#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM2	2515	genome.wustl.edu	37	8	39634664	39634664	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr8:39634664C>A	ENST00000265708.4	-	11	1011	c.908G>T	c.(907-909)aGt>aTt	p.S303I	ADAM2_ENST00000521880.1_Missense_Mutation_p.S303I|ADAM2_ENST00000347580.4_Missense_Mutation_p.S284I|ADAM2_ENST00000379853.2_Missense_Mutation_p.S177I	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	303	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TGATTCCAGACTTATGGTTCT	0.373																																						dbGAP											0													69.0	68.0	69.0					8																	39634664		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.908G>T	8.37:g.39634664C>A	ENSP00000265708:p.Ser303Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	P78326|Q9UQQ8	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S303I	ENST00000265708.4	37	c.908	CCDS34884.1	8	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379555	0.24944	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.58	1.18	0.20946	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.69540	0.3122	L	0.39326	1.205	0.09310	N	1	P;D;D;D	0.69078	0.915;0.997;0.961;0.969	P;D;P;P	0.71184	0.835;0.972;0.817;0.835	T	0.62909	-0.6754	8	.	.	.	.	14.5239	0.67873	0.0:0.4492:0.5508:0.0	.	303;177;284;303	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	I	284;177;303;303	ENSP00000343854:S284I;ENSP00000369182:S177I;ENSP00000265708:S303I;ENSP00000429352:S303I	.	S	-	2	0	ADAM2	39753821	0.003000	0.15002	0.679000	0.29978	0.047000	0.14425	0.021000	0.13489	0.654000	0.30846	0.650000	0.86243	AGT	ADAM2	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000104755		0.373	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1	46	0.00	0	C	NM_001464		39634664	39634664	-1	no_errors	ENST00000265708	ensembl	human	known	69_37n	missense	100	26.47	36	SNP	0.056	A
AJUBA	84962	genome.wustl.edu	37	14	23451265	23451265	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr14:23451265C>A	ENST00000262713.2	-	1	586	c.211G>T	c.(211-213)Gac>Tac	p.D71Y	RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|AJUBA_ENST00000361265.4_Missense_Mutation_p.D71Y|RP11-298I3.5_ENST00000555074.1_Intron|RP11-298I3.4_ENST00000555294.1_RNA	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	71	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										CGCTCAGCGTCCAGGGAACCT	0.687																																						dbGAP											0													17.0	20.0	19.0					14																	23451265		2199	4295	6494	-	-	-	SO:0001583	missense	0			AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.211G>T	14.37:g.23451265C>A	ENSP00000262713:p.Asp71Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX18|D3DS37	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.D71Y	ENST00000262713.2	37	c.211	CCDS9581.1	14	.	.	.	.	.	.	.	.	.	.	C	7.247	0.602457	0.13939	.	.	ENSG00000129474	ENST00000262713;ENST00000361265	T;T	0.58940	0.3;0.3	4.45	4.45	0.53987	.	1.351450	0.04764	N	0.426775	T	0.37758	0.1015	N	0.08118	0	0.35948	D	0.833711	B	0.33379	0.41	B	0.23574	0.047	T	0.41251	-0.9519	10	0.87932	D	0	.	8.2532	0.31739	0.0:0.8938:0.0:0.1062	.	71	Q96IF1	JUB_HUMAN	Y	71	ENSP00000262713:D71Y;ENSP00000354491:D71Y	ENSP00000262713:D71Y	D	-	1	0	JUB	22521105	1.000000	0.71417	0.999000	0.59377	0.070000	0.16714	1.876000	0.39588	2.313000	0.78055	0.462000	0.41574	GAC	AJUBA	-	NULL	ENSG00000129474		0.687	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AJUBA	HGNC	protein_coding	OTTHUMT00000071685.2	31	0.00	0	C			23451265	23451265	-1	no_errors	ENST00000262713	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	0.946	A
ARHGAP11A	9824	genome.wustl.edu	37	15	32929935	32929935	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr15:32929935C>A	ENST00000361627.3	+	12	3683	c.2961C>A	c.(2959-2961)aaC>aaA	p.N987K	ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.N798K|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.N798K	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	987					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GGATAAATAACAGGGTCCTTA	0.403																																					Colon(45;757 1134 30003 36652)	dbGAP											0													50.0	52.0	51.0					15																	32929935		2196	4297	6493	-	-	-	SO:0001583	missense	0			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2961C>A	15.37:g.32929935C>A	ENSP00000355090:p.Asn987Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.N987K	ENST00000361627.3	37	c.2961	CCDS10028.1	15	.	.	.	.	.	.	.	.	.	.	C	1.203	-0.631808	0.03584	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.08193	3.12	4.74	-0.987	0.10249	.	1.102550	0.06817	N	0.791461	T	0.07052	0.0179	L	0.48362	1.52	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.43782	-0.9370	10	0.31617	T	0.26	.	2.041	0.03550	0.4839:0.1909:0.1743:0.151	.	987	Q6P4F7	RHGBA_HUMAN	K	987;798	ENSP00000355090:N987K	ENSP00000355090:N987K	N	+	3	2	ARHGAP11A	30717227	0.000000	0.05858	0.188000	0.23233	0.267000	0.26476	0.191000	0.17076	0.018000	0.15052	-0.218000	0.12543	AAC	ARHGAP11A	-	NULL	ENSG00000198826		0.403	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11A	HGNC	protein_coding	OTTHUMT00000251417.1	74	0.00	0	C	NM_014783		32929935	32929935	+1	no_errors	ENST00000361627	ensembl	human	known	69_37n	missense	75	23.47	23	SNP	0.019	A
ARL1	400	genome.wustl.edu	37	12	101790184	101790184	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr12:101790184T>C	ENST00000261636.8	-	5	682	c.508A>G	c.(508-510)Atg>Gtg	p.M170V	ARL1_ENST00000551671.1_Missense_Mutation_p.M170V|ARL1_ENST00000539055.1_Missense_Mutation_p.M124V|ARL1_ENST00000551828.1_Missense_Mutation_p.M153V|ARL1_ENST00000551688.1_Missense_Mutation_p.M41V|ARL1_ENST00000536227.1_Missense_Mutation_p.M153V	NM_001177.4	NP_001168.1	P40616	ARL1_HUMAN	ADP-ribosylation factor-like 1	170					activation of phospholipase D activity (GO:0031584)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)|toxin metabolic process (GO:0009404)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	enzyme activator activity (GO:0008047)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			central_nervous_system(1)|upper_aerodigestive_tract(1)	2		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)		TGCCATTCCATTGCCTCATCA	0.478																																						dbGAP											0													188.0	187.0	188.0					12																	101790184		2033	4194	6227	-	-	-	SO:0001583	missense	0			BX537387	CCDS44958.1, CCDS73510.1	12q23.3	2014-05-09						"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	692	protein-coding gene	gene with protein product		603425					Standard	XM_005268869		Approved	ARFL1	uc001tib.3	P40616	OTTHUMG00000170271	ENST00000261636.8:c.508A>G	12.37:g.101790184T>C	ENSP00000261636:p.Met170Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWW1|P80417|Q53XB1	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_MIRO-like,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.M170V	ENST00000261636.8	37	c.508	CCDS44958.1	12	.	.	.	.	.	.	.	.	.	.	T	18.17	3.564550	0.65651	.	.	ENSG00000120805	ENST00000261636;ENST00000539055;ENST00000536227;ENST00000551688;ENST00000551828;ENST00000551671	D;D;D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56;-1.56;-1.56	6.02	6.02	0.97574	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85141	0.5629	M	0.65498	2.005	0.80722	D	1	B;P;B	0.44195	0.008;0.828;0.01	B;P;B	0.45406	0.015;0.479;0.017	D	0.86888	0.2046	10	0.87932	D	0	-24.4541	16.5446	0.84426	0.0:0.0:0.0:1.0	.	124;170;170	B4DZG7;F8VYN9;P40616	.;.;ARL1_HUMAN	V	170;124;153;41;153;170	ENSP00000261636:M170V;ENSP00000439590:M124V;ENSP00000441808:M153V;ENSP00000447405:M41V;ENSP00000448850:M153V;ENSP00000448912:M170V	ENSP00000261636:M170V	M	-	1	0	ARL1	100314315	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.040000	0.89188	2.311000	0.77944	0.533000	0.62120	ATG	ARL1	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000120805		0.478	ARL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL1	HGNC	protein_coding	OTTHUMT00000408246.1	274	0.36	1	T	NM_001177		101790184	101790184	-1	no_errors	ENST00000261636	ensembl	human	known	69_37n	missense	336	17.65	72	SNP	1.000	C
ASB7	140460	genome.wustl.edu	37	15	101152633	101152636	+	Splice_Site	DEL	GTGA	GTGA	-			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	GTGA	GTGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr15:101152633_101152636delGTGA	ENST00000332783.7	+	4	996		c.e4+1		ASB7_ENST00000343276.4_Splice_Site|ASB7_ENST00000558747.1_Splice_Site	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			GAACACGGAGGTGAGTTTTGTAGA	0.382																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.211+1GTGA>-	15.37:g.101152633_101152636delGTGA		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1E5|Q6GSJ6|Q7Z4S3	Splice_Site	DEL	-	e1+1	ENST00000332783.7	37	c.211+1_211+1	CCDS10387.1	15																																																																																			ASB7	-	-	ENSG00000183475		0.382	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB7	HGNC	protein_coding	OTTHUMT00000313617.1	198	0.00	0	GTGA	NM_024708	Intron	101152633	101152636	+1	no_errors	ENST00000332783	ensembl	human	known	69_37n	splice_site_del	375	21.71	104	DEL	1.000:1.000:1.000:1.000	-
ATP10B	23120	genome.wustl.edu	37	5	160063260	160063260	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr5:160063260C>A	ENST00000327245.5	-	11	1903	c.1057G>T	c.(1057-1059)Gcc>Tcc	p.A353S	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	353					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGCCATTGGCATCTGGCACA	0.537																																						dbGAP											0													84.0	83.0	83.0					5																	160063260		1947	4146	6093	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1057G>T	5.37:g.160063260C>A	ENSP00000313600:p.Ala353Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.A353S	ENST00000327245.5	37	c.1057	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	4.259	0.047085	0.08243	.	.	ENSG00000118322	ENST00000327245	T	0.42900	0.96	5.18	3.37	0.38596	ATPase, P-type, ATPase-associated domain (1);	0.403149	0.28630	N	0.014672	T	0.22166	0.0534	N	0.13140	0.3	0.24518	N	0.994172	B;B;B;B	0.24092	0.045;0.018;0.097;0.016	B;B;B;B	0.25506	0.06;0.022;0.061;0.015	T	0.16897	-1.0387	9	.	.	.	.	6.4659	0.21981	0.1349:0.6616:0.1304:0.0731	.	397;353;325;353	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	S	353	ENSP00000313600:A353S	.	A	-	1	0	ATP10B	159995838	0.006000	0.16342	0.923000	0.36655	0.421000	0.31385	0.574000	0.23714	0.664000	0.31047	-0.266000	0.10368	GCC	ATP10B	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.537	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	101	0.00	0	C	NM_025153		160063260	160063260	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	63	42.20	46	SNP	0.592	A
ATP1A3	478	genome.wustl.edu	37	19	42474581	42474581	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr19:42474581C>A	ENST00000302102.5	-	17	2527	c.2377G>T	c.(2377-2379)Ggc>Tgc	p.G793C	ATP1A3_ENST00000543770.1_Missense_Mutation_p.G804C|ATP1A3_ENST00000545399.1_Missense_Mutation_p.G806C|ATP1A3_ENST00000602133.1_Missense_Mutation_p.G763C	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	793					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GTGATGGTGCCCAGGGGCAGC	0.612																																						dbGAP											0													142.0	117.0	126.0					19																	42474581		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2377G>T	19.37:g.42474581C>A	ENSP00000302397:p.Gly793Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.G806C	ENST00000302102.5	37	c.2416	CCDS12594.1	19	.	.	.	.	.	.	.	.	.	.	c	22.1	4.239476	0.79800	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82	3.82	3.82	0.43975	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.180744	0.47093	D	0.000256	D	0.98451	0.9484	H	0.97291	3.975	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98979	1.0804	10	0.87932	D	0	.	13.6262	0.62165	0.0:1.0:0.0:0.0	.	806;804;793;793	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	C	793;793;806;763;537;804	ENSP00000302397:G793C;ENSP00000411503:G793C;ENSP00000444688:G806C;ENSP00000437577:G804C	ENSP00000302397:G793C	G	-	1	0	ATP1A3	47166421	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.556000	0.82233	2.159000	0.67721	0.457000	0.33378	GGC	ATP1A3	-	pfam_ATPase_P-typ_cation-transptr_C,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000105409		0.612	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	HGNC	protein_coding	OTTHUMT00000268107.1	383	0.00	0	C	NM_152296		42474581	42474581	-1	no_errors	ENST00000545399	ensembl	human	known	69_37n	missense	394	20.40	101	SNP	1.000	A
ATP8B1	5205	genome.wustl.edu	37	18	55361813	55361813	+	Splice_Site	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr18:55361813C>T	ENST00000283684.4	-	10	1029		c.e10+1		ATP8B1_ENST00000536015.1_Splice_Site|RP11-35G9.3_ENST00000599199.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1						bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				AAAATAAATACCGTGTAAACC	0.308																																						dbGAP											0													131.0	131.0	131.0					18																	55361813		2201	4300	6501	-	-	-	SO:0001630	splice_region_variant	0			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.1029+1G>A	18.37:g.55361813C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTP8	Splice_Site	SNP	-	e10+1	ENST00000283684.4	37	c.1029+1	CCDS11965.1	18	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458171	0.84317	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5916	0.84767	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP8B1	53512811	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.685000	0.84117	2.448000	0.82819	0.609000	0.83330	.	ATP8B1	-	-	ENSG00000081923		0.308	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B1	HGNC	protein_coding	OTTHUMT00000256097.1	267	0.00	0	C	NM_005603	Intron	55361813	55361813	-1	no_errors	ENST00000283684	ensembl	human	known	69_37n	splice_site	266	13.07	40	SNP	1.000	T
ATP8B2	57198	genome.wustl.edu	37	1	154302873	154302873	+	Splice_Site	SNP	A	A	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:154302873A>C	ENST00000368489.3	+	3	132	c.132A>C	c.(130-132)gaA>gaC	p.E44D	ATP8B2_ENST00000368487.3_Splice_Site_p.E11D|ATP8B2_ENST00000426445.1_3'UTR|ATP8B2_ENST00000341822.2_Splice_Site_p.E30D	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	30					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTGTTGCAGAAGAAGAAAGGA	0.473																																						dbGAP											0													84.0	85.0	85.0					1																	154302873		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.131-1A>C	1.37:g.154302873A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.E44D	ENST00000368489.3	37	c.132	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370861	0.82573	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	T;T;T	0.62105	3.58;2.96;0.05	4.65	3.5	0.40072	.	1.557880	0.03820	N	0.267284	T	0.52996	0.1769	N	0.17800	0.525	0.49213	D	0.999764	B;D;P	0.55605	0.267;0.972;0.927	B;D;D	0.70935	0.217;0.971;0.953	T	0.59590	-0.7426	10	0.33141	T	0.24	.	6.4081	0.21676	0.8417:0.0:0.1583:0.0	.	30;44;11	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	D	11;44;30	ENSP00000357472:E11D;ENSP00000357475:E44D;ENSP00000340448:E30D	ENSP00000340448:E30D	E	+	3	2	ATP8B2	152569497	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.661000	0.61518	1.942000	0.56320	0.379000	0.24179	GAA	ATP8B2	-	NULL	ENSG00000143515		0.473	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	160	0.00	0	A	NM_020452	Missense_Mutation	154302873	154302873	+1	no_errors	ENST00000368489	ensembl	human	known	69_37n	missense	292	13.86	47	SNP	1.000	C
BCAT2	587	genome.wustl.edu	37	19	49302971	49302971	+	Missense_Mutation	SNP	C	C	T	rs11548194		TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr19:49302971C>T	ENST00000316273.6	-	6	668	c.656G>A	c.(655-657)cGg>cAg	p.R219Q	BCAT2_ENST00000545387.2_Missense_Mutation_p.R127Q|BCAT2_ENST00000598162.1_Missense_Mutation_p.R219Q|BCAT2_ENST00000599246.1_Missense_Mutation_p.R127Q|BCAT2_ENST00000402551.1_Missense_Mutation_p.R179Q|BCAT2_ENST00000597011.1_Missense_Mutation_p.R179Q	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	219					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	CACCCAGGCCCGGATGAAGGC	0.657																																						dbGAP											0													23.0	23.0	23.0					19																	49302971		2200	4288	6488	-	-	-	SO:0001583	missense	0			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.656G>A	19.37:g.49302971C>T	ENSP00000322991:p.Arg219Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.R219Q	ENST00000316273.6	37	c.656	CCDS12735.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.249309	0.95305	.	.	ENSG00000105552	ENST00000316273;ENST00000545387;ENST00000402551	T;T;T	0.28255	1.62;1.62;1.62	4.2	4.2	0.49525	.	0.061993	0.64402	D	0.000006	T	0.69735	0.3144	H	0.97874	4.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.996;0.999	T	0.82002	-0.0673	10	0.87932	D	0	-16.0213	14.425	0.67210	0.0:1.0:0.0:0.0	rs11548194	179;219;127;219	B3KSI3;Q53EW7;O15382-2;O15382	.;.;.;BCAT2_HUMAN	Q	219;127;179	ENSP00000322991:R219Q;ENSP00000440973:R127Q;ENSP00000385161:R179Q	ENSP00000322991:R219Q	R	-	2	0	BCAT2	53994783	0.994000	0.37717	0.519000	0.27824	0.942000	0.58702	6.667000	0.74451	2.342000	0.79632	0.491000	0.48974	CGG	BCAT2	-	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	ENSG00000105552		0.657	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	HGNC	protein_coding	OTTHUMT00000466202.1	42	0.00	0	C			49302971	49302971	-1	no_errors	ENST00000316273	ensembl	human	known	69_37n	missense	49	41.86	36	SNP	0.998	T
BEND7	222389	genome.wustl.edu	37	10	13522910	13522910	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr10:13522910C>G	ENST00000396900.2	-	6	1051	c.1052G>C	c.(1051-1053)gGt>gCt	p.G351A	BEND7_ENST00000341083.3_Missense_Mutation_p.G299A|BEND7_ENST00000396898.2_Missense_Mutation_p.G364A|BEND7_ENST00000378605.3_Missense_Mutation_p.G312A			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	351	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.					extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						TTTTATTGCACCCACAATATT	0.418																																						dbGAP											0													170.0	160.0	163.0					10																	13522910		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.1052G>C	10.37:g.13522910C>G	ENSP00000380108:p.Gly351Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Missense_Mutation	SNP	pfam_BEN_domain	p.G351A	ENST00000396900.2	37	c.1052		10	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136219	0.77662	.	.	ENSG00000165626	ENST00000396900;ENST00000341083;ENST00000440282;ENST00000396898;ENST00000378605	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.73	5.73	0.89815	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.48466	0.1501	N	0.08118	0	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.60276	-0.7295	10	0.87932	D	0	-12.4917	19.8841	0.96908	0.0:1.0:0.0:0.0	.	364;351;299	E5RFC0;Q8N7W2;Q8N7W2-3	.;BEND7_HUMAN;.	A	351;299;55;364;312	ENSP00000380108:G351A;ENSP00000345773:G299A;ENSP00000401256:G55A;ENSP00000380107:G364A;ENSP00000367868:G312A	ENSP00000345773:G299A	G	-	2	0	BEND7	13562916	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.883000	0.69721	2.713000	0.92767	0.655000	0.94253	GGT	BEND7	-	pfam_BEN_domain	ENSG00000165626		0.418	BEND7-202	KNOWN	basic	protein_coding	BEND7	HGNC	protein_coding		244	0.00	0	C	NM_152751		13522910	13522910	-1	no_errors	ENST00000396900	ensembl	human	known	69_37n	missense	619	14.62	106	SNP	1.000	G
C2orf71	388939	genome.wustl.edu	37	2	29294720	29294720	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:29294720G>T	ENST00000331664.5	-	1	2407	c.2408C>A	c.(2407-2409)cCt>cAt	p.P803H		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	803					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GGGAAAGATAGGTGCTAAGGG	0.537																																						dbGAP											0													79.0	80.0	80.0					2																	29294720		1971	4172	6143	-	-	-	SO:0001583	missense	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2408C>A	2.37:g.29294720G>T	ENSP00000332809:p.Pro803His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P803H	ENST00000331664.5	37	c.2408	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633672	0.47049	.	.	ENSG00000179270	ENST00000331664	T	0.22134	1.97	5.63	3.77	0.43336	.	0.421766	0.23151	N	0.051345	T	0.16981	0.0408	L	0.59436	1.845	0.09310	N	1	P	0.42161	0.772	B	0.32090	0.14	T	0.21655	-1.0239	10	0.56958	D	0.05	-5.4341	8.0411	0.30521	0.075:0.0:0.521:0.404	.	803	A6NGG8	CB071_HUMAN	H	803	ENSP00000332809:P803H	ENSP00000332809:P803H	P	-	2	0	C2orf71	29148224	0.246000	0.23909	0.012000	0.15200	0.100000	0.18952	2.106000	0.41835	1.312000	0.45043	0.650000	0.86243	CCT	C2orf71	-	NULL	ENSG00000179270		0.537	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	65	0.00	0	G	NM_001029883		29294720	29294720	-1	no_errors	ENST00000331664	ensembl	human	novel	69_37n	missense	84	22.73	25	SNP	0.001	T
CASKIN1	57524	genome.wustl.edu	37	16	2240078	2240078	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr16:2240078G>T	ENST00000343516.6	-	3	332	c.240C>A	c.(238-240)aaC>aaA	p.N80K		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	80					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						TCTTGCCTTTGTTGTCCTTGA	0.667																																						dbGAP											0													39.0	39.0	39.0					16																	2240078		1957	4141	6098	-	-	-	SO:0001583	missense	0			AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.240C>A	16.37:g.2240078G>T	ENSP00000345436:p.Asn80Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2P0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_SH3_domain,prints_Ankyrin_rpt	p.N80K	ENST00000343516.6	37	c.240	CCDS42103.1	16	.	.	.	.	.	.	.	.	.	.	G	18.57	3.653287	0.67472	.	.	ENSG00000167971	ENST00000343516	D	0.82081	-1.57	4.14	2.14	0.27477	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.68302	0.2986	N	0.05031	-0.125	0.42978	D	0.994452	P	0.43169	0.8	P	0.45232	0.474	T	0.66240	-0.5973	9	0.34782	T	0.22	-6.6382	10.0059	0.41957	0.1811:0.0:0.8189:0.0	.	80	Q8WXD9	CSKI1_HUMAN	K	80	ENSP00000345436:N80K	ENSP00000345436:N80K	N	-	3	2	CASKIN1	2180079	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.906000	0.39887	1.080000	0.41073	0.655000	0.94253	AAC	CASKIN1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000167971		0.667	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASKIN1	HGNC	protein_coding	OTTHUMT00000435055.1	45	0.00	0	G	NM_020764		2240078	2240078	-1	no_errors	ENST00000343516	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	T
CATSPER3	347732	genome.wustl.edu	37	5	134346160	134346160	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr5:134346160G>C	ENST00000282611.6	+	7	1120	c.1034G>C	c.(1033-1035)aGc>aCc	p.S345T		NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	345					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTTGGCACTAGCTTACCCTTC	0.488																																						dbGAP											0													158.0	146.0	150.0					5																	134346160		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.1034G>C	5.37:g.134346160G>C	ENSP00000282611:p.Ser345Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XS6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.S345T	ENST00000282611.6	37	c.1034	CCDS4181.1	5	.	.	.	.	.	.	.	.	.	.	G	4.999	0.185538	0.09495	.	.	ENSG00000152705	ENST00000282611	D	0.97114	-4.25	4.68	3.79	0.43588	.	0.089879	0.49916	D	0.000140	D	0.96614	0.8895	L	0.45581	1.43	0.30311	N	0.788522	D	0.61080	0.989	P	0.60068	0.868	D	0.93712	0.7025	10	0.27785	T	0.31	-28.762	12.0344	0.53417	0.0:0.0:0.8265:0.1735	.	345	Q86XQ3	CTSR3_HUMAN	T	345	ENSP00000282611:S345T	ENSP00000282611:S345T	S	+	2	0	CATSPER3	134374059	0.996000	0.38824	0.751000	0.31187	0.135000	0.20990	3.646000	0.54396	1.533000	0.49186	0.655000	0.94253	AGC	CATSPER3	-	NULL	ENSG00000152705		0.488	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER3	HGNC	protein_coding	OTTHUMT00000251191.2	323	0.00	0	G	NM_178019		134346160	134346160	+1	no_errors	ENST00000282611	ensembl	human	known	69_37n	missense	172	38.35	107	SNP	0.863	C
CD8A	925	genome.wustl.edu	37	2	87016512	87016512	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:87016512C>A	ENST00000409511.2	-	7	1589	c.559G>T	c.(559-561)Gcg>Tcg	p.A187S	CD8A_ENST00000283635.3_Missense_Mutation_p.A187S|CD8A_ENST00000538832.1_Missense_Mutation_p.A228S|CD8A_ENST00000409781.1_Missense_Mutation_p.A150S|CD8A_ENST00000352580.3_Intron|CD8A_ENST00000456996.2_Intron	NM_001145873.1	NP_001139345.1	P01732	CD8A_HUMAN	CD8a molecule	187					antigen processing and presentation (GO:0019882)|cytotoxic T cell differentiation (GO:0045065)|defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of calcium-mediated signaling (GO:0050850)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|T cell mediated immunity (GO:0002456)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	8						GCCAAGGGCGCCCAGATGTAG	0.607																																						dbGAP											0													83.0	87.0	85.0					2																	87016512		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1992.1, CCDS1993.1	2p12	2014-09-17	2006-03-28		ENSG00000153563	ENSG00000153563		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1706	protein-coding gene	gene with protein product		186910	"""CD8 antigen, alpha polypeptide (p32)"", ""T-cell surface glycoprotein CD8 alpha chain"""	CD8		1541829	Standard	NM_171827		Approved		uc002sru.3	P01732	OTTHUMG00000130265	ENST00000409511.2:c.559G>T	2.37:g.87016512C>A	ENSP00000386559:p.Ala187Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DT80|D6W5M8|Q13970|Q4ZG17	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A228S	ENST00000409511.2	37	c.682	CCDS1992.1	2	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796683	0.50208	.	.	ENSG00000153563	ENST00000283635;ENST00000409511;ENST00000442577;ENST00000538832;ENST00000409781	T;T;T;T	0.79247	-1.21;-1.21;-1.24;-1.25	4.67	2.83	0.33086	.	0.390913	0.27558	N	0.018823	T	0.77226	0.4099	L	0.60904	1.88	0.80722	D	1	P;D	0.63880	0.935;0.993	B;P	0.53266	0.321;0.722	T	0.76953	-0.2768	10	0.72032	D	0.01	-28.961	5.1448	0.14979	0.2068:0.6888:0.0:0.1044	.	228;187	B4DT80;P01732	.;CD8A_HUMAN	S	187;187;172;228;150	ENSP00000283635:A187S;ENSP00000386559:A187S;ENSP00000438371:A228S;ENSP00000387314:A150S	ENSP00000283635:A187S	A	-	1	0	CD8A	86870023	1.000000	0.71417	0.960000	0.40013	0.779000	0.44077	1.858000	0.39408	1.295000	0.44724	0.491000	0.48974	GCG	CD8A	-	NULL	ENSG00000153563		0.607	CD8A-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	CD8A	HGNC	protein_coding	OTTHUMT00000330784.3	67	0.00	0	C	NM_001768		87016512	87016512	-1	no_errors	ENST00000538832	ensembl	human	known	69_37n	missense	74	22.92	22	SNP	0.888	A
CDC25B	994	genome.wustl.edu	37	20	3782017	3782017	+	Silent	SNP	C	C	T	rs554137303	byFrequency	TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr20:3782017C>T	ENST00000245960.5	+	8	1519	c.822C>T	c.(820-822)atC>atT	p.I274I	CDC25B_ENST00000379598.5_Silent_p.I210I|CDC25B_ENST00000439880.2_Silent_p.I260I|CDC25B_ENST00000344256.6_Silent_p.I210I|CDC25B_ENST00000340833.4_Silent_p.I233I|CDC25B_ENST00000467519.1_3'UTR	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	274					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						TTGTGGACATCCTAGAGAGTG	0.557																																						dbGAP											0													139.0	143.0	141.0					20																	3782017		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.822C>T	20.37:g.3782017C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Silent	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.I274	ENST00000245960.5	37	c.822	CCDS13067.1	20																																																																																			CDC25B	-	pfam_MPI_Phosphatase	ENSG00000101224		0.557	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25B	HGNC	protein_coding	OTTHUMT00000077779.2	51	0.00	0	C	NM_021874		3782017	3782017	+1	no_errors	ENST00000245960	ensembl	human	known	69_37n	silent	56	54.47	67	SNP	1.000	T
