.2	428	0.00	0	C	NM_025107		153043116	153043116	+1	no_errors	ENST00000367245	ensembl	human	known	69_37n	nonsense	291	21.35	79	SNP	0.999	T
MYH11	4629	genome.wustl.edu	37	16	15802686	15802687	+	Intron	INS	-	-	G	rs111588143	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:15802686_15802687insG	ENST00000300036.5	-	41	5896				NDE1_ENST00000396354.1_Intron|MYH11_ENST00000452625.2_Frame_Shift_Ins_p.P1940fs|MYH11_ENST00000573908.1_Intron|NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Intron|MYH11_ENST00000576790.2_Frame_Shift_Ins_p.P1933fs	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle						axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AAGTTTCCTGTGGGGGGGGCCC	0.495			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0									,,,,,	37,4227		0,37,2095					,,,,,	1.7	1.0			33	57,8197		0,57,4070	no	frameshift,intron,intron,intron,intron,frameshift	MYH11,NDE1	NM_022844.2,NM_017668.2,NM_002474.2,NM_001143979.1,NM_001040114.1,NM_001040113.1	,,,,,	0,94,6165	A1A1,A1R,RR		0.6906,0.8677,0.7509	,,,,,	,,,,,		94,12424				-	-	-	SO:0001627	intron_variant	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5787-4706->C	16.37:g.15802694_15802694dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Q1941fs	ENST00000300036.5	37	c.5820_5819	CCDS10565.1	16																																																																																			MYH11	-	NULL	ENSG00000133392		0.495	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	13	0.00	0	-	NM_001040113		15802686	15802687	-1	no_errors	ENST00000452625	ensembl	human	known	69_37n	frame_shift_ins	21	25.00	7	INS	1.000:1.000	G
MYH11	4629	genome.wustl.edu	37	16	15802686	15802687	+	Intron	INS	-	-	G	rs111588143	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr16:15802686_15802687insG	ENST00000300036.5	-	41	5896				NDE1_ENST00000396354.1_Intron|MYH11_ENST00000452625.2_Frame_Shift_Ins_p.P1940fs|MYH11_ENST00000573908.1_Intron|NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Intron|MYH11_ENST00000576790.2_Frame_Shift_Ins_p.P1933fs	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle						axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AAGTTTCCTGTGGGGGGGGCCC	0.495			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0									,,,,,	37,4227		0,37,2095					,,,,,	1.7	1.0			33	57,8197		0,57,4070	no	frameshift,intron,intron,intron,intron,frameshift	MYH11,NDE1	NM_022844.2,NM_017668.2,NM_002474.2,NM_001143979.1,NM_001040114.1,NM_001040113.1	,,,,,	0,94,6165	A1A1,A1R,RR		0.6906,0.8677,0.7509	,,,,,	,,,,,		94,12424				-	-	-	SO:0001627	intron_variant	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5787-4706->C	16.37:g.15802694_15802694dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Q1941fs	ENST00000300036.5	37	c.5820_5819	CCDS10565.1	16																																																																																			MYH11	-	NULL	ENSG00000133392		0.495	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	11	0.00	0	-	NM_001040113		15802686	15802687	-1	no_errors	ENST00000452625	ensembl	human	known	69_37n	frame_shift_ins	21	25.00	7	INS	1.000:1.000	G
MYH15	22989	genome.wustl.edu	37	3	108158716	108158716	+	Silent	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:108158716G>T	ENST00000273353.3	-	25	3059	c.3003C>A	c.(3001-3003)atC>atA	p.I1001I		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1001						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TAAGTTTGCTGATATCCTCAT	0.493																																						dbGAP											0													139.0	143.0	142.0					3																	108158716		2185	4297	6482	-	-	-	SO:0001819	synonymous_variant	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3003C>A	3.37:g.108158716G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.I1001	ENST00000273353.3	37	c.3003	CCDS43127.1	3																																																																																			MYH15	-	superfamily_Prefoldin	ENSG00000144821		0.493	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	509	0.00	0	G	XM_036988		108158716	108158716	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	silent	106	59.07	153	SNP	0.004	T
MYH15	22989	genome.wustl.edu	37	3	108158716	108158716	+	Silent	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:108158716G>T	ENST00000273353.3	-	25	3059	c.3003C>A	c.(3001-3003)atC>atA	p.I1001I		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1001						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TAAGTTTGCTGATATCCTCAT	0.493																																						dbGAP											0													139.0	143.0	142.0					3																	108158716		2185	4297	6482	-	-	-	SO:0001819	synonymous_variant	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3003C>A	3.37:g.108158716G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.I1001	ENST00000273353.3	37	c.3003	CCDS43127.1	3																																																																																			MYH15	-	superfamily_Prefoldin	ENSG00000144821		0.493	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	513	0.00	0	G	XM_036988		108158716	108158716	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	silent	106	59.07	153	SNP	0.004	T
MYO7A	4647	genome.wustl.edu	37	11	76903246	76903246	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:76903246G>A	ENST00000409709.3	+	31	4347	c.4075G>A	c.(4075-4077)Gag>Aag	p.E1359K	MYO7A_ENST00000458637.2_Missense_Mutation_p.E1359K|MYO7A_ENST00000409619.2_Missense_Mutation_p.E1348K	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1359	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CAGCCCCTCCGAGGACAACGT	0.627											OREG0021258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													102.0	113.0	109.0					11																	76903246		2152	4253	6405	-	-	-	SO:0001583	missense	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.4075G>A	11.37:g.76903246G>A	ENSP00000386331:p.Glu1359Lys	Somatic	1171	WXS	Illumina GAIIx	Phase_IV	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.E1359K	ENST00000409709.3	37	c.4075	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262794	0.59431	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	4.68	4.68	0.58851	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.112512	0.64402	D	0.000015	T	0.68118	0.2966	M	0.62723	1.935	0.80722	D	1	B;P;B	0.38473	0.348;0.633;0.192	B;B;B	0.35655	0.064;0.207;0.047	T	0.69606	-0.5100	10	0.33141	T	0.24	.	17.6086	0.88046	0.0:0.0:1.0:0.0	.	1348;1359;1359	B9A011;F8VUN5;Q13402	.;.;MYO7A_HUMAN	K	1359;1359;1348;570;1358;1328;1235;540	ENSP00000386331:E1359K;ENSP00000392185:E1359K;ENSP00000386635:E1348K;ENSP00000417017:E540K	ENSP00000345075:E1235K	E	+	1	0	MYO7A	76580894	1.000000	0.71417	0.920000	0.36463	0.269000	0.26545	7.627000	0.83176	2.141000	0.66446	0.471000	0.43371	GAG	MYO7A	-	superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000137474		0.627	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	95	0.00	0	G	NM_000260		76903246	76903246	+1	no_errors	ENST00000409709	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.997	A
NARS2	79731	genome.wustl.edu	37	11	78189715	78189715	+	Silent	SNP	C	C	G	rs566743818		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:78189715C>G	ENST00000281038.5	-	8	1212	c.837G>C	c.(835-837)ctG>ctC	p.L279L	NARS2_ENST00000528850.1_Silent_p.L52L	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	279					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	TAGCCTTGAACAGTTCCTCTA	0.383																																						dbGAP											0													110.0	104.0	106.0					11																	78189715		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.837G>C	11.37:g.78189715C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V178	Silent	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asn-tRNA-synth_IIb	p.L279	ENST00000281038.5	37	c.837	CCDS8261.1	11																																																																																			NARS2	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,tigrfam_Asn-tRNA-synth_IIb	ENSG00000137513		0.383	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARS2	HGNC	protein_coding	OTTHUMT00000391138.2	171	0.00	0	C	NM_024678		78189715	78189715	-1	no_errors	ENST00000281038	ensembl	human	known	69_37n	silent	154	20.62	40	SNP	0.917	G
NARS2	79731	genome.wustl.edu	37	11	78189715	78189715	+	Silent	SNP	C	C	G	rs566743818		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:78189715C>G	ENST00000281038.5	-	8	1212	c.837G>C	c.(835-837)ctG>ctC	p.L279L	NARS2_ENST00000528850.1_Silent_p.L52L	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	279					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	TAGCCTTGAACAGTTCCTCTA	0.383																																						dbGAP											0													110.0	104.0	106.0					11																	78189715		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.837G>C	11.37:g.78189715C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V178	Silent	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asn-tRNA-synth_IIb	p.L279	ENST00000281038.5	37	c.837	CCDS8261.1	11																																																																																			NARS2	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,tigrfam_Asn-tRNA-synth_IIb	ENSG00000137513		0.383	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARS2	HGNC	protein_coding	OTTHUMT00000391138.2	178	0.00	0	C	NM_024678		78189715	78189715	-1	no_errors	ENST00000281038	ensembl	human	known	69_37n	silent	154	20.62	40	SNP	0.917	G
NCEH1	57552	genome.wustl.edu	37	3	172428805	172428805	+	5'UTR	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:172428805G>C	ENST00000475381.1	-	0	203				NCEH1_ENST00000543711.1_5'UTR|NCEH1_ENST00000273512.3_Missense_Mutation_p.C22W|NCEH1_ENST00000538775.1_Missense_Mutation_p.C22W			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1						lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						CAGCGGGCTGGCAAAGAGGAA	0.627											OREG0015927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													37.0	38.0	38.0					3																	172428805		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.-31C>G	3.37:g.172428805G>C		Somatic	1900	WXS	Illumina GAIIx	Phase_IV	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.C22W	ENST00000475381.1	37	c.66		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.77|10.77	1.443391|1.443391	0.25987|0.25987	.|.	.|.	ENSG00000144959|ENSG00000144959	ENST00000424772|ENST00000538775;ENST00000273512	.|T;T	.|0.04317	.|3.65;3.65	4.66|4.66	-0.419|-0.419	0.12340|0.12340	.|.	.|5.002630	.|0.00424	.|N	.|0.000067	T|T	0.03608|0.03608	0.0103|0.0103	N|N	0.08118|0.08118	0|0	0.20638|0.20638	N|N	0.999878|0.999878	.|B	.|0.27765	.|0.188	.|B	.|0.32583	.|0.148	T|T	0.38023|0.38023	-0.9680|-0.9680	5|10	.|0.46703	.|T	.|0.11	3.3681|3.3681	4.6172|4.6172	0.12432|0.12432	0.2572:0.1968:0.546:0.0|0.2572:0.1968:0.546:0.0	.|.	.|22	.|F5H7K4	.|.	G|W	13|22	.|ENSP00000442464:C22W;ENSP00000273512:C22W	.|ENSP00000273512:C22W	A|C	-|-	2|3	0|2	NCEH1|NCEH1	173911499|173911499	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	-0.150000|-0.150000	0.10189|0.10189	-0.184000|-0.184000	0.10567|0.10567	0.549000|0.549000	0.68633|0.68633	GCC|TGC	NCEH1	-	NULL	ENSG00000144959		0.627	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	NCEH1	HGNC	protein_coding	OTTHUMT00000346367.3	55	0.00	0	G	NM_020792		172428805	172428805	-1	no_errors	ENST00000538775	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.000	C
NCEH1	57552	genome.wustl.edu	37	3	172428805	172428805	+	5'UTR	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:172428805G>C	ENST00000475381.1	-	0	203				NCEH1_ENST00000543711.1_5'UTR|NCEH1_ENST00000273512.3_Missense_Mutation_p.C22W|NCEH1_ENST00000538775.1_Missense_Mutation_p.C22W			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1						lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						CAGCGGGCTGGCAAAGAGGAA	0.627											OREG0015927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													37.0	38.0	38.0					3																	172428805		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.-31C>G	3.37:g.172428805G>C		Somatic	1900	WXS	Illumina GAIIx	Phase_IV	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.C22W	ENST00000475381.1	37	c.66		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.77|10.77	1.443391|1.443391	0.25987|0.25987	.|.	.|.	ENSG00000144959|ENSG00000144959	ENST00000424772|ENST00000538775;ENST00000273512	.|T;T	.|0.04317	.|3.65;3.65	4.66|4.66	-0.419|-0.419	0.12340|0.12340	.|.	.|5.002630	.|0.00424	.|N	.|0.000067	T|T	0.03608|0.03608	0.0103|0.0103	N|N	0.08118|0.08118	0|0	0.20638|0.20638	N|N	0.999878|0.999878	.|B	.|0.27765	.|0.188	.|B	.|0.32583	.|0.148	T|T	0.38023|0.38023	-0.9680|-0.9680	5|10	.|0.46703	.|T	.|0.11	3.3681|3.3681	4.6172|4.6172	0.12432|0.12432	0.2572:0.1968:0.546:0.0|0.2572:0.1968:0.546:0.0	.|.	.|22	.|F5H7K4	.|.	G|W	13|22	.|ENSP00000442464:C22W;ENSP00000273512:C22W	.|ENSP00000273512:C22W	A|C	-|-	2|3	0|2	NCEH1|NCEH1	173911499|173911499	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	-0.150000|-0.150000	0.10189|0.10189	-0.184000|-0.184000	0.10567|0.10567	0.549000|0.549000	0.68633|0.68633	GCC|TGC	NCEH1	-	NULL	ENSG00000144959		0.627	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	NCEH1	HGNC	protein_coding	OTTHUMT00000346367.3	17	0.00	0	G	NM_020792		172428805	172428805	-1	no_errors	ENST00000538775	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.000	C
NIPBL	25836	genome.wustl.edu	37	5	37008133	37008134	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr5:37008133_37008134insT	ENST00000282516.8	+	19	4762_4763	c.4263_4264insT	c.(4264-4266)tttfs	p.F1422fs	NIPBL_ENST00000448238.2_Frame_Shift_Ins_p.F1422fs	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1422					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.F1423fs*15(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GAATAACACCATTTTTTGTGGA	0.302																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4269dupT	5.37:g.37008139_37008139dupT	ENSP00000282516:p.Phe1422fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Ins	INS	superfamily_ARM-type_fold	p.V1423fs	ENST00000282516.8	37	c.4263_4264	CCDS3920.1	5																																																																																			NIPBL	-	NULL	ENSG00000164190		0.302	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	51	0.00	0	-	NM_015384		37008133	37008134	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	frame_shift_ins	20	47.37	18	INS	0.998:1.000	T
NIPBL	25836	genome.wustl.edu	37	5	37008133	37008134	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr5:37008133_37008134insT	ENST00000282516.8	+	19	4762_4763	c.4263_4264insT	c.(4264-4266)tttfs	p.F1422fs	NIPBL_ENST00000448238.2_Frame_Shift_Ins_p.F1422fs	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1422					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.F1423fs*15(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GAATAACACCATTTTTTGTGGA	0.302																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4269dupT	5.37:g.37008139_37008139dupT	ENSP00000282516:p.Phe1422fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Ins	INS	superfamily_ARM-type_fold	p.V1423fs	ENST00000282516.8	37	c.4263_4264	CCDS3920.1	5																																																																																			NIPBL	-	NULL	ENSG00000164190		0.302	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	44	0.00	0	-	NM_015384		37008133	37008134	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	frame_shift_ins	20	47.37	18	INS	0.998:1.000	T
NOL6	65083	genome.wustl.edu	37	9	33464968	33464968	+	Silent	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr9:33464968G>A	ENST00000379471.2	-	21	2775	c.2688C>T	c.(2686-2688)ccC>ccT	p.P896P	NOL6_ENST00000455041.2_Silent_p.P844P|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	896					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AGCCAACCTGGGGGGAACTAA	0.507																																						dbGAP											0													50.0	55.0	53.0					9																	33464968		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.2688C>T	9.37:g.33464968G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	pfam_Nrap	p.P896	ENST00000379471.2	37	c.2688		9																																																																																			NOL6	-	pfam_Nrap	ENSG00000165271		0.507	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	NOL6	HGNC	protein_coding	OTTHUMT00000001019.2	58	0.00	0	G	NM_022917		33464968	33464968	-1	no_errors	ENST00000297990	ensembl	human	known	69_37n	silent	48	26.15	17	SNP	0.921	A
NOL6	65083	genome.wustl.edu	37	9	33464968	33464968	+	Silent	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr9:33464968G>A	ENST00000379471.2	-	21	2775	c.2688C>T	c.(2686-2688)ccC>ccT	p.P896P	NOL6_ENST00000455041.2_Silent_p.P844P|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	896					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AGCCAACCTGGGGGGAACTAA	0.507																																						dbGAP											0													50.0	55.0	53.0					9																	33464968		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.2688C>T	9.37:g.33464968G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	pfam_Nrap	p.P896	ENST00000379471.2	37	c.2688		9																																																																																			NOL6	-	pfam_Nrap	ENSG00000165271		0.507	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	NOL6	HGNC	protein_coding	OTTHUMT00000001019.2	52	0.00	0	G	NM_022917		33464968	33464968	-1	no_errors	ENST00000297990	ensembl	human	known	69_37n	silent	48	26.15	17	SNP	0.921	A
