#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACACB	32	genome.wustl.edu	37	12	109654723	109654723	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr12:109654723A>T	ENST00000338432.7	+	24	3681	c.3562A>T	c.(3562-3564)Atc>Ttc	p.I1188F	ACACB_ENST00000377854.5_Intron|ACACB_ENST00000377848.3_Missense_Mutation_p.I1188F			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1188					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GATCATGTTGATCGTAAGCAG	0.547																																						dbGAP											0													53.0	43.0	46.0					12																	109654723		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3562A>T	12.37:g.109654723A>T	ENSP00000341044:p.Ile1188Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.I1188F	ENST00000338432.7	37	c.3562	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	A	23.6	4.429797	0.83776	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000390027	T;T	0.48836	0.8;0.8	5.33	5.33	0.75918	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.61763	0.2373	M	0.85710	2.77	0.80722	D	1	B	0.31730	0.337	B	0.41036	0.346	T	0.67405	-0.5679	10	0.87932	D	0	.	15.3452	0.74330	1.0:0.0:0.0:0.0	.	1188	O00763	ACACB_HUMAN	F	1188;1188;419	ENSP00000341044:I1188F;ENSP00000367079:I1188F	ENSP00000341044:I1188F	I	+	1	0	ACACB	108139106	1.000000	0.71417	0.959000	0.39883	0.696000	0.40369	9.233000	0.95337	2.165000	0.68154	0.529000	0.55759	ATC	ACACB	-	pfam_AcCoA_COase_cen	ENSG00000076555		0.547	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	80	0.00	0	A	NM_001093		109654723	109654723	+1	no_errors	ENST00000338432	ensembl	human	known	69_37n	missense	33	52.17	36	SNP	1.000	T
ACACB	32	genome.wustl.edu	37	12	109654723	109654723	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr12:109654723A>T	ENST00000338432.7	+	24	3681	c.3562A>T	c.(3562-3564)Atc>Ttc	p.I1188F	ACACB_ENST00000377854.5_Intron|ACACB_ENST00000377848.3_Missense_Mutation_p.I1188F			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1188					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GATCATGTTGATCGTAAGCAG	0.547																																						dbGAP											0													53.0	43.0	46.0					12																	109654723		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3562A>T	12.37:g.109654723A>T	ENSP00000341044:p.Ile1188Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.I1188F	ENST00000338432.7	37	c.3562	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	A	23.6	4.429797	0.83776	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000390027	T;T	0.48836	0.8;0.8	5.33	5.33	0.75918	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.61763	0.2373	M	0.85710	2.77	0.80722	D	1	B	0.31730	0.337	B	0.41036	0.346	T	0.67405	-0.5679	10	0.87932	D	0	.	15.3452	0.74330	1.0:0.0:0.0:0.0	.	1188	O00763	ACACB_HUMAN	F	1188;1188;419	ENSP00000341044:I1188F;ENSP00000367079:I1188F	ENSP00000341044:I1188F	I	+	1	0	ACACB	108139106	1.000000	0.71417	0.959000	0.39883	0.696000	0.40369	9.233000	0.95337	2.165000	0.68154	0.529000	0.55759	ATC	ACACB	-	pfam_AcCoA_COase_cen	ENSG00000076555		0.547	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	96	0.00	0	A	NM_001093		109654723	109654723	+1	no_errors	ENST00000338432	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	1.000	T
ADCY5	111	genome.wustl.edu	37	3	123021902	123021902	+	Splice_Site	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr3:123021902C>A	ENST00000462833.1	-	14	3936	c.2724G>T	c.(2722-2724)gaG>gaT	p.E908D	ADCY5_ENST00000309879.5_Splice_Site_p.E558D|ADCY5_ENST00000491190.1_Splice_Site_p.E541D	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	908					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CACCCAGTACCTCGGGGAAGT	0.632																																						dbGAP											0													45.0	42.0	43.0					3																	123021902		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2724+1G>T	3.37:g.123021902C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E908D	ENST00000462833.1	37	c.2724	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.121137	0.94385	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	T;D;D;T	0.81908	-1.11;-1.55;-1.53;-1.42	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.83954	0.5366	M	0.75777	2.31	0.80722	D	1	B;P	0.35527	0.126;0.507	B;B	0.37144	0.086;0.242	T	0.83253	-0.0052	9	.	.	.	.	18.5817	0.91174	0.0:1.0:0.0:0.0	.	908;541	O95622;B3KWA8	ADCY5_HUMAN;.	D	908;541;558;467	ENSP00000419361:E908D;ENSP00000418537:E541D;ENSP00000308685:E558D;ENSP00000420082:E467D	.	E	-	3	2	ADCY5	124504592	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.549000	0.82163	2.619000	0.88677	0.561000	0.74099	GAG	ADCY5	-	NULL	ENSG00000173175		0.632	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	45	0.00	0	C	XM_171048	Missense_Mutation	123021902	123021902	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	missense	54	19.40	13	SNP	1.000	A
ADCY5	111	genome.wustl.edu	37	3	123021902	123021902	+	Splice_Site	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr3:123021902C>A	ENST00000462833.1	-	14	3936	c.2724G>T	c.(2722-2724)gaG>gaT	p.E908D	ADCY5_ENST00000309879.5_Splice_Site_p.E558D|ADCY5_ENST00000491190.1_Splice_Site_p.E541D	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	908					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CACCCAGTACCTCGGGGAAGT	0.632																																						dbGAP											0													45.0	42.0	43.0					3																	123021902		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2724+1G>T	3.37:g.123021902C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E908D	ENST00000462833.1	37	c.2724	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.121137	0.94385	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	T;D;D;T	0.81908	-1.11;-1.55;-1.53;-1.42	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.83954	0.5366	M	0.75777	2.31	0.80722	D	1	B;P	0.35527	0.126;0.507	B;B	0.37144	0.086;0.242	T	0.83253	-0.0052	9	.	.	.	.	18.5817	0.91174	0.0:1.0:0.0:0.0	.	908;541	O95622;B3KWA8	ADCY5_HUMAN;.	D	908;541;558;467	ENSP00000419361:E908D;ENSP00000418537:E541D;ENSP00000308685:E558D;ENSP00000420082:E467D	.	E	-	3	2	ADCY5	124504592	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.549000	0.82163	2.619000	0.88677	0.561000	0.74099	GAG	ADCY5	-	NULL	ENSG00000173175		0.632	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	71	0.00	0	C	XM_171048	Missense_Mutation	123021902	123021902	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	1.000	A
AFF4	27125	genome.wustl.edu	37	5	132228002	132228002	+	Missense_Mutation	SNP	G	G	C	rs374444704		TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr5:132228002G>C	ENST00000265343.5	-	13	2870	c.2491C>G	c.(2491-2493)Cgg>Ggg	p.R831G	AFF4_ENST00000378595.3_Missense_Mutation_p.R831G	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	831					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTCCTCTTCCGAGAGCCATGC	0.468																																					Ovarian(126;889 1733 2942 10745 11605)	dbGAP											0													142.0	139.0	140.0					5																	132228002		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2491C>G	5.37:g.132228002G>C	ENSP00000265343:p.Arg831Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.R831G	ENST00000265343.5	37	c.2491	CCDS4164.1	5	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232793	0.58777	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.66638	-0.22;-0.22	5.8	1.43	0.22495	.	0.000000	0.85682	D	0.000000	T	0.78233	0.4251	M	0.66939	2.045	0.47659	D	0.999488	D;P	0.71674	0.998;0.895	D;P	0.80764	0.994;0.65	T	0.76421	-0.2965	10	0.29301	T	0.29	-8.9034	16.8377	0.85961	0.0:0.0:0.4696:0.5304	.	831;831	Q9UHB7-2;Q9UHB7	.;AFF4_HUMAN	G	831	ENSP00000265343:R831G;ENSP00000367858:R831G	ENSP00000265343:R831G	R	-	1	2	AFF4	132255901	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.377000	0.52425	0.336000	0.23639	-1.364000	0.01208	CGG	AFF4	-	pfam_TF_AF4/FMR2	ENSG00000072364		0.468	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF4	HGNC	protein_coding	OTTHUMT00000133049.1	263	0.00	0	G	NM_014423		132228002	132228002	-1	no_errors	ENST00000265343	ensembl	human	known	69_37n	missense	111	50.88	115	SNP	0.998	C
AFF4	27125	genome.wustl.edu	37	5	132228002	132228002	+	Missense_Mutation	SNP	G	G	C	rs374444704		TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr5:132228002G>C	ENST00000265343.5	-	13	2870	c.2491C>G	c.(2491-2493)Cgg>Ggg	p.R831G	AFF4_ENST00000378595.3_Missense_Mutation_p.R831G	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	831					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTCCTCTTCCGAGAGCCATGC	0.468																																					Ovarian(126;889 1733 2942 10745 11605)	dbGAP											0													142.0	139.0	140.0					5																	132228002		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2491C>G	5.37:g.132228002G>C	ENSP00000265343:p.Arg831Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.R831G	ENST00000265343.5	37	c.2491	CCDS4164.1	5	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232793	0.58777	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.66638	-0.22;-0.22	5.8	1.43	0.22495	.	0.000000	0.85682	D	0.000000	T	0.78233	0.4251	M	0.66939	2.045	0.47659	D	0.999488	D;P	0.71674	0.998;0.895	D;P	0.80764	0.994;0.65	T	0.76421	-0.2965	10	0.29301	T	0.29	-8.9034	16.8377	0.85961	0.0:0.0:0.4696:0.5304	.	831;831	Q9UHB7-2;Q9UHB7	.;AFF4_HUMAN	G	831	ENSP00000265343:R831G;ENSP00000367858:R831G	ENSP00000265343:R831G	R	-	1	2	AFF4	132255901	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.377000	0.52425	0.336000	0.23639	-1.364000	0.01208	CGG	AFF4	-	pfam_TF_AF4/FMR2	ENSG00000072364		0.468	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF4	HGNC	protein_coding	OTTHUMT00000133049.1	54	0.00	0	G	NM_014423		132228002	132228002	-1	no_errors	ENST00000265343	ensembl	human	known	69_37n	missense	31	46.55	27	SNP	0.998	C