CEP164	22897	genome.wustl.edu	37	11	117280410	117280410	+	Silent	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr11:117280410G>A	ENST00000278935.3	+	30	3972	c.3825G>A	c.(3823-3825)ctG>ctA	p.L1275L	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1275					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GCAGCCAGCTGAGCAGTGTCC	0.637																																						dbGAP											0													105.0	115.0	111.0					11																	117280410		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3825G>A	11.37:g.117280410G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Silent	SNP	superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.L1275	ENST00000278935.3	37	c.3825	CCDS31683.1	11																																																																																			CEP164	-	NULL	ENSG00000110274		0.637	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	HGNC	protein_coding	OTTHUMT00000392893.1	70	0.00	0	G	NM_014956		117280410	117280410	+1	no_errors	ENST00000278935	ensembl	human	known	69_37n	silent	52	39.53	34	SNP	0.068	A
CEP290	80184	genome.wustl.edu	37	12	88513938	88513938	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr12:88513938T>C	ENST00000552810.1	-	15	1818	c.1475A>G	c.(1474-1476)aAg>aGg	p.K492R	CEP290_ENST00000309041.7_Missense_Mutation_p.K492R|CEP290_ENST00000397838.3_5'UTR	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	492					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ATCACTGATCTTCAATTCAAG	0.323																																						dbGAP											0													77.0	70.0	72.0					12																	88513938		1823	4062	5885	-	-	-	SO:0001583	missense	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.1475A>G	12.37:g.88513938T>C	ENSP00000448012:p.Lys492Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.K492R	ENST00000552810.1	37	c.1475	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	T	15.10	2.732029	0.48939	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.68181	-0.3;-0.31	5.51	5.51	0.81932	.	0.060518	0.64402	D	0.000005	T	0.74898	0.3777	L	0.54323	1.7	0.80722	D	1	D;P	0.62365	0.991;0.487	P;B	0.59595	0.86;0.189	T	0.73616	-0.3926	10	0.34782	T	0.22	.	15.6153	0.76760	0.0:0.0:0.0:1.0	.	492;492	Q05BJ6;O15078	.;CE290_HUMAN	R	492;492;492;394	ENSP00000448012:K492R;ENSP00000308021:K492R	ENSP00000308021:K492R	K	-	2	0	CEP290	87038069	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.194000	0.65125	2.095000	0.63458	0.528000	0.53228	AAG	CEP290	-	NULL	ENSG00000198707		0.323	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1	143	0.00	0	T	NM_025114		88513938	88513938	-1	no_errors	ENST00000309041	ensembl	human	known	69_37n	missense	137	64.43	250	SNP	1.000	C
CEP350	9857	genome.wustl.edu	37	1	180047635	180047635	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:180047635C>G	ENST00000367607.3	+	29	6223	c.5805C>G	c.(5803-5805)taC>taG	p.Y1935*		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1935					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TACCTCTGTACTCTCATCTAA	0.423																																						dbGAP											0													56.0	54.0	54.0					1																	180047635		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.5805C>G	1.37:g.180047635C>G	ENSP00000356579:p.Tyr1935*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Nonsense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.Y1935*	ENST00000367607.3	37	c.5805	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.951043|3.951043	0.73787|0.73787	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000429851|ENST00000367607	.|.	.|.	.|.	5.05|5.05	3.17|3.17	0.36434|0.36434	.|.	.|0.531595	.|0.15626	.|N	.|0.252650	T|.	0.44052|.	0.1275|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.52208|.	-0.8606|.	3|.	.|.	.|.	.|.	.|.	8.1092|8.1092	0.30905|0.30905	0.0:0.7516:0.0:0.2483|0.0:0.7516:0.0:0.2483	.|.	.|.	.|.	.|.	V|X	110|1935	.|.	.|.	L|Y	+|+	1|3	0|2	CEP350|CEP350	178314258|178314258	0.998000|0.998000	0.40836|0.40836	0.959000|0.959000	0.39883|0.39883	0.775000|0.775000	0.43874|0.43874	0.466000|0.466000	0.22019|0.22019	0.639000|0.639000	0.30564|0.30564	0.591000|0.591000	0.81541|0.81541	CTC|TAC	CEP350	-	NULL	ENSG00000135837		0.423	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	119	0.00	0	C	NM_014810		180047635	180047635	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	nonsense	241	20.39	62	SNP	1.000	G
CHST3	9469	genome.wustl.edu	37	10	73767504	73767506	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr10:73767504_73767506delAAG	ENST00000373115.4	+	3	1152_1154	c.715_717delAAG	c.(715-717)aagdel	p.K240del		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	240					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						GCCCTTCGTCAAGAAGGTCTTCG	0.66																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.715_717delAAG	10.37:g.73767507_73767509delAAG	ENSP00000362207:p.Lys240del	Somatic		WXS	Illumina GAIIx	Phase_IV	O75099|Q52M30	In_Frame_Del	DEL	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.K240in_frame_del	ENST00000373115.4	37	c.715_717	CCDS7312.1	10																																																																																			CHST3	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	ENSG00000122863		0.660	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST3	HGNC	protein_coding	OTTHUMT00000048563.1	24	0.00	0	AAG	NM_004273		73767504	73767506	+1	no_errors	ENST00000373115	ensembl	human	known	69_37n	in_frame_del	19	26.92	7	DEL	1.000:1.000:1.000	-
CLEC10A	10462	genome.wustl.edu	37	17	6978705	6978705	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr17:6978705A>C	ENST00000254868.4	-	8	1084	c.756T>G	c.(754-756)gaT>gaG	p.D252E	CLEC10A_ENST00000571664.1_Missense_Mutation_p.D228E|CLEC10A_ENST00000576617.1_3'UTR|CLEC10A_ENST00000416562.2_Missense_Mutation_p.D225E	NM_182906.2	NP_878910.1	Q8IUN9	CLC10_HUMAN	C-type lectin domain family 10, member A	252	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						AGTCTGTTCCATCCACCCACT	0.572																																						dbGAP											0													101.0	92.0	95.0					17																	6978705		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50532	CCDS11087.1, CCDS45597.1	17p13.2	2014-05-20	2005-02-09	2005-02-11		ENSG00000132514		"""C-type lectin domain containing"", ""CD molecules"""	16916	protein-coding gene	gene with protein product	"""macrophage lectin 2 (calcium dependent)"""	605999	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 14 (macrophage-derived)"""	CLECSF13, CLECSF14		8598452	Standard	XM_005256411		Approved	HML2, HML, CD301	uc002gej.3	Q8IUN9		ENST00000254868.4:c.756T>G	17.37:g.6978705A>C	ENSP00000254868:p.Asp252Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8J8|Q14538|Q6PIW3	Missense_Mutation	SNP	pfam_Lectin_N,pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.D252E	ENST00000254868.4	37	c.756	CCDS11087.1	17	.	.	.	.	.	.	.	.	.	.	A	19.27	3.794988	0.70452	.	.	ENSG00000132514	ENST00000254868;ENST00000416562	T;T	0.30981	1.51;2.36	4.6	1.76	0.24704	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.115050	0.39274	N	0.001420	T	0.55924	0.1951	M	0.89534	3.04	0.30003	N	0.81584	D;D	0.76494	0.996;0.999	D;D	0.71870	0.975;0.94	T	0.57289	-0.7837	10	0.87932	D	0	.	7.8676	0.29545	0.8197:0.0:0.1803:0.0	.	252;228	Q8IUN9;Q8IUN9-2	CLC10_HUMAN;.	E	252;228	ENSP00000254868:D252E;ENSP00000414938:D228E	ENSP00000254868:D252E	D	-	3	2	CLEC10A	6919429	1.000000	0.71417	0.998000	0.56505	0.756000	0.42949	1.093000	0.30939	0.185000	0.20105	0.528000	0.53228	GAT	CLEC10A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000132514		0.572	CLEC10A-001	KNOWN	basic|CCDS	protein_coding	CLEC10A	HGNC	protein_coding	OTTHUMT00000439837.2	196	0.51	1	A	NM_006344		6978705	6978705	-1	no_errors	ENST00000254868	ensembl	human	known	69_37n	missense	259	22.22	74	SNP	1.000	C
COG2	22796	genome.wustl.edu	37	1	230822805	230822805	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:230822805C>T	ENST00000366669.4	+	13	1620	c.1505C>T	c.(1504-1506)aCa>aTa	p.T502I	COG2_ENST00000534989.1_Missense_Mutation_p.T443I|COG2_ENST00000546013.1_Missense_Mutation_p.T191I|COG2_ENST00000366668.3_Missense_Mutation_p.T502I|COG2_ENST00000535166.1_Missense_Mutation_p.T386I	NM_001145036.1|NM_007357.2	NP_001138508.1|NP_031383.1	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2	502					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|Golgi transport complex (GO:0017119)	protein transporter activity (GO:0008565)			NS(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|urinary_tract(3)	27	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				CCTTCGGAAACAAAGCCTGTG	0.488																																						dbGAP											0													99.0	81.0	87.0					1																	230822805		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z34975	CCDS1584.1, CCDS44329.1	1q42.2	2008-02-05	2002-05-28	2002-05-31	ENSG00000135775	ENSG00000135775		"""Components of oligomeric golgi complex"""	6546	protein-coding gene	gene with protein product		606974	"""low density lipoprotein receptor defect C complementing"""	LDLC		7962052	Standard	NM_007357		Approved		uc001htw.3	Q14746	OTTHUMG00000037753	ENST00000366669.4:c.1505C>T	1.37:g.230822805C>T	ENSP00000355629:p.Thr502Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86U99	Missense_Mutation	SNP	pfam_COG_complex_COG2_C,pfam_COG_su2_N	p.T502I	ENST00000366669.4	37	c.1505	CCDS1584.1	1	.	.	.	.	.	.	.	.	.	.	C	8.690	0.907115	0.17833	.	.	ENSG00000135775	ENST00000366669;ENST00000535166;ENST00000366668;ENST00000534989;ENST00000546013	T;T;T;T;T	0.46063	1.89;1.89;1.92;1.9;0.88	5.45	5.45	0.79879	.	0.362890	0.28754	N	0.014248	T	0.34948	0.0915	L	0.38175	1.15	0.30702	N	0.750227	B;B	0.21147	0.052;0.005	B;B	0.23275	0.045;0.003	T	0.26883	-1.0090	10	0.32370	T	0.25	-2.7214	14.2268	0.65866	0.0:0.8396:0.1603:0.0	.	502;502	Q86U99;Q14746	.;COG2_HUMAN	I	502;386;502;443;191	ENSP00000355629:T502I;ENSP00000445724:T386I;ENSP00000355628:T502I;ENSP00000440349:T443I;ENSP00000442147:T191I	ENSP00000355628:T502I	T	+	2	0	COG2	228889428	0.000000	0.05858	0.314000	0.25224	0.046000	0.14306	0.250000	0.18235	2.547000	0.85894	0.655000	0.94253	ACA	COG2	-	NULL	ENSG00000135775		0.488	COG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COG2	HGNC	protein_coding	OTTHUMT00000092087.1	78	0.00	0	C	NM_007357		230822805	230822805	+1	no_errors	ENST00000366669	ensembl	human	known	69_37n	missense	230	11.54	30	SNP	0.774	T
COL5A2	1290	genome.wustl.edu	37	2	189904113	189904113	+	Silent	SNP	A	A	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:189904113A>T	ENST00000374866.3	-	51	4084	c.3810T>A	c.(3808-3810)gcT>gcA	p.A1270A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1270	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			ACTTCAGGGTAGCATGAACCC	0.512																																						dbGAP											0													118.0	104.0	109.0					2																	189904113		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3810T>A	2.37:g.189904113A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.A1270	ENST00000374866.3	37	c.3810	CCDS33350.1	2																																																																																			COL5A2	-	smart_Fib_collagen_C	ENSG00000204262		0.512	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	223	0.00	0	A	NM_000393		189904113	189904113	-1	no_errors	ENST00000374866	ensembl	human	known	69_37n	silent	207	34.49	109	SNP	0.855	T
COX4I2	84701	genome.wustl.edu	37	20	30227892	30227892	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr20:30227892A>G	ENST00000376075.3	+	3	314	c.239A>G	c.(238-240)aAg>aGg	p.K80R	COX4I2_ENST00000490030.1_3'UTR	NM_032609.2	NP_115998.2	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2 (lung)	80					cellular respiration (GO:0045333)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)	mitochondrial respiratory chain complex IV (GO:0005751)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	11	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			CACGCCGAAAAGGTGGCCTGT	0.602																																						dbGAP											0													33.0	24.0	27.0					20																	30227892		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF257180	CCDS13187.1	20q11.21	2011-07-04	2004-08-11		ENSG00000131055	ENSG00000131055		"""Mitochondrial respiratory chain complex / Complex IV"""	16232	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit IV-like 2"""	607976	"""cytochrome c oxidase subunit IV isoform 2"""	COX4L2		11311561, 17937768	Standard	NM_032609		Approved	COXIV-2, COX4B, dJ857M17.2, COX4-2	uc002wwj.1	Q96KJ9	OTTHUMG00000032180	ENST00000376075.3:c.239A>G	20.37:g.30227892A>G	ENSP00000365243:p.Lys80Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTF4|Q9H0Z4	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su4_fam,superfamily_Cyt_c_oxidase_su4_fam,prints_Cyt_c_oxidase_su4	p.K80R	ENST00000376075.3	37	c.239	CCDS13187.1	20	.	.	.	.	.	.	.	.	.	.	A	15.21	2.765508	0.49574	.	.	ENSG00000131055	ENST00000376075	T	0.62788	-0.0	4.74	4.74	0.60224	.	0.060026	0.64402	D	0.000005	T	0.69717	0.3142	M	0.76574	2.34	0.45307	D	0.998308	P	0.50443	0.935	P	0.51999	0.687	T	0.73424	-0.3987	10	0.59425	D	0.04	-11.8937	10.5539	0.45105	1.0:0.0:0.0:0.0	.	80	Q96KJ9	COX42_HUMAN	R	80	ENSP00000365243:K80R	ENSP00000365243:K80R	K	+	2	0	COX4I2	29691553	1.000000	0.71417	0.998000	0.56505	0.042000	0.13812	6.628000	0.74262	1.984000	0.57885	0.454000	0.30748	AAG	COX4I2	-	pfam_Cyt_c_oxidase_su4_fam,superfamily_Cyt_c_oxidase_su4_fam	ENSG00000131055		0.602	COX4I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX4I2	HGNC	protein_coding	OTTHUMT00000078548.1	50	0.00	0	A	NM_032609		30227892	30227892	+1	no_errors	ENST00000376075	ensembl	human	known	69_37n	missense	64	20.99	17	SNP	1.000	G
CSMD3	114788	genome.wustl.edu	37	8	113353841	113353841	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr8:113353841C>G	ENST00000297405.5	-	42	6761	c.6517G>C	c.(6517-6519)Gaa>Caa	p.E2173Q	CSMD3_ENST00000343508.3_Missense_Mutation_p.E2133Q|CSMD3_ENST00000455883.2_Missense_Mutation_p.E2069Q|CSMD3_ENST00000352409.3_Missense_Mutation_p.E2103Q	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2173	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTACTAGTTTCTGAGGATCCA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													118.0	112.0	114.0					8																	113353841		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6517G>C	8.37:g.113353841C>G	ENSP00000297405:p.Glu2173Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.E2173Q	ENST00000297405.5	37	c.6517	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398671	0.83120	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	4.56	4.56	0.56223	CUB (5);	0.000000	0.64402	D	0.000001	T	0.35770	0.0943	L	0.52126	1.63	0.50813	D	0.999899	P;B;P	0.49358	0.923;0.163;0.604	P;B;B	0.57057	0.812;0.251;0.398	T	0.01940	-1.1243	10	0.29301	T	0.29	.	17.8784	0.88831	0.0:1.0:0.0:0.0	.	2069;2173;2133	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Q	2133;2173;1443;2069;2103	ENSP00000345799:E2133Q;ENSP00000297405:E2173Q;ENSP00000341558:E1443Q;ENSP00000412263:E2069Q;ENSP00000343124:E2103Q	ENSP00000297405:E2173Q	E	-	1	0	CSMD3	113423017	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.776000	0.68924	2.520000	0.84964	0.655000	0.94253	GAA	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	177	0.00	0	C	NM_052900		113353841	113353841	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	610	12.96	91	SNP	1.000	G
CUBN	8029	genome.wustl.edu	37	10	16893262	16893262	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr10:16893262C>G	ENST00000377833.4	-	60	9700	c.9635G>C	c.(9634-9636)aGg>aCg	p.R3212T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3212	CUB 24. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCATCTTTGCCTAGTACTTGC	0.338																																						dbGAP											0													93.0	96.0	95.0					10																	16893262		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9635G>C	10.37:g.16893262C>G	ENSP00000367064:p.Arg3212Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.R3212T	ENST00000377833.4	37	c.9635	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488515	0.26686	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.75477	-0.94	4.73	-6.58	0.01836	CUB (5);	2.620500	0.01781	N	0.031757	T	0.49287	0.1548	N	0.12182	0.205	0.09310	N	1	B	0.14438	0.01	B	0.19666	0.026	T	0.39292	-0.9621	10	0.13853	T	0.58	.	3.3959	0.07305	0.2833:0.3001:0.3282:0.0884	.	3212	O60494	CUBN_HUMAN	T	3212;53	ENSP00000367064:R3212T	ENSP00000367064:R3212T	R	-	2	0	CUBN	16933268	0.000000	0.05858	0.000000	0.03702	0.858000	0.48976	-1.198000	0.03035	-0.971000	0.03564	0.313000	0.20887	AGG	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.338	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	117	0.00	0	C	NM_001081		16893262	16893262	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	357	15.40	65	SNP	0.000	G
CTNNA3	29119	genome.wustl.edu	37	10	69299408	69299408	+	Silent	SNP	T	T	A	rs201480758		TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr10:69299408T>A	ENST00000433211.2	-	4	486	c.312A>T	c.(310-312)tcA>tcT	p.S104S	CTNNA3_ENST00000545309.1_Silent_p.S104S|CTNNA3_ENST00000373744.4_Silent_p.S104S	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						ATCTCTCAGCTGATACTTTCA	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		18090	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													62.0	64.0	63.0					10																	69299408		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.312A>T	10.37:g.69299408T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.S104	ENST00000433211.2	37	c.312	CCDS7269.1	10																																																																																			CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000183230		0.438	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	47	0.00	0	T	NM_013266		69299408	69299408	-1	no_errors	ENST00000373744	ensembl	human	known	69_37n	silent	54	36.47	31	SNP	1.000	A
DHRS12	79758	genome.wustl.edu	37	13	52345531	52345531	+	Intron	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr13:52345531C>G	ENST00000444610.2	-	8	720				DHRS12_ENST00000490949.1_5'Flank|DHRS12_ENST00000280056.2_Missense_Mutation_p.Q220H|DHRS12_ENST00000218981.1_Intron	NM_001270424.1	NP_001257353.1	A0PJE2	DHR12_HUMAN	dehydrogenase/reductase (SDR family) member 12								oxidoreductase activity (GO:0016491)			cervix(1)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	7		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		GTCCTTGTGGCTGGCATTTAC	0.537																																						dbGAP											0													127.0	105.0	113.0					13																	52345531		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK023701	CCDS9430.1, CCDS31976.1, CCDS58292.1	13q14.3	2013-10-11			ENSG00000102796	ENSG00000102796		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	25832	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 40C, member 1"""					19027726	Standard	NM_001031719		Approved	FLJ13639, SDR40C1	uc001vfq.4	A0PJE2	OTTHUMG00000016952	ENST00000444610.2:c.706+425G>C	13.37:g.52345531C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GB2|Q9H8H1	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR	p.Q220H	ENST00000444610.2	37	c.660	CCDS58292.1	13	.	.	.	.	.	.	.	.	.	.	C	8.174	0.792330	0.16258	.	.	ENSG00000102796	ENST00000280056	D	0.92965	-3.14	3.14	-0.641	0.11490	.	1.818140	0.04382	U	0.361013	D	0.91054	0.7185	.	.	.	0.09310	N	1	P	0.52061	0.95	P	0.50162	0.633	T	0.80571	-0.1323	9	0.48119	T	0.1	.	5.7849	0.18329	0.0:0.4377:0.0:0.5623	.	220	A0PJE2-3	.	H	220	ENSP00000280056:Q220H	ENSP00000280056:Q220H	Q	-	3	2	DHRS12	51243532	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.200000	0.17257	-0.110000	0.12022	-0.378000	0.06908	CAG	DHRS12	-	NULL	ENSG00000102796		0.537	DHRS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS12	HGNC	protein_coding	OTTHUMT00000045036.3	339	0.29	1	C	NM_024705		52345531	52345531	-1	no_errors	ENST00000280056	ensembl	human	known	69_37n	missense	389	35.32	213	SNP	0.000	G
DNAJC6	9829	genome.wustl.edu	37	1	65860643	65860643	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:65860643T>A	ENST00000395325.3	+	13	1952	c.1795T>A	c.(1795-1797)Ttt>Att	p.F599I	DNAJC6_ENST00000263441.7_Missense_Mutation_p.F586I|DNAJC6_ENST00000371069.4_Missense_Mutation_p.F656I	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	599	Pro-rich.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						GCTGGGTTCTTTTCTGAACAC	0.428																																						dbGAP											0													146.0	147.0	146.0					1																	65860643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.1795T>A	1.37:g.65860643T>A	ENSP00000378735:p.Phe599Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DnaJ_N,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_N	p.F656I	ENST00000395325.3	37	c.1966	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760847	0.69763	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	D;D;D	0.94457	-3.4;-3.42;-3.43	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.95601	0.8570	M	0.72118	2.19	0.58432	D	0.999998	D;D	0.69078	0.997;0.994	D;P	0.69824	0.966;0.904	D	0.94179	0.7430	10	0.22109	T	0.4	.	15.5448	0.76090	0.0:0.0:0.0:1.0	.	656;599	O75061-2;O75061	.;AUXI_HUMAN	I	586;599;656	ENSP00000263441:F586I;ENSP00000378735:F599I;ENSP00000360108:F656I	ENSP00000263441:F586I	F	+	1	0	DNAJC6	65633231	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	3.464000	0.53057	2.250000	0.74265	0.528000	0.53228	TTT	DNAJC6	-	NULL	ENSG00000116675		0.428	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1	212	0.00	0	T			65860643	65860643	+1	no_errors	ENST00000371069	ensembl	human	known	69_37n	missense	376	19.14	89	SNP	1.000	A
DNMBP	23268	genome.wustl.edu	37	10	101643811	101643811	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr10:101643811T>G	ENST00000324109.4	-	15	4045	c.3954A>C	c.(3952-3954)aaA>aaC	p.K1318N	DNMBP_ENST00000543621.1_Missense_Mutation_p.K564N|DNMBP_ENST00000472036.1_5'Flank|DNMBP_ENST00000540316.1_Missense_Mutation_p.K254N|DNMBP_ENST00000342239.3_Missense_Mutation_p.K1342N	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1318	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CCATGGGGTCTTTTTTCTTAA	0.453																																						dbGAP											0													69.0	70.0	70.0					10																	101643811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3954A>C	10.37:g.101643811T>G	ENSP00000315659:p.Lys1318Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,prints_p67phox,prints_Spectrin_alpha_SH3,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.K1342N	ENST00000324109.4	37	c.4026	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	T	21.4	4.136231	0.77662	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.94	1.02	0.19986	Src homology-3 domain (2);	0.125090	0.36101	N	0.002786	T	0.52306	0.1726	L	0.43152	1.355	0.41488	D	0.9882	D;D;D	0.76494	0.997;0.982;0.999	P;P;D	0.63877	0.889;0.818;0.919	T	0.43702	-0.9375	10	0.33940	T	0.23	-29.3671	10.2002	0.43077	0.0:0.5104:0.0:0.4896	.	1318;564;1342	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	N	1342;1318;564;564;254	ENSP00000344914:K1342N;ENSP00000315659:K1318N;ENSP00000443657:K564N;ENSP00000443573:K254N	ENSP00000315659:K1318N	K	-	3	2	DNMBP	101633801	0.828000	0.29307	0.981000	0.43875	0.943000	0.58893	-0.002000	0.12924	0.196000	0.20367	-0.417000	0.06048	AAA	DNMBP	-	superfamily_SH3_domain,smart_SH3_domain	ENSG00000107554		0.453	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	100	0.00	0	T	NM_015221		101643811	101643811	-1	no_errors	ENST00000342239	ensembl	human	known	69_37n	missense	117	29.94	50	SNP	1.000	G
DVL1	1855	genome.wustl.edu	37	1	1273446	1273446	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:1273446T>A	ENST00000378888.5	-	14	1909	c.1625A>T	c.(1624-1626)tAc>tTc	p.Y542F	DVL1_ENST00000378891.5_Missense_Mutation_p.Y517F			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	542					axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGGTCCCGGGTACTGGTAGGG	0.682																																						dbGAP											0													14.0	20.0	18.0					1																	1273446		2188	4280	6468	-	-	-	SO:0001583	missense	0			AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.1625A>T	1.37:g.1273446T>A	ENSP00000368166:p.Tyr542Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TA33|Q5TA35	Missense_Mutation	SNP	pfam_Dishevelled_C-dom,pfam_DIX,pfam_Dishevelled_protein_dom,pfam_PDZ,pfam_DEP_dom,superfamily_PDZ,smart_DIX,smart_PDZ,smart_DEP_dom,pfscan_DEP_dom,pfscan_DIX,pfscan_PDZ,prints_Dishevelled_1,prints_Dishevelled	p.Y542F	ENST00000378888.5	37	c.1625		1	.	.	.	.	.	.	.	.	.	.	T	11.16	1.556241	0.27827	.	.	ENSG00000107404	ENST00000378891;ENST00000378888;ENST00000345100;ENST00000263743	T;T	0.05855	3.38;3.4	4.39	4.39	0.52855	Winged helix-turn-helix transcription repressor DNA-binding (2);Dishevelled C-terminal (2);	0.072550	0.56097	D	0.000030	T	0.19765	0.0475	M	0.68317	2.08	0.50467	D	0.999872	D;D;D;P	0.71674	0.995;0.983;0.998;0.886	P;P;D;P	0.69307	0.852;0.818;0.963;0.461	T	0.03077	-1.1075	10	0.23891	T	0.37	.	13.9495	0.64106	0.0:0.0:0.0:1.0	.	200;542;517;517	G3XA93;O14640;P54792;O14640-2	.;DVL1_HUMAN;DVL1L_HUMAN;.	F	517;542;291;200	ENSP00000368169:Y517F;ENSP00000368166:Y542F	ENSP00000263743:Y200F	Y	-	2	0	DVL1	1263309	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	3.642000	0.54367	1.768000	0.52137	0.374000	0.22700	TAC	DVL1	-	pfam_Dishevelled_C-dom	ENSG00000107404		0.682	DVL1-004	KNOWN	basic|appris_principal	protein_coding	DVL1	HGNC	protein_coding	OTTHUMT00000008490.1	27	0.00	0	T	NM_004421		1273446	1273446	-1	no_errors	ENST00000378888	ensembl	human	known	69_37n	missense	12	38.10	8	SNP	1.000	A
DZIP3	9666	genome.wustl.edu	37	3	108355480	108355480	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr3:108355480A>T	ENST00000361582.3	+	11	1166	c.936A>T	c.(934-936)aaA>aaT	p.K312N	DZIP3_ENST00000463306.1_Missense_Mutation_p.K312N	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	312					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						GTGGGAAAAAATGTTTGAAGG	0.279																																						dbGAP											0													172.0	166.0	168.0					3																	108355480		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.936A>T	3.37:g.108355480A>T	ENSP00000355028:p.Lys312Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.K312N	ENST00000361582.3	37	c.936	CCDS2952.1	3	.	.	.	.	.	.	.	.	.	.	A	12.05	1.821604	0.32237	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T;T	0.48201	0.82;0.82;0.82	4.88	1.1	0.20463	.	0.113892	0.39475	N	0.001345	T	0.42426	0.1202	N	0.14661	0.345	0.31140	N	0.706771	D;B	0.64830	0.994;0.232	D;B	0.67900	0.954;0.07	T	0.42275	-0.9461	10	0.36615	T	0.2	-21.0939	6.6999	0.23219	0.7061:0.0:0.2939:0.0	.	312;312	C9J9M8;Q86Y13	.;DZIP3_HUMAN	N	312	ENSP00000355028:K312N;ENSP00000418115:K312N;ENSP00000419981:K312N	ENSP00000355028:K312N	K	+	3	2	DZIP3	109838170	0.997000	0.39634	1.000000	0.80357	0.935000	0.57460	0.274000	0.18680	0.357000	0.24183	0.528000	0.53228	AAA	DZIP3	-	NULL	ENSG00000198919		0.279	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP3	HGNC	protein_coding	OTTHUMT00000353968.1	112	0.00	0	A	NM_014648		108355480	108355480	+1	no_errors	ENST00000361582	ensembl	human	known	69_37n	missense	266	21.76	74	SNP	0.996	T