NPPA	4878	genome.wustl.edu	37	1	11907684	11907684	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:11907684G>C	ENST00000376480.3	-	1	156	c.58C>G	c.(58-60)Cta>Gta	p.L20V	NPPA-AS1_ENST00000446542.1_RNA|NPPA_ENST00000376476.1_Intron|NPPA-AS1_ENST00000400892.2_RNA	NM_006172.3	NP_006163.1	P01160	ANF_HUMAN	natriuretic peptide A	20					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to mechanical stimulus (GO:0071260)|cGMP biosynthetic process (GO:0006182)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|negative regulation of cell growth (GO:0030308)|negative regulation of systemic arterial blood pressure (GO:0003085)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTCTGACCTAGGAGCTGGAAT	0.562																																						dbGAP											0													222.0	192.0	202.0					1																	11907684		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005893	CCDS139.1	1p36.21	2014-09-17	2010-11-09		ENSG00000175206	ENSG00000175206		"""Endogenous ligands"""	7939	protein-coding gene	gene with protein product		108780	"""natriuretic peptide precursor A"""	ANP, PND			Standard	NM_006172		Approved		uc001ati.3	P01160	OTTHUMG00000002388	ENST00000376480.3:c.58C>G	1.37:g.11907684G>C	ENSP00000365663:p.Leu20Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13766|Q5JZE1	Missense_Mutation	SNP	pfam_Natr_peptide,smart_Natr_peptide,prints_Natriuretic_peptide_atrial,prints_Natr_peptide	p.L20V	ENST00000376480.3	37	c.58	CCDS139.1	1	.	.	.	.	.	.	.	.	.	.	G	3.791	-0.043667	0.07452	.	.	ENSG00000175206	ENST00000376480	T	0.42131	0.98	5.57	4.66	0.58398	.	0.516357	0.18994	N	0.125530	T	0.33000	0.0848	L	0.36672	1.1	0.27669	N	0.946837	B	0.11235	0.004	B	0.12837	0.008	T	0.19095	-1.0316	10	0.38643	T	0.18	-0.1506	10.5698	0.45194	0.0891:0.0:0.9109:0.0	.	20	P01160	ANF_HUMAN	V	20	ENSP00000365663:L20V	ENSP00000365663:L20V	L	-	1	2	NPPA	11830271	1.000000	0.71417	0.010000	0.14722	0.043000	0.13939	1.825000	0.39081	1.351000	0.45789	0.491000	0.48974	CTA	NPPA	-	prints_Natriuretic_peptide_atrial	ENSG00000175206		0.562	NPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPPA	HGNC	protein_coding	OTTHUMT00000006852.1	108	0.00	0	G	NM_006172		11907684	11907684	-1	no_errors	ENST00000376480	ensembl	human	known	69_37n	missense	55	19.12	13	SNP	0.123	C
ONECUT2	9480	genome.wustl.edu	37	18	55143875	55143875	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr18:55143875C>T	ENST00000491143.2	+	2	1467	c.1435C>T	c.(1435-1437)Cgc>Tgc	p.R479C		NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	479					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GAACGCCCGGCGCCGCAGCCT	0.582																																						dbGAP											0													40.0	46.0	44.0					18																	55143875		2071	4237	6308	-	-	-	SO:0001583	missense	0			Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1435C>T	18.37:g.55143875C>T	ENSP00000419185:p.Arg479Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.R479C	ENST00000491143.2	37	c.1435	CCDS42440.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.004712|4.004712	0.74932|0.74932	.|.	.|.	ENSG00000119547|ENSG00000119547	ENST00000481727|ENST00000491143;ENST00000262095	.|.	.|.	.|.	6.02|6.02	4.14|4.14	0.48551|0.48551	.|Homeobox (3);Homeodomain-like (1);	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.74023|0.74023	0.3662|0.3662	M|M	0.93241|0.93241	3.395|3.395	0.80722|0.80722	D|D	1|1	.|P	.|0.47962	.|0.903	.|P	.|0.47430	.|0.547	T|T	0.79999|0.79999	-0.1566|-0.1566	5|9	.|0.87932	.|D	.|0	-21.0285|-21.0285	9.4953|9.4953	0.38984|0.38984	0.2309:0.6999:0.0:0.0692|0.2309:0.6999:0.0:0.0692	.|.	.|479	.|O95948	.|ONEC2_HUMAN	V|C	107|460;479	.|.	.|ENSP00000262095:R479C	A|R	+|+	2|1	0|0	ONECUT2|ONECUT2	53294873|53294873	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.750000|1.750000	0.38329|0.38329	1.557000|1.557000	0.49525|0.49525	0.650000|0.650000	0.86243|0.86243	GCG|CGC	ONECUT2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000119547		0.582	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT2	HGNC	protein_coding	OTTHUMT00000357264.3	91	0.00	0	C			55143875	55143875	+1	no_errors	ENST00000262095	ensembl	human	known	69_37n	missense	51	26.09	18	SNP	1.000	T
ONECUT2	9480	genome.wustl.edu	37	18	55143875	55143875	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr18:55143875C>T	ENST00000491143.2	+	2	1467	c.1435C>T	c.(1435-1437)Cgc>Tgc	p.R479C		NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	479					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GAACGCCCGGCGCCGCAGCCT	0.582																																						dbGAP											0													40.0	46.0	44.0					18																	55143875		2071	4237	6308	-	-	-	SO:0001583	missense	0			Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1435C>T	18.37:g.55143875C>T	ENSP00000419185:p.Arg479Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.R479C	ENST00000491143.2	37	c.1435	CCDS42440.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.004712|4.004712	0.74932|0.74932	.|.	.|.	ENSG00000119547|ENSG00000119547	ENST00000481727|ENST00000491143;ENST00000262095	.|.	.|.	.|.	6.02|6.02	4.14|4.14	0.48551|0.48551	.|Homeobox (3);Homeodomain-like (1);	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.74023|0.74023	0.3662|0.3662	M|M	0.93241|0.93241	3.395|3.395	0.80722|0.80722	D|D	1|1	.|P	.|0.47962	.|0.903	.|P	.|0.47430	.|0.547	T|T	0.79999|0.79999	-0.1566|-0.1566	5|9	.|0.87932	.|D	.|0	-21.0285|-21.0285	9.4953|9.4953	0.38984|0.38984	0.2309:0.6999:0.0:0.0692|0.2309:0.6999:0.0:0.0692	.|.	.|479	.|O95948	.|ONEC2_HUMAN	V|C	107|460;479	.|.	.|ENSP00000262095:R479C	A|R	+|+	2|1	0|0	ONECUT2|ONECUT2	53294873|53294873	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.750000|1.750000	0.38329|0.38329	1.557000|1.557000	0.49525|0.49525	0.650000|0.650000	0.86243|0.86243	GCG|CGC	ONECUT2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000119547		0.582	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT2	HGNC	protein_coding	OTTHUMT00000357264.3	82	0.00	0	C			55143875	55143875	+1	no_errors	ENST00000262095	ensembl	human	known	69_37n	missense	51	26.09	18	SNP	1.000	T
OR2T3	343173	genome.wustl.edu	37	1	248637179	248637179	+	Silent	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:248637179T>A	ENST00000359594.2	+	1	553	c.528T>A	c.(526-528)tcT>tcA	p.S176S		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTTGCCAGTCTAGGAAAATCC	0.527																																						dbGAP											0													45.0	41.0	43.0					1																	248637179		2161	4257	6418	-	-	-	SO:0001819	synonymous_variant	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.528T>A	1.37:g.248637179T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S176	ENST00000359594.2	37	c.528	CCDS31117.1	1																																																																																			OR2T3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196539		0.527	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	338	0.00	0	T	NM_001005495		248637179	248637179	+1	no_errors	ENST00000359594	ensembl	human	known	69_37n	silent	343	43.72	268	SNP	0.000	A
OR2T3	343173	genome.wustl.edu	37	1	248637179	248637179	+	Silent	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:248637179T>A	ENST00000359594.2	+	1	553	c.528T>A	c.(526-528)tcT>tcA	p.S176S		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTTGCCAGTCTAGGAAAATCC	0.527																																						dbGAP											0													45.0	41.0	43.0					1																	248637179		2161	4257	6418	-	-	-	SO:0001819	synonymous_variant	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.528T>A	1.37:g.248637179T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S176	ENST00000359594.2	37	c.528	CCDS31117.1	1																																																																																			OR2T3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196539		0.527	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	462	0.00	0	T	NM_001005495		248637179	248637179	+1	no_errors	ENST00000359594	ensembl	human	known	69_37n	silent	343	43.72	268	SNP	0.000	A
OR2G6	391211	genome.wustl.edu	37	1	248685865	248685865	+	Silent	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:248685865G>T	ENST00000343414.4	+	1	950	c.918G>T	c.(916-918)ctG>ctT	p.L306L		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTGATACTGGGTAGTGCTG	0.463																																						dbGAP											0													42.0	42.0	42.0					1																	248685865		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.918G>T	1.37:g.248685865G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP33	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L306	ENST00000343414.4	37	c.918	CCDS31119.1	1																																																																																			OR2G6	-	NULL	ENSG00000188558		0.463	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	HGNC	protein_coding	OTTHUMT00000097358.1	175	0.00	0	G	XM_372842		248685865	248685865	+1	no_errors	ENST00000343414	ensembl	human	known	69_37n	silent	255	36.88	149	SNP	0.000	T
OR2G6	391211	genome.wustl.edu	37	1	248685865	248685865	+	Silent	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:248685865G>T	ENST00000343414.4	+	1	950	c.918G>T	c.(916-918)ctG>ctT	p.L306L		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTGATACTGGGTAGTGCTG	0.463																																						dbGAP											0													42.0	42.0	42.0					1																	248685865		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.918G>T	1.37:g.248685865G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP33	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L306	ENST00000343414.4	37	c.918	CCDS31119.1	1																																																																																			OR2G6	-	NULL	ENSG00000188558		0.463	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	HGNC	protein_coding	OTTHUMT00000097358.1	287	0.00	0	G	XM_372842		248685865	248685865	+1	no_errors	ENST00000343414	ensembl	human	known	69_37n	silent	255	36.88	149	SNP	0.000	T
OR5T1	390155	genome.wustl.edu	37	11	56043581	56043581	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:56043581T>A	ENST00000313033.2	+	1	553	c.467T>A	c.(466-468)cTc>cAc	p.L156H		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TATGTGCCACTCATCACTGCT	0.443																																						dbGAP											0													275.0	235.0	248.0					11																	56043581		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.467T>A	11.37:g.56043581T>A	ENSP00000323612:p.Leu156His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNM9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L156H	ENST00000313033.2	37	c.467	CCDS31525.1	11	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024959	0.54683	.	.	ENSG00000181698	ENST00000313033	T	0.45668	0.89	3.44	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45606	D	0.000347	T	0.74831	0.3768	H	0.97783	4.075	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70378	-0.4888	10	0.87932	D	0	.	11.2384	0.48955	0.0:0.0:0.0:1.0	.	156	Q8NG75	OR5T1_HUMAN	H	156	ENSP00000323612:L156H	ENSP00000323612:L156H	L	+	2	0	OR5T1	55800157	0.174000	0.23070	0.100000	0.21137	0.397000	0.30659	3.315000	0.51951	1.583000	0.49898	0.381000	0.24937	CTC	OR5T1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181698		0.443	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1	1330	0.00	0	T	NM_001004745		56043581	56043581	+1	no_errors	ENST00000313033	ensembl	human	known	69_37n	missense	356	33.89	183	SNP	0.005	A
OR5T1	390155	genome.wustl.edu	37	11	56043581	56043581	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:56043581T>A	ENST00000313033.2	+	1	553	c.467T>A	c.(466-468)cTc>cAc	p.L156H		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TATGTGCCACTCATCACTGCT	0.443																																						dbGAP											0													275.0	235.0	248.0					11																	56043581		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.467T>A	11.37:g.56043581T>A	ENSP00000323612:p.Leu156His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNM9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L156H	ENST00000313033.2	37	c.467	CCDS31525.1	11	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024959	0.54683	.	.	ENSG00000181698	ENST00000313033	T	0.45668	0.89	3.44	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45606	D	0.000347	T	0.74831	0.3768	H	0.97783	4.075	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70378	-0.4888	10	0.87932	D	0	.	11.2384	0.48955	0.0:0.0:0.0:1.0	.	156	Q8NG75	OR5T1_HUMAN	H	156	ENSP00000323612:L156H	ENSP00000323612:L156H	L	+	2	0	OR5T1	55800157	0.174000	0.23070	0.100000	0.21137	0.397000	0.30659	3.315000	0.51951	1.583000	0.49898	0.381000	0.24937	CTC	OR5T1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181698		0.443	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1	1082	0.00	0	T	NM_001004745		56043581	56043581	+1	no_errors	ENST00000313033	ensembl	human	known	69_37n	missense	356	33.89	183	SNP	0.005	A
PABPC4	8761	genome.wustl.edu	37	1	40028015	40028016	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:40028015_40028016insG	ENST00000372857.3	-	13	2485_2486	c.1693_1694insC	c.(1693-1695)cagfs	p.Q565fs	PABPC4_ENST00000372862.3_Frame_Shift_Ins_p.Q536fs|PABPC4_ENST00000372858.3_Frame_Shift_Ins_p.Q581fs|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372856.3_Frame_Shift_Ins_p.Q552fs	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	565	PABC. {ECO:0000255|PROSITE- ProRule:PRU00641}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CTTCTGTTCCTGGGGGGGTGCT	0.604																																						dbGAP											0									,,	14,4250		0,14,2118					,,	5.4	1.0			53	20,8234		0,20,4107	no	frameshift,frameshift,frameshift	PABPC4	NM_003819.3,NM_001135654.1,NM_001135653.1	,,	0,34,6225	A1A1,A1R,RR		0.2423,0.3283,0.2716	,,	,,		34,12484				-	-	-	SO:0001589	frameshift_variant	0			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1694dupC	1.37:g.40028022_40028022dupG	ENSP00000361948:p.Gln565fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANQ8|Q4VC03|Q6P0N3	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.Q581fs	ENST00000372857.3	37	c.1742_1741	CCDS438.1	1																																																																																			PABPC4	-	pfam_PABP_HYD,superfamily_PABP_HYD,smart_PABP_HYD,tigrfam_PABP_1234	ENSG00000090621		0.604	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	HGNC	protein_coding	OTTHUMT00000025220.1	48	0.00	0	-	NM_001135653		40028015	40028016	-1	no_errors	ENST00000372858	ensembl	human	known	69_37n	frame_shift_ins	39	11.36	5	INS	1.000:1.000	G
OR6K6	128371	genome.wustl.edu	37	1	158724637	158724637	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:158724637C>G	ENST00000368144.2	+	1	128	c.32C>G	c.(31-33)tCc>tGc	p.S11C		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					AATCAACATTCCAATTATAGG	0.393																																						dbGAP											0													138.0	141.0	140.0					1																	158724637		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.32C>G	1.37:g.158724637C>G	ENSP00000357126:p.Ser11Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S11C	ENST00000368144.2	37	c.32	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	C	9.175	1.022159	0.19433	.	.	ENSG00000180433	ENST00000368144	T	0.00318	8.12	4.7	-3.16	0.05217	.	.	.	.	.	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	P	0.40619	0.724	B	0.37731	0.257	T	0.07501	-1.0769	9	0.42905	T	0.14	.	2.5719	0.04797	0.1162:0.3161:0.12:0.4477	.	11	Q8NGW6	OR6K6_HUMAN	C	11	ENSP00000357126:S11C	ENSP00000357126:S11C	S	+	2	0	OR6K6	156991261	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.217000	0.02979	-0.936000	0.03723	-0.768000	0.03414	TCC	OR6K6	-	NULL	ENSG00000180433		0.393	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	389	0.00	0	C	NM_001005184		158724637	158724637	+1	no_errors	ENST00000368144	ensembl	human	known	69_37n	missense	409	31.38	187	SNP	0.000	G
OR6K6	128371	genome.wustl.edu	37	1	158724637	158724637	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:158724637C>G	ENST00000368144.2	+	1	128	c.32C>G	c.(31-33)tCc>tGc	p.S11C		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					AATCAACATTCCAATTATAGG	0.393																																						dbGAP											0													138.0	141.0	140.0					1																	158724637		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.32C>G	1.37:g.158724637C>G	ENSP00000357126:p.Ser11Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S11C	ENST00000368144.2	37	c.32	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	C	9.175	1.022159	0.19433	.	.	ENSG00000180433	ENST00000368144	T	0.00318	8.12	4.7	-3.16	0.05217	.	.	.	.	.	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	P	0.40619	0.724	B	0.37731	0.257	T	0.07501	-1.0769	9	0.42905	T	0.14	.	2.5719	0.04797	0.1162:0.3161:0.12:0.4477	.	11	Q8NGW6	OR6K6_HUMAN	C	11	ENSP00000357126:S11C	ENSP00000357126:S11C	S	+	2	0	OR6K6	156991261	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.217000	0.02979	-0.936000	0.03723	-0.768000	0.03414	TCC	OR6K6	-	NULL	ENSG00000180433		0.393	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	554	0.00	0	C	NM_001005184		158724637	158724637	+1	no_errors	ENST00000368144	ensembl	human	known	69_37n	missense	409	31.38	187	SNP	0.000	G
PCDHB2	56133	genome.wustl.edu	37	5	140476160	140476160	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr5:140476160G>A	ENST00000194155.4	+	1	1934	c.1786G>A	c.(1786-1788)Ggc>Agc	p.G596S		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	596	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGGTGGACGGCGACTCGGG	0.726																																						dbGAP											0													11.0	13.0	12.0					5																	140476160		1818	3658	5476	-	-	-	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1786G>A	5.37:g.140476160G>A	ENSP00000194155:p.Gly596Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G596S	ENST00000194155.4	37	c.1786	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468385	0.43839	.	.	ENSG00000112852	ENST00000194155	T	0.48201	0.82	4.5	2.6	0.31112	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35158	0.0922	L	0.33624	1.015	0.26937	N	0.966325	B	0.25441	0.126	B	0.18871	0.023	T	0.24225	-1.0166	9	0.48119	T	0.1	.	9.8738	0.41191	0.0834:0.1467:0.77:0.0	.	596	Q9Y5E7	PCDB2_HUMAN	S	596	ENSP00000194155:G596S	ENSP00000194155:G596S	G	+	1	0	PCDHB2	140456344	0.018000	0.18449	1.000000	0.80357	0.997000	0.91878	1.930000	0.40124	0.975000	0.38392	0.556000	0.70494	GGC	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.726	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	68	0.00	0	G	NM_018936		140476160	140476160	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	missense	11	15.38	2	SNP	0.997	A