CNNM3	26505	genome.wustl.edu	37	2	97490563	97490563	+	Intron	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:97490563C>T	ENST00000305510.3	+	2	1253				ANKRD23_ENST00000476975.1_5'UTR|CNNM3_ENST00000377060.3_Intron	NM_017623.4	NP_060093.3	Q8NE01	CNNM3_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 3						ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)|skin(1)|urinary_tract(2)	13						gggccttgtgcagatgggcat	0.517																																						dbGAP											0													41.0	34.0	36.0					2																	97490563		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF216965	CCDS2025.1, CCDS2026.1	2q11.2	2014-08-08	2014-08-07		ENSG00000168763	ENSG00000168763			104	protein-coding gene	gene with protein product		607804	"""cyclin M3"""	ACDP3		21393841, 24632616	Standard	XM_005263917		Approved		uc002swy.3	Q8NE01	OTTHUMG00000130531	ENST00000305510.3:c.1226-232C>T	2.37:g.97490563C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX67|Q8TBV4|Q96IW4|Q9NRK4|Q9NXW6	RNA	SNP	-	NULL	ENST00000305510.3	37	NULL	CCDS2025.1	2																																																																																			ANKRD23	-	-	ENSG00000163126		0.517	CNNM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD23	HGNC	protein_coding	OTTHUMT00000252952.2	83	0.00	0	C	NM_017623		97490563	97490563	-1	no_errors	ENST00000476975	ensembl	human	known	69_37n	rna	62	10.14	7	SNP	0.000	T
ANKRD30BP2	149992	genome.wustl.edu	37	21	14418421	14418421	+	RNA	SNP	G	G	A	rs201867271		TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr21:14418421G>A	ENST00000507941.1	+	0	1033				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		AGCCTTGGTCGTGATTTACAA	0.363																																						dbGAP											0																																										-	-	-			0			AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14418421G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309		0.363	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	HGNC	pseudogene	OTTHUMT00000372094.1	9	0.00	0	G	NR_026916		14418421	14418421	+1	no_errors	ENST00000507941	ensembl	human	known	69_37n	rna	1	66.67	2	SNP	0.000	A
AOC3	8639	genome.wustl.edu	37	17	41004004	41004004	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr17:41004004C>T	ENST00000308423.2	+	1	804	c.644C>T	c.(643-645)cCc>cTc	p.P215L	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	215					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	ACCACGGCTCCCCGTGGTCTG	0.597																																					NSCLC(3;192 220 10664 11501 16477)	dbGAP											0													24.0	25.0	25.0					17																	41004004		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.644C>T	17.37:g.41004004C>T	ENSP00000312326:p.Pro215Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.P215L	ENST00000308423.2	37	c.644	CCDS11444.1	17	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067031	0.55539	.	.	ENSG00000131471	ENST00000308423	T	0.60920	0.15	4.55	4.55	0.56014	Copper amine oxidase, N3-terminal (1);Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (1);	0.195346	0.44688	N	0.000425	T	0.77935	0.4205	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80367	-0.1412	10	0.48119	T	0.1	.	17.4801	0.87670	0.0:1.0:0.0:0.0	.	215	Q16853	AOC3_HUMAN	L	215	ENSP00000312326:P215L	ENSP00000312326:P215L	P	+	2	0	AOC3	38257530	1.000000	0.71417	0.766000	0.31476	0.447000	0.32167	5.784000	0.68990	2.361000	0.80049	0.491000	0.48974	CCC	AOC3	-	pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	ENSG00000131471		0.597	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	HGNC	protein_coding	OTTHUMT00000452444.1	26	0.00	0	C	NM_003734		41004004	41004004	+1	no_errors	ENST00000308423	ensembl	human	known	69_37n	missense	86	11.34	11	SNP	0.999	T
AP5B1	91056	genome.wustl.edu	37	11	65546850	65546850	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr11:65546850C>T	ENST00000532090.2	-	2	1324	c.1114G>A	c.(1114-1116)Gtc>Atc	p.V372I		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	372	Leu-rich.				endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						AAGCTCAGGACGCAGTGAAGG	0.647																																						dbGAP											0													15.0	19.0	18.0					11																	65546850		2121	4234	6355	-	-	-	SO:0001583	missense	0			JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.1114G>A	11.37:g.65546850C>T	ENSP00000454303:p.Val372Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	NULL	p.V372I	ENST00000532090.2	37	c.1114	CCDS58146.1	11																																																																																			AP5B1	-	NULL	ENSG00000254470		0.647	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AP5B1	HGNC	protein_coding	OTTHUMT00000390636.2	89	0.00	0	C	NM_138368		65546850	65546850	-1	no_errors	ENST00000532090	ensembl	human	novel	69_37n	missense	62	18.42	14	SNP	1.000	T
APBB1IP	54518	genome.wustl.edu	37	10	26781288	26781288	+	Missense_Mutation	SNP	G	G	A	rs146489691		TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:26781288G>A	ENST00000376236.4	+	3	488	c.33G>A	c.(31-33)atG>atA	p.M11I	APBB1IP_ENST00000356785.4_Missense_Mutation_p.M11I	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	11					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						TAGACCAAATGTTCAGCACTT	0.388													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19830	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													157.0	146.0	150.0					10																	26781288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.33G>A	10.37:g.26781288G>A	ENSP00000365411:p.Met11Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.M11I	ENST00000376236.4	37	c.33	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	G	18.25	3.581436	0.65992	.	.	ENSG00000077420	ENST00000445780;ENST00000376236;ENST00000356785	T	0.60040	0.22	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.75882	0.3910	M	0.71036	2.16	0.54753	D	0.999985	P;D;D	0.71674	0.949;0.993;0.998	D;D;D	0.78314	0.914;0.968;0.991	T	0.77459	-0.2580	10	0.72032	D	0.01	.	17.9328	0.89004	0.0:0.0:1.0:0.0	.	11;11;11	B4E100;Q7Z5R6;Q8IYL7	.;AB1IP_HUMAN;.	I	11	ENSP00000365411:M11I	ENSP00000349237:M11I	M	+	3	0	APBB1IP	26821294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.009000	0.76347	2.745000	0.94114	0.491000	0.48974	ATG	APBB1IP	-	NULL	ENSG00000077420		0.388	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	234	0.43	1	G	NM_019043		26781288	26781288	+1	no_errors	ENST00000376236	ensembl	human	known	69_37n	missense	202	50.85	209	SNP	1.000	A
APBB1IP	54518	genome.wustl.edu	37	10	26781288	26781288	+	Missense_Mutation	SNP	G	G	A	rs146489691		TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr10:26781288G>A	ENST00000376236.4	+	3	488	c.33G>A	c.(31-33)atG>atA	p.M11I	APBB1IP_ENST00000356785.4_Missense_Mutation_p.M11I	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	11					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						TAGACCAAATGTTCAGCACTT	0.388													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19830	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													157.0	146.0	150.0					10																	26781288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.33G>A	10.37:g.26781288G>A	ENSP00000365411:p.Met11Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.M11I	ENST00000376236.4	37	c.33	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	G	18.25	3.581436	0.65992	.	.	ENSG00000077420	ENST00000445780;ENST00000376236;ENST00000356785	T	0.60040	0.22	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.75882	0.3910	M	0.71036	2.16	0.54753	D	0.999985	P;D;D	0.71674	0.949;0.993;0.998	D;D;D	0.78314	0.914;0.968;0.991	T	0.77459	-0.2580	10	0.72032	D	0.01	.	17.9328	0.89004	0.0:0.0:1.0:0.0	.	11;11;11	B4E100;Q7Z5R6;Q8IYL7	.;AB1IP_HUMAN;.	I	11	ENSP00000365411:M11I	ENSP00000349237:M11I	M	+	3	0	APBB1IP	26821294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.009000	0.76347	2.745000	0.94114	0.491000	0.48974	ATG	APBB1IP	-	NULL	ENSG00000077420		0.388	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	67	0.00	0	G	NM_019043		26781288	26781288	+1	no_errors	ENST00000376236	ensembl	human	known	69_37n	missense	36	50.68	37	SNP	1.000	A
ARFGAP1	55738	genome.wustl.edu	37	20	61907987	61907987	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr20:61907987C>A	ENST00000370283.4	+	4	466	c.326C>A	c.(325-327)gCc>gAc	p.A109D	ARFGAP1_ENST00000353546.3_Missense_Mutation_p.A109D|ARFGAP1_ENST00000519604.1_Missense_Mutation_p.A56D|ARFGAP1_ENST00000519273.2_Missense_Mutation_p.P30T|ARFGAP1_ENST00000370275.4_Missense_Mutation_p.A109D|ARFGAP1_ENST00000547204.1_Missense_Mutation_p.A35D	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	109	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AGAGCCGCGGCCCTCTTTAGG	0.557																																						dbGAP											0													59.0	53.0	55.0					20																	61907987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.326C>A	20.37:g.61907987C>A	ENSP00000359306:p.Ala109Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Missense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.A109D	ENST00000370283.4	37	c.326	CCDS13515.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.951618|3.951618	0.73787|0.73787	.|.	.|.	ENSG00000101199|ENSG00000101199	ENST00000370283;ENST00000547204;ENST00000549047;ENST00000519604;ENST00000370275;ENST00000518601;ENST00000353546;ENST00000522403;ENST00000550188|ENST00000519273	T;T;T;T;T;T;T;T;T|T	0.58506|0.39229	0.95;0.33;0.44;0.95;0.95;0.38;0.95;0.95;0.95|1.09	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.43277|0.43277	0.1240|0.1240	M|M	0.78285|0.78285	2.405|2.405	0.46927|0.46927	D|D	0.999251|0.999251	D;D;D;P|B	0.89917|0.32467	1.0;1.0;0.999;0.858|0.372	D;D;D;P|B	0.91635|0.27796	0.999;0.999;0.988;0.58|0.083	T|T	0.45396|0.45396	-0.9264|-0.9264	10|9	0.44086|0.11485	T|T	0.13|0.65	-24.7309|-24.7309	18.117|18.117	0.89559|0.89559	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	56;109;109;109|30	E7EV62;B7ZBI2;Q8N6T3;Q8N6T3-2|B7Z8H8	.;.;ARFG1_HUMAN;.|.	D|T	109;35;35;56;109;35;109;109;109|30	ENSP00000359306:A109D;ENSP00000449800:A35D;ENSP00000447037:A35D;ENSP00000430500:A56D;ENSP00000359298:A109D;ENSP00000429674:A35D;ENSP00000314615:A109D;ENSP00000430929:A109D;ENSP00000449515:A109D|ENSP00000443716:P30T	ENSP00000314615:A109D|ENSP00000443716:P30T	A|P	+|+	2|1	0|0	ARFGAP1|ARFGAP1	61378432|61378432	1.000000|1.000000	0.71417|0.71417	0.628000|0.628000	0.29241|0.29241	0.575000|0.575000	0.36095|0.36095	7.347000|7.347000	0.79356|0.79356	2.345000|2.345000	0.79718|0.79718	0.563000|0.563000	0.77884|0.77884	GCC|CCC	ARFGAP1	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP	ENSG00000101199		0.557	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP1	HGNC	protein_coding	OTTHUMT00000080134.3	114	0.00	0	C	NM_018209		61907987	61907987	+1	no_errors	ENST00000353546	ensembl	human	known	69_37n	missense	149	30.59	67	SNP	1.000	A