ECE2	9718	genome.wustl.edu	37	3	183994723	183994723	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr3:183994723C>T	ENST00000402825.3	+	3	524	c.524C>T	c.(523-525)aCg>aTg	p.T175M	ECE2_ENST00000357474.5_Missense_Mutation_p.T103M|ECE2_ENST00000359140.4_Missense_Mutation_p.T28M|ECE2_ENST00000404464.3_Missense_Mutation_p.T57M|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	175					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGCTCACGCACGCAGCTGGAG	0.592																																						dbGAP											0													65.0	58.0	60.0					3																	183994723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.524C>T	3.37:g.183994723C>T	ENSP00000384223:p.Thr175Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.T175M	ENST00000402825.3	37	c.524	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	C	32	5.178060	0.94846	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;D;D;D;T	0.83163	-1.47;-1.66;-1.68;-1.69;-1.4	4.97	4.97	0.65823	.	0.166875	0.52532	D	0.000063	T	0.81987	0.4939	N	0.08118	0	0.53005	D	0.999962	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.74348	0.911;0.983;0.969;0.972;0.944;0.939	D	0.86274	0.1663	10	0.87932	D	0	-12.3109	14.9356	0.70951	0.0:1.0:0.0:0.0	.	28;103;57;103;28;175	B4DKF3;B7Z1P1;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;ECE2_HUMAN	M	175;28;57;103;49	ENSP00000384223:T175M;ENSP00000352052:T28M;ENSP00000385846:T57M;ENSP00000350066:T103M;ENSP00000398444:T49M	ENSP00000350066:T103M	T	+	2	0	ECE2	185477417	0.944000	0.32072	0.380000	0.26093	0.750000	0.42670	2.054000	0.41335	2.264000	0.75181	0.655000	0.94253	ACG	ECE2	-	NULL	ENSG00000145194		0.592	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	103	0.00	0	C	NM_014693		183994723	183994723	+1	no_errors	ENST00000402825	ensembl	human	known	69_37n	missense	153	20.31	39	SNP	0.892	T
AGO3	192669	genome.wustl.edu	37	1	36411332	36411332	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:36411332G>T	ENST00000373191.4	+	2	408	c.59G>T	c.(58-60)aGa>aTa	p.R20I	AGO3_ENST00000246314.6_5'UTR|AGO3_ENST00000324350.5_Missense_Mutation_p.R20I|AGO3_ENST00000397828.2_Missense_Mutation_p.R20I	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	20					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GTGCCCAGAAGACCTGGCTAT	0.483																																						dbGAP											0													88.0	101.0	96.0					1																	36411332		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.59G>T	1.37:g.36411332G>T	ENSP00000362287:p.Arg20Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R20I	ENST00000373191.4	37	c.59	CCDS399.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.754973	0.96898	.	.	ENSG00000126070	ENST00000324350;ENST00000373191;ENST00000397828	T	0.26957	1.7	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.69060	-0.5245	10	0.87932	D	0	-3.7833	20.8794	0.99867	0.0:0.0:1.0:0.0	.	20;20	Q9H9G7;Q5TA56	AGO3_HUMAN;.	I	20	ENSP00000362287:R20I	ENSP00000317425:R20I	R	+	2	0	EIF2C3	36183919	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	AGA	EIF2C3	-	NULL	ENSG00000126070		0.483	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C3	HGNC	protein_coding	OTTHUMT00000019831.4	95	0.00	0	G	NM_024852		36411332	36411332	+1	no_errors	ENST00000373191	ensembl	human	known	69_37n	missense	184	18.22	41	SNP	1.000	T
ELP5	23587	genome.wustl.edu	37	17	7158042	7158042	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr17:7158042T>C	ENST00000396628.2	+	4	594	c.377T>C	c.(376-378)cTc>cCc	p.L126P	ELP5_ENST00000574993.1_Missense_Mutation_p.L126P|CTDNEP1_ENST00000572043.1_5'Flank|CTDNEP1_ENST00000573600.1_5'Flank|ELP5_ENST00000354429.2_Missense_Mutation_p.L126P|ELP5_ENST00000573657.1_Missense_Mutation_p.L126P|CTDNEP1_ENST00000318988.6_5'Flank|ELP5_ENST00000356683.2_Missense_Mutation_p.L126P|ELP5_ENST00000396627.2_Missense_Mutation_p.L126P|ELP5_ENST00000574255.1_Missense_Mutation_p.L126P|RP1-4G17.5_ENST00000577138.1_Intron	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5	126					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)											CTCGATTCACTCAGCTGGCTG	0.572																																						dbGAP											0													150.0	101.0	117.0					17																	7158042		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.377T>C	17.37:g.7158042T>C	ENSP00000379869:p.Leu126Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Missense_Mutation	SNP	pfam_Histone_acetylation_protein_2	p.L126P	ENST00000396628.2	37	c.377	CCDS11094.1	17	.	.	.	.	.	.	.	.	.	.	T	21.2	4.108154	0.77096	.	.	ENSG00000170291	ENST00000354429;ENST00000396628;ENST00000396627;ENST00000356683	T;T;T;T	0.69806	0.43;0.43;0.43;-0.43	5.81	5.81	0.92471	.	0.147285	0.46442	N	0.000282	T	0.80121	0.4565	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	T	0.82153	-0.0598	10	0.87932	D	0	-7.4327	14.1293	0.65242	0.0:0.0:0.0:1.0	.	126;126;126;126	Q8TE02-2;Q8TE02-3;A8K1M5;Q8TE02	.;.;.;DERP6_HUMAN	P	126	ENSP00000346412:L126P;ENSP00000379869:L126P;ENSP00000379868:L126P;ENSP00000349111:L126P	ENSP00000346412:L126P	L	+	2	0	C17orf81	7098766	0.995000	0.38212	1.000000	0.80357	0.933000	0.57130	3.865000	0.56033	2.217000	0.71921	0.482000	0.46254	CTC	ELP5	-	pfam_Histone_acetylation_protein_2	ENSG00000170291		0.572	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ELP5	HGNC	protein_coding	OTTHUMT00000440111.1	156	0.00	0	T	NM_015362		7158042	7158042	+1	no_errors	ENST00000354429	ensembl	human	known	69_37n	missense	138	26.98	51	SNP	1.000	C
RIN1	9610	genome.wustl.edu	37	11	66103801	66103801	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr11:66103801G>C	ENST00000311320.4	-	1	199	c.73C>G	c.(73-75)Ctg>Gtg	p.L25V	RIN1_ENST00000530056.1_Intron|RIN1_ENST00000524804.1_5'Flank|RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000424433.2_5'UTR	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	25					associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						TCTCTCGCCAGGTGCCCAGTA	0.632																																						dbGAP											0													22.0	24.0	23.0					11																	66103801		2200	4295	6495	-	-	-	SO:0001583	missense	0			L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.73C>G	11.37:g.66103801G>C	ENSP00000310406:p.Leu25Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15010|Q00427|Q96CC8	Splice_Site	SNP	-	NULL	ENST00000311320.4	37	c.NULL	CCDS31614.1	11	.	.	.	.	.	.	.	.	.	.	G	4.095	0.015597	0.07959	.	.	ENSG00000174791	ENST00000311320	T	0.08458	3.09	3.7	2.78	0.32641	.	2.407580	0.02215	N	0.063491	T	0.07954	0.0199	L	0.36672	1.1	0.24938	N	0.991877	B	0.31318	0.319	B	0.26416	0.069	T	0.36089	-0.9762	10	0.17832	T	0.49	-1.5849	6.8449	0.23982	0.1288:0.0:0.8712:0.0	.	25	Q13671	RIN1_HUMAN	V	25	ENSP00000310406:L25V	ENSP00000310406:L25V	L	-	1	2	RIN1	65860377	0.954000	0.32549	0.114000	0.21550	0.260000	0.26232	1.178000	0.31981	0.915000	0.36847	0.462000	0.41574	CTG	RP11-867G23.12	-	-	ENSG00000254756		0.632	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254756	Clone_based_vega_gene	protein_coding	OTTHUMT00000392980.2	52	0.00	0	G	NM_004292		66103801	66103801	+1	no_errors	ENST00000526655	ensembl	human	known	69_37n	splice_site	71	21.98	20	SNP	0.042	C
EPS15	2060	genome.wustl.edu	37	1	51912687	51912687	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:51912687C>A	ENST00000371733.3	-	10	838	c.742G>T	c.(742-744)Gtc>Ttc	p.V248F	EPS15_ENST00000371730.2_Missense_Mutation_p.V248F	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	248	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EH 3. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						ATTTCACGGACCTCCAATCCA	0.348			T	MLL	ALL																																	dbGAP		Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	1	Whole gene deletion(1)	central_nervous_system(1)											126.0	131.0	129.0					1																	51912687		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.742G>T	1.37:g.51912687C>A	ENSP00000360798:p.Val248Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.V248F	ENST00000371733.3	37	c.742	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621918	0.66787	.	.	ENSG00000085832	ENST00000371730;ENST00000371733	T;T	0.44881	0.91;0.91	5.88	4.96	0.65561	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.29760	N	0.011276	T	0.61788	0.2375	M	0.75615	2.305	0.80722	D	1	D;D	0.67145	0.996;0.984	P;P	0.62089	0.898;0.851	T	0.64398	-0.6417	10	0.62326	D	0.03	.	15.4293	0.75081	0.0:0.9324:0.0:0.0676	.	248;248	B1AUU8;P42566	.;EPS15_HUMAN	F	248	ENSP00000360795:V248F;ENSP00000360798:V248F	ENSP00000360795:V248F	V	-	1	0	EPS15	51685275	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	6.084000	0.71335	2.789000	0.95967	0.591000	0.81541	GTC	EPS15	-	smart_EPS15_homology,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_EPS15_homology	ENSG00000085832		0.348	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	136	0.00	0	C	NM_001981		51912687	51912687	-1	no_errors	ENST00000371733	ensembl	human	known	69_37n	missense	310	23.77	97	SNP	1.000	A
ETFA	2108	genome.wustl.edu	37	15	76578063	76578063	+	Silent	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr15:76578063T>A	ENST00000557943.1	-	7	659	c.579A>T	c.(577-579)ccA>ccT	p.P193P	ETFA_ENST00000433983.2_Silent_p.P144P|ETFA_ENST00000560726.1_5'UTR|ETFA_ENST00000560816.1_5'UTR|ETFA_ENST00000559602.1_Silent_p.P89P	NM_000126.3	NP_000117.1	P13804	ETFA_HUMAN	electron-transfer-flavoprotein, alpha polypeptide	193	Domain I. {ECO:0000269|PubMed:8962055}.				cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9						ATATTTCCACTGGTGAAGTAC	0.343																																						dbGAP											0													115.0	107.0	110.0					15																	76578063		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0			J04058	CCDS32299.1, CCDS45311.1	15q23-q25	2012-04-04	2008-08-01		ENSG00000140374	ENSG00000140374			3481	protein-coding gene	gene with protein product	"""glutaric aciduria II"""	608053					Standard	NM_000126		Approved	GA2, EMA, MADD	uc002bbt.2	P13804	OTTHUMG00000172586	ENST00000557943.1:c.579A>T	15.37:g.76578063T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DT43|Q53XN3	Missense_Mutation	SNP	pfam_ETF_asu_C,pfam_ETF_a/b_N	p.S97C	ENST00000557943.1	37	c.289	CCDS32299.1	15																																																																																			ETFA	-	NULL	ENSG00000140374		0.343	ETFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFA	HGNC	protein_coding	OTTHUMT00000419302.2	210	0.00	0	T	NM_000126		76578063	76578063	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000559973	ensembl	human	putative	69_37n	missense	511	15.12	91	SNP	0.987	A
FAM135B	51059	genome.wustl.edu	37	8	139209858	139209858	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr8:139209858G>A	ENST00000395297.1	-	8	894	c.724C>T	c.(724-726)Cga>Tga	p.R242*		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	242								p.R242R(2)|p.R242*(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CACAGGTCTCGGTGCCACTTG	0.577										HNSCC(54;0.14)																												dbGAP											4	Substitution - Nonsense(2)|Substitution - coding silent(2)	large_intestine(2)|lung(2)											89.0	105.0	99.0					8																	139209858		2159	4277	6436	-	-	-	SO:0001587	stop_gained	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.724C>T	8.37:g.139209858G>A	ENSP00000378710:p.Arg242*	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB3|O95879|Q2WGJ7|Q3KP46	Nonsense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.R242*	ENST00000395297.1	37	c.724	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	G	39	7.326279	0.98214	.	.	ENSG00000147724	ENST00000395297	.	.	.	4.74	4.74	0.60224	.	0.170571	0.39341	N	0.001383	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.303	13.1038	0.59235	0.0:0.0:1.0:0.0	.	.	.	.	X	242	.	ENSP00000276737:R242X	R	-	1	2	FAM135B	139279040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.019000	0.49635	2.473000	0.83533	0.563000	0.77884	CGA	FAM135B	-	NULL	ENSG00000147724		0.577	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	152	0.00	0	G	NM_015912		139209858	139209858	-1	no_errors	ENST00000395297	ensembl	human	known	69_37n	nonsense	227	31.21	103	SNP	1.000	A
FANCM	57697	genome.wustl.edu	37	14	45644732	45644732	+	Silent	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr14:45644732A>G	ENST00000267430.5	+	14	2860	c.2775A>G	c.(2773-2775)acA>acG	p.T925T	FANCM_ENST00000542564.2_Silent_p.T899T	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	925					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TGTTATTAACAGAGTGTCAGT	0.313								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													90.0	100.0	97.0					14																	45644732		2203	4290	6493	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2775A>G	14.37:g.45644732A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T925	ENST00000267430.5	37	c.2775	CCDS32070.1	14																																																																																			FANCM	-	NULL	ENSG00000187790		0.313	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	35	0.00	0	A	XM_048128		45644732	45644732	+1	no_errors	ENST00000267430	ensembl	human	known	69_37n	silent	71	61.41	113	SNP	0.000	G
FGD3	89846	genome.wustl.edu	37	9	95738615	95738615	+	Missense_Mutation	SNP	G	G	T	rs377204137		TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr9:95738615G>T	ENST00000375482.3	+	3	573	c.77G>T	c.(76-78)aGt>aTt	p.S26I	FGD3_ENST00000337352.6_Missense_Mutation_p.S26I|FGD3_ENST00000468206.1_3'UTR|FGD3_ENST00000416701.2_Missense_Mutation_p.S26I	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	26					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						GGGCCTGGCAGTTCCTCCCTA	0.637																																						dbGAP											0													19.0	23.0	22.0					9																	95738615		1903	4114	6017	-	-	-	SO:0001583	missense	0			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.77G>T	9.37:g.95738615G>T	ENSP00000364631:p.Ser26Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S26I	ENST00000375482.3	37	c.77	CCDS43849.1	9	.	.	.	.	.	.	.	.	.	.	G	11.52	1.663653	0.29515	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352	T;T;T	0.73363	-0.73;-0.74;-0.73	4.48	1.5	0.22942	.	.	.	.	.	T	0.56156	0.1966	L	0.29908	0.895	0.09310	N	1	P;B	0.37276	0.589;0.294	B;B	0.36504	0.226;0.057	T	0.41556	-0.9502	9	0.26408	T	0.33	.	3.0406	0.06137	0.1018:0.196:0.5312:0.1711	.	26;26	F8W7P2;Q5JSP0	.;FGD3_HUMAN	I	26	ENSP00000364631:S26I;ENSP00000413833:S26I;ENSP00000336914:S26I	ENSP00000336914:S26I	S	+	2	0	FGD3	94778436	0.040000	0.19996	0.000000	0.03702	0.011000	0.07611	0.401000	0.20948	0.076000	0.16826	0.655000	0.94253	AGT	FGD3	-	NULL	ENSG00000127084		0.637	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	HGNC	protein_coding	OTTHUMT00000055493.1	30	0.00	0	G	NM_033086		95738615	95738615	+1	no_errors	ENST00000337352	ensembl	human	known	69_37n	missense	17	48.48	16	SNP	0.001	T
FLNA	2316	genome.wustl.edu	37	X	153586901	153586901	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chrX:153586901C>T	ENST00000369850.3	-	27	4746	c.4510G>A	c.(4510-4512)Gat>Aat	p.D1504N	FLNA_ENST00000344736.4_Missense_Mutation_p.D1504N|FLNA_ENST00000360319.4_Missense_Mutation_p.D1504N|FLNA_ENST00000369856.3_5'Flank|FLNA_ENST00000422373.1_Missense_Mutation_p.D1504N	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1504	Interaction with furin. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGGGTGCCATCAGCGTTGTCT	0.602																																						dbGAP											0													82.0	82.0	82.0					X																	153586901		2124	4214	6338	-	-	-	SO:0001583	missense	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.4510G>A	X.37:g.153586901C>T	ENSP00000358866:p.Asp1504Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.D1504N	ENST00000369850.3	37	c.4510	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688032	0.68271	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13	5.47	5.47	0.80525	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.064000	0.64402	D	0.000014	D	0.90048	0.6892	L	0.51853	1.615	0.80722	D	1	B;B	0.24483	0.104;0.006	B;B	0.33254	0.16;0.033	D	0.87090	0.2172	10	0.42905	T	0.14	.	11.9113	0.52741	0.0:0.9183:0.0:0.0817	.	1504;1504	P21333-2;P21333	.;FLNA_HUMAN	N	1504;1477;1504;1504;1504	ENSP00000353467:D1504N;ENSP00000416926:D1504N;ENSP00000358866:D1504N;ENSP00000358863:D1504N	ENSP00000358863:D1504N	D	-	1	0	FLNA	153240095	1.000000	0.71417	0.881000	0.34555	0.880000	0.50808	6.066000	0.71185	2.294000	0.77228	0.529000	0.55759	GAT	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.602	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	196	0.51	1	C			153586901	153586901	-1	no_errors	ENST00000369850	ensembl	human	known	69_37n	missense	88	46.99	78	SNP	0.999	T
FMN2	56776	genome.wustl.edu	37	1	240601454	240601454	+	Silent	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:240601454C>T	ENST00000319653.9	+	16	5234	c.5004C>T	c.(5002-5004)ttC>ttT	p.F1668F	FMN2_ENST00000545751.1_Silent_p.F264F	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1668	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGCATGAATTCAGCTCTGACT	0.388																																						dbGAP											0													130.0	127.0	128.0					1																	240601454		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.5004C>T	1.37:g.240601454C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.F1668	ENST00000319653.9	37	c.5004	CCDS31069.2	1																																																																																			FMN2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.388	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	158	0.00	0	C	XM_371352		240601454	240601454	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	silent	402	25.69	139	SNP	1.000	T
GIMAP8	155038	genome.wustl.edu	37	7	150171337	150171337	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr7:150171337C>T	ENST00000307271.3	+	4	1494	c.920C>T	c.(919-921)tCa>tTa	p.S307L		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	307	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CCGGACATCTCATCTTTAAAG	0.448																																						dbGAP											0													77.0	83.0	81.0					7																	150171337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.920C>T	7.37:g.150171337C>T	ENSP00000305107:p.Ser307Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AIG1	p.S307L	ENST00000307271.3	37	c.920	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554320	0.45487	.	.	ENSG00000171115	ENST00000307271	T	0.04551	3.6	4.47	0.34	0.15985	AIG1 (1);	0.447644	0.16564	N	0.208920	T	0.07143	0.0181	L	0.31371	0.925	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.12604	-1.0541	10	0.05525	T	0.97	.	6.0718	0.19893	0.0:0.5186:0.0:0.4814	.	307	Q8ND71	GIMA8_HUMAN	L	307	ENSP00000305107:S307L	ENSP00000305107:S307L	S	+	2	0	GIMAP8	149802270	0.000000	0.05858	0.000000	0.03702	0.100000	0.18952	-1.355000	0.02612	0.177000	0.19895	0.650000	0.86243	TCA	GIMAP8	-	pfam_AIG1	ENSG00000171115		0.448	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	76	0.00	0	C	NM_175571		150171337	150171337	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	missense	139	16.77	28	SNP	0.000	T
GRIK3	2899	genome.wustl.edu	37	1	37270745	37270745	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:37270745C>G	ENST00000373091.3	-	15	2424	c.2408G>C	c.(2407-2409)aGc>aCc	p.S803T	GRIK3_ENST00000373093.4_Missense_Mutation_p.S803T	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	803					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				AGGACACCCGCTGCCCCGCCA	0.602																																						dbGAP											0													62.0	63.0	63.0					1																	37270745		2203	4300	6503	-	-	-	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2408G>C	1.37:g.37270745C>G	ENSP00000362183:p.Ser803Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S803T	ENST00000373091.3	37	c.2408	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	C	8.267	0.812496	0.16537	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.11712	2.75;2.75	4.59	3.44	0.39384	Ionotropic glutamate receptor (1);	0.102562	0.64402	D	0.000004	T	0.08802	0.0218	L	0.37466	1.105	0.37912	D	0.931391	B;B	0.19073	0.033;0.033	B;B	0.29440	0.102;0.063	T	0.15521	-1.0434	10	0.35671	T	0.21	.	5.4644	0.16635	0.0:0.668:0.0:0.332	.	803;803	A9Z1Z8;Q13003	.;GRIK3_HUMAN	T	803	ENSP00000362183:S803T;ENSP00000362185:S803T	ENSP00000362183:S803T	S	-	2	0	GRIK3	37043332	0.546000	0.26457	0.997000	0.53966	0.968000	0.65278	0.838000	0.27572	2.084000	0.62774	0.551000	0.68910	AGC	GRIK3	-	pfam_Iontro_glu_rcpt	ENSG00000163873		0.602	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	53	0.00	0	C	NM_000831		37270745	37270745	-1	no_errors	ENST00000373091	ensembl	human	known	69_37n	missense	63	14.86	11	SNP	1.000	G
HDAC2	3066	genome.wustl.edu	37	6	114274578	114274578	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:114274578G>A	ENST00000519065.1	-	6	878	c.502C>T	c.(502-504)Cat>Tat	p.H168Y	HDAC2_ENST00000398283.2_Missense_Mutation_p.H262Y|HDAC2_ENST00000519108.1_Missense_Mutation_p.H138Y|HDAC2_ENST00000368632.2_Missense_Mutation_p.H138Y			Q92769	HDAC2_HUMAN	histone deacetylase 2	168	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|cardiac muscle cell development (GO:0055013)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|dendrite development (GO:0016358)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|hair follicle placode formation (GO:0060789)|hippocampus development (GO:0021766)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|maintenance of chromatin silencing (GO:0006344)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell cycle (GO:0045786)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of neuron projection development (GO:0010977)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of proteolysis (GO:0045862)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein deacetylation (GO:0090311)|regulation of protein kinase B signaling (GO:0051896)|regulation of sarcomere organization (GO:0060297)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|replication fork (GO:0005657)|Sin3 complex (GO:0016580)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|poly(A) RNA binding (GO:0044822)|protein deacetylase activity (GO:0033558)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			biliary_tract(1)|central_nervous_system(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Aminophylline(DB01223)|Lovastatin(DB00227)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Valproic Acid(DB00313)|Vorinostat(DB02546)	ACTCTCTGATGATACCTGAAA	0.343																																						dbGAP											0													92.0	87.0	89.0					6																	114274578		1821	4071	5892	-	-	-	SO:0001583	missense	0			U31814	CCDS43493.1, CCDS43493.2	6q21	2008-08-29			ENSG00000196591	ENSG00000196591			4853	protein-coding gene	gene with protein product		605164				9782097	Standard	NM_001527		Approved	RPD3, YAF1	uc003pwd.2	Q92769	OTTHUMG00000015411	ENST00000519065.1:c.502C>T	6.37:g.114274578G>A	ENSP00000430432:p.His168Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRS5|B4DL58|E1P561|Q5SRI8|Q5SZ86|Q8NEH4	Missense_Mutation	SNP	pfam_His_deacetylse_dom,prints_His_deacetylse_1,prints_His_deacetylse	p.H262Y	ENST00000519065.1	37	c.784	CCDS43493.2	6	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025346	0.75390	.	.	ENSG00000196591	ENST00000519065;ENST00000398283;ENST00000519108;ENST00000368632	T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4	5.67	5.67	0.87782	Histone deacetylase domain (2);	0.000000	0.64402	D	0.000001	T	0.73171	0.3553	M	0.63208	1.945	0.80722	D	1	B;D	0.54772	0.145;0.968	B;P	0.55615	0.148;0.78	T	0.75059	-0.3451	10	0.87932	D	0	-33.3777	20.1358	0.98028	0.0:0.0:1.0:0.0	.	138;168	B3KRS5;Q92769	.;HDAC2_HUMAN	Y	168;262;138;138	ENSP00000430432:H168Y;ENSP00000381331:H262Y;ENSP00000430008:H138Y;ENSP00000357621:H138Y	ENSP00000357621:H138Y	H	-	1	0	HDAC2	114381271	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.813000	0.99286	2.833000	0.97629	0.585000	0.79938	CAT	HDAC2	-	pfam_His_deacetylse_dom,prints_His_deacetylse_1	ENSG00000196591		0.343	HDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC2	HGNC	protein_coding	OTTHUMT00000041909.2	108	0.00	0	G			114274578	114274578	-1	no_errors	ENST00000398283	ensembl	human	known	69_37n	missense	180	18.18	40	SNP	1.000	A
HEATR5A	25938	genome.wustl.edu	37	14	31787465	31787465	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr14:31787465C>G	ENST00000389961.3	-	25	3984	c.3985G>C	c.(3985-3987)Gag>Cag	p.E1329Q	HEATR5A_ENST00000543095.2_Missense_Mutation_p.E1335Q|HEATR5A_ENST00000439727.1_Missense_Mutation_p.E1042Q|HEATR5A_ENST00000439348.1_Missense_Mutation_p.E1329Q			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1329										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GGTGGTGTCTCTGAAGTGAAG	0.413																																						dbGAP											0													155.0	154.0	154.0					14																	31787465		2054	4207	6261	-	-	-	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.3985G>C	14.37:g.31787465C>G	ENSP00000374611:p.Glu1329Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1329Q	ENST00000389961.3	37	c.3985		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.099497|5.099497	0.94197|0.94197	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095|ENST00000538864	T;T;T;T|.	0.66638|.	-0.22;0.79;-0.22;-0.22|.	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	0.107611|.	0.64402|.	D|.	0.000006|.	T|T	0.66771|0.66771	0.2823|0.2823	L|L	0.39898|0.39898	1.24|1.24	0.80722|0.80722	D|D	1|1	B|.	0.30727|.	0.292|.	B|.	0.36845|.	0.234|.	T|T	0.62120|0.62120	-0.6921|-0.6921	10|5	0.87932|.	D|.	0|.	.|.	19.1381|19.1381	0.93436|0.93436	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1329|.	Q86XA9-2|.	.|.	Q|H	1329;1329;1042;1335|962	ENSP00000374611:E1329Q;ENSP00000405407:E1329Q;ENSP00000408681:E1042Q;ENSP00000437968:E1335Q|.	ENSP00000374611:E1329Q|.	E|Q	-|-	1|3	0|2	HEATR5A|HEATR5A	30857216|30857216	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	7.627000|7.627000	0.83176|0.83176	2.591000|2.591000	0.87537|0.87537	0.467000|0.467000	0.42956|0.42956	GAG|CAG	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.413	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		167	0.00	0	C	NM_015473		31787465	31787465	-1	no_errors	ENST00000389961	ensembl	human	known	69_37n	missense	376	12.76	55	SNP	1.000	G
HIAT1	64645	genome.wustl.edu	37	1	100535194	100535194	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:100535194G>C	ENST00000370152.3	+	8	980	c.844G>C	c.(844-846)Gtt>Ctt	p.V282L	RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	282					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		ACCAGAAAGTGTTGCAGCGTT	0.388																																						dbGAP											0													162.0	158.0	160.0					1																	100535194		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.844G>C	1.37:g.100535194G>C	ENSP00000359171:p.Val282Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Tet-R_TetA/multi-R_MdtG,pfscan_MFS_dom	p.V282L	ENST00000370152.3	37	c.844	CCDS763.1	1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592814	0.46214	.	.	ENSG00000156875	ENST00000370152	T	0.56941	0.43	5.63	5.63	0.86233	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000001	T	0.45155	0.1328	L	0.59912	1.85	0.80722	D	1	B	0.27316	0.175	B	0.33339	0.162	T	0.42716	-0.9435	10	0.45353	T	0.12	-17.3115	19.6913	0.96002	0.0:0.0:1.0:0.0	.	282	Q96MC6	HIAT1_HUMAN	L	282	ENSP00000359171:V282L	ENSP00000359171:V282L	V	+	1	0	HIAT1	100307782	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.842000	0.62831	2.654000	0.90174	0.561000	0.74099	GTT	HIAT1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Tet-R_TetA/multi-R_MdtG,pfscan_MFS_dom	ENSG00000156875		0.388	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIAT1	HGNC	protein_coding	OTTHUMT00000029657.1	262	0.00	0	G	NM_033055		100535194	100535194	+1	no_errors	ENST00000370152	ensembl	human	known	69_37n	missense	460	31.75	214	SNP	1.000	C