PFKP	5214	genome.wustl.edu	37	10	3172105	3172106	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr10:3172105_3172106insG	ENST00000381125.4	+	17	1854_1855	c.1778_1779insG	c.(1777-1782)atggggfs	p.MG593fs	PFKP_ENST00000381075.2_Frame_Shift_Ins_p.MG585fs|PFKP_ENST00000381072.1_Frame_Shift_Ins_p.MG11fs	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	593	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		CTGGCCAACATGGGGGGGCTCG	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.1785dupG	10.37:g.3172112_3172112dupG	ENSP00000370517:p.Met593fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS15|Q5VSR7|Q5VSR8	Frame_Shift_Ins	INS	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.L596fs	ENST00000381125.4	37	c.1778_1779	CCDS7059.1	10																																																																																			PFKP	-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000067057		0.639	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKP	HGNC	protein_coding	OTTHUMT00000046454.1	23	0.00	0	-	NM_002627		3172105	3172106	+1	no_errors	ENST00000381125	ensembl	human	known	69_37n	frame_shift_ins	18	14.29	3	INS	1.000:1.000	G
PHLDB1	23187	genome.wustl.edu	37	11	118498674	118498674	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:118498674C>T	ENST00000361417.2	+	7	1546	c.1135C>T	c.(1135-1137)Cct>Tct	p.P379S	PHLDB1_ENST00000356063.5_Missense_Mutation_p.P379S	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	379										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CACCAGCATTCCTGGCAGCCC	0.632																																						dbGAP											0													82.0	79.0	80.0					11																	118498674		2200	4295	6495	-	-	-	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1135C>T	11.37:g.118498674C>T	ENSP00000354498:p.Pro379Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P379S	ENST00000361417.2	37	c.1135	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	C	10.34	1.323285	0.24080	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000356063	T;T	0.31510	1.52;1.49	4.81	3.9	0.45041	.	0.460663	0.20662	N	0.088005	T	0.25901	0.0631	L	0.40543	1.245	0.80722	D	1	B;B;B	0.20988	0.05;0.034;0.01	B;B;B	0.19391	0.019;0.025;0.003	T	0.04825	-1.0924	10	0.36615	T	0.2	-8.3926	12.3708	0.55254	0.0:0.9164:0.0:0.0836	.	379;379;379	Q86UU1-3;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	S	379;138;379	ENSP00000354498:P379S;ENSP00000348359:P379S	ENSP00000348359:P379S	P	+	1	0	PHLDB1	118003884	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	2.865000	0.48412	1.397000	0.46682	0.563000	0.77884	CCT	PHLDB1	-	NULL	ENSG00000019144		0.632	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	306	0.00	0	C	NM_015157		118498674	118498674	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	missense	17	73.02	46	SNP	1.000	T
PHLDB1	23187	genome.wustl.edu	37	11	118498674	118498674	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:118498674C>T	ENST00000361417.2	+	7	1546	c.1135C>T	c.(1135-1137)Cct>Tct	p.P379S	PHLDB1_ENST00000356063.5_Missense_Mutation_p.P379S	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	379										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CACCAGCATTCCTGGCAGCCC	0.632																																						dbGAP											0													82.0	79.0	80.0					11																	118498674		2200	4295	6495	-	-	-	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1135C>T	11.37:g.118498674C>T	ENSP00000354498:p.Pro379Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P379S	ENST00000361417.2	37	c.1135	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	C	10.34	1.323285	0.24080	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000356063	T;T	0.31510	1.52;1.49	4.81	3.9	0.45041	.	0.460663	0.20662	N	0.088005	T	0.25901	0.0631	L	0.40543	1.245	0.80722	D	1	B;B;B	0.20988	0.05;0.034;0.01	B;B;B	0.19391	0.019;0.025;0.003	T	0.04825	-1.0924	10	0.36615	T	0.2	-8.3926	12.3708	0.55254	0.0:0.9164:0.0:0.0836	.	379;379;379	Q86UU1-3;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	S	379;138;379	ENSP00000354498:P379S;ENSP00000348359:P379S	ENSP00000348359:P379S	P	+	1	0	PHLDB1	118003884	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	2.865000	0.48412	1.397000	0.46682	0.563000	0.77884	CCT	PHLDB1	-	NULL	ENSG00000019144		0.632	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	46	0.00	0	C	NM_015157		118498674	118498674	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	missense	17	73.02	46	SNP	1.000	T
PIGG	54872	genome.wustl.edu	37	4	502620	502620	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr4:502620G>C	ENST00000453061.2	+	5	868	c.762G>C	c.(760-762)gaG>gaC	p.E254D	PIGG_ENST00000509768.1_Missense_Mutation_p.E165D|PIGG_ENST00000383028.4_Missense_Mutation_p.E121D|PIGG_ENST00000503111.1_Missense_Mutation_p.E165D|PIGG_ENST00000296306.7_Missense_Mutation_p.E165D|PIGG_ENST00000536264.1_Missense_Mutation_p.E132D|PIGG_ENST00000504346.1_Missense_Mutation_p.E165D|PIGG_ENST00000310340.5_Missense_Mutation_p.E254D	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	254					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						CCTTAAAGGAGAGAGAGACGC	0.443																																						dbGAP											0													150.0	137.0	141.0					4																	502620		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.762G>C	4.37:g.502620G>C	ENSP00000415203:p.Glu254Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.E254D	ENST00000453061.2	37	c.762	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	G	5.025	0.190264	0.09547	.	.	ENSG00000174227	ENST00000296306;ENST00000536264;ENST00000310340;ENST00000453061;ENST00000504346;ENST00000503111;ENST00000383028;ENST00000509768	T;T;T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67;-0.67;2.92;-0.67	5.63	0.832	0.18867	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.047588	0.85682	N	0.000000	T	0.39064	0.1064	N	0.11427	0.14	0.40405	D	0.97968	B;B;B;B;B;B	0.28026	0.0;0.198;0.001;0.001;0.017;0.008	B;B;B;B;B;B	0.25140	0.007;0.057;0.007;0.002;0.058;0.019	T	0.29761	-1.0001	10	0.05833	T	0.94	.	4.8886	0.13715	0.3909:0.1561:0.453:0.0	.	132;121;165;165;254;254	B4DKC7;Q5H8A4-3;D6RFE8;Q5H8A4-5;Q5H8A4;Q5H8A4-2	.;.;.;.;PIGG_HUMAN;.	D	165;132;254;254;165;165;121;165	ENSP00000296306:E165D;ENSP00000439240:E132D;ENSP00000311750:E254D;ENSP00000415203:E254D;ENSP00000424800:E165D;ENSP00000426002:E165D;ENSP00000372494:E121D;ENSP00000421550:E165D	ENSP00000296306:E165D	E	+	3	2	PIGG	492620	1.000000	0.71417	0.937000	0.37676	0.168000	0.22595	1.352000	0.34033	0.314000	0.23086	0.655000	0.94253	GAG	PIGG	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000174227		0.443	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	HGNC	protein_coding	OTTHUMT00000357494.1	342	0.00	0	G	NM_017733		502620	502620	+1	no_errors	ENST00000453061	ensembl	human	known	69_37n	missense	132	29.03	54	SNP	0.933	C
PIGG	54872	genome.wustl.edu	37	4	502620	502620	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr4:502620G>C	ENST00000453061.2	+	5	868	c.762G>C	c.(760-762)gaG>gaC	p.E254D	PIGG_ENST00000509768.1_Missense_Mutation_p.E165D|PIGG_ENST00000383028.4_Missense_Mutation_p.E121D|PIGG_ENST00000503111.1_Missense_Mutation_p.E165D|PIGG_ENST00000296306.7_Missense_Mutation_p.E165D|PIGG_ENST00000536264.1_Missense_Mutation_p.E132D|PIGG_ENST00000504346.1_Missense_Mutation_p.E165D|PIGG_ENST00000310340.5_Missense_Mutation_p.E254D	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	254					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						CCTTAAAGGAGAGAGAGACGC	0.443																																						dbGAP											0													150.0	137.0	141.0					4																	502620		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.762G>C	4.37:g.502620G>C	ENSP00000415203:p.Glu254Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.E254D	ENST00000453061.2	37	c.762	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	G	5.025	0.190264	0.09547	.	.	ENSG00000174227	ENST00000296306;ENST00000536264;ENST00000310340;ENST00000453061;ENST00000504346;ENST00000503111;ENST00000383028;ENST00000509768	T;T;T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67;-0.67;2.92;-0.67	5.63	0.832	0.18867	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.047588	0.85682	N	0.000000	T	0.39064	0.1064	N	0.11427	0.14	0.40405	D	0.97968	B;B;B;B;B;B	0.28026	0.0;0.198;0.001;0.001;0.017;0.008	B;B;B;B;B;B	0.25140	0.007;0.057;0.007;0.002;0.058;0.019	T	0.29761	-1.0001	10	0.05833	T	0.94	.	4.8886	0.13715	0.3909:0.1561:0.453:0.0	.	132;121;165;165;254;254	B4DKC7;Q5H8A4-3;D6RFE8;Q5H8A4-5;Q5H8A4;Q5H8A4-2	.;.;.;.;PIGG_HUMAN;.	D	165;132;254;254;165;165;121;165	ENSP00000296306:E165D;ENSP00000439240:E132D;ENSP00000311750:E254D;ENSP00000415203:E254D;ENSP00000424800:E165D;ENSP00000426002:E165D;ENSP00000372494:E121D;ENSP00000421550:E165D	ENSP00000296306:E165D	E	+	3	2	PIGG	492620	1.000000	0.71417	0.937000	0.37676	0.168000	0.22595	1.352000	0.34033	0.314000	0.23086	0.655000	0.94253	GAG	PIGG	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000174227		0.443	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	HGNC	protein_coding	OTTHUMT00000357494.1	82	0.00	0	G	NM_017733		502620	502620	+1	no_errors	ENST00000453061	ensembl	human	known	69_37n	missense	132	29.03	54	SNP	0.933	C
PIK3C2G	5288	genome.wustl.edu	37	12	18644449	18644449	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr12:18644449T>A	ENST00000266497.5	+	18	2665	c.2627T>A	c.(2626-2628)cTt>cAt	p.L876H	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.L876H|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.L917H			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	876					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ACTTGTCATCTTCCTCTGAAC	0.328																																						dbGAP											0													112.0	107.0	109.0					12																	18644449		1852	4078	5930	-	-	-	SO:0001583	missense	0			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.2627T>A	12.37:g.18644449T>A	ENSP00000266497:p.Leu876His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U0	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.L917H	ENST00000266497.5	37	c.2750	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	T	19.58	3.854240	0.71719	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	D;D;D	0.82984	-1.67;-1.67;-1.67	5.1	3.98	0.46160	Protein kinase-like domain (1);	0.316475	0.25490	N	0.030311	D	0.90549	0.7038	M	0.87180	2.865	0.53005	D	0.999969	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90934	0.4792	10	0.87932	D	0	-14.7529	8.6773	0.34187	0.0:0.0875:0.0:0.9125	.	916;917;876	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	H	876;876;917	ENSP00000404845:L876H;ENSP00000266497:L876H;ENSP00000445381:L917H	ENSP00000266497:L876H	L	+	2	0	PIK3C2G	18535716	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.960000	0.63673	2.212000	0.71576	0.533000	0.62120	CTT	PIK3C2G	-	superfamily_Kinase-like_dom	ENSG00000139144		0.328	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	339	0.29	1	T	NM_004570		18644449	18644449	+1	no_errors	ENST00000538779	ensembl	human	known	69_37n	missense	249	20.63	65	SNP	0.998	A
PIK3C2G	5288	genome.wustl.edu	37	12	18644449	18644449	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr12:18644449T>A	ENST00000266497.5	+	18	2665	c.2627T>A	c.(2626-2628)cTt>cAt	p.L876H	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.L876H|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.L917H			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	876					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ACTTGTCATCTTCCTCTGAAC	0.328																																						dbGAP											0													112.0	107.0	109.0					12																	18644449		1852	4078	5930	-	-	-	SO:0001583	missense	0			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.2627T>A	12.37:g.18644449T>A	ENSP00000266497:p.Leu876His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U0	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.L917H	ENST00000266497.5	37	c.2750	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	T	19.58	3.854240	0.71719	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	D;D;D	0.82984	-1.67;-1.67;-1.67	5.1	3.98	0.46160	Protein kinase-like domain (1);	0.316475	0.25490	N	0.030311	D	0.90549	0.7038	M	0.87180	2.865	0.53005	D	0.999969	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90934	0.4792	10	0.87932	D	0	-14.7529	8.6773	0.34187	0.0:0.0875:0.0:0.9125	.	916;917;876	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	H	876;876;917	ENSP00000404845:L876H;ENSP00000266497:L876H;ENSP00000445381:L917H	ENSP00000266497:L876H	L	+	2	0	PIK3C2G	18535716	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.960000	0.63673	2.212000	0.71576	0.533000	0.62120	CTT	PIK3C2G	-	superfamily_Kinase-like_dom	ENSG00000139144		0.328	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	273	0.36	1	T	NM_004570		18644449	18644449	+1	no_errors	ENST00000538779	ensembl	human	known	69_37n	missense	249	20.63	65	SNP	0.998	A
PRKAG2	51422	genome.wustl.edu	37	7	151265913	151265913	+	Silent	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:151265913T>C	ENST00000287878.4	-	11	1626	c.1122A>G	c.(1120-1122)gtA>gtG	p.V374V	PRKAG2_ENST00000392801.2_Silent_p.V330V|PRKAG2_ENST00000418337.2_Silent_p.V133V|PRKAG2_ENST00000492843.1_Silent_p.V250V|PRKAG2_ENST00000433631.2_Silent_p.V249V	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	374	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TCAAGGAGTATACAGCATCGA	0.413																																						dbGAP											0													102.0	100.0	101.0					7																	151265913		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.1122A>G	7.37:g.151265913T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Silent	SNP	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	p.V374	ENST00000287878.4	37	c.1122	CCDS5928.1	7																																																																																			PRKAG2	-	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	ENSG00000106617		0.413	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAG2	HGNC	protein_coding	OTTHUMT00000348440.2	130	0.00	0	T	NM_016203		151265913	151265913	-1	no_errors	ENST00000287878	ensembl	human	known	69_37n	silent	143	16.37	28	SNP	0.995	C
PRKAG2	51422	genome.wustl.edu	37	7	151265913	151265913	+	Silent	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:151265913T>C	ENST00000287878.4	-	11	1626	c.1122A>G	c.(1120-1122)gtA>gtG	p.V374V	PRKAG2_ENST00000392801.2_Silent_p.V330V|PRKAG2_ENST00000418337.2_Silent_p.V133V|PRKAG2_ENST00000492843.1_Silent_p.V250V|PRKAG2_ENST00000433631.2_Silent_p.V249V	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	374	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TCAAGGAGTATACAGCATCGA	0.413																																						dbGAP											0													102.0	100.0	101.0					7																	151265913		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.1122A>G	7.37:g.151265913T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Silent	SNP	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	p.V374	ENST00000287878.4	37	c.1122	CCDS5928.1	7																																																																																			PRKAG2	-	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	ENSG00000106617		0.413	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAG2	HGNC	protein_coding	OTTHUMT00000348440.2	102	0.00	0	T	NM_016203		151265913	151265913	-1	no_errors	ENST00000287878	ensembl	human	known	69_37n	silent	143	16.37	28	SNP	0.995	C
PTGDS	5730	genome.wustl.edu	37	9	139875223	139875224	+	Intron	DEL	CA	CA	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr9:139875223_139875224delCA	ENST00000371625.3	+	6	624				PTGDS_ENST00000224167.2_Intron|LCNL1_ENST00000408973.2_5'Flank	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)						arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACAGGAAGCCCAGTGGGAAAAT	0.554																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.551-61CA>-	9.37:g.139875223_139875224delCA		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Frame_Shift_Del	DEL	NULL	p.P41fs	ENST00000371625.3	37	c.122_123	CCDS7019.1	9																																																																																			PTGDS	-	NULL	ENSG00000107317		0.554	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDS	HGNC	protein_coding	OTTHUMT00000055188.1	23	0.00	0	CA	NM_000954		139875223	139875224	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444903	ensembl	human	known	69_37n	frame_shift_del	7	36.36	4	DEL	0.000:0.000	-
PTPRZ1	5803	genome.wustl.edu	37	7	121695092	121695092	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:121695092C>G	ENST00000393386.2	+	27	6890	c.6479C>G	c.(6478-6480)tCt>tGt	p.S2160C	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.S1293C	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2160	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AAATGTCTATCTAATGAGGAA	0.323																																						dbGAP											0													83.0	86.0	85.0					7																	121695092		2203	4299	6502	-	-	-	SO:0001583	missense	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6479C>G	7.37:g.121695092C>G	ENSP00000377047:p.Ser2160Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a	p.S2160C	ENST00000393386.2	37	c.6479	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255037	0.80135	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	D;D	0.84223	-1.82;-1.82	5.96	5.96	0.96718	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.165233	0.43260	D	0.000592	D	0.92466	0.7608	M	0.71581	2.175	0.58432	D	0.999993	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.939;0.974;0.999	D	0.92308	0.5855	10	0.87932	D	0	.	20.4019	0.98996	0.0:1.0:0.0:0.0	.	1299;1293;2160	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	C	2160;1293	ENSP00000377047:S2160C;ENSP00000410000:S1293C	ENSP00000377047:S2160C	S	+	2	0	PTPRZ1	121482328	1.000000	0.71417	0.960000	0.40013	0.958000	0.62258	6.040000	0.70980	2.815000	0.96918	0.650000	0.86243	TCT	PTPRZ1	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000106278		0.323	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	204	0.00	0	C	NM_002851		121695092	121695092	+1	no_errors	ENST00000393386	ensembl	human	known	69_37n	missense	353	17.91	77	SNP	0.998	G