ARFGAP1	55738	genome.wustl.edu	37	20	61907987	61907987	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr20:61907987C>A	ENST00000370283.4	+	4	466	c.326C>A	c.(325-327)gCc>gAc	p.A109D	ARFGAP1_ENST00000353546.3_Missense_Mutation_p.A109D|ARFGAP1_ENST00000519604.1_Missense_Mutation_p.A56D|ARFGAP1_ENST00000519273.2_Missense_Mutation_p.P30T|ARFGAP1_ENST00000370275.4_Missense_Mutation_p.A109D|ARFGAP1_ENST00000547204.1_Missense_Mutation_p.A35D	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	109	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AGAGCCGCGGCCCTCTTTAGG	0.557																																						dbGAP											0													59.0	53.0	55.0					20																	61907987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.326C>A	20.37:g.61907987C>A	ENSP00000359306:p.Ala109Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Missense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.A109D	ENST00000370283.4	37	c.326	CCDS13515.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.951618|3.951618	0.73787|0.73787	.|.	.|.	ENSG00000101199|ENSG00000101199	ENST00000370283;ENST00000547204;ENST00000549047;ENST00000519604;ENST00000370275;ENST00000518601;ENST00000353546;ENST00000522403;ENST00000550188|ENST00000519273	T;T;T;T;T;T;T;T;T|T	0.58506|0.39229	0.95;0.33;0.44;0.95;0.95;0.38;0.95;0.95;0.95|1.09	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.43277|0.43277	0.1240|0.1240	M|M	0.78285|0.78285	2.405|2.405	0.46927|0.46927	D|D	0.999251|0.999251	D;D;D;P|B	0.89917|0.32467	1.0;1.0;0.999;0.858|0.372	D;D;D;P|B	0.91635|0.27796	0.999;0.999;0.988;0.58|0.083	T|T	0.45396|0.45396	-0.9264|-0.9264	10|9	0.44086|0.11485	T|T	0.13|0.65	-24.7309|-24.7309	18.117|18.117	0.89559|0.89559	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	56;109;109;109|30	E7EV62;B7ZBI2;Q8N6T3;Q8N6T3-2|B7Z8H8	.;.;ARFG1_HUMAN;.|.	D|T	109;35;35;56;109;35;109;109;109|30	ENSP00000359306:A109D;ENSP00000449800:A35D;ENSP00000447037:A35D;ENSP00000430500:A56D;ENSP00000359298:A109D;ENSP00000429674:A35D;ENSP00000314615:A109D;ENSP00000430929:A109D;ENSP00000449515:A109D|ENSP00000443716:P30T	ENSP00000314615:A109D|ENSP00000443716:P30T	A|P	+|+	2|1	0|0	ARFGAP1|ARFGAP1	61378432|61378432	1.000000|1.000000	0.71417|0.71417	0.628000|0.628000	0.29241|0.29241	0.575000|0.575000	0.36095|0.36095	7.347000|7.347000	0.79356|0.79356	2.345000|2.345000	0.79718|0.79718	0.563000|0.563000	0.77884|0.77884	GCC|CCC	ARFGAP1	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP	ENSG00000101199		0.557	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP1	HGNC	protein_coding	OTTHUMT00000080134.3	53	0.00	0	C	NM_018209		61907987	61907987	+1	no_errors	ENST00000353546	ensembl	human	known	69_37n	missense	32	37.25	19	SNP	1.000	A
ARHGAP11A	9824	genome.wustl.edu	37	15	32929244	32929244	+	Missense_Mutation	SNP	A	A	G	rs189559276		TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr15:32929244A>G	ENST00000361627.3	+	12	2992	c.2270A>G	c.(2269-2271)gAc>gGc	p.D757G	ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.D568G|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.D568G	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	757					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		CATAGCAAGGACGAGGCTAGA	0.388													A|||	1	0.000199681	0.0	0.0	5008	,	,		20126	0.001		0.0	False		,,,				2504	0.0				Colon(45;757 1134 30003 36652)	dbGAP											0													81.0	76.0	78.0					15																	32929244		2201	4300	6501	-	-	-	SO:0001583	missense	0			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2270A>G	15.37:g.32929244A>G	ENSP00000355090:p.Asp757Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.D757G	ENST00000361627.3	37	c.2270	CCDS10028.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	0.351	-0.945006	0.02304	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.09630	2.96	5.01	-2.18	0.07037	.	0.673401	0.14084	N	0.342491	T	0.06735	0.0172	L	0.50333	1.59	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.39603	-0.9606	10	0.18710	T	0.47	.	0.579	0.00709	0.3769:0.1198:0.2456:0.2577	.	757	Q6P4F7	RHGBA_HUMAN	G	757;568	ENSP00000355090:D757G	ENSP00000355090:D757G	D	+	2	0	ARHGAP11A	30716536	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.153000	0.10144	-0.171000	0.10797	0.528000	0.53228	GAC	ARHGAP11A	-	NULL	ENSG00000198826		0.388	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11A	HGNC	protein_coding	OTTHUMT00000251417.1	56	0.00	0	A	NM_014783		32929244	32929244	+1	no_errors	ENST00000361627	ensembl	human	known	69_37n	missense	27	48.08	25	SNP	0.000	G
ATF3	467	genome.wustl.edu	37	1	212791561	212791561	+	Silent	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:212791561G>A	ENST00000341491.4	+	3	598	c.333G>A	c.(331-333)acG>acA	p.T111T	ATF3_ENST00000366983.1_Silent_p.T111T|ATF3_ENST00000492118.1_Intron|RN7SL512P_ENST00000578962.1_RNA|ATF3_ENST00000366985.1_Silent_p.T54T|ATF3_ENST00000336937.4_Silent_p.T82T|ATF3_ENST00000366987.2_Silent_p.T111T	NM_001040619.2|NM_001206488.2|NM_001674.3	NP_001035709.1|NP_001193417.2|NP_001665.1	P18847	ATF3_HUMAN	activating transcription factor 3	111	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gluconeogenesis (GO:0006094)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)	Pseudoephedrine(DB00852)	AGGAGAAGACGGAGTGCCTGC	0.468																																						dbGAP											0													176.0	166.0	169.0					1																	212791561		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L19871	CCDS1506.1, CCDS41464.1, CCDS55688.1, CCDS58059.1	1q32.3	2013-01-10			ENSG00000162772	ENSG00000162772		"""basic leucine zipper proteins"""	785	protein-coding gene	gene with protein product		603148				7515060	Standard	NM_001674		Approved		uc021pit.1	P18847	OTTHUMG00000036747	ENST00000341491.4:c.333G>A	1.37:g.212791561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTZ2|Q6ICQ9|Q7Z566|Q8WYM6	Silent	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.T111	ENST00000341491.4	37	c.333	CCDS1506.1	1																																																																																			ATF3	-	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	ENSG00000162772		0.468	ATF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF3	HGNC	protein_coding	OTTHUMT00000089296.1	254	0.39	1	G	NM_001674		212791561	212791561	+1	no_errors	ENST00000341491	ensembl	human	known	69_37n	silent	174	45.62	146	SNP	0.349	A
ATF3	467	genome.wustl.edu	37	1	212791561	212791561	+	Silent	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:212791561G>A	ENST00000341491.4	+	3	598	c.333G>A	c.(331-333)acG>acA	p.T111T	ATF3_ENST00000366983.1_Silent_p.T111T|ATF3_ENST00000492118.1_Intron|RN7SL512P_ENST00000578962.1_RNA|ATF3_ENST00000366985.1_Silent_p.T54T|ATF3_ENST00000336937.4_Silent_p.T82T|ATF3_ENST00000366987.2_Silent_p.T111T	NM_001040619.2|NM_001206488.2|NM_001674.3	NP_001035709.1|NP_001193417.2|NP_001665.1	P18847	ATF3_HUMAN	activating transcription factor 3	111	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gluconeogenesis (GO:0006094)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)	Pseudoephedrine(DB00852)	AGGAGAAGACGGAGTGCCTGC	0.468																																						dbGAP											0													176.0	166.0	169.0					1																	212791561		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L19871	CCDS1506.1, CCDS41464.1, CCDS55688.1, CCDS58059.1	1q32.3	2013-01-10			ENSG00000162772	ENSG00000162772		"""basic leucine zipper proteins"""	785	protein-coding gene	gene with protein product		603148				7515060	Standard	NM_001674		Approved		uc021pit.1	P18847	OTTHUMG00000036747	ENST00000341491.4:c.333G>A	1.37:g.212791561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTZ2|Q6ICQ9|Q7Z566|Q8WYM6	Silent	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.T111	ENST00000341491.4	37	c.333	CCDS1506.1	1																																																																																			ATF3	-	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	ENSG00000162772		0.468	ATF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF3	HGNC	protein_coding	OTTHUMT00000089296.1	34	0.00	0	G	NM_001674		212791561	212791561	+1	no_errors	ENST00000341491	ensembl	human	known	69_37n	silent	10	33.33	5	SNP	0.349	A
ARID4B	51742	genome.wustl.edu	37	1	235345422	235345422	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:235345422T>G	ENST00000264183.3	-	20	3309	c.2812A>C	c.(2812-2814)Aaa>Caa	p.K938Q	ARID4B_ENST00000349213.3_Missense_Mutation_p.K852Q|ARID4B_ENST00000494543.1_5'Flank|ARID4B_ENST00000366603.2_Missense_Mutation_p.K938Q	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	938					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTCAGCGTTTTTTTAGGCCAC	0.473																																						dbGAP											0													62.0	66.0	65.0					1																	235345422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2812A>C	1.37:g.235345422T>G	ENSP00000264183:p.Lys938Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.K938Q	ENST00000264183.3	37	c.2812	CCDS31061.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.18|12.18	1.860493|1.860493	0.32884|0.32884	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|T;T;T	.|0.27557	.|1.66;1.7;1.7	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.045500|0.045500	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.41511|0.41511	0.1162|0.1162	N|N	0.24115|0.24115	0.695|0.695	0.53688|0.53688	D|D	0.999979|0.999979	.|D;D;D;D	.|0.89917	.|1.0;0.996;0.996;0.993	.|D;D;D;D	.|0.83275	.|0.996;0.99;0.981;0.977	T|T	0.30851|0.30851	-0.9964|-0.9964	7|10	0.44086|0.44086	T|T	0.13|0.13	-22.5427|-22.5427	15.0537|15.0537	0.71894|0.71894	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|619;938;852;938	.|Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39	.|.;.;.;ARI4B_HUMAN	N|Q	337|938;852;938;938	.|ENSP00000264184:K852Q;ENSP00000355562:K938Q;ENSP00000264183:K938Q	ENSP00000416063:K337N|ENSP00000264183:K938Q	K|K	-|-	3|1	2|0	ARID4B|ARID4B	233412045|233412045	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.231000|0.231000	0.25187|0.25187	5.777000|5.777000	0.68931|0.68931	2.144000|2.144000	0.66660|0.66660	0.477000|0.477000	0.44152|0.44152	AAA|AAA	ARID4B	-	NULL	ENSG00000054267		0.473	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	70	0.00	0	T	NM_016374		235345422	235345422	-1	no_errors	ENST00000264183	ensembl	human	known	69_37n	missense	74	43.08	56	SNP	1.000	G