HHIPL2	79802	genome.wustl.edu	37	1	222717112	222717112	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:222717112A>T	ENST00000343410.6	-	2	799	c.741T>A	c.(739-741)gaT>gaA	p.D247E		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	247					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GGCGACTCCCATCAGGGAGGT	0.597																																						dbGAP											0													86.0	80.0	82.0					1																	222717112		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.741T>A	1.37:g.222717112A>T	ENSP00000342118:p.Asp247Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.D247E	ENST00000343410.6	37	c.741	CCDS1530.2	1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.363401	0.41902	.	.	ENSG00000143512	ENST00000343410	T	0.14266	2.52	5.31	-4.33	0.03677	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.099910	0.64402	D	0.000004	T	0.13200	0.0320	L	0.53729	1.69	0.36354	D	0.860284	B	0.30889	0.299	B	0.36186	0.219	T	0.05037	-1.0910	10	0.31617	T	0.26	-18.5314	12.7954	0.57556	0.5108:0.0:0.4892:0.0	.	247	Q6UWX4	HIPL2_HUMAN	E	247	ENSP00000342118:D247E	ENSP00000342118:D247E	D	-	3	2	HHIPL2	220783735	0.001000	0.12720	0.872000	0.34217	0.584000	0.36387	-0.442000	0.06871	-0.918000	0.03808	-0.605000	0.04089	GAT	HHIPL2	-	superfamily_Quinoprot_gluc/sorb_DH	ENSG00000143512		0.597	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2	120	0.00	0	A	NM_024746		222717112	222717112	-1	no_errors	ENST00000343410	ensembl	human	known	69_37n	missense	158	19.80	39	SNP	0.984	T
HIST1H3A	8350	genome.wustl.edu	37	6	26020728	26020728	+	Missense_Mutation	SNP	C	C	T	rs199966951		TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:26020728C>T	ENST00000357647.3	+	1	11	c.11C>T	c.(10-12)aCt>aTt	p.T4I	HIST1H4A_ENST00000359907.3_5'Flank|HIST1H1A_ENST00000244573.3_5'Flank	NM_003529.2	NP_003520.1	P68431	H31_HUMAN	histone cluster 1, H3a	4					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|lung(3)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						ATGGCTCGCACTAAGCAAACT	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		15442	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													65.0	60.0	62.0					6																	26020728		2203	4298	6501	-	-	-	SO:0001583	missense	0			Z46261	CCDS4570.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000198366	ENSG00000275714		"""Histones / Replication-dependent"""	4766	protein-coding gene	gene with protein product		602810	"""H3 histone family, member A"", ""histone 1, H3a"""	H3FA		9119399, 12408966	Standard	NM_003529		Approved	H3/A	uc003nfp.1	P68431	OTTHUMG00000014418	ENST00000357647.3:c.11C>T	6.37:g.26020728C>T	ENSP00000350275:p.Thr4Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.T4I	ENST00000357647.3	37	c.11	CCDS4570.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	9.945	1.218553	0.22373	.	.	ENSG00000198366	ENST00000357647	T	0.44482	0.92	3.79	3.79	0.43588	Histone-fold (2);	.	.	.	.	T	0.43411	0.1246	M	0.89785	3.06	0.48236	D	0.999612	P	0.42692	0.787	B	0.39419	0.299	T	0.63037	-0.6726	9	0.87932	D	0	.	15.9278	0.79632	0.0:1.0:0.0:0.0	.	4	P68431	H31_HUMAN	I	4	ENSP00000350275:T4I	ENSP00000350275:T4I	T	+	2	0	HIST1H3A	26128707	1.000000	0.71417	0.058000	0.19502	0.307000	0.27823	7.424000	0.80242	2.405000	0.81733	0.650000	0.86243	ACT	HIST1H3A	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000198366		0.552	HIST1H3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3A	HGNC	protein_coding	OTTHUMT00000040080.1	143	0.00	0	C	NM_003529		26020728	26020728	+1	no_errors	ENST00000357647	ensembl	human	known	69_37n	missense	179	17.51	38	SNP	0.989	T
HIST1H2BB	3018	genome.wustl.edu	37	6	26043523	26043523	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:26043523C>G	ENST00000357905.2	-	1	362	c.363G>C	c.(361-363)aaG>aaC	p.K121N	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	121					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						AGCTAGTGTACTTGGTAACTG	0.507																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.363G>C	6.37:g.26043523C>G	ENSP00000350580:p.Lys121Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN36	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.K121N	ENST00000357905.2	37	c.363	CCDS4575.1	6	.	.	.	.	.	.	.	.	.	.	c	8.683	0.905693	0.17760	.	.	ENSG00000196226	ENST00000357905	T	0.46819	0.86	5.08	2.34	0.29019	Histone-fold (2);	0.000000	0.64402	U	0.000012	T	0.34366	0.0895	M	0.90705	3.14	0.36247	D	0.853642	B	0.31837	0.342	B	0.20184	0.028	T	0.31447	-0.9943	10	0.66056	D	0.02	.	9.803	0.40775	0.0:0.7823:0.0:0.2177	.	121	P33778	H2B1B_HUMAN	N	121	ENSP00000350580:K121N	ENSP00000350580:K121N	K	-	3	2	HIST1H2BB	26151502	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	3.361000	0.52306	0.258000	0.21686	0.467000	0.42956	AAG	HIST1H2BB	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000196226		0.507	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BB	HGNC	protein_coding	OTTHUMT00000040083.1	81	0.00	0	C	NM_021062		26043523	26043523	-1	no_errors	ENST00000357905	ensembl	human	known	69_37n	missense	152	21.24	41	SNP	1.000	G
HIST1H2BB	3018	genome.wustl.edu	37	6	26043604	26043604	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:26043604C>G	ENST00000357905.2	-	1	281	c.282G>C	c.(280-282)gaG>gaC	p.E94D	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	94					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						CCGTCTGAATCTCCCTGGAGG	0.562																																						dbGAP											0													64.0	65.0	64.0					6																	26043604		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.282G>C	6.37:g.26043604C>G	ENSP00000350580:p.Glu94Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN36	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E94D	ENST00000357905.2	37	c.282	CCDS4575.1	6	.	.	.	.	.	.	.	.	.	.	c	16.52	3.147564	0.57151	.	.	ENSG00000196226	ENST00000357905	T	0.44881	0.91	5.08	5.08	0.68730	Histone-fold (2);Histone core (1);	0.000000	0.64402	U	0.000019	T	0.32882	0.0844	L	0.60957	1.885	0.47341	D	0.999399	B	0.13145	0.007	B	0.24848	0.056	T	0.25537	-1.0129	10	0.66056	D	0.02	.	17.8155	0.88632	0.0:1.0:0.0:0.0	.	94	P33778	H2B1B_HUMAN	D	94	ENSP00000350580:E94D	ENSP00000350580:E94D	E	-	3	2	HIST1H2BB	26151583	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.058000	0.71126	2.498000	0.84270	0.467000	0.42956	GAG	HIST1H2BB	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000196226		0.562	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BB	HGNC	protein_coding	OTTHUMT00000040083.1	237	0.00	0	C	NM_021062		26043604	26043604	-1	no_errors	ENST00000357905	ensembl	human	known	69_37n	missense	346	22.42	100	SNP	1.000	G
HIST1H1T	3010	genome.wustl.edu	37	6	26108318	26108318	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:26108318A>G	ENST00000338379.4	-	1	46	c.4T>C	c.(4-6)Tct>Cct	p.S2P		NM_005323.3	NP_005314.2	P22492	H1T_HUMAN	histone cluster 1, H1t	2					binding of sperm to zona pellucida (GO:0007339)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|nucleosome assembly (GO:0006334)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(1)|lung(3)|ovary(2)|prostate(1)	9						ACGGTTTCAGACATAACAACA	0.542																																						dbGAP											0													34.0	34.0	34.0					6																	26108318		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60094	CCDS34349.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000187475	ENSG00000187475		"""Histones / Replication-dependent"""	4720	protein-coding gene	gene with protein product		142712	"""H1 histone family, member T (testis-specific)"", ""histone 1, H1t"""	H1FT		8175896, 12408966	Standard	NM_005323		Approved	H1t	uc003ngj.3	P22492	OTTHUMG00000014430	ENST00000338379.4:c.4T>C	6.37:g.26108318A>G	ENSP00000341214:p.Ser2Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ISI1|Q8IUE8	Missense_Mutation	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.S2P	ENST00000338379.4	37	c.4	CCDS34349.1	6	.	.	.	.	.	.	.	.	.	.	.	14.90	2.673967	0.47781	.	.	ENSG00000187475	ENST00000338379	T	0.07216	3.21	5.13	3.98	0.46160	.	0.419999	0.25464	N	0.030496	T	0.03959	0.0111	N	0.08118	0	0.40882	D	0.984003	D	0.67145	0.996	P	0.59171	0.853	T	0.41716	-0.9493	10	0.87932	D	0	-5.3986	6.3519	0.21381	0.7558:0.16:0.0842:0.0	.	2	P22492	H1T_HUMAN	P	2	ENSP00000341214:S2P	ENSP00000341214:S2P	S	-	1	0	HIST1H1T	26216297	1.000000	0.71417	0.800000	0.32199	0.234000	0.25298	1.194000	0.32174	0.994000	0.38892	0.533000	0.62120	TCT	HIST1H1T	-	NULL	ENSG00000187475		0.542	HIST1H1T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1T	HGNC	protein_coding	OTTHUMT00000040093.2	56	0.00	0	A	NM_005323		26108318	26108318	-1	no_errors	ENST00000338379	ensembl	human	known	69_37n	missense	100	48.45	94	SNP	0.994	G
HIST1H3I	8354	genome.wustl.edu	37	6	27840056	27840056	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:27840056C>A	ENST00000328488.2	-	1	43	c.38G>T	c.(37-39)gGc>gTc	p.G13V		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	13					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CGCTTTGCCGCCGGTGGACTT	0.592																																						dbGAP											0													21.0	25.0	24.0					6																	27840056		2190	4281	6471	-	-	-	SO:0001583	missense	0			X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.38G>T	6.37:g.27840056C>A	ENSP00000329554:p.Gly13Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.G13V	ENST00000328488.2	37	c.38	CCDS4636.1	6	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627557	0.28978	.	.	ENSG00000182572	ENST00000328488	T	0.50277	0.75	4.12	4.12	0.48240	.	.	.	.	.	T	0.58750	0.2144	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64499	-0.6393	6	0.87932	D	0	.	16.6345	0.85043	0.0:1.0:0.0:0.0	.	.	.	.	V	13	ENSP00000329554:G13V	ENSP00000329554:G13V	G	-	2	0	HIST1H3I	27948035	1.000000	0.71417	0.997000	0.53966	0.222000	0.24845	7.297000	0.78799	2.580000	0.87095	0.650000	0.86243	GGC	HIST1H3I	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000182572		0.592	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3I	HGNC	protein_coding	OTTHUMT00000043452.1	74	0.00	0	C	NM_003533		27840056	27840056	-1	no_errors	ENST00000328488	ensembl	human	known	69_37n	missense	68	21.84	19	SNP	1.000	A
HYAL4	23553	genome.wustl.edu	37	7	123516844	123516844	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr7:123516844G>A	ENST00000223026.4	+	5	1719	c.1081G>A	c.(1081-1083)Gat>Aat	p.D361N	HYAL4_ENST00000476325.1_Missense_Mutation_p.D361N	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	361					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TGTGAGTTCTGATTTAGGGAG	0.448																																						dbGAP											0													154.0	146.0	149.0					7																	123516844		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.1081G>A	7.37:g.123516844G>A	ENSP00000223026:p.Asp361Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase,prints_Glyco_hydro_56_PH20	p.D361N	ENST00000223026.4	37	c.1081	CCDS5789.1	7	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123458	0.37436	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.21361	2.01;2.01	5.62	4.69	0.59074	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.407188	0.27214	N	0.020392	T	0.20292	0.0488	L	0.40543	1.245	0.30055	N	0.811377	B	0.31459	0.324	B	0.33890	0.172	T	0.05386	-1.0888	10	0.27785	T	0.31	-18.6283	16.0183	0.80460	0.0:0.1344:0.8656:0.0	.	361	Q2M3T9	HYAL4_HUMAN	N	361	ENSP00000223026:D361N;ENSP00000417186:D361N	ENSP00000223026:D361N	D	+	1	0	HYAL4	123304080	0.240000	0.23847	0.993000	0.49108	0.994000	0.84299	2.322000	0.43814	2.822000	0.97130	0.650000	0.86243	GAT	HYAL4	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	ENSG00000106302		0.448	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYAL4	HGNC	protein_coding	OTTHUMT00000348545.1	196	0.51	1	G	NM_012269		123516844	123516844	+1	no_errors	ENST00000223026	ensembl	human	known	69_37n	missense	293	16.52	58	SNP	0.999	A
IGHE	3497	genome.wustl.edu	37	14	106067884	106067884	+	lincRNA	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr14:106067884G>A	ENST00000390540.2	-	0	501				IGHE_ENST00000576077.1_RNA|IGHE_ENST00000577108.1_RNA|AL928742.12_ENST00000412518.1_lincRNA																							ACCAGAGAGCGTGAGGGTGGT	0.622																																						dbGAP											0													152.0	168.0	162.0					14																	106067884		2164	4246	6410	-	-	-			0																															14.37:g.106067884G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.T61M	ENST00000390540.2	37	c.182		14																																																																																			IGHE	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211891		0.622	RP11-731F5.1-001	KNOWN	basic	lincRNA	IGHE	HGNC	lincRNA	OTTHUMT00000380286.1	319	0.00	0	G			106067884	106067884	-1	no_start_codon	ENST00000390541	ensembl	human	known	69_37n	missense	136	53.26	155	SNP	0.000	A
IGKV3-7	28915	genome.wustl.edu	37	2	89277990	89277990	+	RNA	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:89277990T>A	ENST00000390247.2	-	0	441									immunoglobulin kappa variable 3-7 (non-functional)																		CTGTGGGAGGTAAGTTATAAT	0.448																																						dbGAP											0													17.0	16.0	16.0					2																	89277990		1766	3966	5732	-	-	-			0			X02725		2p11.2	2012-02-08	2008-09-10		ENSG00000243063	ENSG00000243063		"""Immunoglobulins / IGK locus"""	5821	other	immunoglobulin gene			"""immunoglobulin kappa variable 3-7"""				Standard	NG_000834		Approved				OTTHUMG00000151636		2.37:g.89277990T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L115F	ENST00000390247.2	37	c.345		2																																																																																			IGKV3-7	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000243063		0.448	IGKV3-7-001	KNOWN	non_canonical_polymorphism|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV3-7	HGNC	IG_V_gene	OTTHUMT00000323360.1	118	0.00	0	T	NG_000834		89277990	89277990	-1	no_stop_codon	ENST00000390247	ensembl	human	known	69_37n	missense	145	26.40	52	SNP	0.039	A
IMPA1	3612	genome.wustl.edu	37	8	82598029	82598029	+	Intron	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr8:82598029C>G	ENST00000256108.5	-	1	442				IMPA1_ENST00000311489.4_Intron|IMPA1_ENST00000449740.2_Missense_Mutation_p.S41T|IMPA1_ENST00000523710.1_Intron	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1						inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	AACACCTGAACTGTTTCCTGC	0.468																																						dbGAP											0													86.0	72.0	77.0					8																	82598029		692	1591	2283	-	-	-	SO:0001627	intron_variant	0				CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.23+457G>C	8.37:g.82598029C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Missense_Mutation	SNP	pfam_Inositol_monophosphatase,prints_Inositol_monoPase_Li-sen,prints_Inositol_monophosphatase	p.S41T	ENST00000256108.5	37	c.122	CCDS6231.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.444|2.444	-0.327950|-0.327950	0.05314|0.05314	.|.	.|.	ENSG00000133731|ENSG00000133731	ENST00000523942|ENST00000449740;ENST00000522997	.|T;T	.|0.35789	.|1.34;1.29	2.58|2.58	-1.23|-1.23	0.09465|0.09465	.|.	.|.	.|.	.|.	.|.	T|T	0.13157|0.13157	0.0319|0.0319	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.10296	.|0.003	.|B	.|0.04013	.|0.001	T|T	0.30563|0.30563	-0.9974|-0.9974	5|9	.|0.09590	.|T	.|0.72	.|.	3.1159|3.1159	0.06375|0.06375	0.4383:0.2571:0.3046:0.0|0.4383:0.2571:0.3046:0.0	.|.	.|41	.|B7Z6Q4	.|.	H|T	13|41	.|ENSP00000408526:S41T;ENSP00000430081:S41T	.|ENSP00000408526:S41T	Q|S	-|-	3|2	2|0	IMPA1|IMPA1	82760584|82760584	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.120000|0.120000	0.20174|0.20174	0.041000|0.041000	0.13927|0.13927	-0.268000|-0.268000	0.09312|0.09312	-0.410000|-0.410000	0.06199|0.06199	CAG|AGT	IMPA1	-	NULL	ENSG00000133731		0.468	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPA1	HGNC	protein_coding	OTTHUMT00000379723.1	207	0.00	0	C			82598029	82598029	-1	no_errors	ENST00000449740	ensembl	human	known	69_37n	missense	265	32.40	127	SNP	0.002	G
KCNA10	3744	genome.wustl.edu	37	1	111060445	111060445	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:111060445T>A	ENST00000369771.2	-	1	1352	c.965A>T	c.(964-966)gAg>gTg	p.E322V		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	322					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	CTGGACTAGCTCTGTGATGAG	0.527																																						dbGAP											0													128.0	121.0	123.0					1																	111060445		2203	4300	6503	-	-	-	SO:0001583	missense	0			U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.965A>T	1.37:g.111060445T>A	ENSP00000358786:p.Glu322Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.E322V	ENST00000369771.2	37	c.965	CCDS826.1	1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.713388	0.48517	.	.	ENSG00000143105	ENST00000369771	D	0.98493	-4.96	5.67	5.67	0.87782	Ion transport (1);	0.052415	0.85682	D	0.000000	D	0.97120	0.9059	L	0.31845	0.965	0.58432	D	0.999996	D	0.63880	0.993	P	0.61003	0.882	D	0.97264	0.9906	10	0.40728	T	0.16	.	14.7286	0.69362	0.0:0.0:0.0:1.0	.	322	Q16322	KCA10_HUMAN	V	322	ENSP00000358786:E322V	ENSP00000358786:E322V	E	-	2	0	KCNA10	110861968	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	8.040000	0.89188	2.164000	0.68074	0.460000	0.39030	GAG	KCNA10	-	pfam_Ion_trans_dom	ENSG00000143105		0.527	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA10	HGNC	protein_coding	OTTHUMT00000059081.1	180	0.55	1	T	NM_005549		111060445	111060445	-1	no_errors	ENST00000369771	ensembl	human	known	69_37n	missense	224	19.42	54	SNP	1.000	A
KCNV2	169522	genome.wustl.edu	37	9	2729625	2729625	+	Silent	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr9:2729625C>T	ENST00000382082.3	+	2	1774	c.1536C>T	c.(1534-1536)cgC>cgT	p.R512R		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	512					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		CCACCATACGCAGGGAGAGGG	0.468																																						dbGAP											0													109.0	98.0	101.0					9																	2729625		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.1536C>T	9.37:g.2729625C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6X0	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.R512	ENST00000382082.3	37	c.1536	CCDS6447.1	9																																																																																			KCNV2	-	NULL	ENSG00000168263		0.468	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV2	HGNC	protein_coding	OTTHUMT00000051528.1	109	0.00	0	C	NM_133497		2729625	2729625	+1	no_errors	ENST00000382082	ensembl	human	known	69_37n	silent	267	42.83	200	SNP	0.000	T
KLHL24	54800	genome.wustl.edu	37	3	183390243	183390243	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr3:183390243A>G	ENST00000454652.2	+	8	1959	c.1573A>G	c.(1573-1575)Atg>Gtg	p.M525V	KLHL24_ENST00000476808.1_Missense_Mutation_p.M525V|KLHL24_ENST00000242810.6_Missense_Mutation_p.M525V	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	525						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			AGATTACTGGATGCACGTACA	0.373																																						dbGAP											0													81.0	64.0	70.0					3																	183390243		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1573A>G	3.37:g.183390243A>G	ENSP00000395012:p.Met525Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.M525V	ENST00000454652.2	37	c.1573	CCDS3246.1	3	.	.	.	.	.	.	.	.	.	.	A	12.87	2.066815	0.36470	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.76709	-1.04;-1.04;-1.04	5.9	5.9	0.94986	Galactose oxidase, beta-propeller (1);	0.039341	0.85682	D	0.000000	T	0.62829	0.2460	N	0.11560	0.145	0.58432	D	0.999999	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.57991	-0.7715	10	0.33141	T	0.24	.	16.3291	0.83001	1.0:0.0:0.0:0.0	.	525;525	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	V	525	ENSP00000242810:M525V;ENSP00000395012:M525V;ENSP00000419010:M525V	ENSP00000242810:M525V	M	+	1	0	KLHL24	184872937	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.257000	0.74773	0.528000	0.53228	ATG	KLHL24	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000114796		0.373	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLHL24	HGNC	protein_coding	OTTHUMT00000346586.2	81	0.00	0	A	NM_017644		183390243	183390243	+1	no_errors	ENST00000242810	ensembl	human	known	69_37n	missense	141	25.40	48	SNP	1.000	G
KLHL38	340359	genome.wustl.edu	37	8	124663967	124663967	+	Silent	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr8:124663967G>T	ENST00000325995.7	-	1	1223	c.1200C>A	c.(1198-1200)tcC>tcA	p.S400S	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	400										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						ACCTTTCCATGGAGCCCATGA	0.577																																						dbGAP											0													68.0	67.0	67.0					8																	124663967		2024	4182	6206	-	-	-	SO:0001819	synonymous_variant	0				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1200C>A	8.37:g.124663967G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK12	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S400	ENST00000325995.7	37	c.1200	CCDS43766.1	8																																																																																			KLHL38	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000175946		0.577	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL38	HGNC	protein_coding	OTTHUMT00000381288.1	197	0.00	0	G			124663967	124663967	-1	no_errors	ENST00000325995	ensembl	human	known	69_37n	silent	340	24.94	113	SNP	0.986	T
LDLR	3949	genome.wustl.edu	37	19	11216199	11216199	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr19:11216199G>T	ENST00000558518.1	+	4	804	c.617G>T	c.(616-618)aGt>aTt	p.S206I	LDLR_ENST00000455727.2_Intron|LDLR_ENST00000558013.1_Missense_Mutation_p.S206I|LDLR_ENST00000535915.1_Missense_Mutation_p.S165I|LDLR_ENST00000545707.1_Intron|LDLR_ENST00000557933.1_Missense_Mutation_p.S206I	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	206	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	CACTGCCTAAGTGGCGAGTGC	0.622																																					GBM(18;201 575 7820 21545)	dbGAP											1	Unknown(1)	lung(1)	GRCh37	CD983972	LDLR	D							38.0	43.0	42.0					19																	11216199		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.617G>T	19.37:g.11216199G>T	ENSP00000454071:p.Ser206Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S206I	ENST00000558518.1	37	c.617	CCDS12254.1	19	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385956	0.61956	.	.	ENSG00000130164	ENST00000252444;ENST00000535915	D	0.95918	-3.85	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000001	D	0.98327	0.9445	M	0.92459	3.31	0.58432	D	0.999999	P;D;D;D	0.89917	0.784;1.0;1.0;1.0	P;D;D;D	0.87578	0.779;0.997;0.998;0.998	D	0.99229	1.0881	10	0.87932	D	0	.	18.3742	0.90430	0.0:0.0:1.0:0.0	.	85;165;218;206	B4DII3;B4DTQ3;Q59FQ1;P01130	.;.;.;LDLR_HUMAN	I	206;165	ENSP00000440520:S165I	ENSP00000252444:S206I	S	+	2	0	LDLR	11077199	0.974000	0.33945	0.977000	0.42913	0.132000	0.20833	3.147000	0.50639	2.648000	0.89879	0.591000	0.81541	AGT	LDLR	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000130164		0.622	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	HGNC	protein_coding	OTTHUMT00000415973.2	55	0.00	0	G			11216199	11216199	+1	no_errors	ENST00000558518	ensembl	human	known	69_37n	missense	28	39.13	18	SNP	0.999	T
KLK15	55554	genome.wustl.edu	37	19	51330004	51330004	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr19:51330004G>T	ENST00000598239.1	-	4	521	c.491C>A	c.(490-492)cCa>cAa	p.P164Q	KLK15_ENST00000596931.1_Intron|KLK1_ENST00000301420.2_5'Flank|KLK1_ENST00000448701.2_5'Flank|KLK15_ENST00000416184.1_Intron|KLK15_ENST00000301421.2_Intron|KLK15_ENST00000326856.4_Missense_Mutation_p.P163Q	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	164	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		CAACGTATCTGGGAGACTCAC	0.557																																					Pancreas(140;10 2513 7143 9246)	dbGAP											0													121.0	112.0	115.0					19																	51330004		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.491C>A	19.37:g.51330004G>T	ENSP00000469315:p.Pro164Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.P164Q	ENST00000598239.1	37	c.491	CCDS12805.1	19	.	.	.	.	.	.	.	.	.	.	g	26.4	4.735868	0.89482	.	.	ENSG00000174562	ENST00000326856	.	.	.	4.65	4.65	0.58169	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.46145	D	0.000309	T	0.80681	0.4669	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.995	D	0.83986	0.0335	9	0.87932	D	0	.	15.4101	0.74911	0.0:0.0:1.0:0.0	.	163;164	Q6ISI0;Q9H2R5	.;KLK15_HUMAN	Q	164	.	ENSP00000314783:P164Q	P	-	2	0	KLK15	56021816	0.997000	0.39634	0.211000	0.23655	0.990000	0.78478	3.328000	0.52052	2.595000	0.87683	0.555000	0.69702	CCA	KLK15	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000174562		0.557	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK15	HGNC	protein_coding	OTTHUMT00000465160.1	215	0.00	0	G	NM_017509		51330004	51330004	-1	no_errors	ENST00000326856	ensembl	human	known	69_37n	missense	250	16.94	51	SNP	0.534	T
LILRA6	79168	genome.wustl.edu	37	19	54744774	54744774	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr19:54744774G>T	ENST00000396365.2	-	5	927	c.888C>A	c.(886-888)tgC>tgA	p.C296*	LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000245621.5_Nonsense_Mutation_p.C296*|LILRA6_ENST00000419410.2_Nonsense_Mutation_p.C296*|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000440558.2_Nonsense_Mutation_p.C296*	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	296	Ig-like C2-type 1.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTGCACCATAGCACCTGTACT	0.677																																						dbGAP											0													57.0	71.0	66.0					19																	54744774		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.888C>A	19.37:g.54744774G>T	ENSP00000379651:p.Cys296*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.C296*	ENST00000396365.2	37	c.888	CCDS42610.1	19	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986804	0.35036	.	.	ENSG00000244482	ENST00000440558;ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	.	.	.	2.1	-0.226	0.13106	.	0.000000	0.51477	D	0.000094	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4601	0.11663	0.3639:0.0:0.6361:0.0	.	.	.	.	X	296	.	ENSP00000245621:C296X	C	-	3	2	LILRA6	59436586	0.031000	0.19500	0.825000	0.32803	0.043000	0.13939	0.389000	0.20751	0.032000	0.15435	0.162000	0.16502	TGC	LILRA6	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000244482		0.677	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	LILRA6	HGNC	protein_coding	OTTHUMT00000313725.1	214	0.00	0	G	NM_024318		54744774	54744774	-1	no_errors	ENST00000419410	ensembl	human	known	69_37n	nonsense	258	15.69	48	SNP	0.864	T
LPGAT1	9926	genome.wustl.edu	37	1	211924401	211924401	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:211924401G>A	ENST00000366997.4	-	7	1089	c.863C>T	c.(862-864)cCa>cTa	p.P288L	LPGAT1_ENST00000366996.1_Missense_Mutation_p.P288L	NM_014873.2	NP_055688.1	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	288					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		ATCTTTAATTGGAAAGATCCT	0.343																																						dbGAP											0													63.0	64.0	64.0					1																	211924401		2203	4299	6502	-	-	-	SO:0001583	missense	0			D86960	CCDS31018.1	1q32.3	2008-05-14	2004-11-25	2004-11-26	ENSG00000123684	ENSG00000123684			28985	protein-coding gene	gene with protein product		610473	"""family with sequence similarity 34, member A"""	FAM34A		9039502, 15485873	Standard	NM_014873		Approved	KIAA0205, FAM34A1, NET8	uc001hiv.3	Q92604	OTTHUMG00000037120	ENST00000366997.4:c.863C>T	1.37:g.211924401G>A	ENSP00000355964:p.Pro288Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YL2	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.P288L	ENST00000366997.4	37	c.863	CCDS31018.1	1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724534	0.89298	.	.	ENSG00000123684	ENST00000366997;ENST00000366996	T;T	0.73469	-0.75;-0.75	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.87305	0.6144	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87757	0.2596	10	0.54805	T	0.06	-13.6607	19.269	0.94002	0.0:0.0:1.0:0.0	.	288	Q92604	LGAT1_HUMAN	L	288	ENSP00000355964:P288L;ENSP00000355963:P288L	ENSP00000355963:P288L	P	-	2	0	LPGAT1	209991024	1.000000	0.71417	0.974000	0.42286	0.916000	0.54674	8.398000	0.90195	2.630000	0.89119	0.591000	0.81541	CCA	LPGAT1	-	NULL	ENSG00000123684		0.343	LPGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPGAT1	HGNC	protein_coding	OTTHUMT00000090150.1	107	0.00	0	G	NM_014873		211924401	211924401	-1	no_errors	ENST00000366996	ensembl	human	known	69_37n	missense	184	41.40	130	SNP	1.000	A