PTPRZ1	5803	genome.wustl.edu	37	7	121695092	121695092	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:121695092C>G	ENST00000393386.2	+	27	6890	c.6479C>G	c.(6478-6480)tCt>tGt	p.S2160C	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.S1293C	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2160	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AAATGTCTATCTAATGAGGAA	0.323																																						dbGAP											0													83.0	86.0	85.0					7																	121695092		2203	4299	6502	-	-	-	SO:0001583	missense	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6479C>G	7.37:g.121695092C>G	ENSP00000377047:p.Ser2160Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a	p.S2160C	ENST00000393386.2	37	c.6479	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255037	0.80135	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	D;D	0.84223	-1.82;-1.82	5.96	5.96	0.96718	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.165233	0.43260	D	0.000592	D	0.92466	0.7608	M	0.71581	2.175	0.58432	D	0.999993	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.939;0.974;0.999	D	0.92308	0.5855	10	0.87932	D	0	.	20.4019	0.98996	0.0:1.0:0.0:0.0	.	1299;1293;2160	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	C	2160;1293	ENSP00000377047:S2160C;ENSP00000410000:S1293C	ENSP00000377047:S2160C	S	+	2	0	PTPRZ1	121482328	1.000000	0.71417	0.960000	0.40013	0.958000	0.62258	6.040000	0.70980	2.815000	0.96918	0.650000	0.86243	TCT	PTPRZ1	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000106278		0.323	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	541	0.18	1	C	NM_002851		121695092	121695092	+1	no_errors	ENST00000393386	ensembl	human	known	69_37n	missense	353	17.91	77	SNP	0.998	G
QPCTL	54814	genome.wustl.edu	37	19	46196814	46196814	+	Splice_Site	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:46196814G>A	ENST00000012049.5	+	2	572	c.351G>A	c.(349-351)aaG>aaA	p.K117K	SNRPD2_ENST00000585392.1_5'Flank|SNRPD2_ENST00000342669.3_5'Flank|SNRPD2_ENST00000587579.1_5'Flank|SNRPD2_ENST00000588599.1_5'Flank|SNRPD2_ENST00000391932.3_5'Flank|QPCTL_ENST00000366382.4_Splice_Site_p.K117K|SNRPD2_ENST00000587367.1_5'Flank|SNRPD2_ENST00000588301.1_5'Flank|SNRPD2_ENST00000590212.1_5'Flank	NM_017659.3	NP_060129.2	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like	117					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(1)|lung(5)|skin(1)|stomach(1)	11		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		AAGTCAGAAAGGTAAAGGGAC	0.567											OREG0025560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													63.0	71.0	68.0					19																	46196814		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK000091	CCDS12672.1, CCDS54282.1	19q13.32	2014-09-04			ENSG00000011478	ENSG00000011478			25952	protein-coding gene	gene with protein product	"""glutaminyl cyclase-like"""						Standard	NM_017659		Approved	FLJ20084	uc010xxr.2	Q9NXS2	OTTHUMG00000182131	ENST00000012049.5:c.351+1G>A	19.37:g.46196814G>A		Somatic	937	WXS	Illumina GAIIx	Phase_IV	Q53HE4|Q96F74	Silent	SNP	pfam_Peptidase_M28	p.K117	ENST00000012049.5	37	c.351	CCDS12672.1	19																																																																																			QPCTL	-	NULL	ENSG00000011478		0.567	QPCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QPCTL	HGNC	protein_coding	OTTHUMT00000459656.1	106	0.00	0	G	NM_017659	Silent	46196814	46196814	+1	no_errors	ENST00000012049	ensembl	human	known	69_37n	silent	41	19.61	10	SNP	1.000	A
QPCTL	54814	genome.wustl.edu	37	19	46196814	46196814	+	Splice_Site	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:46196814G>A	ENST00000012049.5	+	2	572	c.351G>A	c.(349-351)aaG>aaA	p.K117K	SNRPD2_ENST00000585392.1_5'Flank|SNRPD2_ENST00000342669.3_5'Flank|SNRPD2_ENST00000587579.1_5'Flank|SNRPD2_ENST00000588599.1_5'Flank|SNRPD2_ENST00000391932.3_5'Flank|QPCTL_ENST00000366382.4_Splice_Site_p.K117K|SNRPD2_ENST00000587367.1_5'Flank|SNRPD2_ENST00000588301.1_5'Flank|SNRPD2_ENST00000590212.1_5'Flank	NM_017659.3	NP_060129.2	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like	117					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(1)|lung(5)|skin(1)|stomach(1)	11		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		AAGTCAGAAAGGTAAAGGGAC	0.567											OREG0025560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													63.0	71.0	68.0					19																	46196814		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK000091	CCDS12672.1, CCDS54282.1	19q13.32	2014-09-04			ENSG00000011478	ENSG00000011478			25952	protein-coding gene	gene with protein product	"""glutaminyl cyclase-like"""						Standard	NM_017659		Approved	FLJ20084	uc010xxr.2	Q9NXS2	OTTHUMG00000182131	ENST00000012049.5:c.351+1G>A	19.37:g.46196814G>A		Somatic	937	WXS	Illumina GAIIx	Phase_IV	Q53HE4|Q96F74	Silent	SNP	pfam_Peptidase_M28	p.K117	ENST00000012049.5	37	c.351	CCDS12672.1	19																																																																																			QPCTL	-	NULL	ENSG00000011478		0.567	QPCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QPCTL	HGNC	protein_coding	OTTHUMT00000459656.1	37	0.00	0	G	NM_017659	Silent	46196814	46196814	+1	no_errors	ENST00000012049	ensembl	human	known	69_37n	silent	41	19.61	10	SNP	1.000	A
RAB26	25837	genome.wustl.edu	37	16	2203026	2203027	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:2203026_2203027delGA	ENST00000210187.6	+	7	731_732	c.571_572delGA	c.(571-573)gacfs	p.D191fs	RP11-304L19.5_ENST00000563192.1_lincRNA|SNORD60_ENST00000383903.1_RNA|RAB26_ENST00000541451.1_Frame_Shift_Del_p.D125fs|TRAF7_ENST00000326181.6_5'Flank	NM_014353.4	NP_055168.2	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family	191					exocrine system development (GO:0035272)|Golgi to plasma membrane protein transport (GO:0043001)|regulated secretory pathway (GO:0045055)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	Golgi membrane (GO:0000139)|intrinsic component of plasma membrane (GO:0031226)|secretory granule membrane (GO:0030667)	GMP binding (GO:0019002)|GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(3)	5						GAAGAGGGAGGACGGGGAGAAG	0.693																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB027137	CCDS10460.1	16p13.3	2008-07-28			ENSG00000167964	ENSG00000167964		"""RAB, member RAS oncogene"""	14259	protein-coding gene	gene with protein product		605455				11043516	Standard	NM_014353		Approved		uc002cou.3	Q9ULW5	OTTHUMG00000128829	ENST00000210187.6:c.571_572delGA	16.37:g.2203026_2203027delGA	ENSP00000210187:p.Asp191fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAA6|Q3L6K5|Q6NXS7	Frame_Shift_Del	DEL	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D191fs	ENST00000210187.6	37	c.571_572	CCDS10460.1	16																																																																																			RAB26	-	pfam_Small_GTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000167964		0.693	RAB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB26	HGNC	protein_coding	OTTHUMT00000250767.2	20	0.00	0	GA			2203026	2203027	+1	no_errors	ENST00000210187	ensembl	human	known	69_37n	frame_shift_del	2	50.00	2	DEL	1.000:0.997	-
RASL11B	65997	genome.wustl.edu	37	4	53731706	53731706	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr4:53731706C>G	ENST00000248706.3	+	4	699	c.481C>G	c.(481-483)Cag>Gag	p.Q161E	RASL11B_ENST00000505041.1_3'UTR	NM_023940.2	NP_076429.1			RAS-like, family 11, member B											autonomic_ganglia(1)|central_nervous_system(1)|lung(5)|ovary(1)|stomach(1)	9			LUSC - Lung squamous cell carcinoma(32;0.0302)			GCACATCAAACAGGTTGACCC	0.537																																						dbGAP											0													154.0	144.0	147.0					4																	53731706		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK001672	CCDS3490.1	4q12	2014-05-09			ENSG00000128045	ENSG00000128045			23804	protein-coding gene	gene with protein product		612404					Standard	NM_023940		Approved		uc003gzt.3	Q9BPW5	OTTHUMG00000102097	ENST00000248706.3:c.481C>G	4.37:g.53731706C>G	ENSP00000248706:p.Gln161Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q161E	ENST00000248706.3	37	c.481	CCDS3490.1	4	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733786	0.30684	.	.	ENSG00000128045	ENST00000248706	T	0.79247	-1.25	5.57	5.57	0.84162	Small GTP-binding protein domain (1);	0.101142	0.64402	D	0.000001	T	0.64983	0.2648	N	0.20766	0.605	0.39697	D	0.971135	B	0.09022	0.002	B	0.10450	0.005	T	0.60541	-0.7243	10	0.25106	T	0.35	.	14.8832	0.70547	0.0:0.8459:0.154:0.0	.	161	Q9BPW5	RSLBB_HUMAN	E	161	ENSP00000248706:Q161E	ENSP00000248706:Q161E	Q	+	1	0	RASL11B	53426463	1.000000	0.71417	1.000000	0.80357	0.474000	0.32979	3.780000	0.55386	2.596000	0.87737	0.655000	0.94253	CAG	RASL11B	-	pfam_Small_GTPase,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000128045		0.537	RASL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL11B	HGNC	protein_coding	OTTHUMT00000219931.2	137	0.00	0	C	NM_023940		53731706	53731706	+1	no_errors	ENST00000248706	ensembl	human	known	69_37n	missense	47	44.71	38	SNP	1.000	G
RASL11B	65997	genome.wustl.edu	37	4	53731706	53731706	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr4:53731706C>G	ENST00000248706.3	+	4	699	c.481C>G	c.(481-483)Cag>Gag	p.Q161E	RASL11B_ENST00000505041.1_3'UTR	NM_023940.2	NP_076429.1			RAS-like, family 11, member B											autonomic_ganglia(1)|central_nervous_system(1)|lung(5)|ovary(1)|stomach(1)	9			LUSC - Lung squamous cell carcinoma(32;0.0302)			GCACATCAAACAGGTTGACCC	0.537																																						dbGAP											0													154.0	144.0	147.0					4																	53731706		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK001672	CCDS3490.1	4q12	2014-05-09			ENSG00000128045	ENSG00000128045			23804	protein-coding gene	gene with protein product		612404					Standard	NM_023940		Approved		uc003gzt.3	Q9BPW5	OTTHUMG00000102097	ENST00000248706.3:c.481C>G	4.37:g.53731706C>G	ENSP00000248706:p.Gln161Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q161E	ENST00000248706.3	37	c.481	CCDS3490.1	4	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733786	0.30684	.	.	ENSG00000128045	ENST00000248706	T	0.79247	-1.25	5.57	5.57	0.84162	Small GTP-binding protein domain (1);	0.101142	0.64402	D	0.000001	T	0.64983	0.2648	N	0.20766	0.605	0.39697	D	0.971135	B	0.09022	0.002	B	0.10450	0.005	T	0.60541	-0.7243	10	0.25106	T	0.35	.	14.8832	0.70547	0.0:0.8459:0.154:0.0	.	161	Q9BPW5	RSLBB_HUMAN	E	161	ENSP00000248706:Q161E	ENSP00000248706:Q161E	Q	+	1	0	RASL11B	53426463	1.000000	0.71417	1.000000	0.80357	0.474000	0.32979	3.780000	0.55386	2.596000	0.87737	0.655000	0.94253	CAG	RASL11B	-	pfam_Small_GTPase,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000128045		0.537	RASL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL11B	HGNC	protein_coding	OTTHUMT00000219931.2	91	0.00	0	C	NM_023940		53731706	53731706	+1	no_errors	ENST00000248706	ensembl	human	known	69_37n	missense	47	44.71	38	SNP	1.000	G
RFX1	5989	genome.wustl.edu	37	19	14076329	14076329	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:14076329C>G	ENST00000254325.4	-	16	2377	c.2143G>C	c.(2143-2145)Gcc>Ccc	p.A715P		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	715					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			AGGCTCTTGGCAAAGTTCCGG	0.652																																						dbGAP											0													120.0	127.0	125.0					19																	14076329		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2143G>C	19.37:g.14076329C>G	ENSP00000254325:p.Ala715Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.A715P	ENST00000254325.4	37	c.2143	CCDS12301.1	19	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016052	0.93404	.	.	ENSG00000132005	ENST00000254325	T	0.08282	3.11	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.36552	0.0971	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.50775	-0.8788	10	0.87932	D	0	-28.3169	15.4578	0.75330	0.0:1.0:0.0:0.0	.	715	P22670	RFX1_HUMAN	P	715	ENSP00000254325:A715P	ENSP00000254325:A715P	A	-	1	0	RFX1	13937329	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.606000	0.82863	2.158000	0.67659	0.462000	0.41574	GCC	RFX1	-	NULL	ENSG00000132005		0.652	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX1	HGNC	protein_coding	OTTHUMT00000458510.1	18	0.00	0	C	NM_002918		14076329	14076329	-1	no_errors	ENST00000254325	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	1.000	G
RFX1	5989	genome.wustl.edu	37	19	14076329	14076329	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:14076329C>G	ENST00000254325.4	-	16	2377	c.2143G>C	c.(2143-2145)Gcc>Ccc	p.A715P		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	715					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			AGGCTCTTGGCAAAGTTCCGG	0.652																																						dbGAP											0													120.0	127.0	125.0					19																	14076329		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2143G>C	19.37:g.14076329C>G	ENSP00000254325:p.Ala715Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.A715P	ENST00000254325.4	37	c.2143	CCDS12301.1	19	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016052	0.93404	.	.	ENSG00000132005	ENST00000254325	T	0.08282	3.11	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.36552	0.0971	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.50775	-0.8788	10	0.87932	D	0	-28.3169	15.4578	0.75330	0.0:1.0:0.0:0.0	.	715	P22670	RFX1_HUMAN	P	715	ENSP00000254325:A715P	ENSP00000254325:A715P	A	-	1	0	RFX1	13937329	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.606000	0.82863	2.158000	0.67659	0.462000	0.41574	GCC	RFX1	-	NULL	ENSG00000132005		0.652	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX1	HGNC	protein_coding	OTTHUMT00000458510.1	13	0.00	0	C	NM_002918		14076329	14076329	-1	no_errors	ENST00000254325	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	1.000	G
RTN4RL1	146760	genome.wustl.edu	37	17	1840864	1840864	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:1840864G>C	ENST00000331238.6	-	2	731	c.252C>G	c.(250-252)taC>taG	p.Y84*		NM_178568.2	NP_848663.1			reticulon 4 receptor-like 1											breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|prostate(2)|skin(1)	11						TGTTGTTCGAGTAGATCCACA	0.652																																					GBM(68;949 1139 14865 32798 38342)	dbGAP											0													84.0	95.0	91.0					17																	1840864		2190	4287	6477	-	-	-	SO:0001587	stop_gained	0			AF532859	CCDS45569.1	17p13.3	2008-02-05				ENSG00000185924			21329	protein-coding gene	gene with protein product	"""nogo-66 receptor homolog 2"""	610461					Standard	NM_178568		Approved	NGRH2, NgR3, DKFZp547J144	uc002ftp.3	Q86UN2		ENST00000331238.6:c.252C>G	17.37:g.1840864G>C	ENSP00000330631:p.Tyr84*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Y84*	ENST00000331238.6	37	c.252	CCDS45569.1	17	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325324	0.60743	.	.	ENSG00000185924	ENST00000331238	.	.	.	5.49	2.43	0.29744	.	0.000000	0.35739	N	0.003018	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.3544	0.38157	0.2699:0.0:0.7301:0.0	.	.	.	.	X	84	.	ENSP00000330631:Y84X	Y	-	3	2	RTN4RL1	1787614	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.466000	0.45084	1.346000	0.45694	-0.143000	0.13931	TAC	RTN4RL1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000185924		0.652	RTN4RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4RL1	HGNC	protein_coding	OTTHUMT00000450155.2	22	0.00	0	G	NM_178568		1840864	1840864	-1	no_errors	ENST00000331238	ensembl	human	known	69_37n	nonsense	18	35.71	10	SNP	1.000	C
SALL1	6299	genome.wustl.edu	37	16	51172798	51172798	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:51172798delG	ENST00000251020.4	-	2	3368	c.3335delC	c.(3334-3336)cctfs	p.P1112fs	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Frame_Shift_Del_p.P1015fs	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1112					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GGAAGACAGAGGCCCAGACGG	0.552																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													96.0	81.0	86.0					16																	51172798		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3335delC	16.37:g.51172798delG	ENSP00000251020:p.Pro1112fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99881|Q9NSC3|Q9P1R0	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1112fs	ENST00000251020.4	37	c.3335	CCDS10747.1	16																																																																																			SALL1	-	NULL	ENSG00000103449		0.552	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	73	0.00	0	G	NM_002968		51172798	51172798	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	frame_shift_del	16	64.71	33	DEL	1.000	-
SALL1	6299	genome.wustl.edu	37	16	51172798	51172798	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr16:51172798delG	ENST00000251020.4	-	2	3368	c.3335delC	c.(3334-3336)cctfs	p.P1112fs	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Frame_Shift_Del_p.P1015fs	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1112					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GGAAGACAGAGGCCCAGACGG	0.552																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													96.0	81.0	86.0					16																	51172798		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3335delC	16.37:g.51172798delG	ENSP00000251020:p.Pro1112fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99881|Q9NSC3|Q9P1R0	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1112fs	ENST00000251020.4	37	c.3335	CCDS10747.1	16																																																																																			SALL1	-	NULL	ENSG00000103449		0.552	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	67	0.00	0	G	NM_002968		51172798	51172798	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	frame_shift_del	16	64.71	33	DEL	1.000	-