ARID4B	51742	genome.wustl.edu	37	1	235345422	235345422	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:235345422T>G	ENST00000264183.3	-	20	3309	c.2812A>C	c.(2812-2814)Aaa>Caa	p.K938Q	ARID4B_ENST00000349213.3_Missense_Mutation_p.K852Q|ARID4B_ENST00000494543.1_5'Flank|ARID4B_ENST00000366603.2_Missense_Mutation_p.K938Q	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	938					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTCAGCGTTTTTTTAGGCCAC	0.473																																						dbGAP											0													62.0	66.0	65.0					1																	235345422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2812A>C	1.37:g.235345422T>G	ENSP00000264183:p.Lys938Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.K938Q	ENST00000264183.3	37	c.2812	CCDS31061.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.18|12.18	1.860493|1.860493	0.32884|0.32884	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|T;T;T	.|0.27557	.|1.66;1.7;1.7	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.045500|0.045500	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.41511|0.41511	0.1162|0.1162	N|N	0.24115|0.24115	0.695|0.695	0.53688|0.53688	D|D	0.999979|0.999979	.|D;D;D;D	.|0.89917	.|1.0;0.996;0.996;0.993	.|D;D;D;D	.|0.83275	.|0.996;0.99;0.981;0.977	T|T	0.30851|0.30851	-0.9964|-0.9964	7|10	0.44086|0.44086	T|T	0.13|0.13	-22.5427|-22.5427	15.0537|15.0537	0.71894|0.71894	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|619;938;852;938	.|Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39	.|.;.;.;ARI4B_HUMAN	N|Q	337|938;852;938;938	.|ENSP00000264184:K852Q;ENSP00000355562:K938Q;ENSP00000264183:K938Q	ENSP00000416063:K337N|ENSP00000264183:K938Q	K|K	-|-	3|1	2|0	ARID4B|ARID4B	233412045|233412045	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.231000|0.231000	0.25187|0.25187	5.777000|5.777000	0.68931|0.68931	2.144000|2.144000	0.66660|0.66660	0.477000|0.477000	0.44152|0.44152	AAA|AAA	ARID4B	-	NULL	ENSG00000054267		0.473	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	63	0.00	0	T	NM_016374		235345422	235345422	-1	no_errors	ENST00000264183	ensembl	human	known	69_37n	missense	56	45.63	47	SNP	1.000	G
ATP6V0A1	535	genome.wustl.edu	37	17	40629720	40629720	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr17:40629720G>A	ENST00000343619.4	+	6	589	c.466G>A	c.(466-468)Gag>Aag	p.E156K	ATP6V0A1_ENST00000544137.1_Intron|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.E113K|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.E156K|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.E163K|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.E113K|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.E156K	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	156					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		ATCCCTCTTGGAGCCAAGTGA	0.438																																						dbGAP											0													158.0	132.0	141.0					17																	40629720		2203	4300	6503	-	-	-	SO:0001583	missense	0			U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.466G>A	17.37:g.40629720G>A	ENSP00000342951:p.Glu156Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	pfam_ATPase_V0/A0_a	p.E163K	ENST00000343619.4	37	c.487	CCDS45684.1	17	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191897	0.78902	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	6.03	6.03	0.97812	.	0.274240	0.42053	D	0.000773	D	0.86053	0.5841	M	0.64567	1.98	0.80722	D	1	B;B;B;P;B	0.37207	0.25;0.254;0.008;0.587;0.234	B;B;B;B;B	0.38985	0.077;0.201;0.01;0.287;0.182	D	0.84626	0.0687	10	0.45353	T	0.12	-5.6551	20.5752	0.99366	0.0:0.0:1.0:0.0	.	113;113;163;156;156	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	K	156;156;156;163;113	ENSP00000342951:E156K;ENSP00000444676:E156K;ENSP00000377415:E156K;ENSP00000264649:E163K;ENSP00000443991:E113K	ENSP00000264649:E163K	E	+	1	0	ATP6V0A1	37883246	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.820000	0.99359	2.868000	0.98415	0.557000	0.71058	GAG	ATP6V0A1	-	pfam_ATPase_V0/A0_a	ENSG00000033627		0.438	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP6V0A1	HGNC	protein_coding	OTTHUMT00000450364.1	40	0.00	0	G	NM_001130020		40629720	40629720	+1	no_errors	ENST00000264649	ensembl	human	known	69_37n	missense	83	12.63	12	SNP	1.000	A
DQX1	165545	genome.wustl.edu	37	2	74756062	74756062	+	5'Flank	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:74756062G>A	ENST00000404568.3	-	0	0				HTRA2_ENST00000352222.3_5'Flank|DQX1_ENST00000393951.2_5'Flank|AUP1_ENST00000377526.3_Splice_Site_p.P114S|HTRA2_ENST00000258080.3_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TTGAGTAGAGGCTGGGAACCA	0.493																																						dbGAP											0													34.0	34.0	34.0					2																	74756062		1842	4088	5930	-	-	-	SO:0001631	upstream_gene_variant	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74756062G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_CUE,smart_CUE,pfscan_CUE	p.P114S	ENST00000404568.3	37	c.340	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	G	33	5.196264	0.94960	.	.	ENSG00000115307	ENST00000377526;ENST00000258081;ENST00000412627	D	0.94232	-3.38	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.95436	0.8518	L	0.49778	1.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	D	0.95679	0.8730	10	0.87932	D	0	-10.9997	16.0852	0.81042	0.0:0.0:1.0:0.0	.	171;180;114	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	S	114;178;116	ENSP00000366748:P114S	ENSP00000258081:P178S	P	-	1	0	AUP1	74609570	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.706000	0.84615	2.669000	0.90835	0.561000	0.74099	CCT	AUP1	-	NULL	ENSG00000115307		0.493	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUP1	HGNC	protein_coding	OTTHUMT00000252230.3	59	0.00	0	G	NM_133637		74756062	74756062	-1	no_errors	ENST00000377526	ensembl	human	known	69_37n	missense	91	27.78	35	SNP	1.000	A
DQX1	165545	genome.wustl.edu	37	2	74756062	74756062	+	5'Flank	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:74756062G>A	ENST00000404568.3	-	0	0				HTRA2_ENST00000352222.3_5'Flank|DQX1_ENST00000393951.2_5'Flank|AUP1_ENST00000377526.3_Splice_Site_p.P114S|HTRA2_ENST00000258080.3_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TTGAGTAGAGGCTGGGAACCA	0.493																																						dbGAP											0													34.0	34.0	34.0					2																	74756062		1842	4088	5930	-	-	-	SO:0001631	upstream_gene_variant	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74756062G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_CUE,smart_CUE,pfscan_CUE	p.P114S	ENST00000404568.3	37	c.340	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	G	33	5.196264	0.94960	.	.	ENSG00000115307	ENST00000377526;ENST00000258081;ENST00000412627	D	0.94232	-3.38	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.95436	0.8518	L	0.49778	1.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	D	0.95679	0.8730	10	0.87932	D	0	-10.9997	16.0852	0.81042	0.0:0.0:1.0:0.0	.	171;180;114	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	S	114;178;116	ENSP00000366748:P114S	ENSP00000258081:P178S	P	-	1	0	AUP1	74609570	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.706000	0.84615	2.669000	0.90835	0.561000	0.74099	CCT	AUP1	-	NULL	ENSG00000115307		0.493	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUP1	HGNC	protein_coding	OTTHUMT00000252230.3	45	0.00	0	G	NM_133637		74756062	74756062	-1	no_errors	ENST00000377526	ensembl	human	known	69_37n	missense	18	43.75	14	SNP	1.000	A
BAI2	576	genome.wustl.edu	37	1	32203298	32203298	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:32203298C>G	ENST00000373658.3	-	19	3172	c.2831G>C	c.(2830-2832)tGc>tCc	p.C944S	BAI2_ENST00000398556.3_Missense_Mutation_p.C892S|BAI2_ENST00000398547.1_Missense_Mutation_p.C877S|BAI2_ENST00000465256.1_5'Flank|BAI2_ENST00000373655.2_Missense_Mutation_p.C944S|BAI2_ENST00000257070.4_Missense_Mutation_p.C944S|BAI2_ENST00000398538.1_Missense_Mutation_p.C932S|BAI2_ENST00000440175.2_Missense_Mutation_p.C586S|BAI2_ENST00000527361.1_Missense_Mutation_p.C944S|BAI2_ENST00000398542.1_Missense_Mutation_p.C877S	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	944					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CAGCGCCATGCACGACACTGC	0.662																																						dbGAP											0													35.0	36.0	36.0					1																	32203298		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2831G>C	1.37:g.32203298C>G	ENSP00000362762:p.Cys944Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.C944S	ENST00000373658.3	37	c.2831	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	C	8.023	0.760133	0.15846	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.38	5.38	0.77491	GPCR, family 2-like (1);	0.000000	0.44688	D	0.000437	T	0.33059	0.0850	N	0.02286	-0.61	0.49483	D	0.99979	D;B;B;D;B	0.76494	0.999;0.328;0.083;0.999;0.379	D;B;B;D;B	0.91635	0.997;0.122;0.086;0.999;0.193	T	0.33240	-0.9876	10	0.08837	T	0.75	.	18.2921	0.90134	0.0:1.0:0.0:0.0	.	944;932;586;944;944	O60241-4;O60241-3;B4DKC3;O60241-2;O60241	.;.;.;.;BAI2_HUMAN	S	892;877;944;944;877;944;944;586;932	ENSP00000381564:C892S;ENSP00000381555:C877S;ENSP00000362762:C944S;ENSP00000362759:C944S;ENSP00000381550:C877S;ENSP00000257070:C944S;ENSP00000435397:C944S;ENSP00000391071:C586S;ENSP00000381548:C932S	ENSP00000257070:C944S	C	-	2	0	BAI2	31975885	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	2.484000	0.45242	2.699000	0.92147	0.462000	0.41574	TGC	BAI2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000121753		0.662	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	34	0.00	0	C	NM_001703		32203298	32203298	-1	no_errors	ENST00000373658	ensembl	human	known	69_37n	missense	30	36.17	17	SNP	1.000	G