LRFN5	145581	genome.wustl.edu	37	14	42356845	42356845	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr14:42356845C>G	ENST00000298119.4	+	3	2206	c.1017C>G	c.(1015-1017)aaC>aaG	p.N339K	LRFN5_ENST00000554171.1_Missense_Mutation_p.N339K|LRFN5_ENST00000554120.1_Missense_Mutation_p.N339K	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	339	Ig-like.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGTATGATAACGGAACACTTG	0.448										HNSCC(30;0.082)																												dbGAP											0													126.0	122.0	124.0					14																	42356845		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1017C>G	14.37:g.42356845C>G	ENSP00000298119:p.Asn339Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU78|Q86XL2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.N339K	ENST00000298119.4	37	c.1017	CCDS9678.1	14	.	.	.	.	.	.	.	.	.	.	C	14.64	2.594345	0.46214	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.74106	-0.81;-0.81;-0.81	5.4	-1.73	0.08081	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000011	D	0.83161	0.5194	M	0.83483	2.645	0.52099	D	0.999944	D;D	0.76494	0.999;0.98	D;D	0.76575	0.988;0.934	T	0.82125	-0.0612	10	0.72032	D	0.01	.	9.8469	0.41032	0.0:0.4212:0.0:0.5788	.	339;339	G3V364;Q96NI6	.;LRFN5_HUMAN	K	339	ENSP00000298119:N339K;ENSP00000451897:N339K;ENSP00000451067:N339K	ENSP00000298119:N339K	N	+	3	2	LRFN5	41426595	0.161000	0.22892	0.995000	0.50966	0.993000	0.82548	-0.501000	0.06398	-0.156000	0.11079	-0.440000	0.05779	AAC	LRFN5	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000165379		0.448	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	HGNC	protein_coding	OTTHUMT00000276786.1	115	0.00	0	C	NM_152447		42356845	42356845	+1	no_errors	ENST00000298119	ensembl	human	known	69_37n	missense	169	39.21	109	SNP	0.999	G
LSM5	23658	genome.wustl.edu	37	7	32529929	32529929	+	Intron	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr7:32529929T>A	ENST00000450169.2	-	1	99				LSM5_ENST00000410044.1_5'UTR|LSM5_ENST00000409782.1_Intron|LSM5_ENST00000409987.1_Intron|LSM5_ENST00000409952.3_Intron|LSM5_ENST00000409909.3_Intron|LSM5_ENST00000409292.1_5'Flank	NM_001130710.1|NM_012322.2	NP_001124182.1|NP_036454.1	Q9Y4Y9	LSM5_HUMAN	LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			breast(1)|cervix(1)|large_intestine(1)|lung(1)|stomach(1)	5			GBM - Glioblastoma multiforme(11;0.152)			GGACGGCGATTACCTAAGGGC	0.602																																						dbGAP											0													88.0	70.0	76.0					7																	32529929		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF182291	CCDS5438.1, CCDS47571.1	7p14.3	2003-02-17			ENSG00000106355	ENSG00000106355			17162	protein-coding gene	gene with protein product		607285				10369684, 12515382	Standard	NM_001130710		Approved	YER146W	uc003tct.2	Q9Y4Y9	OTTHUMG00000022913	ENST00000450169.2:c.46+2A>T	7.37:g.32529929T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.N17Y	ENST00000450169.2	37	c.49	CCDS5438.1	7																																																																																			LSM5	-	NULL	ENSG00000106355		0.602	LSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM5	HGNC	protein_coding	OTTHUMT00000215102.2	194	0.00	0	T			32529929	32529929	-1	no_errors	ENST00000223084	ensembl	human	known	69_37n	missense	120	30.86	54	SNP	0.997	A
MARC2	54996	genome.wustl.edu	37	1	220928454	220928454	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:220928454C>G	ENST00000366913.3	+	2	636	c.438C>G	c.(436-438)caC>caG	p.H146Q	MARC2_ENST00000359316.2_Missense_Mutation_p.H146Q	NM_017898.3	NP_060368.2	Q969Z3	MARC2_HUMAN	mitochondrial amidoxime reducing component 2	146					detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										ACAAACTCCACAACTGCAGGT	0.488																																						dbGAP											0													102.0	95.0	97.0					1																	220928454		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1525.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000117791	ENSG00000117791			26064	protein-coding gene	gene with protein product		614127	"""MOCO sulphurase C-terminal domain containing 2"""	MOSC2		11886751	Standard	NM_017898		Approved	FLJ20605	uc001hmq.3	Q969Z3	OTTHUMG00000037354	ENST00000366913.3:c.438C>G	1.37:g.220928454C>G	ENSP00000355880:p.His146Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2D0R5|D3DTB3|Q0JSK7|Q5VT67|Q5VXC7|Q7L317|Q9H066|Q9NWU0	Missense_Mutation	SNP	pfam_MOSC_N,pfam_MoCF_Sase_C,superfamily_Pyrv_Knase-like_insert_dom	p.H146Q	ENST00000366913.3	37	c.438	CCDS1525.1	1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.937892	0.34189	.	.	ENSG00000117791	ENST00000359316;ENST00000366913;ENST00000425560	T;T;T	0.27557	1.66;1.66;1.66	5.05	-10.1	0.00402	MOSC, N-terminal beta barrel (1);Pyruvate kinase-like, insert domain (1);	0.807665	0.11372	N	0.570774	T	0.12561	0.0305	N	0.16130	0.375	0.09310	N	1	B;B	0.15473	0.005;0.013	B;B	0.22152	0.01;0.038	T	0.20974	-1.0259	10	0.27785	T	0.31	-33.207	8.5384	0.33377	0.0849:0.5857:0.2315:0.0979	.	146;146	Q969Z3-2;Q969Z3	.;MOSC2_HUMAN	Q	146;146;47	ENSP00000352266:H146Q;ENSP00000355880:H146Q;ENSP00000416442:H47Q	ENSP00000352266:H146Q	H	+	3	2	MOSC2	218995077	0.000000	0.05858	0.002000	0.10522	0.603000	0.37013	-3.611000	0.00415	-1.850000	0.01169	0.563000	0.77884	CAC	MARC2	-	pfam_MOSC_N,superfamily_Pyrv_Knase-like_insert_dom	ENSG00000117791		0.488	MARC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARC2	HGNC	protein_coding	OTTHUMT00000090911.1	131	0.00	0	C	NM_017898		220928454	220928454	+1	no_errors	ENST00000366913	ensembl	human	known	69_37n	missense	154	32.46	74	SNP	0.000	G
LYST	1130	genome.wustl.edu	37	1	235922289	235922289	+	Silent	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:235922289T>A	ENST00000389794.3	-	23	7038	c.6864A>T	c.(6862-6864)cgA>cgT	p.R2288R	LYST_ENST00000389793.2_Silent_p.R2288R			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2288					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CACTTGCAGTTCGGTTGTAAT	0.418																																						dbGAP											0													76.0	68.0	71.0					1																	235922289		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6864A>T	1.37:g.235922289T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R2288	ENST00000389794.3	37	c.6864	CCDS31062.1	1																																																																																			LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.418	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	67	0.00	0	T			235922289	235922289	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	silent	315	10.76	38	SNP	0.006	A
MARCH10	162333	genome.wustl.edu	37	17	60814611	60814611	+	Silent	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr17:60814611C>A	ENST00000311269.5	-	6	892	c.618G>T	c.(616-618)tcG>tcT	p.S206S	RP11-156L14.1_ENST00000579201.1_RNA|RP11-156L14.1_ENST00000577270.1_RNA|MARCH10_ENST00000544856.2_Silent_p.S205S|RP11-156L14.1_ENST00000584597.1_RNA|MARCH10_ENST00000583600.1_Silent_p.S244S|RP11-156L14.1_ENST00000582564.1_RNA|MARCH10_ENST00000456609.2_Silent_p.S206S	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	206					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						TTGGCTGTGACGATGGGACCA	0.502																																						dbGAP											0													253.0	244.0	247.0					17																	60814611		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.618G>T	17.37:g.60814611C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU09|Q8IYS7|Q8N7Z7	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.S206	ENST00000311269.5	37	c.618	CCDS11635.1	17																																																																																			MARCH10	-	NULL	ENSG00000173838		0.502	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MARCH10	HGNC	protein_coding	OTTHUMT00000445252.1	284	0.00	0	C	NM_152598		60814611	60814611	-1	no_errors	ENST00000311269	ensembl	human	known	69_37n	silent	409	21.80	114	SNP	0.003	A
MRFAP1	93621	genome.wustl.edu	37	4	6642829	6642829	+	Frame_Shift_Del	DEL	C	C	-	rs147713674	byFrequency	TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr4:6642829delC	ENST00000320912.4	+	2	893	c.240delC	c.(238-240)aacfs	p.N80fs	MRFAP1_ENST00000507420.1_Frame_Shift_Del_p.N80fs|MRFAP1_ENST00000382581.4_Frame_Shift_Del_p.N80fs	NM_001272053.1	NP_001258982.1			Morf4 family associated protein 1											lung(1)	1						GCGCCCTCAACCACCTCCAGA	0.647																																						dbGAP											0													49.0	50.0	49.0					4																	6642829		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF116272	CCDS3389.1	4p16.1	2011-01-27	2011-01-27		ENSG00000179010	ENSG00000179010			24549	protein-coding gene	gene with protein product						15367658	Standard	NM_033296		Approved	PAM14, PGR1	uc003gjh.2	Q9Y605	OTTHUMG00000125504	ENST00000320912.4:c.240delC	4.37:g.6642829delC	ENSP00000318352:p.Asn80fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	NULL	p.H81fs	ENST00000320912.4	37	c.240	CCDS3389.1	4																																																																																			MRFAP1	-	NULL	ENSG00000179010		0.647	MRFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRFAP1	HGNC	protein_coding	OTTHUMT00000246831.1	54	0.00	0	C	NM_033296		6642829	6642829	+1	no_errors	ENST00000320912	ensembl	human	known	69_37n	frame_shift_del	91	18.75	21	DEL	0.000	-
MSL1	339287	genome.wustl.edu	37	17	38290099	38290099	+	Silent	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr17:38290099C>T	ENST00000398532.4	+	8	2016	c.1701C>T	c.(1699-1701)acC>acT	p.T567T	MSL1_ENST00000578648.1_Silent_p.T551T|MSL1_ENST00000579565.1_Silent_p.T304T	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)	567	Sufficient for interaction with MSL3 MRG domain.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						TGATGATTACCCCCTTCTTGC	0.398																																						dbGAP											0													166.0	148.0	154.0					17																	38290099		1855	4096	5951	-	-	-	SO:0001819	synonymous_variant	0				CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.1701C>T	17.37:g.38290099C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VF46|Q69Z03	Silent	SNP	NULL	p.T567	ENST00000398532.4	37	c.1701		17																																																																																			MSL1	-	NULL	ENSG00000188895		0.398	MSL1-003	KNOWN	basic	protein_coding	MSL1	HGNC	protein_coding	OTTHUMT00000447409.2	322	0.31	1	C	NM_001012241		38290099	38290099	+1	no_errors	ENST00000398532	ensembl	human	known	69_37n	silent	324	28.00	126	SNP	1.000	T
MXRA5	25878	genome.wustl.edu	37	X	3241923	3241923	+	Silent	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chrX:3241923A>G	ENST00000217939.6	-	5	1957	c.1803T>C	c.(1801-1803)gcT>gcC	p.A601A		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	601	Ig-like C2-type 2.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTATTGCTAAAGCATTGCAAG	0.463																																						dbGAP											0													87.0	69.0	75.0					X																	3241923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1803T>C	X.37:g.3241923A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A601	ENST00000217939.6	37	c.1803	CCDS14124.1	X																																																																																			MXRA5	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000101825		0.463	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	266	0.00	0	A	NM_015419		3241923	3241923	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	silent	407	15.73	76	SNP	0.000	G
STK26	51765	genome.wustl.edu	37	X	131202597	131202597	+	Splice_Site	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chrX:131202597A>G	ENST00000354719.6	+	6	813	c.597A>G	c.(595-597)aaA>aaG	p.K199K	MST4_ENST00000481105.1_Splice_Site_p.K221K|MST4_ENST00000394335.2_Splice_Site_p.K122K|MST4_ENST00000394334.2_Splice_Site_p.K199K|MST4_ENST00000496850.1_Splice_Site_p.K199K																endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					ATGACTCAAAAGTAAAGTATT	0.353																																						dbGAP											0													58.0	60.0	59.0					X																	131202597		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000354719.6:c.597+1A>G	X.37:g.131202597A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K199	ENST00000354719.6	37	c.597		X																																																																																			MST4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000134602		0.353	MST4-002	NOVEL	basic|exp_conf	protein_coding	MST4	Clone_based_vega_gene	protein_coding	OTTHUMT00000058308.2	35	0.00	0	A		Silent	131202597	131202597	+1	no_errors	ENST00000394334	ensembl	human	known	69_37n	silent	66	34.00	34	SNP	1.000	G
MYT1L	23040	genome.wustl.edu	37	2	1946873	1946873	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:1946873C>T	ENST00000399161.2	-	9	1133	c.386G>A	c.(385-387)cGg>cAg	p.R129Q	MYT1L_ENST00000428368.2_Missense_Mutation_p.R129Q	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	129	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ctcctcctcccggtccccctc	0.587																																						dbGAP											0													84.0	85.0	84.0					2																	1946873		2102	4106	6208	-	-	-	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.386G>A	2.37:g.1946873C>T	ENSP00000382114:p.Arg129Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.R129Q	ENST00000399161.2	37	c.386		2	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034996	0.35893	.	.	ENSG00000186487	ENST00000399161;ENST00000428368	T;T	0.44083	0.93;0.93	5.26	5.26	0.73747	.	2.289470	0.02717	U	0.113530	T	0.36331	0.0963	L	0.27053	0.805	0.42026	D	0.991001	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.02404	-1.1164	10	0.18710	T	0.47	-5.6421	12.8852	0.58040	0.0:0.9207:0.0:0.0793	.	129;129	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	Q	129	ENSP00000382114:R129Q;ENSP00000396103:R129Q	ENSP00000382114:R129Q	R	-	2	0	MYT1L	1925880	1.000000	0.71417	0.983000	0.44433	0.532000	0.34746	2.150000	0.42254	2.446000	0.82766	0.563000	0.77884	CGG	MYT1L	-	NULL	ENSG00000186487		0.587	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	652	0.00	0	C	NM_015025		1946873	1946873	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	missense	782	18.61	179	SNP	0.990	T
NAALAD2	10003	genome.wustl.edu	37	11	89916133	89916133	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr11:89916133G>A	ENST00000534061.1	+	18	2220	c.1990G>A	c.(1990-1992)Gca>Aca	p.A664T	NAALAD2_ENST00000321955.4_Missense_Mutation_p.A631T|NAALAD2_ENST00000375944.3_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	664					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CCTGGAAAGAGCATTCATCGA	0.418																																						dbGAP											0													149.0	144.0	145.0					11																	89916133		2201	4298	6499	-	-	-	SO:0001583	missense	0			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1990G>A	11.37:g.89916133G>A	ENSP00000432481:p.Ala664Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.A664T	ENST00000534061.1	37	c.1990	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933659	0.92458	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	T;T	0.58652	0.32;0.32	4.77	4.77	0.60923	Transferrin receptor-like, dimerisation domain (3);	0.000000	0.64402	D	0.000001	T	0.70343	0.3213	M	0.78344	2.41	0.80722	D	1	D	0.53885	0.963	P	0.52386	0.697	T	0.73814	-0.3864	9	.	.	.	-18.7528	18.2222	0.89905	0.0:0.0:1.0:0.0	.	664	Q9Y3Q0	NALD2_HUMAN	T	664;631	ENSP00000432481:A664T;ENSP00000320083:A631T	.	A	+	1	0	NAALAD2	89555781	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.280000	0.95786	2.355000	0.79922	0.552000	0.68991	GCA	NAALAD2	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom	ENSG00000077616		0.418	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	135	0.00	0	G	NM_005467		89916133	89916133	+1	no_errors	ENST00000534061	ensembl	human	known	69_37n	missense	314	17.80	68	SNP	1.000	A
NBPF10	100132406	genome.wustl.edu	37	1	145323656	145323656	+	Missense_Mutation	SNP	A	A	T	rs75252120	byFrequency	TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:145323656A>T	ENST00000342960.5	+	27	3528	c.3493A>T	c.(3493-3495)Att>Ttt	p.I1165F	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	752						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.I1165F(3)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TATTGCAGGAATTAAAAAGGA	0.473																																						dbGAP											3	Substitution - Missense(3)	endometrium(2)|kidney(1)																																								-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3493A>T	1.37:g.145323656A>T	ENSP00000345684:p.Ile1165Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.I1165F	ENST00000342960.5	37	c.3493	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	7.524	0.657305	0.14580	.	.	ENSG00000163386	ENST00000342960	T	0.03441	3.93	.	.	.	.	.	.	.	.	T	0.02342	0.0072	M	0.67953	2.075	0.09310	N	1	.	.	.	.	.	.	T	0.44065	-0.9352	5	0.28530	T	0.3	.	.	.	.	.	.	.	.	F	1165	ENSP00000345684:I1165F	ENSP00000345684:I1165F	I	+	1	0	NBPF10	144035013	0.353000	0.24904	0.005000	0.12908	0.123000	0.20343	1.122000	0.31295	0.386000	0.24997	0.128000	0.15822	ATT	NBPF10	-	NULL	ENSG00000163386		0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		35	0.00	0	A	NM_001039703		145323656	145323656	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	176	17.76	38	SNP	0.007	T
NCSTN	23385	genome.wustl.edu	37	1	160314596	160314596	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:160314596C>G	ENST00000294785.5	+	2	295	c.170C>G	c.(169-171)aCt>aGt	p.T57S	NCSTN_ENST00000535857.1_Missense_Mutation_p.T57S|NCSTN_ENST00000392212.4_Missense_Mutation_p.T37S|NCSTN_ENST00000368063.1_Missense_Mutation_p.T37S|COPA_ENST00000368069.3_5'Flank|COPA_ENST00000241704.7_5'Flank	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	57					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTCAACGCCACTCATCAGATT	0.443																																						dbGAP											0													89.0	74.0	80.0					1																	160314596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.170C>G	1.37:g.160314596C>G	ENSP00000294785:p.Thr57Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T207|Q5T208|Q86VV5	Missense_Mutation	SNP	pfam_Nicastrin	p.T57S	ENST00000294785.5	37	c.170	CCDS1203.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608476	0.87258	.	.	ENSG00000162736	ENST00000294785;ENST00000368063;ENST00000437169;ENST00000421914;ENST00000535857;ENST00000438008;ENST00000392212	T;T;T;T;T;T;T	0.80738	-1.39;-1.41;-0.72;-0.48;-0.43;-0.43;-1.41	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.85292	0.5663	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.81914	0.99;0.995;0.983	D	0.84166	0.0431	10	0.36615	T	0.2	-16.8848	14.2472	0.65995	0.0:1.0:0.0:0.0	.	57;37;57	F6Y097;Q92542-2;Q92542	.;.;NICA_HUMAN	S	57;37;57;57;57;90;37	ENSP00000294785:T57S;ENSP00000357042:T37S;ENSP00000415442:T57S;ENSP00000390409:T57S;ENSP00000442605:T57S;ENSP00000389370:T90S;ENSP00000376047:T37S	ENSP00000294785:T57S	T	+	2	0	NCSTN	158581220	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	6.667000	0.74451	2.366000	0.80165	0.557000	0.71058	ACT	NCSTN	-	NULL	ENSG00000162736		0.443	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCSTN	HGNC	protein_coding	OTTHUMT00000080622.1	172	0.00	0	C	NM_015331		160314596	160314596	+1	no_errors	ENST00000294785	ensembl	human	known	69_37n	missense	380	14.61	65	SNP	1.000	G
NDRG4	65009	genome.wustl.edu	37	16	58543214	58543214	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr16:58543214C>G	ENST00000570248.1	+	13	929	c.823C>G	c.(823-825)Ctg>Gtg	p.L275V	NDRG4_ENST00000563799.1_Missense_Mutation_p.L293V|NDRG4_ENST00000394279.2_Missense_Mutation_p.L307V|NDRG4_ENST00000258187.5_Missense_Mutation_p.L307V|NDRG4_ENST00000568640.1_Missense_Mutation_p.L293V|NDRG4_ENST00000562999.1_Missense_Mutation_p.L263V|NDRG4_ENST00000394282.4_Missense_Mutation_p.L327V|NDRG4_ENST00000566192.1_Missense_Mutation_p.L275V|NDRG4_ENST00000569923.1_Missense_Mutation_p.L220V|NDRG4_ENST00000356752.4_Missense_Mutation_p.L305V	NM_001242835.1	NP_001229764.1	Q9ULP0	NDRG4_HUMAN	NDRG family member 4	275					cell differentiation (GO:0030154)|cell growth (GO:0016049)|response to stress (GO:0006950)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11						GCCAGGGAAGCTGACTGAAGC	0.572																																						dbGAP											0													94.0	87.0	90.0					16																	58543214		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB044947	CCDS10797.1, CCDS45500.1, CCDS55999.1, CCDS58465.1, CCDS58466.1, CCDS58467.1	16q21-q22.3	2008-07-04			ENSG00000103034	ENSG00000103034			14466	protein-coding gene	gene with protein product		614463				11352569, 16408304	Standard	NM_020465		Approved	KIAA1180, SMAP-8	uc002enk.3	Q9ULP0	OTTHUMG00000133485	ENST00000570248.1:c.823C>G	16.37:g.58543214C>G	ENSP00000457659:p.Leu275Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNU2|B4DK66|B4DSW5|H7C600|Q6ZNE7|Q6ZTI7|Q96PL9|Q9GZM1|Q9GZN3|Q9GZX0	Missense_Mutation	SNP	pfam_Ndr	p.L327V	ENST00000570248.1	37	c.979	CCDS58466.1	16	.	.	.	.	.	.	.	.	.	.	C	21.3	4.122279	0.77436	.	.	ENSG00000103034	ENST00000258187;ENST00000421602;ENST00000394282;ENST00000394279;ENST00000356752	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.38692	0.1050	L	0.46157	1.445	0.80722	D	1	D;D;D;P;D;D;D	0.67145	0.984;0.996;0.984;0.937;0.979;0.987;0.968	P;D;P;P;P;P;P	0.64776	0.833;0.929;0.846;0.561;0.765;0.779;0.704	T	0.02301	-1.1180	10	0.36615	T	0.2	-16.1219	17.7598	0.88461	0.0:1.0:0.0:0.0	.	293;305;293;275;275;327;307	B4DK66;B4DSW5;Q9ULP0-5;Q9ULP0-2;Q9ULP0;Q9ULP0-6;Q9ULP0-3	.;.;.;.;NDRG4_HUMAN;.;.	V	307;220;327;307;305	ENSP00000258187:L307V;ENSP00000377823:L327V;ENSP00000377820:L307V;ENSP00000349193:L305V	ENSP00000258187:L307V	L	+	1	2	NDRG4	57100715	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.836000	0.55813	2.526000	0.85167	0.561000	0.74099	CTG	NDRG4	-	pfam_Ndr	ENSG00000103034		0.572	NDRG4-009	KNOWN	basic|CCDS	protein_coding	NDRG4	HGNC	protein_coding	OTTHUMT00000422671.2	166	0.00	0	C			58543214	58543214	+1	no_errors	ENST00000394282	ensembl	human	known	69_37n	missense	168	21.76	47	SNP	1.000	G
NFKB2	4791	genome.wustl.edu	37	10	104158163	104158163	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr10:104158163delC	ENST00000369966.3	+	11	1124	c.874delC	c.(874-876)cccfs	p.P293fs	NFKB2_ENST00000428099.1_Frame_Shift_Del_p.P293fs|NFKB2_ENST00000189444.6_Frame_Shift_Del_p.P293fs|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	293	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	GTTCCGGACACCCCCCTATCA	0.567			T	IGH@	B-NHL																																	dbGAP		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	0													147.0	149.0	148.0					10																	104158163		1955	4150	6105	-	-	-	SO:0001589	frameshift_variant	0			X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.874delC	10.37:g.104158163delC	ENSP00000358983:p.Pro293fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Frame_Shift_Del	DEL	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like,smart_IPT_TIG_rcpt,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD,prints_NF_Rel_dor,prints_Ankyrin_rpt	p.Y294fs	ENST00000369966.3	37	c.874	CCDS41564.1	10																																																																																			NFKB2	-	superfamily_Ig_E-set,smart_IPT_TIG_rcpt,prints_NF_Rel_dor	ENSG00000077150		0.567	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKB2	HGNC	protein_coding	OTTHUMT00000050080.2	310	0.00	0	C			104158163	104158163	+1	no_errors	ENST00000189444	ensembl	human	known	69_37n	frame_shift_del	248	26.15	91	DEL	1.000	-
NPDC1	56654	genome.wustl.edu	37	9	139935565	139935565	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr9:139935565C>T	ENST00000371601.4	-	3	547	c.334G>A	c.(334-336)Gga>Aga	p.G112R	NPDC1_ENST00000488145.1_5'UTR|NPDC1_ENST00000371600.3_Missense_Mutation_p.G190R	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1	112						integral component of membrane (GO:0016021)				NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		GTTGAGTGTCCAGACTCCTTC	0.692																																						dbGAP											0													42.0	40.0	41.0					9																	139935565		2193	4290	6483	-	-	-	SO:0001583	missense	0			AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.334G>A	9.37:g.139935565C>T	ENSP00000360660:p.Gly112Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	Missense_Mutation	SNP	pfam_NPDC1	p.G190R	ENST00000371601.4	37	c.568	CCDS7024.1	9	.	.	.	.	.	.	.	.	.	.	C	3.233	-0.156965	0.06544	.	.	ENSG00000107281	ENST00000371600;ENST00000371601	.	.	.	3.55	2.63	0.31362	.	1.017110	0.07898	N	0.972119	T	0.27559	0.0677	L	0.36672	1.1	0.09310	N	1	P;P;B;P	0.35714	0.517;0.517;0.055;0.517	B;B;B;B	0.35899	0.213;0.213;0.1;0.213	T	0.12967	-1.0527	9	0.10377	T	0.69	-6.4477	9.7672	0.40567	0.0:0.7716:0.2284:0.0	.	112;112;190;112	Q8WXX4;Q9NQX5;Q5SPY9;Q8NCE1	.;NPDC1_HUMAN;.;.	R	190;112	.	ENSP00000360659:G190R	G	-	1	0	NPDC1	139055386	0.001000	0.12720	0.002000	0.10522	0.011000	0.07611	0.613000	0.24299	0.646000	0.30693	0.542000	0.68232	GGA	NPDC1	-	pfam_NPDC1	ENSG00000107281		0.692	NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPDC1	HGNC	protein_coding	OTTHUMT00000055182.1	77	0.00	0	C	NM_015392		139935565	139935565	-1	no_errors	ENST00000371600	ensembl	human	known	69_37n	missense	74	16.85	15	SNP	0.007	T
NR5A2	2494	genome.wustl.edu	37	1	200017390	200017390	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:200017390T>A	ENST00000367362.3	+	5	800	c.554T>A	c.(553-555)cTc>cAc	p.L185H	NR5A2_ENST00000236914.3_Missense_Mutation_p.L139H|NR5A2_ENST00000544748.1_Missense_Mutation_p.L113H	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	185					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					AAAAAAGCCCTCATCCGAGCC	0.507																																					Melanoma(179;1138 2773 15678 26136)	dbGAP											0													136.0	131.0	133.0					1																	200017390		2203	4300	6503	-	-	-	SO:0001583	missense	0			U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.554T>A	1.37:g.200017390T>A	ENSP00000356331:p.Leu185His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pirsf_Steroidogenic_factor_1,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.L185H	ENST00000367362.3	37	c.554	CCDS1401.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.8|22.8	4.342058|4.342058	0.81911|0.81911	.|.	.|.	ENSG00000116833|ENSG00000116833	ENST00000367362;ENST00000236914;ENST00000544748;ENST00000235480|ENST00000367357	D;D;D|.	0.95001|.	-3.53;-3.58;-3.57|.	5.76|5.76	5.76|5.76	0.90799|0.90799	Nuclear hormone receptor, ligand-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75627|0.75627	0.3875|0.3875	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	B;B|.	0.32876|.	0.238;0.388|.	B;B|.	0.29716|.	0.06;0.106|.	T|T	0.75926|0.75926	-0.3145|-0.3145	9|5	.|.	.|.	.|.	.|.	16.3695|16.3695	0.83350|0.83350	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	139;185|.	F1D8R9;O00482|.	.;NR5A2_HUMAN|.	H|T	185;139;113;105|106	ENSP00000356331:L185H;ENSP00000236914:L139H;ENSP00000439116:L113H|.	.|.	L|S	+|+	2|1	0|0	NR5A2|NR5A2	198284013|198284013	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.945000|7.945000	0.87732|0.87732	2.315000|2.315000	0.78130|0.78130	0.533000|0.533000	0.62120|0.62120	CTC|TCA	NR5A2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,pirsf_Steroidogenic_factor_1	ENSG00000116833		0.507	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR5A2	HGNC	protein_coding	OTTHUMT00000086497.2	146	0.67	1	T			200017390	200017390	+1	no_errors	ENST00000367362	ensembl	human	known	69_37n	missense	297	14.90	52	SNP	1.000	A