SATL1	340562	genome.wustl.edu	37	X	84349172	84349172	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chrX:84349172A>T	ENST00000395409.3	-	4	1837	c.1277T>A	c.(1276-1278)cTt>cAt	p.L426H	SATL1_ENST00000332921.5_Missense_Mutation_p.L426H|SATL1_ENST00000509231.1_Missense_Mutation_p.L613H			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	426	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CTCTAGGTAAAGTACCTTGCC	0.338																																						dbGAP											0													122.0	101.0	108.0					X																	84349172		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.1277T>A	X.37:g.84349172A>T	ENSP00000378804:p.Leu426His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.L613H	ENST00000395409.3	37	c.1838		X	.	.	.	.	.	.	.	.	.	.	A	17.10	3.301872	0.60195	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.49720	1.83;0.77;0.77	5.14	3.95	0.45737	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.29286	N	0.012595	T	0.72630	0.3484	M	0.93763	3.455	0.36546	D	0.871576	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.994	T	0.78314	-0.2252	10	0.87932	D	0	-15.2816	7.5894	0.28012	0.8076:0.0:0.0:0.1924	.	426;613	Q86VE3;E9PB72	SATL1_HUMAN;.	H	426;426;613	ENSP00000378804:L426H;ENSP00000329115:L426H;ENSP00000425421:L613H	ENSP00000329115:L426H	L	-	2	0	SATL1	84235828	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	6.518000	0.73764	0.694000	0.31654	0.486000	0.48141	CTT	SATL1	-	superfamily_Acyl_CoA_acyltransferase	ENSG00000184788		0.338	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		223	0.00	0	A	XM_291339		84349172	84349172	-1	no_errors	ENST00000509231	ensembl	human	known	69_37n	missense	56	65.03	106	SNP	1.000	T
SATL1	340562	genome.wustl.edu	37	X	84349172	84349172	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chrX:84349172A>T	ENST00000395409.3	-	4	1837	c.1277T>A	c.(1276-1278)cTt>cAt	p.L426H	SATL1_ENST00000332921.5_Missense_Mutation_p.L426H|SATL1_ENST00000509231.1_Missense_Mutation_p.L613H			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	426	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CTCTAGGTAAAGTACCTTGCC	0.338																																						dbGAP											0													122.0	101.0	108.0					X																	84349172		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.1277T>A	X.37:g.84349172A>T	ENSP00000378804:p.Leu426His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.L613H	ENST00000395409.3	37	c.1838		X	.	.	.	.	.	.	.	.	.	.	A	17.10	3.301872	0.60195	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.49720	1.83;0.77;0.77	5.14	3.95	0.45737	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.29286	N	0.012595	T	0.72630	0.3484	M	0.93763	3.455	0.36546	D	0.871576	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.994	T	0.78314	-0.2252	10	0.87932	D	0	-15.2816	7.5894	0.28012	0.8076:0.0:0.0:0.1924	.	426;613	Q86VE3;E9PB72	SATL1_HUMAN;.	H	426;426;613	ENSP00000378804:L426H;ENSP00000329115:L426H;ENSP00000425421:L613H	ENSP00000329115:L426H	L	-	2	0	SATL1	84235828	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	6.518000	0.73764	0.694000	0.31654	0.486000	0.48141	CTT	SATL1	-	superfamily_Acyl_CoA_acyltransferase	ENSG00000184788		0.338	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		268	0.00	0	A	XM_291339		84349172	84349172	-1	no_errors	ENST00000509231	ensembl	human	known	69_37n	missense	56	65.03	106	SNP	1.000	T
SEC14L5	9717	genome.wustl.edu	37	16	5061151	5061152	+	Frame_Shift_Ins	INS	-	-	C	rs546621651	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:5061151_5061152insC	ENST00000251170.7	+	15	2036_2037	c.1856_1857insC	c.(1855-1860)agccccfs	p.SP619fs	RP11-165E7.1_ENST00000588778.1_RNA	NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	619	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						CAAATGCACAGCCCCCCCAGCA	0.663																																						dbGAP											0										17,3811		0,17,1897						-0.2	0.0			25	8,7966		0,8,3979	no	frameshift	SEC14L5	NM_014692.1		0,25,5876	A1A1,A1R,RR		0.1003,0.4441,0.2118				25,11777				-	-	-	SO:0001589	frameshift_variant	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1863dupC	16.37:g.5061158_5061158dupC	ENSP00000251170:p.Ser619fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.S622fs	ENST00000251170.7	37	c.1856_1857	CCDS45403.1	16																																																																																			SEC14L5	-	superfamily_GOLD,pfscan_GOLD	ENSG00000103184		0.663	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	10	0.00	0	-			5061151	5061152	+1	no_errors	ENST00000251170	ensembl	human	known	69_37n	frame_shift_ins	5	28.57	2	INS	0.002:0.000	C
SEPT12	124404	genome.wustl.edu	37	16	4827934	4827935	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr16:4827934_4827935insA	ENST00000268231.8	-	10	1203_1204	c.940_941insT	c.(940-942)agafs	p.R314fs	SEPT12_ENST00000396693.5_Frame_Shift_Ins_p.R268fs	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	314	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						TTCATTGAGTCTGATGACGCGG	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.940_941insT	16.37:g.4827934_4827935insA	ENSP00000268231:p.Arg314fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6B0|Q1PBH0|Q96LL0	Frame_Shift_Ins	INS	pfam_Cell_div_GTP-bd,pfam_AIG1,pirsf_Septin	p.R314fs	ENST00000268231.8	37	c.941_940	CCDS10522.1	16																																																																																			SEPT12	-	pfam_Cell_div_GTP-bd,pirsf_Septin	ENSG00000140623		0.644	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT12	HGNC	protein_coding	OTTHUMT00000251645.2	11	0.00	0	-	NM_144605		4827934	4827935	-1	no_errors	ENST00000268231	ensembl	human	known	69_37n	frame_shift_ins	7	36.36	4	INS	0.952:0.900	A
SLC26A3	1811	genome.wustl.edu	37	7	107427288	107427288	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:107427288C>A	ENST00000340010.5	-	8	1139	c.955G>T	c.(955-957)Ggg>Tgg	p.G319W	SLC26A3_ENST00000422236.2_Missense_Mutation_p.G284W	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	319					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TTCATGTCCCCAACCACAGCC	0.468																																						dbGAP											0													177.0	163.0	167.0					7																	107427288		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.955G>T	7.37:g.107427288C>A	ENSP00000345873:p.Gly319Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.G319W	ENST00000340010.5	37	c.955	CCDS5748.1	7	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103550	0.76983	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.95171	-3.63;-3.63	5.43	5.43	0.79202	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.98235	0.9416	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98968	1.0800	10	0.87932	D	0	.	19.0299	0.92952	0.0:1.0:0.0:0.0	.	284;319	G5E9U3;P40879	.;S26A3_HUMAN	W	284;319	ENSP00000415817:G284W;ENSP00000345873:G319W	ENSP00000345873:G319W	G	-	1	0	SLC26A3	107214524	1.000000	0.71417	0.857000	0.33713	0.022000	0.10575	6.077000	0.71275	2.827000	0.97445	0.650000	0.86243	GGG	SLC26A3	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000091138		0.468	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	HGNC	protein_coding	OTTHUMT00000337190.1	153	0.65	1	C	NM_000111		107427288	107427288	-1	no_errors	ENST00000340010	ensembl	human	known	69_37n	missense	140	38.05	86	SNP	1.000	A
SLC26A3	1811	genome.wustl.edu	37	7	107427288	107427288	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:107427288C>A	ENST00000340010.5	-	8	1139	c.955G>T	c.(955-957)Ggg>Tgg	p.G319W	SLC26A3_ENST00000422236.2_Missense_Mutation_p.G284W	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	319					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TTCATGTCCCCAACCACAGCC	0.468																																						dbGAP											0													177.0	163.0	167.0					7																	107427288		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.955G>T	7.37:g.107427288C>A	ENSP00000345873:p.Gly319Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.G319W	ENST00000340010.5	37	c.955	CCDS5748.1	7	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103550	0.76983	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.95171	-3.63;-3.63	5.43	5.43	0.79202	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.98235	0.9416	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98968	1.0800	10	0.87932	D	0	.	19.0299	0.92952	0.0:1.0:0.0:0.0	.	284;319	G5E9U3;P40879	.;S26A3_HUMAN	W	284;319	ENSP00000415817:G284W;ENSP00000345873:G319W	ENSP00000345873:G319W	G	-	1	0	SLC26A3	107214524	1.000000	0.71417	0.857000	0.33713	0.022000	0.10575	6.077000	0.71275	2.827000	0.97445	0.650000	0.86243	GGG	SLC26A3	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000091138		0.468	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	HGNC	protein_coding	OTTHUMT00000337190.1	371	0.27	1	C	NM_000111		107427288	107427288	-1	no_errors	ENST00000340010	ensembl	human	known	69_37n	missense	140	38.05	86	SNP	1.000	A
SMTNL1	219537	genome.wustl.edu	37	11	57314020	57314020	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:57314020C>A	ENST00000399154.2	+	7	1124	c.1124C>A	c.(1123-1125)gCc>gAc	p.A375D	SMTNL1_ENST00000527972.1_Missense_Mutation_p.A412D|SMTNL1_ENST00000457912.1_Missense_Mutation_p.A430D			A8MU46	SMTL1_HUMAN	smoothelin-like 1	375	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						AGTGGTATGGCCTTCTGTGCC	0.592																																						dbGAP											0													113.0	111.0	112.0					11																	57314020		2200	4296	6496	-	-	-	SO:0001583	missense	0			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.1124C>A	11.37:g.57314020C>A	ENSP00000382108:p.Ala375Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.A430D	ENST00000399154.2	37	c.1289		11	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402141	0.83230	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	D;D;D	0.96491	-4.03;-4.03;-4.03	4.44	3.48	0.39840	.	0.000000	0.31358	U	0.007791	D	0.98764	0.9584	H	0.98238	4.18	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	D	0.99146	1.0857	10	0.87932	D	0	-13.0158	13.254	0.60068	0.0:0.8386:0.1614:0.0	.	430	C9J621	.	D	430;412;375	ENSP00000406485:A430D;ENSP00000432651:A412D;ENSP00000382108:A375D	ENSP00000382108:A375D	A	+	2	0	SMTNL1	57070596	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.553000	0.82203	1.153000	0.42468	0.561000	0.74099	GCC	SMTNL1	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000214872		0.592	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	SMTNL1	HGNC	protein_coding		37	0.00	0	C	XM_166203		57314020	57314020	+1	no_errors	ENST00000457912	ensembl	human	known	69_37n	missense	17	41.94	13	SNP	1.000	A
SMTNL1	219537	genome.wustl.edu	37	11	57314020	57314020	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:57314020C>A	ENST00000399154.2	+	7	1124	c.1124C>A	c.(1123-1125)gCc>gAc	p.A375D	SMTNL1_ENST00000527972.1_Missense_Mutation_p.A412D|SMTNL1_ENST00000457912.1_Missense_Mutation_p.A430D			A8MU46	SMTL1_HUMAN	smoothelin-like 1	375	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						AGTGGTATGGCCTTCTGTGCC	0.592																																						dbGAP											0													113.0	111.0	112.0					11																	57314020		2200	4296	6496	-	-	-	SO:0001583	missense	0			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.1124C>A	11.37:g.57314020C>A	ENSP00000382108:p.Ala375Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.A430D	ENST00000399154.2	37	c.1289		11	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402141	0.83230	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	D;D;D	0.96491	-4.03;-4.03;-4.03	4.44	3.48	0.39840	.	0.000000	0.31358	U	0.007791	D	0.98764	0.9584	H	0.98238	4.18	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	D	0.99146	1.0857	10	0.87932	D	0	-13.0158	13.254	0.60068	0.0:0.8386:0.1614:0.0	.	430	C9J621	.	D	430;412;375	ENSP00000406485:A430D;ENSP00000432651:A412D;ENSP00000382108:A375D	ENSP00000382108:A375D	A	+	2	0	SMTNL1	57070596	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.553000	0.82203	1.153000	0.42468	0.561000	0.74099	GCC	SMTNL1	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000214872		0.592	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	SMTNL1	HGNC	protein_coding		32	0.00	0	C	XM_166203		57314020	57314020	+1	no_errors	ENST00000457912	ensembl	human	known	69_37n	missense	17	41.94	13	SNP	1.000	A
SPATA16	83893	genome.wustl.edu	37	3	172835390	172835390	+	Silent	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr3:172835390T>A	ENST00000351008.3	-	2	315	c.132A>T	c.(130-132)tcA>tcT	p.S44S		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	44					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TAATCTCTTGTGACATTTCCA	0.373																																						dbGAP											0													306.0	294.0	298.0					3																	172835390		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.132A>T	3.37:g.172835390T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Silent	SNP	NULL	p.S44	ENST00000351008.3	37	c.132	CCDS3221.1	3																																																																																			SPATA16	-	NULL	ENSG00000144962		0.373	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA16	HGNC	protein_coding	OTTHUMT00000346322.1	470	0.00	0	T	NM_031955		172835390	172835390	-1	no_errors	ENST00000351008	ensembl	human	known	69_37n	silent	678	22.94	203	SNP	0.000	A
SPATA16	83893	genome.wustl.edu	37	3	172835390	172835390	+	Silent	SNP	T	T	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr3:172835390T>A	ENST00000351008.3	-	2	315	c.132A>T	c.(130-132)tcA>tcT	p.S44S		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	44					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TAATCTCTTGTGACATTTCCA	0.373																																						dbGAP											0													306.0	294.0	298.0					3																	172835390		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.132A>T	3.37:g.172835390T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Silent	SNP	NULL	p.S44	ENST00000351008.3	37	c.132	CCDS3221.1	3																																																																																			SPATA16	-	NULL	ENSG00000144962		0.373	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA16	HGNC	protein_coding	OTTHUMT00000346322.1	885	0.00	0	T	NM_031955		172835390	172835390	-1	no_errors	ENST00000351008	ensembl	human	known	69_37n	silent	678	22.94	203	SNP	0.000	A
SRRT	51593	genome.wustl.edu	37	7	100479395	100479395	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr7:100479395A>T	ENST00000347433.4	+	4	525	c.367A>T	c.(367-369)Atg>Ttg	p.M123L	SRRT_ENST00000388793.4_Missense_Mutation_p.M123L|SRRT_ENST00000457580.2_Missense_Mutation_p.M123L|SRRT_ENST00000432932.1_Missense_Mutation_p.M123L			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	123					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CGTCCACATCATGCAGCACCA	0.627																																						dbGAP											0													42.0	43.0	43.0					7																	100479395		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.367A>T	7.37:g.100479395A>T	ENSP00000314491:p.Met123Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.M123L	ENST00000347433.4	37	c.367	CCDS34709.1	7	.	.	.	.	.	.	.	.	.	.	A	4.636	0.118297	0.08881	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000539682;ENST00000432932;ENST00000347433	.	.	.	4.78	3.62	0.41486	.	0.047772	0.85682	D	0.000000	T	0.29620	0.0739	N	0.14661	0.345	0.49213	D	0.999767	B;B;B;B	0.09022	0.002;0.002;0.002;0.001	B;B;B;B	0.06405	0.002;0.002;0.002;0.001	T	0.05852	-1.0860	9	0.11182	T	0.66	.	8.5212	0.33277	0.9063:0.0:0.0937:0.0	.	123;123;123;123	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	L	123;123;38;123;123	.	ENSP00000314491:M123L	M	+	1	0	SRRT	100317331	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.504000	0.60414	0.841000	0.35020	0.533000	0.62120	ATG	SRRT	-	NULL	ENSG00000087087		0.627	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	24	0.00	0	A	NM_015908		100479395	100479395	+1	no_errors	ENST00000388793	ensembl	human	known	69_37n	missense	46	41.03	32	SNP	1.000	T
STARD10	10809	genome.wustl.edu	37	11	72470286	72470287	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:72470286_72470287insC	ENST00000334805.6	-	3	1266_1267	c.347_348insG	c.(346-348)tatfs	p.Y116fs	STARD10_ENST00000538437.1_5'UTR|STARD10_ENST00000538536.1_Frame_Shift_Ins_p.Y70fs|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000545082.1_Frame_Shift_Ins_p.Y87fs|STARD10_ENST00000543304.1_Frame_Shift_Ins_p.Y116fs	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	116	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			CACAGGAGTAATAGCCCACGTC	0.569																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.347_348insG	11.37:g.72470286_72470287insC	ENSP00000335247:p.Tyr116fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60532	Frame_Shift_Ins	INS	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.Y116fs	ENST00000334805.6	37	c.348_347	CCDS41688.1	11																																																																																			STARD10	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	ENSG00000214530		0.569	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STARD10	HGNC	protein_coding	OTTHUMT00000397254.1	160	0.00	0	-			72470286	72470287	-1	no_errors	ENST00000334805	ensembl	human	known	69_37n	frame_shift_ins	18	21.74	5	INS	1.000:1.000	C
STARD10	10809	genome.wustl.edu	37	11	72470286	72470287	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:72470286_72470287insC	ENST00000334805.6	-	3	1266_1267	c.347_348insG	c.(346-348)tatfs	p.Y116fs	STARD10_ENST00000538437.1_5'UTR|STARD10_ENST00000538536.1_Frame_Shift_Ins_p.Y70fs|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000545082.1_Frame_Shift_Ins_p.Y87fs|STARD10_ENST00000543304.1_Frame_Shift_Ins_p.Y116fs	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	116	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			CACAGGAGTAATAGCCCACGTC	0.569																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.347_348insG	11.37:g.72470286_72470287insC	ENSP00000335247:p.Tyr116fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60532	Frame_Shift_Ins	INS	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.Y116fs	ENST00000334805.6	37	c.348_347	CCDS41688.1	11																																																																																			STARD10	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	ENSG00000214530		0.569	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STARD10	HGNC	protein_coding	OTTHUMT00000397254.1	17	0.00	0	-			72470286	72470287	-1	no_errors	ENST00000334805	ensembl	human	known	69_37n	frame_shift_ins	18	21.74	5	INS	1.000:1.000	C