BAI2	576	genome.wustl.edu	37	1	32203298	32203298	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:32203298C>G	ENST00000373658.3	-	19	3172	c.2831G>C	c.(2830-2832)tGc>tCc	p.C944S	BAI2_ENST00000398556.3_Missense_Mutation_p.C892S|BAI2_ENST00000398547.1_Missense_Mutation_p.C877S|BAI2_ENST00000465256.1_5'Flank|BAI2_ENST00000373655.2_Missense_Mutation_p.C944S|BAI2_ENST00000257070.4_Missense_Mutation_p.C944S|BAI2_ENST00000398538.1_Missense_Mutation_p.C932S|BAI2_ENST00000440175.2_Missense_Mutation_p.C586S|BAI2_ENST00000527361.1_Missense_Mutation_p.C944S|BAI2_ENST00000398542.1_Missense_Mutation_p.C877S	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	944					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CAGCGCCATGCACGACACTGC	0.662																																						dbGAP											0													35.0	36.0	36.0					1																	32203298		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2831G>C	1.37:g.32203298C>G	ENSP00000362762:p.Cys944Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.C944S	ENST00000373658.3	37	c.2831	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	C	8.023	0.760133	0.15846	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.38	5.38	0.77491	GPCR, family 2-like (1);	0.000000	0.44688	D	0.000437	T	0.33059	0.0850	N	0.02286	-0.61	0.49483	D	0.99979	D;B;B;D;B	0.76494	0.999;0.328;0.083;0.999;0.379	D;B;B;D;B	0.91635	0.997;0.122;0.086;0.999;0.193	T	0.33240	-0.9876	10	0.08837	T	0.75	.	18.2921	0.90134	0.0:1.0:0.0:0.0	.	944;932;586;944;944	O60241-4;O60241-3;B4DKC3;O60241-2;O60241	.;.;.;.;BAI2_HUMAN	S	892;877;944;944;877;944;944;586;932	ENSP00000381564:C892S;ENSP00000381555:C877S;ENSP00000362762:C944S;ENSP00000362759:C944S;ENSP00000381550:C877S;ENSP00000257070:C944S;ENSP00000435397:C944S;ENSP00000391071:C586S;ENSP00000381548:C932S	ENSP00000257070:C944S	C	-	2	0	BAI2	31975885	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	2.484000	0.45242	2.699000	0.92147	0.462000	0.41574	TGC	BAI2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000121753		0.662	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	29	0.00	0	C	NM_001703		32203298	32203298	-1	no_errors	ENST00000373658	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	G
C16orf93	90835	genome.wustl.edu	37	16	30772925	30772925	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr16:30772925G>A	ENST00000543610.1	-	1	1106	c.145C>T	c.(145-147)Cag>Tag	p.Q49*	RNF40_ENST00000357890.5_5'Flank|RNF40_ENST00000402121.3_5'Flank|C16orf93_ENST00000545825.1_Nonsense_Mutation_p.Q49*|RNF40_ENST00000563683.1_5'Flank|C16orf93_ENST00000541260.1_Nonsense_Mutation_p.Q49*|RNF40_ENST00000324685.6_5'Flank	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	49										breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						GTCGTCCACTGAGTCCGCACA	0.637																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.145C>T	16.37:g.30772925G>A	ENSP00000437532:p.Gln49*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4V8|F5GX13|Q569G2	Nonsense_Mutation	SNP	NULL	p.Q49*	ENST00000543610.1	37	c.145	CCDS32434.2	16	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944232	0.92593	.	.	ENSG00000196118	ENST00000543610;ENST00000545825	.	.	.	4.99	3.02	0.34903	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-5.7207	11.8423	0.52361	0.0:0.6401:0.3599:0.0	.	.	.	.	X	49	.	ENSP00000437532:Q49X	Q	-	1	0	C16orf93	30680426	0.024000	0.19004	0.012000	0.15200	0.002000	0.02628	0.667000	0.25112	0.793000	0.33875	-0.344000	0.07964	CAG	C16orf93	-	NULL	ENSG00000196118		0.637	C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf93	HGNC	protein_coding	OTTHUMT00000397089.1	141	0.00	0	G	NM_001014979		30772925	30772925	-1	no_errors	ENST00000543610	ensembl	human	known	69_37n	nonsense	33	62.07	54	SNP	0.022	A
C16orf87	388272	genome.wustl.edu	37	16	46858381	46858381	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr16:46858381C>A	ENST00000285697.4	-	2	341	c.80G>T	c.(79-81)tGt>tTt	p.C27F	C16orf87_ENST00000394806.2_Missense_Mutation_p.C27F|C16orf87_ENST00000564250.1_5'UTR	NM_001001436.2	NP_001001436.1	Q6PH81	CP087_HUMAN	chromosome 16 open reading frame 87	27										large_intestine(4)|urinary_tract(1)	5						ACATGATTTACATGCAACAGG	0.303																																						dbGAP											0													70.0	69.0	69.0					16																	46858381		2203	4294	6497	-	-	-	SO:0001583	missense	0				CCDS10724.1	16q11.2	2008-08-08			ENSG00000155330	ENSG00000155330			33754	protein-coding gene	gene with protein product							Standard	NM_001001436		Approved		uc002eek.1	Q6PH81	OTTHUMG00000132538	ENST00000285697.4:c.80G>T	16.37:g.46858381C>A	ENSP00000285697:p.Cys27Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HN9	Missense_Mutation	SNP	pfam_UPF0547	p.C27F	ENST00000285697.4	37	c.80	CCDS10724.1	16	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987255	0.53934	.	.	ENSG00000155330	ENST00000285697;ENST00000394806	.	.	.	5.62	5.62	0.85841	Uncharacterised domain UPF0547 (1);	0.000000	0.85682	D	0.000000	T	0.76835	0.4043	L	0.54323	1.7	0.80722	D	1	D	0.55800	0.973	D	0.77557	0.99	T	0.77928	-0.2404	9	0.87932	D	0	.	18.4323	0.90630	0.0:1.0:0.0:0.0	.	27	Q6PH81	CP087_HUMAN	F	27	.	ENSP00000285697:C27F	C	-	2	0	C16orf87	45415882	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.469000	0.73555	2.653000	0.90120	0.404000	0.27445	TGT	C16orf87	-	pfam_UPF0547	ENSG00000155330		0.303	C16orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf87	HGNC	protein_coding	OTTHUMT00000255738.2	51	0.00	0	C	NM_001001436		46858381	46858381	-1	no_errors	ENST00000285697	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	1.000	A
CFAP74	85452	genome.wustl.edu	37	1	1860235	1860235	+	IGR	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:1860235C>T								TMEM52 (9523 upstream) : C1orf222 (59327 downstream)																							ATTTGGTCTCCATTTCTTTGT	0.637																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.1860235C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_PapD-like	p.M408I		37	c.1224		1	.	.	.	.	.	.	.	.	.	.	c	7.565	0.665552	0.14710	.	.	ENSG00000142609	ENST00000493964	T	0.21191	2.02	3.4	-6.79	0.01715	.	.	.	.	.	T	0.14356	0.0347	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.25012	-1.0144	6	0.34782	T	0.22	.	7.0694	0.25169	0.2004:0.5483:0.0:0.2512	.	.	.	.	I	408	ENSP00000417061:M408I	ENSP00000417061:M408I	M	-	3	0	C1orf222	1850095	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-4.777000	0.00187	-2.206000	0.00741	0.299000	0.19835	ATG	C1orf222	-	NULL	ENSG00000142609	0	0.637					C1orf222	HGNC			81	0.00	0	C			1860235	1860235	-1	no_start_codon	ENST00000493964	ensembl	human	putative	69_37n	missense	43	28.33	17	SNP	0.000	T
CAST	831	genome.wustl.edu	37	5	96079350	96079350	+	Intron	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr5:96079350C>T	ENST00000341926.3	+	14	1113				CAST_ENST00000511782.1_Intron|CAST_ENST00000504465.1_Intron|CAST_ENST00000359176.4_Intron|CAST_ENST00000508830.1_Intron|CAST_ENST00000508608.1_Intron|CAST_ENST00000325674.7_Intron|CAST_ENST00000509903.1_Intron|CAST_ENST00000348386.3_Intron|CAST_ENST00000309190.5_Intron|CAST_ENST00000395813.1_Intron|CAST_ENST00000510756.1_Intron|CAST_ENST00000338252.3_Intron|CAST_ENST00000511049.1_Intron|CAST_ENST00000515663.1_Missense_Mutation_p.S7L|CAST_ENST00000395812.2_Intron|CTC-506B8.1_ENST00000502568.1_RNA|CAST_ENST00000508579.1_Intron			P20810	ICAL_HUMAN	calpastatin						negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		TTTCTATCTTCGACTTTCTTG	0.537																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.951+890C>T	5.37:g.96079350C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	pfam_Prot_inh_calpain	p.S7L	ENST00000341926.3	37	c.20		5	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669325	0.47677	.	.	ENSG00000153113	ENST00000515663	T	0.20069	2.1	3.7	3.7	0.42460	.	.	.	.	.	T	0.22166	0.0534	.	.	.	0.80722	D	1	D;D	0.58970	0.981;0.984	B;B	0.44163	0.358;0.443	T	0.03240	-1.1057	8	0.72032	D	0.01	.	11.2466	0.49000	0.0:1.0:0.0:0.0	.	7;7	E7EQA0;E7EPY6	.;.	L	7	ENSP00000422929:S7L	ENSP00000422929:S7L	S	+	2	0	CAST	96105106	0.883000	0.30277	0.794000	0.32065	0.729000	0.41735	2.981000	0.49329	2.337000	0.79520	0.563000	0.77884	TCG	CAST	-	NULL	ENSG00000153113		0.537	CAST-004	KNOWN	basic	protein_coding	CAST	HGNC	protein_coding	OTTHUMT00000250199.2	198	0.00	0	C	NM_173062		96079350	96079350	+1	no_errors	ENST00000515663	ensembl	human	novel	69_37n	missense	195	13.27	30	SNP	0.831	T
CCDC168	643677	genome.wustl.edu	37	13	103384955	103384955	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr13:103384955C>A	ENST00000322527.2	-	1	4204	c.4205G>T	c.(4204-4206)aGc>aTc	p.S1402I		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1402																	GATTAGGCGGCTGTTCTCCCT	0.388																																						dbGAP											0													208.0	153.0	170.0					13																	103384955		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4205G>T	13.37:g.103384955C>A	ENSP00000320232:p.Ser1402Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N800	Missense_Mutation	SNP	NULL	p.S1402I	ENST00000322527.2	37	c.4205		13	.	.	.	.	.	.	.	.	.	.	C	8.043	0.764343	0.15914	.	.	ENSG00000175820	ENST00000322527	T	0.05447	3.44	2.94	-2.1	0.07210	.	.	.	.	.	T	0.07773	0.0195	N	0.14661	0.345	0.09310	N	1	D	0.69078	0.997	P	0.62184	0.899	T	0.33292	-0.9874	9	0.34782	T	0.22	.	7.518	0.27612	0.0:0.3987:0.0:0.6013	.	1402	Q8NDH2	CC168_HUMAN	I	1402	ENSP00000320232:S1402I	ENSP00000320232:S1402I	S	-	2	0	CCDC168	102182956	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.780000	0.01775	-0.611000	0.05709	-0.384000	0.06662	AGC	CCDC168	-	NULL	ENSG00000175820		0.388	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		323	0.00	0	C	NM_001146197		103384955	103384955	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	missense	309	20.51	80	SNP	0.000	A