NSFL1C	55968	genome.wustl.edu	37	20	1434913	1434913	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr20:1434913G>A	ENST00000216879.4	-	5	1349	c.482C>T	c.(481-483)cCa>cTa	p.P161L	NSFL1C_ENST00000476071.1_Missense_Mutation_p.P163L|NSFL1C_ENST00000350991.4_Missense_Mutation_p.P163L|NSFL1C_ENST00000381658.4_Missense_Mutation_p.P50L|NSFL1C_ENST00000461211.1_5'UTR|NSFL1C_ENST00000353088.2_Intron	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	161						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						CTCTTCCTCTGGTGCTGCCCC	0.512																																						dbGAP											0													95.0	78.0	83.0					20																	1434913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.482C>T	20.37:g.1434913G>A	ENSP00000216879:p.Pro161Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	pfam_SEP_domain,pfam_UBX,superfamily_SEP_domain,superfamily_UBA-like,smart_SEP_domain,smart_UBX,pfscan_UBX	p.P163L	ENST00000216879.4	37	c.488	CCDS13015.1	20	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398408	0.62177	.	.	ENSG00000088833	ENST00000476071;ENST00000216879;ENST00000381658;ENST00000350991	T;T;T;T	0.46063	0.9;0.9;0.88;0.9	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.54695	0.1874	L	0.48362	1.52	0.80722	D	1	D;D	0.69078	0.99;0.997	P;P	0.60789	0.801;0.879	T	0.51568	-0.8689	10	0.46703	T	0.11	-7.7799	17.0105	0.86405	0.0:0.0:1.0:0.0	.	50;161	Q9UNZ2-6;Q9UNZ2	.;NSF1C_HUMAN	L	163;161;50;163	ENSP00000418529:P163L;ENSP00000216879:P161L;ENSP00000371074:P50L;ENSP00000202584:P163L	ENSP00000216879:P161L	P	-	2	0	NSFL1C	1382913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.502000	0.66956	2.756000	0.94617	0.563000	0.77884	CCA	NSFL1C	-	NULL	ENSG00000088833		0.512	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NSFL1C	HGNC	protein_coding	OTTHUMT00000077525.2	135	0.00	0	G	NM_016143		1434913	1434913	-1	no_errors	ENST00000350991	ensembl	human	known	69_37n	missense	316	13.42	49	SNP	1.000	A
OR10Q1	219960	genome.wustl.edu	37	11	57996010	57996010	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr11:57996010C>A	ENST00000316770.2	-	1	380	c.338G>T	c.(337-339)aGc>aTc	p.S113I		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				ACAGTCCGTGCTGCCGAGGGT	0.562																																						dbGAP											0													92.0	77.0	82.0					11																	57996010		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.338G>T	11.37:g.57996010C>A	ENSP00000314324:p.Ser113Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFG4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S113I	ENST00000316770.2	37	c.338	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	C	4.844	0.156855	0.09236	.	.	ENSG00000180475	ENST00000316770	T	0.01347	4.99	4.45	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	0.263525	0.26808	N	0.022395	T	0.01029	0.0034	N	0.20685	0.6	0.09310	N	1	P	0.40266	0.71	B	0.39562	0.303	T	0.49762	-0.8905	10	0.13108	T	0.6	.	5.8416	0.18637	0.0:0.5279:0.3018:0.1703	.	113	Q8NGQ4	O10Q1_HUMAN	I	113	ENSP00000314324:S113I	ENSP00000314324:S113I	S	-	2	0	OR10Q1	57752586	0.000000	0.05858	0.000000	0.03702	0.469000	0.32828	-0.388000	0.07352	0.473000	0.27368	0.557000	0.71058	AGC	OR10Q1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180475		0.562	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1	167	0.00	0	C	NM_001004471		57996010	57996010	-1	no_errors	ENST00000316770	ensembl	human	known	69_37n	missense	185	21.61	51	SNP	0.000	A
OR2A4	79541	genome.wustl.edu	37	6	132022337	132022337	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:132022337C>T	ENST00000315453.2	-	1	298	c.205G>A	c.(205-207)Gac>Aac	p.D69N	ENPP3_ENST00000414305.1_Intron|ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000358229.5_Intron	NM_030908.1	NP_112170.1	O95047	OR2A4_HUMAN	olfactory receptor, family 2, subfamily A, member 4	69					positive regulation of cytokinesis (GO:0032467)|regulation of actin cytoskeleton organization (GO:0032956)	cleavage furrow (GO:0032154)|Flemming body (GO:0090543)|integral component of membrane (GO:0016021)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|ovary(1)|skin(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.018)|OV - Ovarian serous cystadenocarcinoma(155;0.041)		TAGGCGATGTCGACGACCGCC	0.612																																						dbGAP											0													5.0	6.0	6.0					6																	132022337		1754	3645	5399	-	-	-	SO:0001583	missense	0			AC005587	CCDS5149.1	6q23	2012-08-09	2003-05-22		ENSG00000180658	ENSG00000180658		"""GPCR / Class A : Olfactory receptors"""	14729	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 10"""	OR2A10			Standard	NM_030908		Approved		uc011ecd.2	O95047	OTTHUMG00000016316	ENST00000315453.2:c.205G>A	6.37:g.132022337C>T	ENSP00000319546:p.Asp69Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAR3|Q6IF18|Q9NQN0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.D69N	ENST00000315453.2	37	c.205	CCDS5149.1	6	.	.	.	.	.	.	.	.	.	.	-	12.13	1.845065	0.32606	.	.	ENSG00000180658	ENST00000315453	T	0.01165	5.24	1.68	1.68	0.24146	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39020	U	0.001494	T	0.03564	0.0102	M	0.91920	3.255	0.27270	N	0.958395	D	0.89917	1.0	D	0.85130	0.997	T	0.08391	-1.0724	10	0.87932	D	0	.	9.7155	0.40272	0.0:1.0:0.0:0.0	.	69	O95047	OR2A4_HUMAN	N	69	ENSP00000319546:D69N	ENSP00000319546:D69N	D	-	1	0	OR2A4	132064030	0.957000	0.32711	0.704000	0.30370	0.000000	0.00434	2.651000	0.46674	0.975000	0.38392	0.000000	0.15137	GAC	OR2A4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180658		0.612	OR2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A4	HGNC	protein_coding	OTTHUMT00000109221.1	30	0.00	0	C	NM_030908		132022337	132022337	-1	no_errors	ENST00000315453	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.919	T
OR3A1	4994	genome.wustl.edu	37	17	3195848	3195848	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr17:3195848G>A	ENST00000323404.1	-	1	28	c.29C>T	c.(28-30)aCa>aTa	p.T10I	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	10					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T10K(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20						AGCAATGACTGTTCCATTGGC	0.502																																					GBM(20;287 516 18743 28660 36594)	dbGAP											1	Substitution - Missense(1)	lung(1)											48.0	52.0	51.0					17																	3195848		2203	4300	6503	-	-	-	SO:0001583	missense	0			X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090		"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product						8921386, 8647456	Standard	NM_002550		Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.29C>T	17.37:g.3195848G>A	ENSP00000313803:p.Thr10Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VB06|Q6IFM4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T10I	ENST00000323404.1	37	c.29	CCDS11023.1	17	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573496	0.65765	.	.	ENSG00000180090	ENST00000323404	T	0.04809	3.55	6.1	6.1	0.99115	.	0.151000	0.30859	N	0.008721	T	0.13884	0.0336	M	0.90252	3.1	0.09310	N	0.999998	B	0.30326	0.276	B	0.30782	0.12	T	0.07751	-1.0756	10	0.87932	D	0	-11.5502	15.6559	0.77133	0.0:0.1374:0.8626:0.0	.	10	P47881	OR3A1_HUMAN	I	10	ENSP00000313803:T10I	ENSP00000313803:T10I	T	-	2	0	OR3A1	3142598	0.123000	0.22298	0.841000	0.33234	0.604000	0.37047	1.034000	0.30204	2.902000	0.99343	0.650000	0.86243	ACA	OR3A1	-	NULL	ENSG00000180090		0.502	OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR3A1	HGNC	protein_coding	OTTHUMT00000207302.2	54	0.00	0	G			3195848	3195848	-1	no_errors	ENST00000323404	ensembl	human	known	69_37n	missense	75	14.77	13	SNP	0.171	A
OR5I1	10798	genome.wustl.edu	37	11	55703812	55703812	+	Missense_Mutation	SNP	C	C	T	rs575836357		TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr11:55703812C>T	ENST00000301532.3	-	1	64	c.65G>A	c.(64-66)cGc>cAc	p.R22H		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	22					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R22H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CAGTTCAGGGCGAGTTGGAAA	0.368																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											61.0	58.0	59.0					11																	55703812		2201	4295	6496	-	-	-	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.65G>A	11.37:g.55703812C>T	ENSP00000301532:p.Arg22His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEU4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R22H	ENST00000301532.3	37	c.65	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	C	0.030	-1.340191	0.01277	.	.	ENSG00000167825	ENST00000301532	T	0.01084	5.36	5.05	2.13	0.27403	.	0.292228	0.24846	N	0.035138	T	0.00695	0.0023	N	0.05487	-0.04	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.49153	-0.8969	10	0.19590	T	0.45	.	6.5935	0.22659	0.0:0.6303:0.0:0.3697	.	22	Q13606	OR5I1_HUMAN	H	22	ENSP00000301532:R22H	ENSP00000301532:R22H	R	-	2	0	OR5I1	55460388	0.000000	0.05858	0.087000	0.20705	0.612000	0.37316	-7.433000	0.00036	0.637000	0.30526	0.637000	0.83480	CGC	OR5I1	-	NULL	ENSG00000167825		0.368	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	29	0.00	0	C	NM_006637		55703812	55703812	-1	no_errors	ENST00000301532	ensembl	human	known	69_37n	missense	64	45.30	53	SNP	0.003	T
PAGE2	203569	genome.wustl.edu	37	X	55117826	55117826	+	Silent	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chrX:55117826A>G	ENST00000374968.4	+	4	359	c.255A>G	c.(253-255)ggA>ggG	p.G85G	PAGE2_ENST00000374965.1_Silent_p.G68G	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)	85										endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						ATGAGCCTGGAGATGGTCCTG	0.388																																						dbGAP											0													123.0	135.0	131.0					X																	55117826		2172	4295	6467	-	-	-	SO:0001819	synonymous_variant	0			BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.255A>G	X.37:g.55117826A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRK7|Q5JRK8	Silent	SNP	pfam_GAGE	p.G85	ENST00000374968.4	37	c.255	CCDS14367.1	X																																																																																			PAGE2	-	pfam_GAGE	ENSG00000234068		0.388	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE2	HGNC	protein_coding	OTTHUMT00000056857.1	579	0.34	2	A	NM_207339		55117826	55117826	+1	no_errors	ENST00000374968	ensembl	human	known	69_37n	silent	748	24.06	237	SNP	0.000	G
PI4KA	5297	genome.wustl.edu	37	22	21173951	21173951	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr22:21173951C>G	ENST00000572273.1	-	6	823	c.593G>C	c.(592-594)aGc>aCc	p.S198T	PI4KA_ENST00000255882.6_Missense_Mutation_p.S256T			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	198					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GGACACACTGCTGGTTTTCCT	0.532																																					GBM(136;1332 1831 3115 23601 50806)	dbGAP											0													93.0	87.0	89.0					22																	21173951		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.593G>C	22.37:g.21173951C>G	ENSP00000458238:p.Ser198Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z625|Q9UPG2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.S256T	ENST00000572273.1	37	c.767		22	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000696	0.35320	.	.	ENSG00000241973	ENST00000255882	T	0.79940	-1.32	5.19	5.19	0.71726	.	0.189441	0.56097	D	0.000029	T	0.67392	0.2888	N	0.15975	0.35	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.61893	-0.6969	10	0.13108	T	0.6	-29.7142	18.9172	0.92510	0.0:1.0:0.0:0.0	.	256;198	D3DX33;P42356	.;PI4KA_HUMAN	T	198	ENSP00000255882:S198T	ENSP00000255882:S198T	S	-	2	0	PI4KA	19503951	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.005000	0.57075	2.702000	0.92279	0.557000	0.71058	AGC	PI4KA	-	superfamily_ARM-type_fold	ENSG00000241973		0.532	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		68	0.00	0	C	NM_058004		21173951	21173951	-1	no_errors	ENST00000255882	ensembl	human	known	69_37n	missense	51	56.03	65	SNP	1.000	G
PIANP	196500	genome.wustl.edu	37	12	6804780	6804780	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr12:6804780G>T	ENST00000540656.1	-	5	981	c.643C>A	c.(643-645)Cag>Aag	p.Q215K	PIANP_ENST00000534837.1_Missense_Mutation_p.Q215K|PIANP_ENST00000320591.5_Missense_Mutation_p.Q215K	NM_001244015.1	NP_001230944.1	Q8IYJ0	PIANP_HUMAN	PILR alpha associated neural protein	215						integral component of membrane (GO:0016021)											GCACCTTGCTGCCCTGAGGGT	0.647																																						dbGAP											0													41.0	45.0	44.0					12																	6804780		2031	4164	6195	-	-	-	SO:0001583	missense	0			BC035736	CCDS44818.1, CCDS58205.1	12p13.31	2012-08-17	2012-08-17	2012-08-17	ENSG00000139200	ENSG00000139200			25338	protein-coding gene	gene with protein product	"""PILR-associating neural protein"""		"""chromosome 12 open reading frame 53"""	C12orf53		12975309	Standard	NM_153685		Approved	DKFZp547D2210, PANP	uc001qqf.2	Q8IYJ0	OTTHUMG00000168664	ENST00000540656.1:c.643C>A	12.37:g.6804780G>T	ENSP00000442157:p.Gln215Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0T3|B3KPF7|B3KRI6|Q6UX35	Missense_Mutation	SNP	NULL	p.Q215K	ENST00000540656.1	37	c.643	CCDS44818.1	12	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066320	0.36470	.	.	ENSG00000139200	ENST00000540656;ENST00000320591;ENST00000534837;ENST00000439553	T;T;T	0.55588	0.51;0.51;0.51	3.58	3.58	0.41010	.	0.000000	0.64402	U	0.000001	T	0.46425	0.1392	N	0.08118	0	0.38118	D	0.937764	P	0.46395	0.877	P	0.53518	0.728	T	0.61879	-0.6972	10	0.72032	D	0.01	-6.6379	15.3621	0.74487	0.0:0.0:1.0:0.0	.	215	Q8IYJ0	CL053_HUMAN	K	215;215;215;189	ENSP00000442157:Q215K;ENSP00000317818:Q215K;ENSP00000443919:Q215K	ENSP00000317818:Q215K	Q	-	1	0	C12orf53	6675041	1.000000	0.71417	0.996000	0.52242	0.749000	0.42624	4.820000	0.62671	1.829000	0.53265	0.313000	0.20887	CAG	PIANP	-	NULL	ENSG00000139200		0.647	PIANP-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PIANP	HGNC	protein_coding	OTTHUMT00000400524.1	35	0.00	0	G	NM_153685		6804780	6804780	-1	no_errors	ENST00000320591	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	T
PIK3CD	5293	genome.wustl.edu	37	1	9777151	9777151	+	Silent	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:9777151C>G	ENST00000377346.4	+	7	1110	c.915C>G	c.(913-915)ccC>ccG	p.P305P	PIK3CD_ENST00000543390.1_5'Flank|PIK3CD_ENST00000361110.2_Silent_p.P270P|PIK3CD_ENST00000536656.1_Silent_p.P270P	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	305					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	AACCACCTCCCATTCCTGCGA	0.622																																						dbGAP											0													120.0	110.0	113.0					1																	9777151		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.915C>G	1.37:g.9777151C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCG0|G1FFP1|O15445|Q5SR49	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.P270	ENST00000377346.4	37	c.810	CCDS104.1	1																																																																																			PIK3CD	-	smart_PI3K_Ras-bd_dom	ENSG00000171608		0.622	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CD	HGNC	protein_coding	OTTHUMT00000004235.1	140	0.00	0	C	NM_005026		9777151	9777151	+1	no_errors	ENST00000536656	ensembl	human	known	69_37n	silent	92	26.98	34	SNP	0.315	G
PLA2G2C	391013	genome.wustl.edu	37	1	20501650	20501650	+	Intron	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:20501650G>A	ENST00000429261.2	-	2	101				PLA2G2C_ENST00000247992.5_Missense_Mutation_p.S13L|PLA2G2C_ENST00000495760.2_5'UTR			Q5R387	PA2GC_HUMAN	phospholipase A2, group IIC						lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)	7		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.14e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.000528)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGCCACCACCGATGAGAAAAA	0.507																																						dbGAP											0													107.0	114.0	112.0					1																	20501650		1973	4153	6126	-	-	-	SO:0001627	intron_variant	0					1p36.12	2010-06-04	2003-10-13		ENSG00000187980	ENSG00000187980			9032	protein-coding gene	gene with protein product			"""phospholipase A2, group IIC (possible pseudogene)"""			8838795	Standard	NM_001105572		Approved		uc009vpq.1	Q5R387	OTTHUMG00000002705	ENST00000429261.2:c.41-12C>T	1.37:g.20501650G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7M4M6	Missense_Mutation	SNP	pfam_PLipase_A2_euk,superfamily_PLipase_A2,smart_PLipase_A2,prints_PLipase_A2_euk	p.S13L	ENST00000429261.2	37	c.38		1	.	.	.	.	.	.	.	.	.	.	G	9.090	1.001414	0.19121	.	.	ENSG00000187980	ENST00000247992	T	0.24908	1.83	5.54	-8.49	0.00931	.	3.275840	0.01252	N	0.008904	T	0.16214	0.0390	N	0.05487	-0.04	0.09310	N	1	.	.	.	.	.	.	T	0.10019	-1.0648	7	.	.	.	.	19.5871	0.95493	0.2423:0.0:0.7577:0.0	.	.	.	.	L	13	ENSP00000247992:S13L	.	S	-	2	0	PLA2G2C	20374237	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.277000	0.08502	-1.650000	0.01506	-0.793000	0.03317	TCG	PLA2G2C	-	NULL	ENSG00000187980		0.507	PLA2G2C-001	PUTATIVE	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	PLA2G2C	HGNC	protein_coding	OTTHUMT00000007689.3	189	0.00	0	G	NM_001105572		20501650	20501650	-1	no_errors	ENST00000247992	ensembl	human	known	69_37n	missense	200	23.57	62	SNP	0.000	A
LRRC7	57554	genome.wustl.edu	37	1	70385493	70385493	+	Intron	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:70385493C>T	ENST00000035383.5	+	6	563				LRRC7_ENST00000310961.5_Intron|PIN1P1_ENST00000412108.1_RNA|LRRC7_ENST00000415775.2_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCACGGATTCCGGCATCCACG	0.652																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.534-11697C>T	1.37:g.70385493C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	RNA	SNP	-	NULL	ENST00000035383.5	37	NULL	CCDS645.1	1																																																																																			PIN1P1	-	-	ENSG00000229359		0.652	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1P1	HGNC	protein_coding	OTTHUMT00000131261.1	64	0.00	0	C	NM_020794		70385493	70385493	+1	no_errors	ENST00000412108	ensembl	human	known	69_37n	rna	59	25.32	20	SNP	0.293	T
PPP1R13L	10848	genome.wustl.edu	37	19	45900186	45900186	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr19:45900186C>T	ENST00000418234.2	-	4	407	c.329G>A	c.(328-330)aGc>aAc	p.S110N	PPP1R13L_ENST00000360957.5_Missense_Mutation_p.S110N	NM_001142502.1	NP_001135974.1	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13 like	110	Pro-rich.				apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic camera-type eye development (GO:0031076)|hair cycle (GO:0042633)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle tissue development (GO:0003229)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GGACAGCGGGCTGTAGGGGTG	0.746																																					Pancreas(61;1447 1663 31419 50578)	dbGAP											0													17.0	24.0	22.0					19																	45900186		2177	4258	6435	-	-	-	SO:0001583	missense	0			AF078036	CCDS33050.1	19q13.32	2013-01-10	2011-10-04		ENSG00000104881	ENSG00000104881		"""Ankyrin repeat domain containing"""	18838	protein-coding gene	gene with protein product		607463	"""protein phosphatase 1, regulatory (inhibitor) subunit 13 like"""			10336463	Standard	NM_006663		Approved	RAI, IASPP	uc002pbo.3	Q8WUF5		ENST00000418234.2:c.329G>A	19.37:g.45900186C>T	ENSP00000403902:p.Ser110Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ9|Q5DU71|Q5I1X4|Q6P1R7|Q6PKF8|Q9Y290	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_SH3_domain	p.S110N	ENST00000418234.2	37	c.329	CCDS33050.1	19	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440950	0.25900	.	.	ENSG00000104881	ENST00000418234;ENST00000360957	T;T	0.61040	0.14;0.14	5.02	2.89	0.33648	.	0.495867	0.23303	N	0.049644	T	0.38453	0.1041	N	0.24115	0.695	0.31059	N	0.714305	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.0	T	0.31251	-0.9950	10	0.25106	T	0.35	.	7.9719	0.30132	0.0:0.8079:0.0:0.1921	.	110;110	Q6ZNZ8;Q8WUF5	.;IASPP_HUMAN	N	110	ENSP00000403902:S110N;ENSP00000354218:S110N	ENSP00000354218:S110N	S	-	2	0	PPP1R13L	50592026	1.000000	0.71417	0.989000	0.46669	0.040000	0.13550	1.385000	0.34408	0.628000	0.30357	0.462000	0.41574	AGC	PPP1R13L	-	NULL	ENSG00000104881		0.746	PPP1R13L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPP1R13L	HGNC	protein_coding	OTTHUMT00000457586.1	82	0.00	0	C	NM_006663		45900186	45900186	-1	no_errors	ENST00000360957	ensembl	human	known	69_37n	missense	74	13.95	12	SNP	0.996	T
PVRIG	79037	genome.wustl.edu	37	7	99818572	99818572	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr7:99818572G>A	ENST00000317271.2	+	6	1042	c.679G>A	c.(679-681)Gct>Act	p.A227T	GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA|AC005071.1_ENST00000410550.1_RNA	NM_024070.3	NP_076975.2	Q6DKI7	PVRIG_HUMAN	poliovirus receptor related immunoglobulin domain containing	227						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)	11	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCCTCCCAGGCTGCTCTTCA	0.672																																						dbGAP											0													67.0	71.0	69.0					7																	99818572		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001129	CCDS5690.1	7q22.1	2013-06-26			ENSG00000213413	ENSG00000213413			32190	protein-coding gene	gene with protein product						16926269	Standard	NM_024070		Approved	MGC2463, C7orf15	uc003uuf.1	Q6DKI7	OTTHUMG00000156798	ENST00000317271.2:c.679G>A	7.37:g.99818572G>A	ENSP00000316675:p.Ala227Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5U9|Q9BVK3	Missense_Mutation	SNP	NULL	p.A227T	ENST00000317271.2	37	c.679	CCDS5690.1	7	.	.	.	.	.	.	.	.	.	.	g	2.379	-0.342535	0.05243	.	.	ENSG00000213413	ENST00000317271	T	0.51325	0.71	2.88	-3.04	0.05412	.	.	.	.	.	T	0.16214	0.0390	N	0.03608	-0.345	0.09310	N	1	B	0.19331	0.035	B	0.17433	0.018	T	0.23976	-1.0173	9	0.08179	T	0.78	.	3.323	0.07057	0.2396:0.0:0.2435:0.5169	.	227	Q6DKI7	PVRIG_HUMAN	T	227	ENSP00000316675:A227T	ENSP00000316675:A227T	A	+	1	0	PVRIG	99656508	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.687000	0.01927	-0.760000	0.04677	-0.461000	0.05368	GCT	PVRIG	-	NULL	ENSG00000213413		0.672	PVRIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRIG	HGNC	protein_coding	OTTHUMT00000345870.2	118	0.00	0	G	NM_024070		99818572	99818572	+1	no_errors	ENST00000317271	ensembl	human	known	69_37n	missense	203	16.33	40	SNP	0.000	A
RGS3	5998	genome.wustl.edu	37	9	116356374	116356374	+	Intron	SNP	T	T	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr9:116356374T>C	ENST00000374140.2	+	23	3289				RGS3_ENST00000342620.5_Intron|RGS3_ENST00000462143.1_Intron|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000374134.3_Intron|RGS3_ENST00000462403.1_Missense_Mutation_p.S59P|RGS3_ENST00000350696.5_Intron|RGS3_ENST00000343817.5_Intron	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						GCTCCTCCTGTCTGAGTCCCA	0.622																																						dbGAP											0													72.0	82.0	78.0					9																	116356374		2202	4298	6500	-	-	-	SO:0001627	intron_variant	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3081-336T>C	9.37:g.116356374T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.S59P	ENST00000374140.2	37	c.175	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	T	14.96	2.691737	0.48097	.	.	ENSG00000138835	ENST00000462403	T	0.61040	0.14	5.42	4.27	0.50696	.	.	.	.	.	T	0.40498	0.1119	N	0.08118	0	0.80722	D	1	D	0.56968	0.978	P	0.45913	0.497	T	0.44236	-0.9341	9	0.87932	D	0	.	9.9321	0.41528	0.0:0.0:0.3299:0.6701	.	59	Q5VZ06	.	P	59	ENSP00000436168:S59P	ENSP00000436168:S59P	S	+	1	0	RGS3	115396195	0.688000	0.27680	1.000000	0.80357	0.848000	0.48234	0.856000	0.27818	0.876000	0.35872	-0.323000	0.08544	TCT	RGS3	-	NULL	ENSG00000138835		0.622	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	48	0.00	0	T	NM_017790		116356374	116356374	+1	no_errors	ENST00000462403	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	1.000	C
LINC00969	440993	genome.wustl.edu	37	3	195390960	195390960	+	lincRNA	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr3:195390960G>C	ENST00000445430.1	+	0	486									long intergenic non-protein coding RNA 969																		TTCACAGGTAGAAAATTATGG	0.403																																						dbGAP											0																																										-	-	-			0			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195390960G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			SDHAP2	-	-	ENSG00000215837		0.403	LINC00969-038	KNOWN	basic	lincRNA	SDHAP2	HGNC	lincRNA	OTTHUMT00000341951.1	194	0.00	0	G			195390960	195390960	+1	no_errors	ENST00000429897	ensembl	human	known	69_37n	rna	247	22.81	73	SNP	1.000	C
SELL	6402	genome.wustl.edu	37	1	169670813	169670813	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:169670813G>T	ENST00000236147.4	-	7	1168	c.1008C>A	c.(1006-1008)ttC>ttA	p.F336L	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	323					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					TAATCATTGAGAAACTTTTGT	0.403																																						dbGAP											0													48.0	44.0	45.0					1																	169670813		1875	4110	5985	-	-	-	SO:0001583	missense	0			M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.1008C>A	1.37:g.169670813G>T	ENSP00000236147:p.Phe336Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	pirsf_L-selectin,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_EGF-like,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.F336L	ENST00000236147.4	37	c.1008	CCDS53427.1	1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605235	0.46423	.	.	ENSG00000188404	ENST00000236147	T	0.13089	2.62	5.79	2.68	0.31781	.	0.235594	0.30126	N	0.010343	T	0.02649	0.0080	L	0.46741	1.465	0.27964	N	0.936665	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.42916	-0.9423	10	0.08381	T	0.77	-7.2703	4.23	0.10599	0.1878:0.0:0.6173:0.1948	.	336;323	Q8WW79;P14151	.;LYAM1_HUMAN	L	336	ENSP00000236147:F336L	ENSP00000236147:F336L	F	-	3	2	SELL	167937437	0.999000	0.42202	0.486000	0.27416	0.859000	0.49053	1.420000	0.34804	1.457000	0.47850	0.655000	0.94253	TTC	SELL	-	pirsf_L-selectin	ENSG00000188404		0.403	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELL	HGNC	protein_coding	OTTHUMT00000084233.1	83	0.00	0	G	NM_000655		169670813	169670813	-1	no_errors	ENST00000236147	ensembl	human	known	69_37n	missense	321	15.08	57	SNP	0.627	T
SIDT2	51092	genome.wustl.edu	37	11	117060946	117060946	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr11:117060946A>C	ENST00000324225.4	+	17	2089	c.1558A>C	c.(1558-1560)Atc>Ctc	p.I520L	SIDT2_ENST00000532062.1_5'Flank|SIDT2_ENST00000431081.2_Missense_Mutation_p.I517L	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	520					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		CCTGCTCATCATCCTGCAACG	0.602																																						dbGAP											0													153.0	141.0	145.0					11																	117060946		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1558A>C	11.37:g.117060946A>C	ENSP00000314023:p.Ile520Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBY7|Q9Y357	Missense_Mutation	SNP	NULL	p.I541L	ENST00000324225.4	37	c.1621	CCDS31682.1	11	.	.	.	.	.	.	.	.	.	.	A	18.51	3.640425	0.67244	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.21191	2.02;2.02;2.02	4.6	4.6	0.57074	.	0.066429	0.64402	D	0.000005	T	0.17916	0.0430	N	0.19112	0.55	0.41486	D	0.988195	B;B;B;B	0.32382	0.078;0.05;0.045;0.368	B;B;B;B	0.42386	0.087;0.009;0.088;0.386	T	0.10337	-1.0634	10	0.41790	T	0.15	-33.0483	8.796	0.34878	0.9155:0.0:0.0845:0.0	.	541;517;520;541	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	L	520;541;517	ENSP00000314023:I520L;ENSP00000278951:I541L;ENSP00000399635:I517L	ENSP00000278951:I541L	I	+	1	0	SIDT2	116566156	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.767000	0.68850	1.933000	0.56026	0.402000	0.26972	ATC	SIDT2	-	NULL	ENSG00000149577		0.602	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1	264	0.75	2	A	NM_015996		117060946	117060946	+1	no_errors	ENST00000278951	ensembl	human	known	69_37n	missense	343	18.53	78	SNP	1.000	C