STRN4	29888	genome.wustl.edu	37	19	47240084	47240084	+	Nonsense_Mutation	SNP	G	G	A	rs371207504		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:47240084G>A	ENST00000263280.6	-	4	584	c.535C>T	c.(535-537)Cga>Tga	p.R179*	STRN4_ENST00000539396.1_Nonsense_Mutation_p.R60*|Y_RNA_ENST00000410682.1_RNA|STRN4_ENST00000391910.3_Nonsense_Mutation_p.R179*	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	179	Calmodulin-binding. {ECO:0000255}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		ACTCACTGTCGGAGAAGCTGC	0.617																																						dbGAP											0													130.0	129.0	129.0					19																	47240084		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.535C>T	19.37:g.47240084G>A	ENSP00000263280:p.Arg179*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_Striatin_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R179*	ENST00000263280.6	37	c.535	CCDS12690.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.382748	0.97524	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396;ENST00000435164	.	.	.	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9488	0.71054	0.0:0.0:1.0:0.0	.	.	.	.	X	179;179;60;60	.	ENSP00000263280:R179X	R	-	1	2	STRN4	51931924	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.596000	0.61055	2.509000	0.84616	0.650000	0.86243	CGA	STRN4	-	pfam_Striatin_N	ENSG00000090372		0.617	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	STRN4	HGNC	protein_coding	OTTHUMT00000466607.2	173	0.00	0	G			47240084	47240084	-1	no_errors	ENST00000391910	ensembl	human	known	69_37n	nonsense	51	23.88	16	SNP	1.000	A
STRN4	29888	genome.wustl.edu	37	19	47240084	47240084	+	Nonsense_Mutation	SNP	G	G	A	rs371207504		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:47240084G>A	ENST00000263280.6	-	4	584	c.535C>T	c.(535-537)Cga>Tga	p.R179*	STRN4_ENST00000539396.1_Nonsense_Mutation_p.R60*|Y_RNA_ENST00000410682.1_RNA|STRN4_ENST00000391910.3_Nonsense_Mutation_p.R179*	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	179	Calmodulin-binding. {ECO:0000255}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		ACTCACTGTCGGAGAAGCTGC	0.617																																						dbGAP											0													130.0	129.0	129.0					19																	47240084		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.535C>T	19.37:g.47240084G>A	ENSP00000263280:p.Arg179*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_Striatin_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R179*	ENST00000263280.6	37	c.535	CCDS12690.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.382748	0.97524	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396;ENST00000435164	.	.	.	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9488	0.71054	0.0:0.0:1.0:0.0	.	.	.	.	X	179;179;60;60	.	ENSP00000263280:R179X	R	-	1	2	STRN4	51931924	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.596000	0.61055	2.509000	0.84616	0.650000	0.86243	CGA	STRN4	-	pfam_Striatin_N	ENSG00000090372		0.617	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	STRN4	HGNC	protein_coding	OTTHUMT00000466607.2	19	0.00	0	G			47240084	47240084	-1	no_errors	ENST00000391910	ensembl	human	known	69_37n	nonsense	51	23.88	16	SNP	1.000	A
SYNPO2	171024	genome.wustl.edu	37	4	119948056	119948056	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr4:119948056G>A	ENST00000429713.2	+	3	714	c.532G>A	c.(532-534)Gtg>Atg	p.V178M	SYNPO2_ENST00000434046.2_Missense_Mutation_p.V178M|SYNPO2_ENST00000307142.4_Missense_Mutation_p.V178M|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	178						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AAGAGGACGCGTGGCAGAAGA	0.557																																						dbGAP											0													38.0	43.0	41.0					4																	119948056		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.532G>A	4.37:g.119948056G>A	ENSP00000395143:p.Val178Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V178M	ENST00000429713.2	37	c.532	CCDS47129.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.962|1.962	-0.438650|-0.438650	0.04636|0.04636	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	T|T;T;T	0.09538|0.09163	2.97|3.01;3.02;3.01	5.51|5.51	-3.07|-3.07	0.05363|0.05363	.|.	.|1.209470	.|0.06155	.|N	.|0.674856	T|T	0.04452|0.04452	0.0122|0.0122	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.10296	.|0.002;0.003;0.002;0.002	.|B;B;B;B	.|0.06405	.|0.001;0.002;0.001;0.001	T|T	0.39643|0.39643	-0.9604|-0.9604	7|10	0.02654|0.52906	T|T	1|0.07	-0.0379|-0.0379	0.3681|0.3681	0.00375|0.00375	0.2081:0.2004:0.2426:0.349|0.2081:0.2004:0.2426:0.349	.|.	.|178;178;178;178	.|B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.|.;.;.;SYNP2_HUMAN	H|M	129|178	ENSP00000425496:R129H|ENSP00000306015:V178M;ENSP00000395143:V178M;ENSP00000390965:V178M	ENSP00000425496:R129H|ENSP00000306015:V178M	R|V	+|+	2|1	0|0	SYNPO2|SYNPO2	120167504|120167504	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.148000|-0.148000	0.10219|0.10219	-0.798000|-0.798000	0.04444|0.04444	-1.500000|-1.500000	0.00958|0.00958	CGT|GTG	SYNPO2	-	NULL	ENSG00000172403		0.557	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	HGNC	protein_coding	OTTHUMT00000364020.1	97	0.00	0	G			119948056	119948056	+1	no_errors	ENST00000307142	ensembl	human	known	69_37n	missense	99	26.12	35	SNP	0.000	A
SYNPO2	171024	genome.wustl.edu	37	4	119948056	119948056	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr4:119948056G>A	ENST00000429713.2	+	3	714	c.532G>A	c.(532-534)Gtg>Atg	p.V178M	SYNPO2_ENST00000434046.2_Missense_Mutation_p.V178M|SYNPO2_ENST00000307142.4_Missense_Mutation_p.V178M|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	178						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AAGAGGACGCGTGGCAGAAGA	0.557																																						dbGAP											0													38.0	43.0	41.0					4																	119948056		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.532G>A	4.37:g.119948056G>A	ENSP00000395143:p.Val178Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V178M	ENST00000429713.2	37	c.532	CCDS47129.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.962|1.962	-0.438650|-0.438650	0.04636|0.04636	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	T|T;T;T	0.09538|0.09163	2.97|3.01;3.02;3.01	5.51|5.51	-3.07|-3.07	0.05363|0.05363	.|.	.|1.209470	.|0.06155	.|N	.|0.674856	T|T	0.04452|0.04452	0.0122|0.0122	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.10296	.|0.002;0.003;0.002;0.002	.|B;B;B;B	.|0.06405	.|0.001;0.002;0.001;0.001	T|T	0.39643|0.39643	-0.9604|-0.9604	7|10	0.02654|0.52906	T|T	1|0.07	-0.0379|-0.0379	0.3681|0.3681	0.00375|0.00375	0.2081:0.2004:0.2426:0.349|0.2081:0.2004:0.2426:0.349	.|.	.|178;178;178;178	.|B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.|.;.;.;SYNP2_HUMAN	H|M	129|178	ENSP00000425496:R129H|ENSP00000306015:V178M;ENSP00000395143:V178M;ENSP00000390965:V178M	ENSP00000425496:R129H|ENSP00000306015:V178M	R|V	+|+	2|1	0|0	SYNPO2|SYNPO2	120167504|120167504	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.148000|-0.148000	0.10219|0.10219	-0.798000|-0.798000	0.04444|0.04444	-1.500000|-1.500000	0.00958|0.00958	CGT|GTG	SYNPO2	-	NULL	ENSG00000172403		0.557	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	HGNC	protein_coding	OTTHUMT00000364020.1	98	0.00	0	G			119948056	119948056	+1	no_errors	ENST00000307142	ensembl	human	known	69_37n	missense	99	26.12	35	SNP	0.000	A
TBC1D25	4943	genome.wustl.edu	37	X	48418941	48418941	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chrX:48418941C>G	ENST00000376771.4	+	6	1986	c.1645C>G	c.(1645-1647)Cca>Gca	p.P549A	snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000537536.1_Missense_Mutation_p.P295A	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	549					autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CTCCCCAGACCCACTGCTCTC	0.587																																						dbGAP											0													93.0	85.0	88.0					X																	48418941		2203	4300	6503	-	-	-	SO:0001583	missense	0			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.1645C>G	X.37:g.48418941C>G	ENSP00000365962:p.Pro549Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P549A	ENST00000376771.4	37	c.1645	CCDS35242.1	X	.	.	.	.	.	.	.	.	.	.	C	6.204	0.405826	0.11754	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.13420	2.59;2.6	5.24	4.31	0.51392	Rab-GAP/TBC domain (1);	0.506998	0.20270	N	0.095681	T	0.09598	0.0236	L	0.36672	1.1	0.18873	N	0.999987	B;B;B	0.30914	0.3;0.3;0.3	B;B;B	0.26094	0.066;0.066;0.045	T	0.25012	-1.0144	10	0.13853	T	0.58	-15.4046	9.9389	0.41567	0.0:0.7988:0.2012:0.0	.	553;491;549	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	A	549;295	ENSP00000365962:P549A;ENSP00000444091:P295A	ENSP00000365962:P549A	P	+	1	0	TBC1D25	48303885	0.108000	0.22018	1.000000	0.80357	0.844000	0.47949	2.968000	0.49224	2.183000	0.69458	0.436000	0.28706	CCA	TBC1D25	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000068354		0.587	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D25	HGNC	protein_coding	OTTHUMT00000060764.2	164	0.00	0	C	NM_002536		48418941	48418941	+1	no_errors	ENST00000376771	ensembl	human	known	69_37n	missense	37	57.47	50	SNP	0.157	G
TBC1D25	4943	genome.wustl.edu	37	X	48418941	48418941	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chrX:48418941C>G	ENST00000376771.4	+	6	1986	c.1645C>G	c.(1645-1647)Cca>Gca	p.P549A	snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000537536.1_Missense_Mutation_p.P295A	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	549					autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CTCCCCAGACCCACTGCTCTC	0.587																																						dbGAP											0													93.0	85.0	88.0					X																	48418941		2203	4300	6503	-	-	-	SO:0001583	missense	0			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.1645C>G	X.37:g.48418941C>G	ENSP00000365962:p.Pro549Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P549A	ENST00000376771.4	37	c.1645	CCDS35242.1	X	.	.	.	.	.	.	.	.	.	.	C	6.204	0.405826	0.11754	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.13420	2.59;2.6	5.24	4.31	0.51392	Rab-GAP/TBC domain (1);	0.506998	0.20270	N	0.095681	T	0.09598	0.0236	L	0.36672	1.1	0.18873	N	0.999987	B;B;B	0.30914	0.3;0.3;0.3	B;B;B	0.26094	0.066;0.066;0.045	T	0.25012	-1.0144	10	0.13853	T	0.58	-15.4046	9.9389	0.41567	0.0:0.7988:0.2012:0.0	.	553;491;549	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	A	549;295	ENSP00000365962:P549A;ENSP00000444091:P295A	ENSP00000365962:P549A	P	+	1	0	TBC1D25	48303885	0.108000	0.22018	1.000000	0.80357	0.844000	0.47949	2.968000	0.49224	2.183000	0.69458	0.436000	0.28706	CCA	TBC1D25	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000068354		0.587	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D25	HGNC	protein_coding	OTTHUMT00000060764.2	73	0.00	0	C	NM_002536		48418941	48418941	+1	no_errors	ENST00000376771	ensembl	human	known	69_37n	missense	37	57.47	50	SNP	0.157	G
TMIGD2	126259	genome.wustl.edu	37	19	4298081	4298081	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:4298081C>A	ENST00000301272.2	-	2	353	c.308G>T	c.(307-309)aGc>aTc	p.S103I	TMIGD2_ENST00000600349.1_Intron|TMIGD2_ENST00000600114.1_Intron|TMIGD2_ENST00000595645.1_Missense_Mutation_p.S103I	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	103	Ig-like.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGTTGAGGCTCACAGGGTC	0.642																																						dbGAP											0													66.0	70.0	69.0					19																	4298081		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.308G>T	19.37:g.4298081C>A	ENSP00000301272:p.Ser103Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW59	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.S103I	ENST00000301272.2	37	c.308	CCDS12126.1	19	.	.	.	.	.	.	.	.	.	.	c	13.91	2.379158	0.42207	.	.	ENSG00000167664	ENST00000301272	T	0.16196	2.36	4.09	-8.19	0.01049	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.15262	0.0368	L	0.32530	0.975	0.09310	N	1	D;D	0.55172	0.962;0.97	B;P	0.50314	0.423;0.637	T	0.25606	-1.0127	9	0.72032	D	0.01	.	9.0374	0.36296	0.0:0.1464:0.534:0.3196	.	103;103	Q96BF3-2;Q96BF3	.;TMIG2_HUMAN	I	103	ENSP00000301272:S103I	ENSP00000301272:S103I	S	-	2	0	TMIGD2	4249081	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.280000	0.02804	-1.500000	0.01819	-1.178000	0.01721	AGC	TMIGD2	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000167664		0.642	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMIGD2	HGNC	protein_coding	OTTHUMT00000458088.1	58	0.00	0	C	NM_144615		4298081	4298081	-1	no_errors	ENST00000301272	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	0.000	A
TMIGD2	126259	genome.wustl.edu	37	19	4298081	4298081	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:4298081C>A	ENST00000301272.2	-	2	353	c.308G>T	c.(307-309)aGc>aTc	p.S103I	TMIGD2_ENST00000600349.1_Intron|TMIGD2_ENST00000600114.1_Intron|TMIGD2_ENST00000595645.1_Missense_Mutation_p.S103I	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	103	Ig-like.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGTTGAGGCTCACAGGGTC	0.642																																						dbGAP											0													66.0	70.0	69.0					19																	4298081		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.308G>T	19.37:g.4298081C>A	ENSP00000301272:p.Ser103Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW59	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.S103I	ENST00000301272.2	37	c.308	CCDS12126.1	19	.	.	.	.	.	.	.	.	.	.	c	13.91	2.379158	0.42207	.	.	ENSG00000167664	ENST00000301272	T	0.16196	2.36	4.09	-8.19	0.01049	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.15262	0.0368	L	0.32530	0.975	0.09310	N	1	D;D	0.55172	0.962;0.97	B;P	0.50314	0.423;0.637	T	0.25606	-1.0127	9	0.72032	D	0.01	.	9.0374	0.36296	0.0:0.1464:0.534:0.3196	.	103;103	Q96BF3-2;Q96BF3	.;TMIG2_HUMAN	I	103	ENSP00000301272:S103I	ENSP00000301272:S103I	S	-	2	0	TMIGD2	4249081	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.280000	0.02804	-1.500000	0.01819	-1.178000	0.01721	AGC	TMIGD2	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000167664		0.642	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMIGD2	HGNC	protein_coding	OTTHUMT00000458088.1	17	0.00	0	C	NM_144615		4298081	4298081	-1	no_errors	ENST00000301272	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	0.000	A
TP53	7157	genome.wustl.edu	37	17	7578467	7578467	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr17:7578467T>G	ENST00000269305.4	-	5	652	c.463A>C	c.(463-465)Acc>Ccc	p.T155P	TP53_ENST00000359597.4_Missense_Mutation_p.T155P|TP53_ENST00000445888.2_Missense_Mutation_p.T155P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.T155P|TP53_ENST00000420246.2_Missense_Mutation_p.T155P|TP53_ENST00000413465.2_Missense_Mutation_p.T155P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	155	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1868473}.|T -> I (in sporadic cancers; somatic mutation).|T -> M (in a sporadic cancer; somatic mutation).|T -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation). {ECO:0000269|PubMed:14660794}.|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T155P(17)|p.T155A(10)|p.0?(8)|p.?(5)|p.P152fs*14(5)|p.G154fs*14(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.P151_V173del23(1)|p.G154_R156delGTR(1)|p.T155fs*26(1)|p.T155fs*25(1)|p.D148_T155delDSTPPPGT(1)|p.T62P(1)|p.T23P(1)|p.D148fs*23(1)|p.T62A(1)|p.T23A(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.T155fs*15(1)|p.T155_R156delTR(1)|p.T155S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGACGCGGGTGCCGGGCGGG	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(32)|Deletion - Frameshift(16)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(1)	lung(18)|ovary(9)|oesophagus(7)|skin(6)|bone(5)|stomach(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|breast(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|pancreas(2)|urinary_tract(1)|liver(1)|prostate(1)											50.0	52.0	51.0					17																	7578467		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.463A>C	17.37:g.7578467T>G	ENSP00000269305:p.Thr155Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.T155P	ENST00000269305.4	37	c.463	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941154	0.34283	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99789	-6.75;-6.75;-6.75;-6.75;-6.75;-6.75;-6.75;-6.75;-6.75	5.59	0.31	0.15825	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.718085	0.14119	N	0.340173	D	0.99483	0.9816	M	0.76328	2.33	0.09310	N	1	D;P;B;D;P;P;D	0.63046	0.989;0.736;0.19;0.976;0.662;0.881;0.992	D;P;B;D;P;P;D	0.67900	0.954;0.743;0.256;0.928;0.833;0.874;0.937	D	0.98829	1.0750	10	0.72032	D	0.01	-6.4954	2.9983	0.06005	0.3258:0.3217:0.0:0.3525	.	116;155;155;62;155;155;155	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	155;155;155;155;155;155;144;62;23;62;23;155	ENSP00000410739:T155P;ENSP00000352610:T155P;ENSP00000269305:T155P;ENSP00000398846:T155P;ENSP00000391127:T155P;ENSP00000391478:T155P;ENSP00000425104:T23P;ENSP00000423862:T62P;ENSP00000424104:T155P	ENSP00000269305:T155P	T	-	1	0	TP53	7519192	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.301000	0.08232	0.124000	0.18369	0.533000	0.62120	ACC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	45	0.00	0	T	NM_000546		7578467	7578467	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	18	82.35	84	SNP	0.003	G