CCDC168	643677	genome.wustl.edu	37	13	103384955	103384955	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr13:103384955C>A	ENST00000322527.2	-	1	4204	c.4205G>T	c.(4204-4206)aGc>aTc	p.S1402I		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1402																	GATTAGGCGGCTGTTCTCCCT	0.388																																						dbGAP											0													208.0	153.0	170.0					13																	103384955		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4205G>T	13.37:g.103384955C>A	ENSP00000320232:p.Ser1402Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N800	Missense_Mutation	SNP	NULL	p.S1402I	ENST00000322527.2	37	c.4205		13	.	.	.	.	.	.	.	.	.	.	C	8.043	0.764343	0.15914	.	.	ENSG00000175820	ENST00000322527	T	0.05447	3.44	2.94	-2.1	0.07210	.	.	.	.	.	T	0.07773	0.0195	N	0.14661	0.345	0.09310	N	1	D	0.69078	0.997	P	0.62184	0.899	T	0.33292	-0.9874	9	0.34782	T	0.22	.	7.518	0.27612	0.0:0.3987:0.0:0.6013	.	1402	Q8NDH2	CC168_HUMAN	I	1402	ENSP00000320232:S1402I	ENSP00000320232:S1402I	S	-	2	0	CCDC168	102182956	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.780000	0.01775	-0.611000	0.05709	-0.384000	0.06662	AGC	CCDC168	-	NULL	ENSG00000175820		0.388	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		50	0.00	0	C	NM_001146197		103384955	103384955	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	0.000	A
CD97	976	genome.wustl.edu	37	19	14508566	14508566	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr19:14508566G>A	ENST00000242786.5	+	7	802	c.722G>A	c.(721-723)tGg>tAg	p.W241*	CD97_ENST00000357355.3_Nonsense_Mutation_p.W192*|CD97_ENST00000587728.1_3'UTR|CD97_ENST00000358600.3_Nonsense_Mutation_p.W148*	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	241	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CGCCCAGGCTGGAAGCCCAGA	0.587																																						dbGAP											0													10.0	13.0	12.0					19																	14508566		1927	4010	5937	-	-	-	SO:0001587	stop_gained	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.722G>A	19.37:g.14508566G>A	ENSP00000242786:p.Trp241*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.W241*	ENST00000242786.5	37	c.722	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	g	36	5.689315	0.96784	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	.	.	.	3.66	3.66	0.41972	.	0.000000	0.31358	N	0.007791	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1516	0.48462	0.0:0.0:1.0:0.0	.	.	.	.	X	241;192;148;191	.	ENSP00000242786:W241X	W	+	2	0	CD97	14369566	0.772000	0.28567	0.969000	0.41365	0.557000	0.35523	0.064000	0.14437	2.354000	0.79902	0.651000	0.88453	TGG	CD97	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000123146		0.587	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	49	0.00	0	G	NM_078481		14508566	14508566	+1	no_errors	ENST00000242786	ensembl	human	known	69_37n	nonsense	21	46.15	18	SNP	0.957	A
CDCA7	83879	genome.wustl.edu	37	2	174224156	174224156	+	Intron	SNP	T	T	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:174224156T>C	ENST00000347703.3	+	2	291				CDCA7_ENST00000306721.3_Silent_p.F107F|CDCA7_ENST00000410019.3_Intron|CDCA7_ENST00000410101.3_Silent_p.F63F|CDCA7_ENST00000392567.2_Intron	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7						apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			CCGGTATTTTTCATGCCGACT	0.423																																						dbGAP											0													102.0	101.0	101.0					2																	174224156		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.147+591T>C	2.37:g.174224156T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Silent	SNP	pfam_Znf-4CXXC_R1	p.F107	ENST00000347703.3	37	c.321	CCDS2253.1	2																																																																																			CDCA7	-	NULL	ENSG00000144354		0.423	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7	HGNC	protein_coding	OTTHUMT00000255400.1	100	0.00	0	T	NM_031942		174224156	174224156	+1	no_errors	ENST00000306721	ensembl	human	known	69_37n	silent	106	13.82	17	SNP	1.000	C
CDCA7	83879	genome.wustl.edu	37	2	174224198	174224198	+	Intron	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:174224198G>A	ENST00000347703.3	+	2	291				CDCA7_ENST00000306721.3_Silent_p.E121E|CDCA7_ENST00000410019.3_Intron|CDCA7_ENST00000410101.3_Silent_p.E77E|CDCA7_ENST00000392567.2_Intron	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7						apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			GTTTCTCAGAGAGTGAGATAC	0.378																																						dbGAP											0													96.0	94.0	95.0					2																	174224198		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.147+633G>A	2.37:g.174224198G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Silent	SNP	pfam_Znf-4CXXC_R1	p.E121	ENST00000347703.3	37	c.363	CCDS2253.1	2																																																																																			CDCA7	-	NULL	ENSG00000144354		0.378	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7	HGNC	protein_coding	OTTHUMT00000255400.1	95	0.00	0	G	NM_031942		174224198	174224198	+1	no_errors	ENST00000306721	ensembl	human	known	69_37n	silent	90	12.62	13	SNP	1.000	A
CDH26	60437	genome.wustl.edu	37	20	58547126	58547126	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr20:58547126G>A	ENST00000244047.5	+	4	652	c.341G>A	c.(340-342)gGa>gAa	p.G114E	CDH26_ENST00000348616.4_Missense_Mutation_p.G114E			Q8IXH8	CAD26_HUMAN	cadherin 26	114	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			CATGAGAACGGAAGGATATAT	0.378																																						dbGAP											0													152.0	140.0	144.0					20																	58547126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.341G>A	20.37:g.58547126G>A	ENSP00000244047:p.Gly114Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G114E	ENST00000244047.5	37	c.341		20	.	.	.	.	.	.	.	.	.	.	.	17.55	3.418148	0.62622	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.72725	-0.68;-0.68	5.13	4.18	0.49190	.	0.056589	0.64402	D	0.000001	D	0.87896	0.6293	H	0.95611	3.695	0.45261	D	0.99826	D	0.89917	1.0	D	0.91635	0.999	D	0.90731	0.4642	10	0.87932	D	0	.	12.7156	0.57113	0.0816:0.0:0.9184:0.0	.	114	Q8IXH8-4	.	E	114	ENSP00000244047:G114E;ENSP00000339390:G114E	ENSP00000244047:G114E	G	+	2	0	CDH26	57980521	0.995000	0.38212	0.061000	0.19648	0.689000	0.40095	2.911000	0.48774	1.291000	0.44653	0.650000	0.86243	GGA	CDH26	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000124215		0.378	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		387	0.26	1	G	NM_177980		58547126	58547126	+1	no_errors	ENST00000244047	ensembl	human	known	69_37n	missense	497	16.75	100	SNP	0.783	A
CDH26	60437	genome.wustl.edu	37	20	58547126	58547126	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr20:58547126G>A	ENST00000244047.5	+	4	652	c.341G>A	c.(340-342)gGa>gAa	p.G114E	CDH26_ENST00000348616.4_Missense_Mutation_p.G114E			Q8IXH8	CAD26_HUMAN	cadherin 26	114	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			CATGAGAACGGAAGGATATAT	0.378																																						dbGAP											0													152.0	140.0	144.0					20																	58547126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.341G>A	20.37:g.58547126G>A	ENSP00000244047:p.Gly114Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G114E	ENST00000244047.5	37	c.341		20	.	.	.	.	.	.	.	.	.	.	.	17.55	3.418148	0.62622	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.72725	-0.68;-0.68	5.13	4.18	0.49190	.	0.056589	0.64402	D	0.000001	D	0.87896	0.6293	H	0.95611	3.695	0.45261	D	0.99826	D	0.89917	1.0	D	0.91635	0.999	D	0.90731	0.4642	10	0.87932	D	0	.	12.7156	0.57113	0.0816:0.0:0.9184:0.0	.	114	Q8IXH8-4	.	E	114	ENSP00000244047:G114E;ENSP00000339390:G114E	ENSP00000244047:G114E	G	+	2	0	CDH26	57980521	0.995000	0.38212	0.061000	0.19648	0.689000	0.40095	2.911000	0.48774	1.291000	0.44653	0.650000	0.86243	GGA	CDH26	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000124215		0.378	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		84	0.00	0	G	NM_177980		58547126	58547126	+1	no_errors	ENST00000244047	ensembl	human	known	69_37n	missense	81	17.35	17	SNP	0.783	A
CELSR3	1951	genome.wustl.edu	37	3	48694701	48694701	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr3:48694701C>T	ENST00000164024.4	-	2	4109	c.3829G>A	c.(3829-3831)Gtg>Atg	p.V1277M	CELSR3_ENST00000544264.1_Missense_Mutation_p.V1277M	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1277					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCAAGGCGCACGGTCAGGCTG	0.682																																						dbGAP											0													35.0	30.0	32.0					3																	48694701		2200	4299	6499	-	-	-	SO:0001583	missense	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3829G>A	3.37:g.48694701C>T	ENSP00000164024:p.Val1277Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V1277M	ENST00000164024.4	37	c.3829	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.069906	0.93950	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.74632	-0.86;-0.86	4.9	4.9	0.64082	.	.	.	.	.	D	0.87497	0.6192	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.986;0.998	D	0.89320	0.3639	9	0.87932	D	0	.	18.2685	0.90060	0.0:1.0:0.0:0.0	.	1277;1347	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	M	1277	ENSP00000164024:V1277M;ENSP00000445694:V1277M	ENSP00000164024:V1277M	V	-	1	0	CELSR3	48669705	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	5.904000	0.69886	2.560000	0.86352	0.549000	0.68633	GTG	CELSR3	-	NULL	ENSG00000008300		0.682	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	38	0.00	0	C	NM_001407		48694701	48694701	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	T