SIM1	6492	genome.wustl.edu	37	6	100897470	100897470	+	Missense_Mutation	SNP	G	G	T	rs140908824		TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:100897470G>T	ENST00000369208.3	-	5	1236	c.454C>A	c.(454-456)Cag>Aag	p.Q152K	SIM1_ENST00000262901.4_Missense_Mutation_p.Q152K			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	152					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		ACCTTACCCTGCACGAAGTGA	0.582																																						dbGAP											0													105.0	90.0	95.0					6																	100897470		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.454C>A	6.37:g.100897470G>T	ENSP00000358210:p.Gln152Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDP7	Missense_Mutation	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd	p.Q152K	ENST00000369208.3	37	c.454	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745007	0.69418	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.74002	-0.8;-0.8	5.39	5.39	0.77823	.	0.106425	0.64402	D	0.000003	T	0.50599	0.1625	L	0.31578	0.945	0.80722	D	1	B	0.29671	0.254	B	0.32289	0.143	T	0.55398	-0.8147	10	0.09338	T	0.73	.	19.1592	0.93524	0.0:0.0:1.0:0.0	.	152	P81133	SIM1_HUMAN	K	152	ENSP00000358210:Q152K;ENSP00000262901:Q152K	ENSP00000262901:Q152K	Q	-	1	0	SIM1	101004191	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.543000	0.85770	0.655000	0.94253	CAG	SIM1	-	NULL	ENSG00000112246		0.582	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	208	0.00	0	G	NM_005068		100897470	100897470	-1	no_errors	ENST00000262901	ensembl	human	known	69_37n	missense	177	23.04	53	SNP	1.000	T
SLCO1C1	53919	genome.wustl.edu	37	12	20858927	20858927	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr12:20858927C>T	ENST00000266509.2	+	4	684	c.316C>T	c.(316-318)Ctt>Ttt	p.L106F	SLCO1C1_ENST00000545604.1_Missense_Mutation_p.L106F|SLCO1C1_ENST00000545102.1_5'UTR|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.L106F|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.L106F	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	106					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TGGAGCCAAACTTCACAGGCC	0.378																																						dbGAP											0													165.0	171.0	169.0					12																	20858927		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.316C>T	12.37:g.20858927C>T	ENSP00000266509:p.Leu106Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.L106F	ENST00000266509.2	37	c.316	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861340	0.71949	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.01	5.01	0.66863	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.56156	0.1966	L	0.44542	1.39	0.52099	D	0.999945	P;P;P	0.49961	0.93;0.678;0.828	P;P;P	0.59643	0.861;0.534;0.737	T	0.46470	-0.9189	10	0.09843	T	0.71	.	11.9132	0.52751	0.0:0.9208:0.0:0.0792	.	106;106;106	B7Z3Q3;Q5JPA4;Q9NYB5	.;.;SO1C1_HUMAN	F	106	ENSP00000444149:L106F;ENSP00000438665:L106F;ENSP00000266509:L106F;ENSP00000370964:L106F	ENSP00000266509:L106F	L	+	1	0	SLCO1C1	20750194	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.624000	0.67764	2.593000	0.87608	0.655000	0.94253	CTT	SLCO1C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.378	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	145	0.00	0	C	NM_017435		20858927	20858927	+1	no_errors	ENST00000381552	ensembl	human	known	69_37n	missense	192	27.00	71	SNP	1.000	T
SLX4	84464	genome.wustl.edu	37	16	3632422	3632422	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr16:3632422G>C	ENST00000294008.3	-	15	6066	c.5426C>G	c.(5425-5427)aCc>aGc	p.T1809S	RP11-461A8.1_ENST00000573982.1_lincRNA	NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1809	Interaction with PLK1 and TERF2-TERF2IP.|Interaction with SLX1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GGCGGCAGTGGTGAAGGTGAT	0.657								Direct reversal of damage																														dbGAP											0													91.0	89.0	90.0					16																	3632422		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.5426C>G	16.37:g.3632422G>C	ENSP00000294008:p.Thr1809Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.T1809S	ENST00000294008.3	37	c.5426	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059807	0.55325	.	.	ENSG00000188827	ENST00000294008	T	0.01323	5.01	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.06462	0.0166	L	0.47016	1.485	0.41585	D	0.988769	D	0.69078	0.997	D	0.71870	0.975	T	0.16100	-1.0414	10	0.87932	D	0	.	18.7588	0.91842	0.0:0.0:1.0:0.0	.	1809	Q8IY92	SLX4_HUMAN	S	1809	ENSP00000294008:T1809S	ENSP00000294008:T1809S	T	-	2	0	SLX4	3572423	1.000000	0.71417	1.000000	0.80357	0.200000	0.23975	7.646000	0.83445	2.697000	0.92050	0.655000	0.94253	ACC	SLX4	-	NULL	ENSG00000188827		0.657	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	52	0.00	0	G	NM_032444		3632422	3632422	-1	no_errors	ENST00000294008	ensembl	human	known	69_37n	missense	44	18.18	10	SNP	1.000	C
SMTNL1	219537	genome.wustl.edu	37	11	57313409	57313409	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr11:57313409G>T	ENST00000399154.2	+	5	862	c.862G>T	c.(862-864)Gag>Tag	p.E288*	SMTNL1_ENST00000457912.1_Nonsense_Mutation_p.E343*|SMTNL1_ENST00000527972.1_Nonsense_Mutation_p.E325*			A8MU46	SMTL1_HUMAN	smoothelin-like 1	288					negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						TTCCTCAGGGGAGAAGAAGGA	0.632																																						dbGAP											0													33.0	36.0	35.0					11																	57313409		1883	4109	5992	-	-	-	SO:0001587	stop_gained	0			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.862G>T	11.37:g.57313409G>T	ENSP00000382108:p.Glu288*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.E343*	ENST00000399154.2	37	c.1027		11	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966030	0.34659	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	.	.	.	4.89	1.66	0.24008	.	0.263988	0.19594	U	0.110547	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-9.9093	7.7143	0.28696	0.2731:0.0:0.7269:0.0	.	.	.	.	X	343;325;288	.	ENSP00000382108:E288X	E	+	1	0	SMTNL1	57069985	0.659000	0.27411	0.055000	0.19348	0.081000	0.17604	0.695000	0.25527	0.152000	0.19188	-0.218000	0.12543	GAG	SMTNL1	-	NULL	ENSG00000214872		0.632	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	SMTNL1	HGNC	protein_coding		59	0.00	0	G	XM_166203		57313409	57313409	+1	no_errors	ENST00000457912	ensembl	human	known	69_37n	nonsense	94	22.95	28	SNP	0.235	T
SPAG17	200162	genome.wustl.edu	37	1	118623811	118623811	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:118623811T>C	ENST00000336338.5	-	15	2187	c.2122A>G	c.(2122-2124)Aat>Gat	p.N708D		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	708						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTGAGATTATTCAAGTCAGAA	0.423																																						dbGAP											0													187.0	174.0	178.0					1																	118623811		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2122A>G	1.37:g.118623811T>C	ENSP00000337804:p.Asn708Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.N708D	ENST00000336338.5	37	c.2122	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	T	4.038	0.004711	0.07866	.	.	ENSG00000155761	ENST00000336338	T	0.16743	2.32	3.91	-2.71	0.05986	.	1.825470	0.02090	N	0.053071	T	0.02267	0.0070	N	0.20685	0.6	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29336	-1.0015	10	0.10377	T	0.69	.	4.5268	0.11985	0.1727:0.4402:0.0:0.3871	.	708	Q6Q759	SPG17_HUMAN	D	708	ENSP00000337804:N708D	ENSP00000337804:N708D	N	-	1	0	SPAG17	118425334	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.583000	0.05807	-0.533000	0.06323	-0.403000	0.06358	AAT	SPAG17	-	NULL	ENSG00000155761		0.423	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	243	0.00	0	T	NM_206996		118623811	118623811	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	missense	363	23.74	113	SNP	0.000	C
SPATA17	128153	genome.wustl.edu	37	1	217842375	217842375	+	Splice_Site	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:217842375G>T	ENST00000366933.4	+	4	296	c.241G>T	c.(241-243)Gta>Tta	p.V81L		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	81	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.					cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TGATTCACAGGTAGCATATTA	0.313																																						dbGAP											0													137.0	140.0	139.0					1																	217842375		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.241-1G>T	1.37:g.217842375G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6N2	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.V81L	ENST00000366933.4	37	c.241	CCDS1519.1	1	.	.	.	.	.	.	.	.	.	.	G	2.711	-0.268680	0.05716	.	.	ENSG00000162814	ENST00000366933	T	0.41400	1.0	5.91	-2.24	0.06909	.	0.405817	0.26788	N	0.022489	T	0.07818	0.0196	N	0.00538	-1.39	0.29590	N	0.848485	B	0.02656	0.0	B	0.01281	0.0	T	0.18840	-1.0324	9	.	.	.	-5.8917	0.0628	0.00016	0.2544:0.226:0.1942:0.3254	.	81	Q96L03	SPT17_HUMAN	L	81	ENSP00000355900:V81L	.	V	+	1	0	SPATA17	215908998	1.000000	0.71417	0.964000	0.40570	0.988000	0.76386	1.319000	0.33655	-0.641000	0.05487	0.655000	0.94253	GTA	SPATA17	-	NULL	ENSG00000162814		0.313	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	HGNC	protein_coding	OTTHUMT00000092433.2	214	0.47	1	G	NM_138796	Missense_Mutation	217842375	217842375	+1	no_errors	ENST00000366933	ensembl	human	known	69_37n	missense	565	15.67	105	SNP	0.998	T
SRRM2	23524	genome.wustl.edu	37	16	2816694	2816694	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr16:2816694A>C	ENST00000301740.8	+	11	6714	c.6165A>C	c.(6163-6165)agA>agC	p.R2055S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2055	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GCCGCTCCAGATCCCGTACTC	0.567																																						dbGAP											0													77.0	57.0	63.0					16																	2816694		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6165A>C	16.37:g.2816694A>C	ENSP00000301740:p.Arg2055Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R2055S	ENST00000301740.8	37	c.6165	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	A	8.961	0.970665	0.18659	.	.	ENSG00000167978	ENST00000301740;ENST00000544933	T	0.27890	1.64	5.47	-5.61	0.02489	.	0.000000	0.64402	D	0.000003	T	0.28234	0.0697	N	0.08118	0	0.27948	N	0.937266	D	0.71674	0.998	D	0.76071	0.987	T	0.34502	-0.9826	10	0.34782	T	0.22	-10.4642	16.198	0.82043	0.325:0.0:0.675:0.0	.	2055	Q9UQ35	SRRM2_HUMAN	S	2055;1307	ENSP00000301740:R2055S	ENSP00000301740:R2055S	R	+	3	2	SRRM2	2756695	0.726000	0.28059	0.249000	0.24280	0.820000	0.46376	-0.646000	0.05403	-0.901000	0.03891	0.533000	0.62120	AGA	SRRM2	-	NULL	ENSG00000167978		0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	71	0.00	0	A			2816694	2816694	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	86	18.10	19	SNP	0.633	C
SRRT	51593	genome.wustl.edu	37	7	100485995	100485995	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr7:100485995C>G	ENST00000347433.4	+	19	2704	c.2546C>G	c.(2545-2547)cCt>cGt	p.P849R	SRRT_ENST00000388793.4_Missense_Mutation_p.P848R|SRRT_ENST00000432932.1_Missense_Mutation_p.P844R|SRRT_ENST00000457580.2_Missense_Mutation_p.P845R			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	849					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCTGGGAAACCTCGCAACAGG	0.612																																						dbGAP											0													60.0	60.0	60.0					7																	100485995		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2546C>G	7.37:g.100485995C>G	ENSP00000314491:p.Pro849Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.P848R	ENST00000347433.4	37	c.2543	CCDS34709.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.71|15.71	2.915215|2.915215	0.52546|0.52546	.|.	.|.	ENSG00000087087|ENSG00000087087	ENST00000342198|ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000448764	.|.	.|.	.|.	4.59|4.59	4.59|4.59	0.56863|0.56863	.|Arsenite-resistance protein 2 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75889|0.75889	0.3911|0.3911	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D;D;B	.|0.89917	.|1.0;0.991;0.995;0.43	.|D;P;P;B	.|0.87578	.|0.998;0.783;0.844;0.151	T|T	0.74372|0.74372	-0.3687|-0.3687	6|9	0.87932|0.33940	D|T	0|0.23	.|.	14.9226|14.9226	0.70851|0.70851	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|848;844;845;849	.|Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.|.;.;.;SRRT_HUMAN	V|R	213|845;848;844;849;472	.|.	ENSP00000344670:L213V|ENSP00000314491:P849R	L|P	+|+	1|2	0|0	SRRT|SRRT	100323931|100323931	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.963000|0.963000	0.63663|0.63663	5.183000|5.183000	0.65065|0.65065	2.386000|2.386000	0.81285|0.81285	0.484000|0.484000	0.47621|0.47621	CTC|CCT	SRRT	-	pfam_Arsenite-R_2	ENSG00000087087		0.612	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	133	0.00	0	C	NM_015908		100485995	100485995	+1	no_errors	ENST00000388793	ensembl	human	known	69_37n	missense	189	19.15	45	SNP	1.000	G
STAT4	6775	genome.wustl.edu	37	2	191898277	191898277	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:191898277T>A	ENST00000392320.2	-	20	2105	c.1791A>T	c.(1789-1791)ttA>ttT	p.L597F	AC067945.4_ENST00000456176.1_RNA|STAT4_ENST00000470708.1_5'Flank|STAT4_ENST00000358470.4_Missense_Mutation_p.L597F	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	597	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			CACTGAATCTTAATAAAAAGG	0.368																																						dbGAP											0													68.0	73.0	71.0					2																	191898277		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.1791A>T	2.37:g.191898277T>A	ENSP00000376134:p.Leu597Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96NZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.L597F	ENST00000392320.2	37	c.1791	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	T	18.92	3.726676	0.69074	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	D;D	0.90197	-2.63;-2.63	5.65	0.535	0.17133	SH2 motif (4);	0.000000	0.64402	D	0.000001	D	0.94732	0.8300	M	0.91300	3.195	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92131	0.5712	10	0.87932	D	0	-28.6467	5.8614	0.18749	0.0:0.3421:0.1376:0.5202	.	506;597;597	Q53S87;B4DV04;Q14765	.;.;STAT4_HUMAN	F	597	ENSP00000351255:L597F;ENSP00000376134:L597F	ENSP00000351255:L597F	L	-	3	2	STAT4	191606522	0.997000	0.39634	0.855000	0.33649	0.969000	0.65631	0.387000	0.20718	0.137000	0.18759	-0.256000	0.11100	TTA	STAT4	-	pfam_SH2,pfscan_SH2	ENSG00000138378		0.368	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	110	0.00	0	T	NM_003151		191898277	191898277	-1	no_errors	ENST00000358470	ensembl	human	known	69_37n	missense	175	28.46	70	SNP	0.916	A
SUPT6H	6830	genome.wustl.edu	37	17	27028471	27028471	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr17:27028471C>G	ENST00000314616.6	+	37	5292	c.5009C>G	c.(5008-5010)gCa>gGa	p.A1670G	SUPT6H_ENST00000347486.4_Missense_Mutation_p.A1670G|PROCA1_ENST00000579650.1_5'Flank	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1670	Interaction with histone H2B and H3.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AACAGCCATGCAGCCATCGAC	0.567																																						dbGAP											0													64.0	63.0	63.0					17																	27028471		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.5009C>G	17.37:g.27028471C>G	ENSP00000319104:p.Ala1670Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.A1670G	ENST00000314616.6	37	c.5009	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	15.59	2.878878	0.51801	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.57	5.57	0.84162	.	0.159738	0.56097	D	0.000022	T	0.35278	0.0926	N	0.14661	0.345	0.49051	D	0.999746	P	0.37061	0.58	B	0.26094	0.066	T	0.20739	-1.0266	9	0.35671	T	0.21	-7.5579	19.5406	0.95272	0.0:1.0:0.0:0.0	.	1670	Q7KZ85	SPT6H_HUMAN	G	1670;670	.	ENSP00000319104:A1670G	A	+	2	0	SUPT6H	24052598	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.247000	0.78257	2.624000	0.88883	0.563000	0.77884	GCA	SUPT6H	-	NULL	ENSG00000109111		0.567	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	85	0.00	0	C	NM_003170		27028471	27028471	+1	no_errors	ENST00000314616	ensembl	human	known	69_37n	missense	78	27.78	30	SNP	1.000	G
TAF6	6878	genome.wustl.edu	37	7	99707866	99707866	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr7:99707866G>A	ENST00000344095.4	-	11	1640	c.1115C>T	c.(1114-1116)aCt>aTt	p.T372I	TAF6_ENST00000437822.2_Missense_Mutation_p.T409I|AP4M1_ENST00000421755.1_3'UTR|TAF6_ENST00000418432.2_Missense_Mutation_p.T296I|TAF6_ENST00000472509.1_Missense_Mutation_p.T429I|TAF6_ENST00000452041.1_Missense_Mutation_p.T372I|TAF6_ENST00000453269.2_Missense_Mutation_p.T372I	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	372					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCATAACGAGTCGTCCAGGG	0.527																																						dbGAP											0													200.0	201.0	200.0					7																	99707866		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1115C>T	7.37:g.99707866G>A	ENSP00000344537:p.Thr372Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	pfam_DUF1546,pfam_TAF_TATA-bd,superfamily_Histone-fold,superfamily_ARM-type_fold,smart_TAF_TATA-bd	p.T372I	ENST00000344095.4	37	c.1115	CCDS5686.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	22.1|22.1	4.249983|4.249983	0.80024|0.80024	.|.	.|.	ENSG00000221838|ENSG00000106290	ENST00000450807|ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822	.|T;T;T;T;T;T	.|0.65549	.|-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.24|5.24	4.36|4.36	0.52297|0.52297	.|Domain of unknown function DUF1546 (1);	.|0.047420	.|0.85682	.|D	.|0.000000	T|T	0.70395|0.70395	0.3219|0.3219	M|M	0.81112|0.81112	2.525|2.525	0.49687|0.49687	D|D	0.999815|0.999815	.|P;P;P;P;P	.|0.46706	.|0.854;0.824;0.854;0.883;0.854	.|P;B;P;P;P	.|0.49887	.|0.505;0.372;0.505;0.625;0.505	T|T	0.73072|0.73072	-0.4098|-0.4098	6|9	0.62326|.	D|.	0.03|.	-18.5363|-18.5363	11.8099|11.8099	0.52177|0.52177	0.0845:0.0:0.9155:0.0|0.0845:0.0:0.9155:0.0	.|.	.|409;372;362;372;296	.|B4DT11;P49848-2;A4D299;P49848;B3KUR4	.|.;.;.;TAF6_HUMAN;.	N|I	149|372;429;372;372;296;409	.|ENSP00000389575:T372I;ENSP00000419760:T429I;ENSP00000416396:T372I;ENSP00000344537:T372I;ENSP00000407980:T296I;ENSP00000399982:T409I	ENSP00000391585:S149N|.	S|T	+|-	2|2	0|0	AP4M1|TAF6	99545802|99545802	1.000000|1.000000	0.71417|0.71417	0.796000|0.796000	0.32109|0.32109	0.942000|0.942000	0.58702|0.58702	8.424000|8.424000	0.90267|0.90267	1.438000|1.438000	0.47492|0.47492	0.556000|0.556000	0.70494|0.70494	AGT|ACT	TAF6	-	pfam_DUF1546,superfamily_ARM-type_fold	ENSG00000106290		0.527	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6	HGNC	protein_coding	OTTHUMT00000337024.2	287	0.00	0	G	NM_005641		99707866	99707866	-1	no_errors	ENST00000344095	ensembl	human	known	69_37n	missense	376	19.14	89	SNP	0.969	A
TIA1	7072	genome.wustl.edu	37	2	70454946	70454946	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:70454946G>A	ENST00000433529.2	-	6	529	c.319C>T	c.(319-321)Cat>Tat	p.H107Y	TIA1_ENST00000415783.2_Missense_Mutation_p.H96Y|C2orf42_ENST00000470096.1_Intron|TIA1_ENST00000416149.2_Missense_Mutation_p.H107Y|TIA1_ENST00000445587.1_Missense_Mutation_p.H96Y|TIA1_ENST00000282574.4_Missense_Mutation_p.H107Y	NM_022173.2	NP_071505.2	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein	107	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of translation (GO:0017148)|regulation of mRNA splicing, via spliceosome (GO:0048024)	cytoplasmic stress granule (GO:0010494)|nuclear stress granule (GO:0097165)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	17						ACAAAGACATGGAAATGATCT	0.303																																						dbGAP											0													77.0	82.0	80.0					2																	70454946		2203	4294	6497	-	-	-	SO:0001583	missense	0				CCDS1900.1, CCDS1901.1	2p13	2013-02-12	2001-11-28		ENSG00000116001	ENSG00000116001		"""RNA binding motif (RRM) containing"""	11802	protein-coding gene	gene with protein product	"""T-cell-restricted intracellular antigen-1"", ""nucleolysin TIA-1 isoform p40"""	603518	"""TIA1 cytotoxic granule-associated RNA-binding protein"""			8176212, 12486009	Standard	NM_022173		Approved		uc002sgj.4	P31483	OTTHUMG00000129644	ENST00000433529.2:c.319C>T	2.37:g.70454946G>A	ENSP00000401371:p.His107Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SS9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.H107Y	ENST00000433529.2	37	c.319	CCDS1901.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.81|17.81	3.480566|3.480566	0.63849|0.63849	.|.	.|.	ENSG00000116001|ENSG00000116001	ENST00000433529;ENST00000415783;ENST00000477807;ENST00000282574;ENST00000445587;ENST00000416149|ENST00000361692	D;D;D;D;D|.	0.85702|.	-2.02;-2.02;-2.02;-2.02;-2.02|.	5.08|5.08	5.08|5.08	0.68730|0.68730	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);|.	0.093518|.	0.85682|.	D|.	0.000000|.	T|T	0.47432|0.47432	0.1445|0.1445	N|N	0.12746|0.12746	0.255|0.255	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.996;1.0;0.999|.	D;D;D|.	0.91635|.	0.953;0.999;0.995|.	T|T	0.41052|0.41052	-0.9530|-0.9530	10|5	0.87932|.	D|.	0|.	-25.5208|-25.5208	16.022|16.022	0.80506|0.80506	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	145;96;107|.	Q59G98;P31483-2;P31483|.	.;.;TIA1_HUMAN|.	Y|L	107;96;145;107;96;107|87	ENSP00000401371:H107Y;ENSP00000404023:H96Y;ENSP00000282574:H107Y;ENSP00000399567:H96Y;ENSP00000413751:H107Y|.	ENSP00000282574:H107Y|.	H|P	-|-	1|2	0|0	TIA1|TIA1	70308450|70308450	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.559000|9.559000	0.98135|0.98135	2.642000|2.642000	0.89623|0.89623	0.650000|0.650000	0.86243|0.86243	CAT|CCA	TIA1	-	smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000116001		0.303	TIA1-001	KNOWN	basic|CCDS	protein_coding	TIA1	HGNC	protein_coding	OTTHUMT00000251842.2	119	0.00	0	G	NM_022037		70454946	70454946	-1	no_errors	ENST00000433529	ensembl	human	known	69_37n	missense	154	28.70	62	SNP	1.000	A
SARAF	51669	genome.wustl.edu	37	8	29924354	29924354	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr8:29924354G>A	ENST00000256255.6	-	4	1038	c.781C>T	c.(781-783)Cca>Tca	p.P261S	TMEM66_ENST00000545648.1_Missense_Mutation_p.P89S|TMEM66_ENST00000536273.1_Missense_Mutation_p.P89S	NM_016127.4	NP_057211.4	Q96BY9	SARAF_HUMAN		261					calcium ion transport (GO:0006816)|regulation of store-operated calcium entry (GO:2001256)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|large_intestine(1)|lung(11)	14				KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)		CAGAACCCTGGTCCTGAATTT	0.398																																						dbGAP											0													141.0	139.0	139.0					8																	29924354		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000256255.6:c.781C>T	8.37:g.29924354G>A	ENSP00000256255:p.Pro261Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQQ4|B7Z9J1|D3DSU7|H9MHJ8|H9MHJ9|Q53HE8|Q9UNZ3|Q9Y683	Missense_Mutation	SNP	pfam_DUF1183_TMEM66	p.P261S	ENST00000256255.6	37	c.781	CCDS6074.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.516544|4.516544	0.85495|0.85495	.|.	.|.	ENSG00000133872|ENSG00000133872	ENST00000256255;ENST00000545648;ENST00000541035;ENST00000536273;ENST00000523127|ENST00000518296	T;T;T;T|.	0.52295|.	0.67;0.67;0.67;0.67|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.111228|.	0.64402|.	D|.	0.000009|.	T|T	0.80555|0.80555	0.4645|0.4645	M|M	0.88450|0.88450	2.955|2.955	0.52099|0.52099	D|D	0.999943|0.999943	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	D|D	0.84144|0.84144	0.0419|0.0419	10|5	0.41790|.	T|.	0.15|.	-23.8286|-23.8286	15.7773|15.7773	0.78232|0.78232	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	261;261|.	B3KQQ4;Q96BY9|.	.;TMM66_HUMAN|.	S|I	261;89;225;89;159|130	ENSP00000256255:P261S;ENSP00000441351:P89S;ENSP00000441723:P89S;ENSP00000428323:P159S|.	ENSP00000256255:P261S|.	P|T	-|-	1|2	0|0	TMEM66|TMEM66	30043896|30043896	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.991000|0.991000	0.79684|0.79684	4.410000|4.410000	0.59774|0.59774	2.323000|2.323000	0.78572|0.78572	0.580000|0.580000	0.79431|0.79431	CCA|ACC	TMEM66	-	pfam_DUF1183_TMEM66	ENSG00000133872		0.398	TMEM66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM66	HGNC	protein_coding	OTTHUMT00000257254.4	334	0.30	1	G			29924354	29924354	-1	no_errors	ENST00000256255	ensembl	human	known	69_37n	missense	542	16.46	107	SNP	0.998	A
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000420246.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)											100.0	89.0	93.0					17																	7578265		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I195T	ENST00000269305.4	37	c.584	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	272	0.00	0	A	NM_000546		7578265	7578265	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	150	54.55	180	SNP	1.000	G
TRAF7	84231	genome.wustl.edu	37	16	2226284	2226285	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr16:2226284_2226285delAT	ENST00000326181.6	+	20	2029_2030	c.1897_1898delAT	c.(1897-1899)atgfs	p.M633fs		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	633					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						TATGGACAACATGATCTGCACG	0.668																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.1897_1898delAT	16.37:g.2226284_2226285delAT	ENSP00000318944:p.Met633fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H073	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_TRAF-like,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_Znf_TRAF,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.M633fs	ENST00000326181.6	37	c.1897_1898	CCDS10461.1	16																																																																																			TRAF7	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000131653		0.668	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF7	HGNC	protein_coding	OTTHUMT00000250762.1	43	0.00	0	AT	NM_032271		2226284	2226285	+1	no_errors	ENST00000326181	ensembl	human	known	69_37n	frame_shift_del	48	17.24	10	DEL	1.000:1.000	-
TRO	7216	genome.wustl.edu	37	X	54949939	54949939	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chrX:54949939T>A	ENST00000173898.7	+	3	1086	c.974T>A	c.(973-975)aTa>aAa	p.I325K	TRO_ENST00000484031.1_Intron|TRO_ENST00000375041.2_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000420798.2_Intron|TRO_ENST00000319167.8_Missense_Mutation_p.I325K|TRO_ENST00000375022.4_Missense_Mutation_p.I325K	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	325					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GCCACTCAGATAGTCACAAAC	0.577																																						dbGAP											0													16.0	16.0	16.0					X																	54949939		1869	4083	5952	-	-	-	SO:0001583	missense	0			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.974T>A	X.37:g.54949939T>A	ENSP00000173898:p.Ile325Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.I325K	ENST00000173898.7	37	c.974	CCDS43959.1	X	.	.	.	.	.	.	.	.	.	.	T	3.495	-0.103027	0.06967	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022	T;T;T	0.46451	0.87;0.87;0.87	3.02	1.85	0.25348	.	.	.	.	.	T	0.18635	0.0447	N	0.08118	0	0.23787	N	0.996842	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.23619	-1.0183	8	.	.	.	.	4.1352	0.10167	0.0:0.171:0.0:0.829	.	325;325	Q96SX2;Q12816	.;TROP_HUMAN	K	325	ENSP00000173898:I325K;ENSP00000318278:I325K;ENSP00000364162:I325K	.	I	+	2	0	TRO	54966664	0.908000	0.30866	0.417000	0.26559	0.053000	0.15095	0.530000	0.23036	0.414000	0.25790	0.409000	0.27619	ATA	TRO	-	NULL	ENSG00000067445		0.577	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	HGNC	protein_coding	OTTHUMT00000056837.3	37	0.00	0	T	NM_016157		54949939	54949939	+1	no_errors	ENST00000173898	ensembl	human	known	69_37n	missense	66	20.48	17	SNP	0.404	A