TREH	11181	genome.wustl.edu	37	11	118533617	118533617	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:118533617A>T	ENST00000529101.1	-	4	441	c.396T>A	c.(394-396)caT>caA	p.H132Q	TREH_ENST00000530256.1_Missense_Mutation_p.I12N|TREH_ENST00000525958.1_Missense_Mutation_p.H132Q|TREH_ENST00000264029.4_Missense_Mutation_p.H132Q|TREH_ENST00000397925.1_Missense_Mutation_p.H132Q			O43280	TREA_HUMAN	trehalase (brush-border membrane glycoprotein)	132					carbohydrate metabolic process (GO:0005975)|organ morphogenesis (GO:0009887)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|trehalose catabolic process (GO:0005993)|trehalose metabolic process (GO:0005991)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	alpha,alpha-trehalase activity (GO:0004555)			NS(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.16e-05)		TCCAGAGCTGATGCAGCTGCC	0.592																																						dbGAP											0													29.0	32.0	31.0					11																	118533617		1989	4159	6148	-	-	-	SO:0001583	missense	0			AB000824	CCDS73401.1, CCDS73402.1	11q23.3	2008-07-21				ENSG00000118094	3.2.1.28		12266	protein-coding gene	gene with protein product	"""alpha,alpha-trehalase"", ""alpha,alpha-trehalose glucohydrolase"""	275360				9427547	Standard	NM_007180		Approved	TRE, TREA, MGC129621	uc001pty.1	O43280		ENST00000529101.1:c.396T>A	11.37:g.118533617A>T	ENSP00000435095:p.His132Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MB9|Q53FY8	Missense_Mutation	SNP	pfam_Glyco_hydro_37,superfamily_6-hairpin_glycosidase-like,prints_Glyco_hydro_37	p.H132Q	ENST00000529101.1	37	c.396		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	11.78|11.78	1.740069|1.740069	0.30865|0.30865	.|.	.|.	ENSG00000118094|ENSG00000118094	ENST00000529101;ENST00000264029;ENST00000525958;ENST00000397925|ENST00000530256;ENST00000450700	T;T;T;T|T	0.43688|0.15603	0.94;0.94;0.94;0.94|2.41	4.74|4.74	1.63|1.63	0.23807|0.23807	Six-hairpin glycosidase-like (1);|.	0.287772|.	0.37857|.	N|.	0.001919|.	T|T	0.11196|0.11196	0.0273|0.0273	.|.	.|.	.|.	0.21553|0.21553	N|N	0.999642|0.999642	D;D|B	0.76494|0.23058	0.999;0.996|0.079	D;D|B	0.73380|0.21360	0.98;0.979|0.034	T|T	0.30031|0.30031	-0.9992|-0.9992	9|8	0.72032|0.31617	D|T	0.01|0.26	-21.5661|-21.5661	8.0069|8.0069	0.30329|0.30329	0.3027:0.0:0.6973:0.0|0.3027:0.0:0.6973:0.0	.|.	132;132|12	E9PNA2;O43280|E9PPK1	.;TREA_HUMAN|.	Q|N	132|12	ENSP00000435095:H132Q;ENSP00000264029:H132Q;ENSP00000432853:H132Q;ENSP00000381020:H132Q|ENSP00000432640:I12N	ENSP00000264029:H132Q|ENSP00000398042:I12N	H|I	-|-	3|2	2|0	TREH|TREH	118038827|118038827	0.035000|0.035000	0.19736|0.19736	0.997000|0.997000	0.53966|0.53966	0.977000|0.977000	0.68977|0.68977	0.238000|0.238000	0.18004|0.18004	0.628000|0.628000	0.30357|0.30357	-0.251000|-0.251000	0.11542|0.11542	CAT|ATC	TREH	-	pfam_Glyco_hydro_37,superfamily_6-hairpin_glycosidase-like	ENSG00000118094		0.592	TREH-001	KNOWN	basic|appris_candidate	protein_coding	TREH	HGNC	protein_coding	OTTHUMT00000389639.1	26	0.00	0	A	NM_007180		118533617	118533617	-1	no_errors	ENST00000264029	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	0.943	T
TREH	11181	genome.wustl.edu	37	11	118533617	118533617	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:118533617A>T	ENST00000529101.1	-	4	441	c.396T>A	c.(394-396)caT>caA	p.H132Q	TREH_ENST00000530256.1_Missense_Mutation_p.I12N|TREH_ENST00000525958.1_Missense_Mutation_p.H132Q|TREH_ENST00000264029.4_Missense_Mutation_p.H132Q|TREH_ENST00000397925.1_Missense_Mutation_p.H132Q			O43280	TREA_HUMAN	trehalase (brush-border membrane glycoprotein)	132					carbohydrate metabolic process (GO:0005975)|organ morphogenesis (GO:0009887)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|trehalose catabolic process (GO:0005993)|trehalose metabolic process (GO:0005991)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	alpha,alpha-trehalase activity (GO:0004555)			NS(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.16e-05)		TCCAGAGCTGATGCAGCTGCC	0.592																																						dbGAP											0													29.0	32.0	31.0					11																	118533617		1989	4159	6148	-	-	-	SO:0001583	missense	0			AB000824	CCDS73401.1, CCDS73402.1	11q23.3	2008-07-21				ENSG00000118094	3.2.1.28		12266	protein-coding gene	gene with protein product	"""alpha,alpha-trehalase"", ""alpha,alpha-trehalose glucohydrolase"""	275360				9427547	Standard	NM_007180		Approved	TRE, TREA, MGC129621	uc001pty.1	O43280		ENST00000529101.1:c.396T>A	11.37:g.118533617A>T	ENSP00000435095:p.His132Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MB9|Q53FY8	Missense_Mutation	SNP	pfam_Glyco_hydro_37,superfamily_6-hairpin_glycosidase-like,prints_Glyco_hydro_37	p.H132Q	ENST00000529101.1	37	c.396		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	11.78|11.78	1.740069|1.740069	0.30865|0.30865	.|.	.|.	ENSG00000118094|ENSG00000118094	ENST00000529101;ENST00000264029;ENST00000525958;ENST00000397925|ENST00000530256;ENST00000450700	T;T;T;T|T	0.43688|0.15603	0.94;0.94;0.94;0.94|2.41	4.74|4.74	1.63|1.63	0.23807|0.23807	Six-hairpin glycosidase-like (1);|.	0.287772|.	0.37857|.	N|.	0.001919|.	T|T	0.11196|0.11196	0.0273|0.0273	.|.	.|.	.|.	0.21553|0.21553	N|N	0.999642|0.999642	D;D|B	0.76494|0.23058	0.999;0.996|0.079	D;D|B	0.73380|0.21360	0.98;0.979|0.034	T|T	0.30031|0.30031	-0.9992|-0.9992	9|8	0.72032|0.31617	D|T	0.01|0.26	-21.5661|-21.5661	8.0069|8.0069	0.30329|0.30329	0.3027:0.0:0.6973:0.0|0.3027:0.0:0.6973:0.0	.|.	132;132|12	E9PNA2;O43280|E9PPK1	.;TREA_HUMAN|.	Q|N	132|12	ENSP00000435095:H132Q;ENSP00000264029:H132Q;ENSP00000432853:H132Q;ENSP00000381020:H132Q|ENSP00000432640:I12N	ENSP00000264029:H132Q|ENSP00000398042:I12N	H|I	-|-	3|2	2|0	TREH|TREH	118038827|118038827	0.035000|0.035000	0.19736|0.19736	0.997000|0.997000	0.53966|0.53966	0.977000|0.977000	0.68977|0.68977	0.238000|0.238000	0.18004|0.18004	0.628000|0.628000	0.30357|0.30357	-0.251000|-0.251000	0.11542|0.11542	CAT|ATC	TREH	-	pfam_Glyco_hydro_37,superfamily_6-hairpin_glycosidase-like	ENSG00000118094		0.592	TREH-001	KNOWN	basic|appris_candidate	protein_coding	TREH	HGNC	protein_coding	OTTHUMT00000389639.1	10	0.00	0	A	NM_007180		118533617	118533617	-1	no_errors	ENST00000264029	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	0.943	T
TRERF1	55809	genome.wustl.edu	37	6	42224823	42224823	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr6:42224823A>T	ENST00000372922.4	-	11	2916	c.2354T>A	c.(2353-2355)tTg>tAg	p.L785*	TRERF1_ENST00000541110.1_Nonsense_Mutation_p.L805*|TRERF1_ENST00000340840.2_Nonsense_Mutation_p.L702*|TRERF1_ENST00000372917.4_Nonsense_Mutation_p.L702*|TRERF1_ENST00000354325.2_Nonsense_Mutation_p.L702*	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	785	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTGGAATCTCAAGCCAATGTT	0.463																																						dbGAP											0													143.0	136.0	138.0					6																	42224823		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2354T>A	6.37:g.42224823A>T	ENSP00000362013:p.Leu785*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Nonsense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.L805*	ENST00000372922.4	37	c.2414	CCDS4867.1	6	.	.	.	.	.	.	.	.	.	.	A	45	11.819823	0.99606	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	.	.	.	5.74	4.58	0.56647	.	0.528175	0.16162	N	0.226713	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-5.2221	4.8466	0.13516	0.7458:0.0:0.2542:0.0	.	.	.	.	X	805;702;785;702;702	.	ENSP00000339438:L702X	L	-	2	0	TRERF1	42332801	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	2.808000	0.47963	2.317000	0.78254	0.460000	0.39030	TTG	TRERF1	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000124496		0.463	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	184	0.00	0	A	NM_033502		42224823	42224823	-1	no_errors	ENST00000541110	ensembl	human	known	69_37n	nonsense	53	56.56	69	SNP	0.997	T
TRERF1	55809	genome.wustl.edu	37	6	42224823	42224823	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr6:42224823A>T	ENST00000372922.4	-	11	2916	c.2354T>A	c.(2353-2355)tTg>tAg	p.L785*	TRERF1_ENST00000541110.1_Nonsense_Mutation_p.L805*|TRERF1_ENST00000340840.2_Nonsense_Mutation_p.L702*|TRERF1_ENST00000372917.4_Nonsense_Mutation_p.L702*|TRERF1_ENST00000354325.2_Nonsense_Mutation_p.L702*	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	785	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTGGAATCTCAAGCCAATGTT	0.463																																						dbGAP											0													143.0	136.0	138.0					6																	42224823		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2354T>A	6.37:g.42224823A>T	ENSP00000362013:p.Leu785*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Nonsense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.L805*	ENST00000372922.4	37	c.2414	CCDS4867.1	6	.	.	.	.	.	.	.	.	.	.	A	45	11.819823	0.99606	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	.	.	.	5.74	4.58	0.56647	.	0.528175	0.16162	N	0.226713	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-5.2221	4.8466	0.13516	0.7458:0.0:0.2542:0.0	.	.	.	.	X	805;702;785;702;702	.	ENSP00000339438:L702X	L	-	2	0	TRERF1	42332801	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	2.808000	0.47963	2.317000	0.78254	0.460000	0.39030	TTG	TRERF1	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000124496		0.463	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	94	0.00	0	A	NM_033502		42224823	42224823	-1	no_errors	ENST00000541110	ensembl	human	known	69_37n	nonsense	53	56.56	69	SNP	0.997	T
TRIM46	80128	genome.wustl.edu	37	1	155152365	155152365	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr1:155152365G>T	ENST00000334634.4	+	8	1543	c.1543G>T	c.(1543-1545)Ggc>Tgc	p.G515C	TRIM46_ENST00000543729.1_3'UTR|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368382.1_Missense_Mutation_p.G492C|TRIM46_ENST00000368385.4_Missense_Mutation_p.G515C|TRIM46_ENST00000392451.2_3'UTR|TRIM46_ENST00000545012.1_Missense_Mutation_p.G389C|TRIM46_ENST00000368383.3_Missense_Mutation_p.G515C|RP11-201K10.3_ENST00000473363.2_Intron	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	515	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGCCGGCTACGGCGAATACAG	0.657																																						dbGAP											0													30.0	32.0	31.0					1																	155152365		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1543G>T	1.37:g.155152365G>T	ENSP00000334657:p.Gly515Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.G515C	ENST00000334634.4	37	c.1543	CCDS1097.1	1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456270	0.43634	.	.	ENSG00000163462	ENST00000430513;ENST00000368385;ENST00000545012;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	3.55	3.55	0.40652	Fibronectin, type III (3);B30.2/SPRY domain (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.56247	0.1972	M	0.78049	2.395	0.52501	D	0.999951	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.987;1.0;0.991;1.0	T	0.63431	-0.6639	10	0.87932	D	0	.	13.0312	0.58842	0.0:0.0:1.0:0.0	.	515;492;515;515	Q5VT61;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;TRI46_HUMAN;.	C	473;515;389;515;492;515	ENSP00000357369:G515C;ENSP00000440254:G389C;ENSP00000357367:G515C;ENSP00000357366:G492C;ENSP00000334657:G515C	ENSP00000334657:G515C	G	+	1	0	TRIM46	153418989	1.000000	0.71417	1.000000	0.80357	0.155000	0.21991	5.559000	0.67326	2.011000	0.59026	0.462000	0.41574	GGC	TRIM46	-	superfamily_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	ENSG00000163462		0.657	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	HGNC	protein_coding	OTTHUMT00000086728.1	17	0.00	0	G	NM_025058		155152365	155152365	+1	no_errors	ENST00000334634	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	1.000	T
TRIM46	80128	genome.wustl.edu	37	1	155152365	155152365	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr1:155152365G>T	ENST00000334634.4	+	8	1543	c.1543G>T	c.(1543-1545)Ggc>Tgc	p.G515C	TRIM46_ENST00000543729.1_3'UTR|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368382.1_Missense_Mutation_p.G492C|TRIM46_ENST00000368385.4_Missense_Mutation_p.G515C|TRIM46_ENST00000392451.2_3'UTR|TRIM46_ENST00000545012.1_Missense_Mutation_p.G389C|TRIM46_ENST00000368383.3_Missense_Mutation_p.G515C|RP11-201K10.3_ENST00000473363.2_Intron	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	515	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGCCGGCTACGGCGAATACAG	0.657																																						dbGAP											0													30.0	32.0	31.0					1																	155152365		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1543G>T	1.37:g.155152365G>T	ENSP00000334657:p.Gly515Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.G515C	ENST00000334634.4	37	c.1543	CCDS1097.1	1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456270	0.43634	.	.	ENSG00000163462	ENST00000430513;ENST00000368385;ENST00000545012;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	3.55	3.55	0.40652	Fibronectin, type III (3);B30.2/SPRY domain (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.56247	0.1972	M	0.78049	2.395	0.52501	D	0.999951	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.987;1.0;0.991;1.0	T	0.63431	-0.6639	10	0.87932	D	0	.	13.0312	0.58842	0.0:0.0:1.0:0.0	.	515;492;515;515	Q5VT61;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;TRI46_HUMAN;.	C	473;515;389;515;492;515	ENSP00000357369:G515C;ENSP00000440254:G389C;ENSP00000357367:G515C;ENSP00000357366:G492C;ENSP00000334657:G515C	ENSP00000334657:G515C	G	+	1	0	TRIM46	153418989	1.000000	0.71417	1.000000	0.80357	0.155000	0.21991	5.559000	0.67326	2.011000	0.59026	0.462000	0.41574	GGC	TRIM46	-	superfamily_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	ENSG00000163462		0.657	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	HGNC	protein_coding	OTTHUMT00000086728.1	9	0.00	0	G	NM_025058		155152365	155152365	+1	no_errors	ENST00000334634	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	1.000	T
TRPV2	51393	genome.wustl.edu	37	17	16335509	16335509	+	Silent	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:16335509C>A	ENST00000338560.7	+	12	2283	c.1884C>A	c.(1882-1884)gcC>gcA	p.A628A	TRPV2_ENST00000583241.1_3'UTR|TRPV2_ENST00000577397.1_Silent_p.A198A	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	628					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TGCTGCTGGCCTACGTGCTGC	0.597																																						dbGAP											0													77.0	72.0	74.0					17																	16335509		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1884C>A	17.37:g.16335509C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	NULL	p.L44I	ENST00000338560.7	37	c.130	CCDS32576.1	17																																																																																			TRPV2	-	NULL	ENSG00000187688		0.597	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	HGNC	protein_coding	OTTHUMT00000130464.2	70	0.00	0	C	NM_016113		16335509	16335509	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000580788	ensembl	human	putative	69_37n	missense	65	19.75	16	SNP	0.712	A
TRPV2	51393	genome.wustl.edu	37	17	16335509	16335509	+	Silent	SNP	C	C	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr17:16335509C>A	ENST00000338560.7	+	12	2283	c.1884C>A	c.(1882-1884)gcC>gcA	p.A628A	TRPV2_ENST00000583241.1_3'UTR|TRPV2_ENST00000577397.1_Silent_p.A198A	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	628					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TGCTGCTGGCCTACGTGCTGC	0.597																																						dbGAP											0													77.0	72.0	74.0					17																	16335509		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1884C>A	17.37:g.16335509C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	NULL	p.L44I	ENST00000338560.7	37	c.130	CCDS32576.1	17																																																																																			TRPV2	-	NULL	ENSG00000187688		0.597	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	HGNC	protein_coding	OTTHUMT00000130464.2	41	0.00	0	C	NM_016113		16335509	16335509	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000580788	ensembl	human	putative	69_37n	missense	65	19.75	16	SNP	0.712	A
TSHZ3	57616	genome.wustl.edu	37	19	31767507	31767507	+	Silent	SNP	G	G	A	rs201875959		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr19:31767507G>A	ENST00000240587.4	-	2	3519	c.3192C>T	c.(3190-3192)caC>caT	p.H1064H		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	1064					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GAGATTTCCCGTGTGTTTTGC	0.478													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20918	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													156.0	148.0	150.0					19																	31767507		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.3192C>T	19.37:g.31767507G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.H1064	ENST00000240587.4	37	c.3192	CCDS12421.2	19																																																																																			TSHZ3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000121297		0.478	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	79	0.00	0	G	NM_020856		31767507	31767507	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	silent	56	41.67	40	SNP	0.998	A
TSHZ3	57616	genome.wustl.edu	37	19	31767507	31767507	+	Silent	SNP	G	G	A	rs201875959		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr19:31767507G>A	ENST00000240587.4	-	2	3519	c.3192C>T	c.(3190-3192)caC>caT	p.H1064H		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	1064					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GAGATTTCCCGTGTGTTTTGC	0.478													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20918	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													156.0	148.0	150.0					19																	31767507		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.3192C>T	19.37:g.31767507G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.H1064	ENST00000240587.4	37	c.3192	CCDS12421.2	19																																																																																			TSHZ3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000121297		0.478	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	116	0.00	0	G	NM_020856		31767507	31767507	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	silent	56	41.67	40	SNP	0.998	A