CELSR3	1951	genome.wustl.edu	37	3	48694701	48694701	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr3:48694701C>T	ENST00000164024.4	-	2	4109	c.3829G>A	c.(3829-3831)Gtg>Atg	p.V1277M	CELSR3_ENST00000544264.1_Missense_Mutation_p.V1277M	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1277					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCAAGGCGCACGGTCAGGCTG	0.682																																						dbGAP											0													35.0	30.0	32.0					3																	48694701		2200	4299	6499	-	-	-	SO:0001583	missense	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3829G>A	3.37:g.48694701C>T	ENSP00000164024:p.Val1277Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V1277M	ENST00000164024.4	37	c.3829	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.069906	0.93950	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.74632	-0.86;-0.86	4.9	4.9	0.64082	.	.	.	.	.	D	0.87497	0.6192	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.986;0.998	D	0.89320	0.3639	9	0.87932	D	0	.	18.2685	0.90060	0.0:1.0:0.0:0.0	.	1277;1347	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	M	1277	ENSP00000164024:V1277M;ENSP00000445694:V1277M	ENSP00000164024:V1277M	V	-	1	0	CELSR3	48669705	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	5.904000	0.69886	2.560000	0.86352	0.549000	0.68633	GTG	CELSR3	-	NULL	ENSG00000008300		0.682	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	33	0.00	0	C	NM_001407		48694701	48694701	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	1.000	T
CEP72	55722	genome.wustl.edu	37	5	653161	653161	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr5:653161C>A	ENST00000264935.5	+	12	1927	c.1837C>A	c.(1837-1839)Cac>Aac	p.H613N	CEP72_ENST00000444221.1_3'UTR	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	613					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GCGGGCGCAGCACAGAGCCGA	0.627																																						dbGAP											0													57.0	53.0	54.0					5																	653161		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.1837C>A	5.37:g.653161C>A	ENSP00000264935:p.His613Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Missense_Mutation	SNP	smart_Leu-rich_rpt_typical-subtyp,smart_U2A'_phosphoprotein32A_C	p.H613N	ENST00000264935.5	37	c.1837	CCDS34126.1	5	.	.	.	.	.	.	.	.	.	.	C	19.88	3.908923	0.72868	.	.	ENSG00000112877	ENST00000264935	T	0.52754	0.65	4.94	4.94	0.65067	.	0.158927	0.42548	D	0.000688	T	0.65923	0.2738	M	0.68952	2.095	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.69202	-0.5207	10	0.87932	D	0	-26.2413	13.9976	0.64411	0.0:1.0:0.0:0.0	.	613	Q9P209	CEP72_HUMAN	N	613	ENSP00000264935:H613N	ENSP00000264935:H613N	H	+	1	0	CEP72	706161	0.630000	0.27155	0.971000	0.41717	0.988000	0.76386	2.448000	0.44926	2.449000	0.82847	0.484000	0.47621	CAC	CEP72	-	NULL	ENSG00000112877		0.627	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP72	HGNC	protein_coding	OTTHUMT00000365967.3	100	0.00	0	C	NM_018140		653161	653161	+1	no_errors	ENST00000264935	ensembl	human	known	69_37n	missense	114	17.99	25	SNP	0.990	A
CIRBP	1153	genome.wustl.edu	37	19	1269930	1269930	+	Intron	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr19:1269930C>G	ENST00000588030.1	+	2	254				CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000320936.5_Intron|CIRBP_ENST00000587896.1_Intron|CIRBP_ENST00000585630.1_5'Flank|CIRBP_ENST00000586472.1_Intron|CIRBP_ENST00000589660.1_Intron|CIRBP_ENST00000444172.2_Intron|CIRBP_ENST00000588230.1_Intron|CIRBP_ENST00000587323.1_Intron|CIRBP_ENST00000589235.1_Intron|CIRBP_ENST00000591935.1_Intron|CIRBP_ENST00000586773.1_5'Flank|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000589710.1_Intron|CIRBP_ENST00000589686.1_Intron|CIRBP_ENST00000413636.2_Intron			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGTCTGCCACGTCGTGCTTT	0.557																																						dbGAP											0													70.0	70.0	70.0					19																	1269930		2064	4204	6268	-	-	-	SO:0001627	intron_variant	0			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.-6-997C>G	19.37:g.1269930C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT17|B4E2X2	RNA	SNP	-	NULL	ENST00000588030.1	37	NULL	CCDS12059.1	19																																																																																			CIRBP-AS1	-	-	ENSG00000267493		0.557	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP-AS1	HGNC	protein_coding	OTTHUMT00000449969.1	174	0.00	0	C	NM_001280		1269930	1269930	-1	no_errors	ENST00000585832	ensembl	human	known	69_37n	rna	81	49.38	79	SNP	0.000	G
CIRBP	1153	genome.wustl.edu	37	19	1269930	1269930	+	Intron	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr19:1269930C>G	ENST00000588030.1	+	2	254				CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000320936.5_Intron|CIRBP_ENST00000587896.1_Intron|CIRBP_ENST00000585630.1_5'Flank|CIRBP_ENST00000586472.1_Intron|CIRBP_ENST00000589660.1_Intron|CIRBP_ENST00000444172.2_Intron|CIRBP_ENST00000588230.1_Intron|CIRBP_ENST00000587323.1_Intron|CIRBP_ENST00000589235.1_Intron|CIRBP_ENST00000591935.1_Intron|CIRBP_ENST00000586773.1_5'Flank|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000589710.1_Intron|CIRBP_ENST00000589686.1_Intron|CIRBP_ENST00000413636.2_Intron			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGTCTGCCACGTCGTGCTTT	0.557																																						dbGAP											0													70.0	70.0	70.0					19																	1269930		2064	4204	6268	-	-	-	SO:0001627	intron_variant	0			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.-6-997C>G	19.37:g.1269930C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT17|B4E2X2	RNA	SNP	-	NULL	ENST00000588030.1	37	NULL	CCDS12059.1	19																																																																																			CIRBP-AS1	-	-	ENSG00000267493		0.557	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP-AS1	HGNC	protein_coding	OTTHUMT00000449969.1	92	0.00	0	C	NM_001280		1269930	1269930	-1	no_errors	ENST00000585832	ensembl	human	known	69_37n	rna	24	54.72	29	SNP	0.000	G
CRMP1	1400	genome.wustl.edu	37	4	5844877	5844877	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr4:5844877C>T	ENST00000397890.2	-	7	847	c.633G>A	c.(631-633)cgG>cgA	p.R211R	CRMP1_ENST00000512574.1_Silent_p.R209R|CRMP1_ENST00000324989.7_Silent_p.R325R|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	211					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TCTCCAGGATCCGCTTTTGTT	0.547																																						dbGAP											0													149.0	127.0	134.0					4																	5844877		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.633G>A	4.37:g.5844877C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.R325	ENST00000397890.2	37	c.975	CCDS43207.1	4																																																																																			CRMP1	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.547	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	213	0.00	0	C	NM_001313		5844877	5844877	-1	no_errors	ENST00000324989	ensembl	human	known	69_37n	silent	120	28.14	47	SNP	0.907	T
CRMP1	1400	genome.wustl.edu	37	4	5844877	5844877	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr4:5844877C>T	ENST00000397890.2	-	7	847	c.633G>A	c.(631-633)cgG>cgA	p.R211R	CRMP1_ENST00000512574.1_Silent_p.R209R|CRMP1_ENST00000324989.7_Silent_p.R325R|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	211					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TCTCCAGGATCCGCTTTTGTT	0.547																																						dbGAP											0													149.0	127.0	134.0					4																	5844877		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.633G>A	4.37:g.5844877C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.R325	ENST00000397890.2	37	c.975	CCDS43207.1	4																																																																																			CRMP1	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.547	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	51	0.00	0	C	NM_001313		5844877	5844877	-1	no_errors	ENST00000324989	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.907	T
DENND1C	79958	genome.wustl.edu	37	19	6476917	6476917	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr19:6476917G>A	ENST00000381480.2	-	10	741	c.629C>T	c.(628-630)gCg>gTg	p.A210V	DENND1C_ENST00000591030.1_5'Flank|DENND1C_ENST00000543576.1_Missense_Mutation_p.A166V	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	210	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						GGCCAGGAGCGCCGCGAACAG	0.697																																						dbGAP											0													34.0	40.0	38.0					19																	6476917		1985	4158	6143	-	-	-	SO:0001583	missense	0			AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.629C>T	19.37:g.6476917G>A	ENSP00000370889:p.Ala210Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.A210V	ENST00000381480.2	37	c.629	CCDS45938.1	19	.	.	.	.	.	.	.	.	.	.	g	26.6	4.750471	0.89753	.	.	ENSG00000205744	ENST00000381480;ENST00000543576	T;T	0.12465	2.68;2.68	4.73	4.73	0.59995	DENN (3);	0.220038	0.35040	N	0.003490	T	0.32526	0.0832	M	0.71581	2.175	0.37634	D	0.921785	D	0.65815	0.995	D	0.64877	0.93	T	0.25676	-1.0125	10	0.87932	D	0	-9.7944	11.1517	0.48462	0.0:0.1872:0.8128:0.0	.	210	Q8IV53	DEN1C_HUMAN	V	210;166	ENSP00000370889:A210V;ENSP00000437805:A166V	ENSP00000370889:A210V	A	-	2	0	DENND1C	6427917	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	3.703000	0.54808	2.173000	0.68751	0.556000	0.70494	GCG	DENND1C	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000205744		0.697	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1C	HGNC	protein_coding	OTTHUMT00000453332.2	50	0.00	0	G	NM_024898		6476917	6476917	-1	no_errors	ENST00000381480	ensembl	human	known	69_37n	missense	17	50.00	17	SNP	1.000	A