TSPAN12	23554	genome.wustl.edu	37	7	120428909	120428909	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr7:120428909G>A	ENST00000222747.3	-	8	1262	c.655C>T	c.(655-657)Caa>Taa	p.Q219*	TSPAN12_ENST00000415871.1_Nonsense_Mutation_p.Q219*	NM_012338.3	NP_036470.1	O95859	TSN12_HUMAN	tetraspanin 12	219					angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|regulation of angiogenesis (GO:0045765)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|kidney(1)|lung(4)|ovary(1)|skin(1)	10	all_neural(327;0.117)					ACCTGCAGTTGTTTGGTTCCT	0.408																																						dbGAP											0													73.0	70.0	71.0					7																	120428909		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF124522	CCDS5777.1	7q31.31	2013-02-14	2005-03-21	2005-03-21	ENSG00000106025	ENSG00000106025		"""Tetraspanins"""	21641	protein-coding gene	gene with protein product		613138	"""transmembrane 4 superfamily member 12"""	TM4SF12			Standard	NM_012338		Approved	NET-2	uc003vjk.3	O95859	OTTHUMG00000156980	ENST00000222747.3:c.655C>T	7.37:g.120428909G>A	ENSP00000222747:p.Gln219*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0V8|B4DRG6|Q549U9|Q8N5Y0	Nonsense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.Q219*	ENST00000222747.3	37	c.655	CCDS5777.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.459731	0.97585	.	.	ENSG00000106025	ENST00000222747;ENST00000415871	.	.	.	5.68	5.68	0.88126	.	0.051043	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-13.7135	19.7821	0.96420	0.0:0.0:1.0:0.0	.	.	.	.	X	219	.	ENSP00000222747:Q219X	Q	-	1	0	TSPAN12	120216145	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.230000	0.95299	2.682000	0.91365	0.655000	0.94253	CAA	TSPAN12	-	pfam_Tetraspanin/Peripherin	ENSG00000106025		0.408	TSPAN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN12	HGNC	protein_coding	OTTHUMT00000346951.1	59	0.00	0	G	NM_012338		120428909	120428909	-1	no_errors	ENST00000222747	ensembl	human	known	69_37n	nonsense	196	16.95	40	SNP	1.000	A
TSPAN31	6302	genome.wustl.edu	37	12	58140421	58140421	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr12:58140421A>G	ENST00000257910.3	+	4	636	c.362A>G	c.(361-363)gAt>gGt	p.D121G	TSPAN31_ENST00000547472.1_Missense_Mutation_p.D38G|CDK4_ENST00000551888.1_5'Flank|TSPAN31_ENST00000547992.1_Intron|TSPAN31_ENST00000553221.1_3'UTR	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	121					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			AAGACTCGGGATGAACTGGAA	0.433																																						dbGAP											0													144.0	133.0	136.0					12																	58140421		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.362A>G	12.37:g.58140421A>G	ENSP00000257910:p.Asp121Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00577|Q53X76	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	p.D121G	ENST00000257910.3	37	c.362	CCDS8952.1	12	.	.	.	.	.	.	.	.	.	.	A	10.32	1.317948	0.23994	.	.	ENSG00000135452	ENST00000257910;ENST00000552816;ENST00000547472;ENST00000548167	D;D;D;D	0.89123	-1.6;-2.47;-1.6;-2.47	4.91	4.91	0.64330	.	0.692373	0.14685	N	0.304519	T	0.77068	0.4076	N	0.08118	0	0.26263	N	0.978547	B	0.12013	0.005	B	0.14578	0.011	T	0.65340	-0.6192	10	0.35671	T	0.21	-3.8047	9.3927	0.38383	0.8407:0.0:0.0:0.1592	.	121	Q12999	TSN31_HUMAN	G	121;43;38;43	ENSP00000257910:D121G;ENSP00000449312:D43G;ENSP00000449199:D38G;ENSP00000449131:D43G	ENSP00000257910:D121G	D	+	2	0	TSPAN31	56426688	0.938000	0.31826	0.999000	0.59377	0.998000	0.95712	2.223000	0.42936	2.197000	0.70478	0.455000	0.32223	GAT	TSPAN31	-	pfam_Tetraspanin/Peripherin	ENSG00000135452		0.433	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN31	HGNC	protein_coding	OTTHUMT00000408778.1	227	0.00	0	A			58140421	58140421	+1	no_errors	ENST00000257910	ensembl	human	known	69_37n	missense	230	28.57	92	SNP	0.987	G
CFAP70	118491	genome.wustl.edu	37	10	75071672	75071672	+	Splice_Site	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr10:75071672G>C	ENST00000310715.3	-	12	1414	c.1294C>G	c.(1294-1296)Cag>Gag	p.Q432E	TTC18_ENST00000340329.3_Intron|TTC18_ENST00000394865.1_Splice_Site_p.Q432E|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_5'UTR|TTC18_ENST00000401621.2_Splice_Site_p.Q432E	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		432						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					CTAGGTGCCTGCTGAAAGAAA	0.398																																						dbGAP											0													103.0	111.0	108.0					10																	75071672		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000310715.3:c.1294-1C>G	10.37:g.75071672G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q432E	ENST00000310715.3	37	c.1294	CCDS7324.3	10	.	.	.	.	.	.	.	.	.	.	G	0.905	-0.721065	0.03182	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000372928;ENST00000394865	T;T;T	0.29397	1.98;1.98;1.57	4.92	4.01	0.46588	.	1.313380	0.05307	N	0.524026	T	0.29684	0.0741	L	0.36672	1.1	0.09310	N	1	B;B	0.24368	0.102;0.062	B;B	0.30401	0.115;0.039	T	0.32824	-0.9892	10	0.30078	T	0.28	-21.7745	8.9798	0.35957	0.1036:0.0:0.8964:0.0	.	432;432	Q5T0N1-2;Q5T0N1	.;TTC18_HUMAN	E	432	ENSP00000310829:Q432E;ENSP00000384479:Q432E;ENSP00000378334:Q432E	ENSP00000310829:Q432E	Q	-	1	0	TTC18	74741678	0.987000	0.35691	0.942000	0.38095	0.918000	0.54935	1.706000	0.37878	1.073000	0.40885	0.563000	0.77884	CAG	TTC18	-	NULL	ENSG00000156042		0.398	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding		106	0.00	0	G		Missense_Mutation	75071672	75071672	-1	no_errors	ENST00000310715	ensembl	human	known	69_37n	missense	164	20.39	42	SNP	0.158	C
UBA1	7317	genome.wustl.edu	37	X	47061807	47061807	+	Silent	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chrX:47061807C>T	ENST00000335972.6	+	10	1143	c.960C>T	c.(958-960)ttC>ttT	p.F320F	UBA1_ENST00000377351.4_Silent_p.F320F|INE1_ENST00000456273.1_RNA	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	320	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGACGGACTTCGCCAAGTTTT	0.597																																						dbGAP											0													79.0	61.0	67.0					X																	47061807		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.960C>T	X.37:g.47061807C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRR8|Q96E13	Silent	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.F320	ENST00000335972.6	37	c.960	CCDS14275.1	X																																																																																			UBA1	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.597	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	285	0.00	0	C	NM_003334		47061807	47061807	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	silent	315	30.09	136	SNP	0.938	T
UBAP2	55833	genome.wustl.edu	37	9	33935827	33935827	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr9:33935827C>T	ENST00000379225.1	-	5	1301	c.878G>A	c.(877-879)aGc>aAc	p.S293N	UBAP2_ENST00000418786.2_Intron|UBAP2_ENST00000449054.1_Intron|UBAP2_ENST00000539807.1_Intron|UBAP2_ENST00000379238.1_Intron|SNORD121B_ENST00000458838.1_RNA|UBAP2_ENST00000379239.4_Intron|UBAP2_ENST00000360802.1_Intron					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		TAGCTTGCTGCTATACTTACT	0.408																																						dbGAP											0													127.0	99.0	108.0					9																	33935827		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379225.1:c.878G>A	9.37:g.33935827C>T	ENSP00000368527:p.Ser293Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF3697_Uba2	p.S293N	ENST00000379225.1	37	c.878		9	.	.	.	.	.	.	.	.	.	.	C	10.47	1.357967	0.24598	.	.	ENSG00000137073	ENST00000379225	T	0.30182	1.54	4.22	-2.57	0.06248	.	.	.	.	.	T	0.20251	0.0487	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.14578	0.011	T	0.23190	-1.0195	8	0.59425	D	0.04	.	6.8389	0.23951	0.1999:0.6046:0.0788:0.1167	.	293	A2A306	.	N	293	ENSP00000368527:S293N	ENSP00000368527:S293N	S	-	2	0	UBAP2	33925827	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.464000	0.06688	-0.812000	0.04363	-2.565000	0.00172	AGC	UBAP2	-	NULL	ENSG00000137073		0.408	UBAP2-008	KNOWN	basic	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000207580.1	115	0.00	0	C	NM_018449		33935827	33935827	-1	no_errors	ENST00000379225	ensembl	human	known	69_37n	missense	205	22.64	60	SNP	0.000	T
UBQLN4	56893	genome.wustl.edu	37	1	156012608	156012608	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:156012608C>G	ENST00000368309.3	-	7	1315	c.1223G>C	c.(1222-1224)aGc>aCc	p.S408T		NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	408					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					CTGCATCATGCTGCGCATGTA	0.537																																						dbGAP											0													67.0	66.0	66.0					1																	156012608		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.1223G>C	1.37:g.156012608C>G	ENSP00000357292:p.Ser408Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_UBA/transl_elong_EF1B_N,pfam_SUMO,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.S408T	ENST00000368309.3	37	c.1223	CCDS1127.1	1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873256	0.51695	.	.	ENSG00000160803	ENST00000368309	T	0.59224	0.28	4.64	3.71	0.42584	Heat shock chaperonin-binding (1);	0.080279	0.85682	N	0.000000	T	0.37293	0.0998	L	0.52905	1.665	0.80722	D	1	P;P	0.42010	0.609;0.768	B;B	0.38020	0.119;0.263	T	0.34925	-0.9809	10	0.44086	T	0.13	-35.0304	13.2029	0.59778	0.0:0.8321:0.1679:0.0	.	388;408	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	T	408	ENSP00000357292:S408T	ENSP00000357292:S408T	S	-	2	0	UBQLN4	154279232	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.792000	0.55476	1.125000	0.41998	0.655000	0.94253	AGC	UBQLN4	-	superfamily_XPC-bd,smart_STI1_HS-bd	ENSG00000160803		0.537	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN4	HGNC	protein_coding	OTTHUMT00000046193.1	271	0.00	0	C	NM_020131		156012608	156012608	-1	no_errors	ENST00000368309	ensembl	human	known	69_37n	missense	521	16.24	101	SNP	1.000	G
USP34	9736	genome.wustl.edu	37	2	61520625	61520625	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:61520625G>C	ENST00000398571.2	-	33	4598	c.4522C>G	c.(4522-4524)Cct>Gct	p.P1508A		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1508					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TGCTCTTTAGGCTCTAGAATT	0.358																																						dbGAP											0													95.0	86.0	89.0					2																	61520625		1823	4082	5905	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.4522C>G	2.37:g.61520625G>C	ENSP00000381577:p.Pro1508Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.P1508A	ENST00000398571.2	37	c.4522	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360244	0.61403	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03152	4.03	5.6	5.6	0.85130	.	0.053759	0.85682	D	0.000000	T	0.03390	0.0098	L	0.29908	0.895	0.58432	D	0.999999	B	0.32918	0.39	B	0.24269	0.052	T	0.51284	-0.8725	10	0.08381	T	0.77	.	18.6083	0.91275	0.0:0.0:1.0:0.0	.	1508	Q70CQ2	UBP34_HUMAN	A	1356;1356;1508	ENSP00000381577:P1508A	ENSP00000263989:P1356A	P	-	1	0	USP34	61374129	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.110000	0.94302	2.627000	0.88993	0.650000	0.86243	CCT	USP34	-	superfamily_ARM-type_fold	ENSG00000115464		0.358	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	117	0.00	0	G			61520625	61520625	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	329	12.96	49	SNP	1.000	C
VCX3B	425054	genome.wustl.edu	37	X	8434392	8434392	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chrX:8434392G>T	ENST00000381032.1	+	3	1016	c.709G>T	c.(709-711)Gag>Tag	p.E237*	VCX3B_ENST00000453306.1_Splice_Site_p.E177*|VCX3B_ENST00000381029.4_Nonsense_Mutation_p.E205*|VCX3B_ENST00000440654.2_Splice_Site_p.E177*|VCX3B_ENST00000444481.1_Nonsense_Mutation_p.E207*	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	237	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						ACTGAGTCAGGAGAGCGAGAT	0.562																																						dbGAP											0													85.0	221.0	175.0					X																	8434392		2164	4181	6345	-	-	-	SO:0001587	stop_gained	0				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.709G>T	X.37:g.8434392G>T	ENSP00000370420:p.Glu237*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JS46|Q4KN12	Nonsense_Mutation	SNP	NULL	p.E207*	ENST00000381032.1	37	c.619	CCDS48077.2	X	.	.	.	.	.	.	.	.	.	.	N	16.87	3.243010	0.58995	.	.	ENSG00000205642	ENST00000381032;ENST00000453306;ENST00000444481;ENST00000440654;ENST00000381029	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.27480	N	0.952601	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	6.9298	0.24435	1.0E-4:0.0:0.9999:0.0	.	.	.	.	X	237;177;207;177;205	.	ENSP00000370417:E205X	E	+	1	0	VCX3B	8394392	0.993000	0.37304	0.003000	0.11579	0.015000	0.08874	1.143000	0.31553	0.574000	0.29417	0.379000	0.24179	GAG	VCX3B	-	NULL	ENSG00000205642		0.562	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	VCX3B	HGNC	protein_coding	OTTHUMT00000055691.1	431	0.23	1	G			8434392	8434392	+1	no_errors	ENST00000444481	ensembl	human	known	69_37n	nonsense	561	24.05	178	SNP	0.909	T
VILL	50853	genome.wustl.edu	37	3	38039808	38039808	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr3:38039808C>A	ENST00000283713.6	+	9	1161	c.895C>A	c.(895-897)Cgc>Agc	p.R299S	VILL_ENST00000383759.2_Missense_Mutation_p.R299S|VILL_ENST00000465644.1_Intron			O15195	VILL_HUMAN	villin-like	299					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GTGGCAGGGACGCATGTCTAG	0.617																																						dbGAP											0													99.0	99.0	99.0					3																	38039808		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.895C>A	3.37:g.38039808C>A	ENSP00000283713:p.Arg299Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZP1|Q9BT80|Q9BWH7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.R299S	ENST00000283713.6	37	c.895	CCDS2670.2	3	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004890	0.54254	.	.	ENSG00000136059	ENST00000283713;ENST00000383759;ENST00000356246	T;T	0.52526	0.66;0.66	3.77	3.77	0.43336	Gelsolin domain (1);	0.198260	0.44285	D	0.000472	T	0.48572	0.1507	L	0.39692	1.235	0.34607	D	0.717152	P;P	0.49862	0.929;0.777	P;P	0.53593	0.611;0.73	T	0.62263	-0.6891	10	0.62326	D	0.03	-8.6873	9.4967	0.38993	0.365:0.635:0.0:0.0	.	285;299	O15195-2;O15195	.;VILL_HUMAN	S	299;299;285	ENSP00000283713:R299S;ENSP00000373266:R299S	ENSP00000283713:R299S	R	+	1	0	VILL	38014812	0.000000	0.05858	0.940000	0.37924	0.495000	0.33615	0.473000	0.22132	2.120000	0.65058	0.505000	0.49811	CGC	VILL	-	pfam_Gelsolin_dom,smart_Gelsolin	ENSG00000136059		0.617	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VILL	HGNC	protein_coding	OTTHUMT00000253360.3	218	0.45	1	C	NM_015873		38039808	38039808	+1	no_errors	ENST00000283713	ensembl	human	known	69_37n	missense	121	52.55	134	SNP	0.994	A
VWA3B	200403	genome.wustl.edu	37	2	98834413	98834413	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr2:98834413G>C	ENST00000477737.1	+	14	2145	c.1941G>C	c.(1939-1941)gaG>gaC	p.E647D		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	647	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.									NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTTTGAAAGAGGTTGCTGCTT	0.413																																						dbGAP											0													132.0	123.0	126.0					2																	98834413		1842	4093	5935	-	-	-	SO:0001583	missense	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1941G>C	2.37:g.98834413G>C	ENSP00000417955:p.Glu647Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.E647D	ENST00000477737.1	37	c.1941	CCDS42718.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.45|10.45	1.352835|1.352835	0.24512|0.24512	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000477737|ENST00000473149	T|.	0.08984|.	3.03|.	5.77|5.77	-3.36|-3.36	0.04913|0.04913	von Willebrand factor, type A (3);|.	0.583790|.	0.15881|.	N|.	0.240042|.	T|T	0.32763|0.32763	0.0840|0.0840	L|L	0.27053|0.27053	0.805|0.805	0.38379|0.38379	D|D	0.945071|0.945071	B;B;B;B|.	0.20671|.	0.047;0.034;0.007;0.047|.	B;B;B;B|.	0.18561|.	0.021;0.022;0.009;0.021|.	T|T	0.28267|0.28267	-1.0049|-1.0049	10|5	0.32370|.	T|.	0.25|.	.|.	1.754|1.754	0.02978|0.02978	0.333:0.2137:0.344:0.1093|0.333:0.2137:0.344:0.1093	.|.	39;647;647;647|.	Q502W6-5;Q502W6;Q502W6-8;Q502W6-6|.	.;VWA3B_HUMAN;.;.|.	D|R	647|58	ENSP00000417955:E647D|.	ENSP00000417955:E647D|.	E|G	+|+	3|1	2|0	VWA3B|VWA3B	98200845|98200845	0.307000|0.307000	0.24500|0.24500	0.924000|0.924000	0.36721|0.36721	0.454000|0.454000	0.32378|0.32378	-0.498000|-0.498000	0.06420|0.06420	-0.353000|-0.353000	0.08224|0.08224	-0.733000|-0.733000	0.03571|0.03571	GAG|GGT	VWA3B	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000168658		0.413	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2	310	0.00	0	G	NM_144992		98834413	98834413	+1	no_errors	ENST00000477737	ensembl	human	known	69_37n	missense	505	22.27	145	SNP	0.555	C
WDR20	91833	genome.wustl.edu	37	14	102606230	102606230	+	5'UTR	SNP	A	A	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr14:102606230A>C	ENST00000342702.3	+	0	1				WDR20_ENST00000424963.2_5'UTR|WDR20_ENST00000556511.2_5'Flank|HSP90AA1_ENST00000334701.7_5'Flank|HSP90AA1_ENST00000558600.1_5'Flank|WDR20_ENST00000454394.2_5'Flank|WDR20_ENST00000558567.1_5'Flank|WDR20_ENST00000556807.1_5'UTR|WDR20_ENST00000322340.5_5'UTR|WDR20_ENST00000499851.2_5'UTR|WDR20_ENST00000299135.6_5'Flank|WDR20_ENST00000335263.5_5'UTR	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20											breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						TGATCCGGGCACTTAGGGCAG	0.642																																						dbGAP											0													81.0	76.0	78.0					14																	102606230		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.-31A>C	14.37:g.102606230A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	RNA	SNP	-	NULL	ENST00000342702.3	37	NULL	CCDS9969.1	14																																																																																			WDR20	-	-	ENSG00000140153		0.642	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR20	HGNC	protein_coding	OTTHUMT00000414963.1	95	0.00	0	A	NM_181291		102606230	102606230	+1	no_errors	ENST00000561154	ensembl	human	known	69_37n	rna	81	16.49	16	SNP	1.000	C
ZNF174	7727	genome.wustl.edu	37	16	3458760	3458760	+	Silent	SNP	G	G	A	rs553598485		TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr16:3458760G>A	ENST00000268655.4	+	3	1650	c.1065G>A	c.(1063-1065)acG>acA	p.T355T	ZNF174_ENST00000571936.1_Silent_p.T355T	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	355					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						GACCCTACACGTGCGGAGAGT	0.527																																						dbGAP											0													52.0	59.0	57.0					16																	3458760		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.1065G>A	16.37:g.3458760G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Y68|Q9BQ34	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.T355	ENST00000268655.4	37	c.1065	CCDS10504.1	16																																																																																			ZNF174	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000103343		0.527	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF174	HGNC	protein_coding	OTTHUMT00000251510.1	81	0.00	0	G	NM_003450		3458760	3458760	+1	no_errors	ENST00000268655	ensembl	human	known	69_37n	silent	127	23.49	39	SNP	0.000	A
ZNF318	24149	genome.wustl.edu	37	6	43304909	43304909	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr6:43304909C>G	ENST00000361428.2	-	10	6904	c.6827G>C	c.(6826-6828)aGt>aCt	p.S2276T	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	2276					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GTTGTGAACACTGGATTCTGT	0.443																																						dbGAP											0													100.0	94.0	96.0					6																	43304909		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.6827G>C	6.37:g.43304909C>G	ENSP00000354964:p.Ser2276Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.S2276T	ENST00000361428.2	37	c.6827	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	6.727	0.502814	0.12822	.	.	ENSG00000171467	ENST00000361428	T	0.12984	2.63	5.93	3.0	0.34707	.	0.662303	0.14800	N	0.297665	T	0.03390	0.0098	N	0.24115	0.695	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.22800	-1.0206	10	0.56958	D	0.05	-0.042	7.2401	0.26092	0.0:0.571:0.2734:0.1556	.	2276	Q5VUA4	ZN318_HUMAN	T	2276	ENSP00000354964:S2276T	ENSP00000354964:S2276T	S	-	2	0	ZNF318	43412887	0.000000	0.05858	0.915000	0.36163	0.427000	0.31564	-0.776000	0.04674	0.315000	0.23110	0.655000	0.94253	AGT	ZNF318	-	NULL	ENSG00000171467		0.443	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	152	0.65	1	C	NM_014345		43304909	43304909	-1	no_errors	ENST00000361428	ensembl	human	known	69_37n	missense	325	18.34	73	SNP	0.712	G
ZNF462	58499	genome.wustl.edu	37	9	109773238	109773238	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr9:109773238A>G	ENST00000277225.5	+	13	7737	c.7448A>G	c.(7447-7449)aAt>aGt	p.N2483S	ZNF462_ENST00000542028.1_Missense_Mutation_p.N440S|ZNF462_ENST00000441147.2_Missense_Mutation_p.N1389S|ZNF462_ENST00000457913.1_Missense_Mutation_p.N2543S|RP11-508N12.2_ENST00000439901.1_RNA			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2483					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TCCCTAAAGAATGAAACAGTA	0.423																																						dbGAP											0													102.0	93.0	96.0					9																	109773238		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.7448A>G	9.37:g.109773238A>G	ENSP00000277225:p.Asn2483Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N2543S	ENST00000277225.5	37	c.7628	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	A	7.513	0.655085	0.14580	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147;ENST00000542028	T;T;T;T;T	0.13778	3.57;3.98;4.1;4.11;2.56	5.75	-5.91	0.02269	.	0.739424	0.13344	N	0.394931	T	0.03959	0.0111	N	0.03115	-0.41	0.09310	N	1	B;B	0.13594	0.008;0.0	B;B	0.12156	0.007;0.0	T	0.39742	-0.9599	10	0.02654	T	1	.	12.0216	0.53346	0.3824:0.0942:0.5234:0.0	.	2543;2483	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	S	2483;2543;1426;1389;440	ENSP00000277225:N2483S;ENSP00000414570:N2543S;ENSP00000363818:N1426S;ENSP00000397306:N1389S;ENSP00000439771:N440S	ENSP00000277225:N2483S	N	+	2	0	ZNF462	108813059	0.001000	0.12720	0.002000	0.10522	0.970000	0.65996	-0.205000	0.09411	-1.101000	0.03027	-0.256000	0.11100	AAT	ZNF462	-	NULL	ENSG00000148143		0.423	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	61	0.00	0	A	NM_021224		109773238	109773238	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	87	52.72	97	SNP	0.000	G
ZNF687	57592	genome.wustl.edu	37	1	151261078	151261079	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:151261078_151261079insC	ENST00000368879.2	+	3	2288_2289	c.2190_2191insC	c.(2191-2193)cccfs	p.P731fs		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	731					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H733fs*30(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ATAAGAATCGACCCCCCCATGT	0.579																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.2197dupC	1.37:g.151261085_151261085dupC	ENSP00000357874:p.Pro731fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H732fs	ENST00000368879.2	37	c.2190_2191		1																																																																																			ZNF687	-	pfscan_Znf_C2H2	ENSG00000143373		0.579	ZNF687-201	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding		125	0.00	0	-	NM_020832		151261078	151261079	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	frame_shift_ins	261	10.62	31	INS	0.407:0.430	C
PI4KB	5298	genome.wustl.edu	37	1	151262465	151262465	+	IGR	SNP	G	G	T			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr1:151262465G>T	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Missense_Mutation_p.M982I			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGGCCCACATGAAGAAGGAGC	0.642																																					Colon(154;765 1838 9854 28443 37492)	dbGAP											0													22.0	21.0	21.0					1																	151262465		2202	4296	6498	-	-	-	SO:0001628	intergenic_variant	0			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151262465G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M982I	ENST00000368873.1	37	c.2946		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.57|19.57	3.851929|3.851929	0.71719|0.71719	.|.	.|.	ENSG00000143373|ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879|ENST00000426871	T;T;T|.	0.74947|.	-0.89;-0.89;-0.89|.	5.25|5.25	5.25|5.25	0.73442|0.73442	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);|.	0.000000|.	0.42821|.	D|.	0.000656|.	T|.	0.62527|.	0.2435|.	L|L	0.56124|0.56124	1.755|1.755	0.58432|0.58432	D|D	0.999999|0.999999	P;P|.	0.48503|.	0.891;0.911|.	P;P|.	0.49752|.	0.487;0.621|.	T|.	0.59257|.	-0.7488|.	10|.	0.66056|.	D|.	0.02|.	.|.	16.3975|16.3975	0.83613|0.83613	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	982;982|.	Q8N1G0-2;Q8N1G0|.	.;ZN687_HUMAN|.	I|L	982|585	ENSP00000336620:M982I;ENSP00000319829:M982I;ENSP00000357874:M982I|.	ENSP00000319829:M982I|.	M|X	+|+	3|2	0|2	ZNF687|ZNF687	149529089|149529089	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.572000|0.572000	0.35998|0.35998	9.572000|9.572000	0.98179|0.98179	2.740000|2.740000	0.93945|0.93945	0.313000|0.313000	0.20887|0.20887	ATG|TGA	ZNF687	-	smart_Znf_C2H2-like	ENSG00000143373		0.642	PI4KB-002	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding	OTTHUMT00000034400.3	64	0.00	0	G	NM_002651		151262465	151262465	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	missense	80	22.33	23	SNP	1.000	T
ZNF774	342132	genome.wustl.edu	37	15	90904480	90904482	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-A7-A0DA-01A-31D-A10Y-09	TCGA-A7-A0DA-10A-01D-A110-09	CAT	CAT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	878337fe-9f41-44f5-9760-3977e7d75308	47723567-39d1-40e9-a8ea-1bf9548db03e	g.chr15:90904480_90904482delCAT	ENST00000354377.3	+	4	1603_1605	c.1417_1419delCAT	c.(1417-1419)catdel	p.H473del	ZNF774_ENST00000379090.5_Intron	NM_001004309.2	NP_001004309.2	Q6NX45	ZN774_HUMAN	zinc finger protein 774	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|stomach(1)	14	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TCAGAAAGCGCATCTTTTATGCC	0.433																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC067279	CCDS32330.1	15q26.1	2013-01-08				ENSG00000196391		"""Zinc fingers, C2H2-type"""	33108	protein-coding gene	gene with protein product							Standard	NM_001004309		Approved	MGC75360	uc002bpk.4	Q6NX45		ENST00000354377.3:c.1417_1419delCAT	15.37:g.90904480_90904482delCAT	ENSP00000346348:p.His473del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K020	In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H473in_frame_del	ENST00000354377.3	37	c.1417_1419	CCDS32330.1	15																																																																																			ZNF774	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196391		0.433	ZNF774-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF774	HGNC	protein_coding	OTTHUMT00000418048.1	69	0.00	0	CAT	NM_001004309		90904480	90904482	+1	no_errors	ENST00000354377	ensembl	human	known	69_37n	in_frame_del	158	14.59	27	DEL	0.305:0.665:0.813	-