TTN	7273	genome.wustl.edu	37	2	179641483	179641483	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr2:179641483G>A	ENST00000591111.1	-	28	5332	c.5108C>T	c.(5107-5109)cCa>cTa	p.P1703L	TTN_ENST00000589042.1_Missense_Mutation_p.P1703L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P1657L|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P1703L|TTN_ENST00000360870.5_Missense_Mutation_p.P1703L|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P1657L|TTN_ENST00000342175.6_Missense_Mutation_p.P1657L			Q8WZ42	TITIN_HUMAN	titin	12532	Ig-like 8.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTGAAAAATGGTTTCTGTTG	0.473																																						dbGAP											0													93.0	85.0	88.0					2																	179641483		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5108C>T	2.37:g.179641483G>A	ENSP00000465570:p.Pro1703Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P1703L	ENST00000591111.1	37	c.5108		2	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031346	0.35797	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27	5.34	5.34	0.76211	Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.95639	0.8582	H	0.94698	3.57	0.58432	D	0.999995	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0	D	0.96668	0.9494	9	0.87932	D	0	.	19.0493	0.93036	0.0:0.0:1.0:0.0	.	1657;1657;1657;1703;1703	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	L	1703;1657;1657;1657;1657;1703	ENSP00000343764:P1703L;ENSP00000434586:P1657L;ENSP00000340554:P1657L;ENSP00000352154:P1657L;ENSP00000354117:P1703L	ENSP00000340554:P1657L	P	-	2	0	TTN	179349728	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.789000	0.99068	2.522000	0.85027	0.655000	0.94253	CCA	TTN	-	superfamily_RNaseH-like_dom,pfscan_Ig-like	ENSG00000155657		0.473	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	167	0.00	0	G	NM_133378		179641483	179641483	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	82	31.09	37	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179641483	179641483	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr2:179641483G>A	ENST00000591111.1	-	28	5332	c.5108C>T	c.(5107-5109)cCa>cTa	p.P1703L	TTN_ENST00000589042.1_Missense_Mutation_p.P1703L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P1657L|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P1703L|TTN_ENST00000360870.5_Missense_Mutation_p.P1703L|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P1657L|TTN_ENST00000342175.6_Missense_Mutation_p.P1657L			Q8WZ42	TITIN_HUMAN	titin	12532	Ig-like 8.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTGAAAAATGGTTTCTGTTG	0.473																																						dbGAP											0													93.0	85.0	88.0					2																	179641483		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5108C>T	2.37:g.179641483G>A	ENSP00000465570:p.Pro1703Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P1703L	ENST00000591111.1	37	c.5108		2	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031346	0.35797	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27	5.34	5.34	0.76211	Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.95639	0.8582	H	0.94698	3.57	0.58432	D	0.999995	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0	D	0.96668	0.9494	9	0.87932	D	0	.	19.0493	0.93036	0.0:0.0:1.0:0.0	.	1657;1657;1657;1703;1703	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	L	1703;1657;1657;1657;1657;1703	ENSP00000343764:P1703L;ENSP00000434586:P1657L;ENSP00000340554:P1657L;ENSP00000352154:P1657L;ENSP00000354117:P1703L	ENSP00000340554:P1657L	P	-	2	0	TTN	179349728	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.789000	0.99068	2.522000	0.85027	0.655000	0.94253	CCA	TTN	-	superfamily_RNaseH-like_dom,pfscan_Ig-like	ENSG00000155657		0.473	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	217	0.00	0	G	NM_133378		179641483	179641483	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	82	31.09	37	SNP	1.000	A
VCAN	1462	genome.wustl.edu	37	5	82843850	82843850	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr5:82843850A>C	ENST00000265077.3	+	10	10005	c.9440A>C	c.(9439-9441)aAc>aCc	p.N3147T	VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Missense_Mutation_p.N1345T|VCAN_ENST00000343200.5_Missense_Mutation_p.N2160T|VCAN_ENST00000502527.2_Missense_Mutation_p.N406T|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Missense_Mutation_p.N1393T	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3147	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GATGGTTTTAACACATTCAGG	0.353																																						dbGAP											0													213.0	195.0	201.0					5																	82843850		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9440A>C	5.37:g.82843850A>C	ENSP00000265077:p.Asn3147Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.N3147T	ENST00000265077.3	37	c.9440	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	17.70	3.453890	0.63290	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86	5.57	5.57	0.84162	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000012	D	0.94525	0.8237	M	0.66560	2.04	0.34473	D	0.703058	D;P;P;D	0.89917	1.0;0.902;0.876;1.0	D;B;P;D	0.81914	0.973;0.318;0.858;0.995	D	0.97802	1.0245	10	0.87932	D	0	.	15.7388	0.77870	1.0:0.0:0.0:0.0	.	1393;406;2160;3147	P13611-3;P13611-4;P13611-2;P13611	.;.;.;CSPG2_HUMAN	T	3147;2160;1393;1345;406	ENSP00000265077:N3147T;ENSP00000340062:N2160T;ENSP00000342768:N1393T;ENSP00000425959:N1345T;ENSP00000421362:N406T	ENSP00000265077:N3147T	N	+	2	0	VCAN	82879606	1.000000	0.71417	0.667000	0.29798	0.961000	0.63080	4.266000	0.58871	2.119000	0.64992	0.533000	0.62120	AAC	VCAN	-	pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000038427		0.353	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	150	0.00	0	A	NM_004385		82843850	82843850	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	109	22.70	32	SNP	0.991	C
VCAN	1462	genome.wustl.edu	37	5	82843850	82843850	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr5:82843850A>C	ENST00000265077.3	+	10	10005	c.9440A>C	c.(9439-9441)aAc>aCc	p.N3147T	VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Missense_Mutation_p.N1345T|VCAN_ENST00000343200.5_Missense_Mutation_p.N2160T|VCAN_ENST00000502527.2_Missense_Mutation_p.N406T|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Missense_Mutation_p.N1393T	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3147	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GATGGTTTTAACACATTCAGG	0.353																																						dbGAP											0													213.0	195.0	201.0					5																	82843850		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9440A>C	5.37:g.82843850A>C	ENSP00000265077:p.Asn3147Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.N3147T	ENST00000265077.3	37	c.9440	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	17.70	3.453890	0.63290	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86	5.57	5.57	0.84162	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000012	D	0.94525	0.8237	M	0.66560	2.04	0.34473	D	0.703058	D;P;P;D	0.89917	1.0;0.902;0.876;1.0	D;B;P;D	0.81914	0.973;0.318;0.858;0.995	D	0.97802	1.0245	10	0.87932	D	0	.	15.7388	0.77870	1.0:0.0:0.0:0.0	.	1393;406;2160;3147	P13611-3;P13611-4;P13611-2;P13611	.;.;.;CSPG2_HUMAN	T	3147;2160;1393;1345;406	ENSP00000265077:N3147T;ENSP00000340062:N2160T;ENSP00000342768:N1393T;ENSP00000425959:N1345T;ENSP00000421362:N406T	ENSP00000265077:N3147T	N	+	2	0	VCAN	82879606	1.000000	0.71417	0.667000	0.29798	0.961000	0.63080	4.266000	0.58871	2.119000	0.64992	0.533000	0.62120	AAC	VCAN	-	pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000038427		0.353	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	258	0.00	0	A	NM_004385		82843850	82843850	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	109	22.70	32	SNP	0.991	C
VWA3B	200403	genome.wustl.edu	37	2	98928506	98928507	+	Intron	INS	-	-	G	rs374561862|rs550251243	byFrequency	TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr2:98928506_98928507insG	ENST00000477737.1	+	27	3939				VWA3B_ENST00000490947.2_Intron	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GTTTGGGTGATGGGGGGGGAAC	0.594													GGGGGGG|GGGGGGGG|GGGGGGGGG|cryptic_indel	5	0.000998403	0.0023	0.0	5008	,	,		17671	0.002		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3735+11->G	2.37:g.98928514_98928514dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Frame_Shift_Ins	INS	pfscan_VWF_A	p.T662fs	ENST00000477737.1	37	c.1977_1978	CCDS42718.1	2																																																																																			VWA3B	-	NULL	ENSG00000168658		0.594	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2	18	0.00	0	-	NM_144992		98928506	98928507	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000473149	ensembl	human	putative	69_37n	frame_shift_ins	21	12.50	3	INS	0.000:0.004	G
ZAN	7455	genome.wustl.edu	37	7	100377343	100377343	+	RNA	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr7:100377343C>T	ENST00000348028.3	+	0	6757				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGGCTCAAGCCCCCACTCTGG	0.627																																						dbGAP											0													11.0	13.0	12.0					7																	100377343		1898	4079	5977	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100377343C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.P2197L	ENST00000348028.3	37	c.6590		7	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335643	0.41398	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.73897	-0.79;-0.79;-0.79	4.08	3.2	0.36748	Uncharacterised domain, cysteine-rich (2);	0.875908	0.09475	N	0.797166	T	0.68054	0.2959	.	.	.	0.19300	N	0.999978	P;P	0.44139	0.793;0.827	B;P	0.46917	0.396;0.531	T	0.54063	-0.8349	9	0.22109	T	0.4	.	7.7333	0.28799	0.0:0.8869:0.0:0.1131	.	2197;2198	F5H0T8;Q9Y493	.;ZAN_HUMAN	L	2197	ENSP00000445943:P2197L;ENSP00000445091:P2197L;ENSP00000444427:P2197L	ENSP00000445091:P2197L	P	+	2	0	ZAN	100215279	0.002000	0.14202	0.008000	0.14137	0.971000	0.66376	1.500000	0.35682	1.327000	0.45338	0.558000	0.71614	CCC	ZAN	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000146839		0.627	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	11	0.00	0	C	NM_003386		100377343	100377343	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.010	T
ZFPL1	7542	genome.wustl.edu	37	11	64853916	64853916	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr11:64853916C>T	ENST00000294258.3	+	4	396	c.244C>T	c.(244-246)Cgt>Tgt	p.R82C	AP003068.6_ENST00000525544.2_5'Flank|CDCA5_ENST00000275517.3_5'Flank|CDCA5_ENST00000404147.3_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	82					regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						CCTCAATGAACGTGCTGCCCA	0.597																																						dbGAP											0													191.0	197.0	195.0					11																	64853916		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.244C>T	11.37:g.64853916C>T	ENSP00000294258:p.Arg82Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7E9|O14616|Q9UID0	Missense_Mutation	SNP	NULL	p.R82C	ENST00000294258.3	37	c.244	CCDS8092.1	11	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782832	0.70222	.	.	ENSG00000162300	ENST00000294258;ENST00000526334;ENST00000526945;ENST00000532200	T;T;T	0.67698	-0.28;0.98;-0.28	5.46	4.55	0.56014	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.197100	0.44097	N	0.000481	T	0.52757	0.1754	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.50701	-0.8797	10	0.51188	T	0.08	-1.3262	8.2324	0.31605	0.0:0.8207:0.0:0.1793	.	82	O95159	ZFPL1_HUMAN	C	82;82;76;82	ENSP00000294258:R82C;ENSP00000434454:R82C;ENSP00000437090:R82C	ENSP00000294258:R82C	R	+	1	0	ZFPL1	64610492	0.486000	0.25980	1.000000	0.80357	0.992000	0.81027	0.309000	0.19332	1.316000	0.45131	0.456000	0.33151	CGT	ZFPL1	-	NULL	ENSG00000162300		0.597	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPL1	HGNC	protein_coding	OTTHUMT00000385196.1	405	0.00	0	C	NM_006782		64853916	64853916	+1	no_errors	ENST00000294258	ensembl	human	known	69_37n	missense	93	36.30	53	SNP	1.000	T
ZFPL1	7542	genome.wustl.edu	37	11	64853916	64853916	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr11:64853916C>T	ENST00000294258.3	+	4	396	c.244C>T	c.(244-246)Cgt>Tgt	p.R82C	AP003068.6_ENST00000525544.2_5'Flank|CDCA5_ENST00000275517.3_5'Flank|CDCA5_ENST00000404147.3_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	82					regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						CCTCAATGAACGTGCTGCCCA	0.597																																						dbGAP											0													191.0	197.0	195.0					11																	64853916		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.244C>T	11.37:g.64853916C>T	ENSP00000294258:p.Arg82Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7E9|O14616|Q9UID0	Missense_Mutation	SNP	NULL	p.R82C	ENST00000294258.3	37	c.244	CCDS8092.1	11	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782832	0.70222	.	.	ENSG00000162300	ENST00000294258;ENST00000526334;ENST00000526945;ENST00000532200	T;T;T	0.67698	-0.28;0.98;-0.28	5.46	4.55	0.56014	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.197100	0.44097	N	0.000481	T	0.52757	0.1754	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.50701	-0.8797	10	0.51188	T	0.08	-1.3262	8.2324	0.31605	0.0:0.8207:0.0:0.1793	.	82	O95159	ZFPL1_HUMAN	C	82;82;76;82	ENSP00000294258:R82C;ENSP00000434454:R82C;ENSP00000437090:R82C	ENSP00000294258:R82C	R	+	1	0	ZFPL1	64610492	0.486000	0.25980	1.000000	0.80357	0.992000	0.81027	0.309000	0.19332	1.316000	0.45131	0.456000	0.33151	CGT	ZFPL1	-	NULL	ENSG00000162300		0.597	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPL1	HGNC	protein_coding	OTTHUMT00000385196.1	82	0.00	0	C	NM_006782		64853916	64853916	+1	no_errors	ENST00000294258	ensembl	human	known	69_37n	missense	93	36.30	53	SNP	1.000	T
ZNF831	128611	genome.wustl.edu	37	20	57766219	57766220	+	Frame_Shift_Ins	INS	-	-	C	rs570895195		TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr20:57766219_57766220insC	ENST00000371030.2	+	1	145_146	c.145_146insC	c.(145-147)gccfs	p.A49fs		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	49	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.T52fs*47(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCAGGGCCTGGCCCCCCCCACT	0.728																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)								44,3536		1,42,1747						2.3	0.9			18	50,7732		0,50,3841	no	frameshift	ZNF831	NM_178457.1		1,92,5588	A1A1,A1R,RR		0.6425,1.2291,0.8273				94,11268				-	-	-	SO:0001589	frameshift_variant	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.153dupC	20.37:g.57766227_57766227dupC	ENSP00000360069:p.Ala49fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDR4|Q8TCP0	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T52fs	ENST00000371030.2	37	c.145_146	CCDS42894.1	20																																																																																			ZNF831	-	NULL	ENSG00000124203		0.728	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	11	0.00	0	-	NM_178457		57766219	57766220	+1	no_errors	ENST00000371030	ensembl	human	novel	69_37n	frame_shift_ins	7	36.36	4	INS	0.658:0.643	C
ZZEF1	23140	genome.wustl.edu	37	17	3954156	3954156	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	40f1c52b-2063-4541-8600-865735b708b0	g.chr17:3954156T>C	ENST00000381638.2	-	36	5906	c.5782A>G	c.(5782-5784)Acg>Gcg	p.T1928A		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1928							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CTGCTGCGCGTCTGGGGGTCC	0.597																																						dbGAP											0													64.0	59.0	61.0					17																	3954156		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.5782A>G	17.37:g.3954156T>C	ENSP00000371051:p.Thr1928Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB,smart_EF_hand_Ca-bd,smart_Znf_ZZ,pfscan_EF_HAND_2,pfscan_Znf_ZZ	p.T1928A	ENST00000381638.2	37	c.5782	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	T	1.647	-0.514882	0.04200	.	.	ENSG00000074755	ENST00000381638	T	0.19532	2.14	5.66	4.69	0.59074	.	0.616958	0.17746	N	0.163381	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.22208	-1.0223	10	0.06365	T	0.9	-0.3777	13.8121	0.63270	0.0:0.9252:0.0:0.0748	.	1928;1928	O43149-2;O43149	.;ZZEF1_HUMAN	A	1928	ENSP00000371051:T1928A	ENSP00000371051:T1928A	T	-	1	0	ZZEF1	3900905	0.001000	0.12720	0.646000	0.29493	0.198000	0.23893	0.934000	0.28910	1.353000	0.45828	-0.242000	0.12053	ACG	ZZEF1	-	NULL	ENSG00000074755		0.597	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	167	0.00	0	T	NM_015113		3954156	3954156	-1	no_errors	ENST00000381638	ensembl	human	known	69_37n	missense	74	30.84	33	SNP	0.103	C
ZZEF1	23140	genome.wustl.edu	37	17	3954156	3954156	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0CE-01A-11W-A019-09	TCGA-A7-A0CE-11A-21W-A100-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e8c1bd4a-69aa-4496-96d0-d580d1ccc04c	4c81cd23-413c-45a2-bd6e-73212e75ab8c	g.chr17:3954156T>C	ENST00000381638.2	-	36	5906	c.5782A>G	c.(5782-5784)Acg>Gcg	p.T1928A		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1928							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CTGCTGCGCGTCTGGGGGTCC	0.597																																						dbGAP											0													64.0	59.0	61.0					17																	3954156		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.5782A>G	17.37:g.3954156T>C	ENSP00000371051:p.Thr1928Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB,smart_EF_hand_Ca-bd,smart_Znf_ZZ,pfscan_EF_HAND_2,pfscan_Znf_ZZ	p.T1928A	ENST00000381638.2	37	c.5782	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	T	1.647	-0.514882	0.04200	.	.	ENSG00000074755	ENST00000381638	T	0.19532	2.14	5.66	4.69	0.59074	.	0.616958	0.17746	N	0.163381	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.22208	-1.0223	10	0.06365	T	0.9	-0.3777	13.8121	0.63270	0.0:0.9252:0.0:0.0748	.	1928;1928	O43149-2;O43149	.;ZZEF1_HUMAN	A	1928	ENSP00000371051:T1928A	ENSP00000371051:T1928A	T	-	1	0	ZZEF1	3900905	0.001000	0.12720	0.646000	0.29493	0.198000	0.23893	0.934000	0.28910	1.353000	0.45828	-0.242000	0.12053	ACG	ZZEF1	-	NULL	ENSG00000074755		0.597	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	128	0.00	0	T	NM_015113		3954156	3954156	-1	no_errors	ENST00000381638	ensembl	human	known	69_37n	missense	74	30.84	33	SNP	0.103	C