DENND1C	79958	genome.wustl.edu	37	19	6476917	6476917	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr19:6476917G>A	ENST00000381480.2	-	10	741	c.629C>T	c.(628-630)gCg>gTg	p.A210V	DENND1C_ENST00000591030.1_5'Flank|DENND1C_ENST00000543576.1_Missense_Mutation_p.A166V	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	210	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						GGCCAGGAGCGCCGCGAACAG	0.697																																						dbGAP											0													34.0	40.0	38.0					19																	6476917		1985	4158	6143	-	-	-	SO:0001583	missense	0			AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.629C>T	19.37:g.6476917G>A	ENSP00000370889:p.Ala210Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.A210V	ENST00000381480.2	37	c.629	CCDS45938.1	19	.	.	.	.	.	.	.	.	.	.	g	26.6	4.750471	0.89753	.	.	ENSG00000205744	ENST00000381480;ENST00000543576	T;T	0.12465	2.68;2.68	4.73	4.73	0.59995	DENN (3);	0.220038	0.35040	N	0.003490	T	0.32526	0.0832	M	0.71581	2.175	0.37634	D	0.921785	D	0.65815	0.995	D	0.64877	0.93	T	0.25676	-1.0125	10	0.87932	D	0	-9.7944	11.1517	0.48462	0.0:0.1872:0.8128:0.0	.	210	Q8IV53	DEN1C_HUMAN	V	210;166	ENSP00000370889:A210V;ENSP00000437805:A166V	ENSP00000370889:A210V	A	-	2	0	DENND1C	6427917	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	3.703000	0.54808	2.173000	0.68751	0.556000	0.70494	GCG	DENND1C	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000205744		0.697	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1C	HGNC	protein_coding	OTTHUMT00000453332.2	42	0.00	0	G	NM_024898		6476917	6476917	-1	no_errors	ENST00000381480	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	A
DNAH6	1768	genome.wustl.edu	37	2	84930672	84930672	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:84930672G>A	ENST00000237449.6	+	49	8223	c.8215G>A	c.(8215-8217)Gaa>Aaa	p.E2739K	DNAH6_ENST00000389394.3_Missense_Mutation_p.E2739K			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2739	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AGTGGATCAAGAAAGTGCCGA	0.378																																						dbGAP											0													68.0	60.0	62.0					2																	84930672		692	1591	2283	-	-	-	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8215G>A	2.37:g.84930672G>A	ENSP00000237449:p.Glu2739Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E2739K	ENST00000237449.6	37	c.8215	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183863	0.38609	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.77489	-1.1;-1.1	5.79	5.79	0.91817	Dynein heavy chain, coiled coil stalk (1);	.	.	.	.	T	0.66636	0.2809	N	0.21448	0.665	0.80722	D	1	B	0.20368	0.044	B	0.25140	0.058	T	0.61657	-0.7018	9	0.07813	T	0.8	.	18.8083	0.92047	0.0:0.0:1.0:0.0	.	2739	Q9C0G6	DYH6_HUMAN	K	2739	ENSP00000374045:E2739K;ENSP00000237449:E2739K	ENSP00000237449:E2739K	E	+	1	0	DNAH6	84784183	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.945000	0.87732	2.735000	0.93741	0.563000	0.77884	GAA	DNAH6	-	NULL	ENSG00000115423		0.378	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	96	0.00	0	G	NM_001370		84930672	84930672	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	missense	102	32.00	48	SNP	1.000	A
DNAH6	1768	genome.wustl.edu	37	2	84930672	84930672	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:84930672G>A	ENST00000237449.6	+	49	8223	c.8215G>A	c.(8215-8217)Gaa>Aaa	p.E2739K	DNAH6_ENST00000389394.3_Missense_Mutation_p.E2739K			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2739	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AGTGGATCAAGAAAGTGCCGA	0.378																																						dbGAP											0													68.0	60.0	62.0					2																	84930672		692	1591	2283	-	-	-	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8215G>A	2.37:g.84930672G>A	ENSP00000237449:p.Glu2739Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E2739K	ENST00000237449.6	37	c.8215	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183863	0.38609	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.77489	-1.1;-1.1	5.79	5.79	0.91817	Dynein heavy chain, coiled coil stalk (1);	.	.	.	.	T	0.66636	0.2809	N	0.21448	0.665	0.80722	D	1	B	0.20368	0.044	B	0.25140	0.058	T	0.61657	-0.7018	9	0.07813	T	0.8	.	18.8083	0.92047	0.0:0.0:1.0:0.0	.	2739	Q9C0G6	DYH6_HUMAN	K	2739	ENSP00000374045:E2739K;ENSP00000237449:E2739K	ENSP00000237449:E2739K	E	+	1	0	DNAH6	84784183	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.945000	0.87732	2.735000	0.93741	0.563000	0.77884	GAA	DNAH6	-	NULL	ENSG00000115423		0.378	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	21	0.00	0	G	NM_001370		84930672	84930672	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	A
EHHADH	1962	genome.wustl.edu	37	3	184911054	184911054	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr3:184911054C>G	ENST00000231887.3	-	7	1207	c.1132G>C	c.(1132-1134)Gtc>Ctc	p.V378L	EHHADH_ENST00000456310.1_Missense_Mutation_p.V282L|EHHADH-AS1_ENST00000417720.1_RNA	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	378	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			GCTTCAATGACTAAATCTACA	0.453																																						dbGAP											0													181.0	174.0	176.0					3																	184911054		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1132G>C	3.37:g.184911054C>G	ENSP00000231887:p.Val378Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	pfam_Crotonase_core,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	p.V378L	ENST00000231887.3	37	c.1132	CCDS33901.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.223081	0.79464	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	D;D	0.83335	-1.71;-1.71	6.08	5.2	0.72013	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.89986	0.6874	M	0.76002	2.32	0.80722	D	1	D	0.61080	0.989	P	0.62382	0.901	D	0.91291	0.5059	10	0.87932	D	0	-22.0347	16.7582	0.85505	0.1303:0.8697:0.0:0.0	.	378	Q08426	ECHP_HUMAN	L	378;378;282	ENSP00000231887:V378L;ENSP00000387746:V282L	ENSP00000231887:V378L	V	-	1	0	EHHADH	186393748	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.643000	0.67895	1.561000	0.49584	0.591000	0.81541	GTC	EHHADH	-	pfam_3-OHacyl-CoA_DH_NAD-bd	ENSG00000113790		0.453	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHHADH	HGNC	protein_coding	OTTHUMT00000345326.1	358	0.00	0	C			184911054	184911054	-1	no_errors	ENST00000231887	ensembl	human	known	69_37n	missense	304	36.40	174	SNP	1.000	G
EHHADH	1962	genome.wustl.edu	37	3	184911054	184911054	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr3:184911054C>G	ENST00000231887.3	-	7	1207	c.1132G>C	c.(1132-1134)Gtc>Ctc	p.V378L	EHHADH_ENST00000456310.1_Missense_Mutation_p.V282L|EHHADH-AS1_ENST00000417720.1_RNA	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	378	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			GCTTCAATGACTAAATCTACA	0.453																																						dbGAP											0													181.0	174.0	176.0					3																	184911054		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1132G>C	3.37:g.184911054C>G	ENSP00000231887:p.Val378Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	pfam_Crotonase_core,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	p.V378L	ENST00000231887.3	37	c.1132	CCDS33901.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.223081	0.79464	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	D;D	0.83335	-1.71;-1.71	6.08	5.2	0.72013	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.89986	0.6874	M	0.76002	2.32	0.80722	D	1	D	0.61080	0.989	P	0.62382	0.901	D	0.91291	0.5059	10	0.87932	D	0	-22.0347	16.7582	0.85505	0.1303:0.8697:0.0:0.0	.	378	Q08426	ECHP_HUMAN	L	378;378;282	ENSP00000231887:V378L;ENSP00000387746:V282L	ENSP00000231887:V378L	V	-	1	0	EHHADH	186393748	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.643000	0.67895	1.561000	0.49584	0.591000	0.81541	GTC	EHHADH	-	pfam_3-OHacyl-CoA_DH_NAD-bd	ENSG00000113790		0.453	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHHADH	HGNC	protein_coding	OTTHUMT00000345326.1	93	0.00	0	C			184911054	184911054	-1	no_errors	ENST00000231887	ensembl	human	known	69_37n	missense	53	37.65	32	SNP	1.000	G
EML6	400954	genome.wustl.edu	37	2	55080895	55080895	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:55080895C>G	ENST00000356458.6	+	10	2080	c.1560C>G	c.(1558-1560)gaC>gaG	p.D520E		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	520						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						AGGTTACTGACATCAACTCAG	0.433																																						dbGAP											0													154.0	132.0	139.0					2																	55080895		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.1560C>G	2.37:g.55080895C>G	ENSP00000348842:p.Asp520Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D520E	ENST00000356458.6	37	c.1560	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669448	0.47677	.	.	ENSG00000214595	ENST00000356458	T	0.42900	0.96	5.95	2.64	0.31445	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.27227	U	0.020326	T	0.44561	0.1299	M	0.83953	2.67	0.32740	N	0.50782	B	0.20164	0.042	B	0.21151	0.033	T	0.55075	-0.8197	10	0.54805	T	0.06	.	9.1874	0.37178	0.0:0.6041:0.0:0.3959	.	520	Q6ZMW3	EMAL6_HUMAN	E	520	ENSP00000348842:D520E	ENSP00000348842:D520E	D	+	3	2	EML6	54934399	0.402000	0.25311	1.000000	0.80357	0.918000	0.54935	0.058000	0.14301	0.791000	0.33826	-0.355000	0.07637	GAC	EML6	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000214595		0.433	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	234	0.00	0	C	XM_001725002		55080895	55080895	+1	no_errors	ENST00000356458	ensembl	human	novel	69_37n	missense	268	18.24	60	SNP	0.999	G
EML6	400954	genome.wustl.edu	37	2	55080895	55080895	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:55080895C>G	ENST00000356458.6	+	10	2080	c.1560C>G	c.(1558-1560)gaC>gaG	p.D520E		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	520						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						AGGTTACTGACATCAACTCAG	0.433																																						dbGAP											0													154.0	132.0	139.0					2																	55080895		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.1560C>G	2.37:g.55080895C>G	ENSP00000348842:p.Asp520Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D520E	ENST00000356458.6	37	c.1560	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669448	0.47677	.	.	ENSG00000214595	ENST00000356458	T	0.42900	0.96	5.95	2.64	0.31445	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.27227	U	0.020326	T	0.44561	0.1299	M	0.83953	2.67	0.32740	N	0.50782	B	0.20164	0.042	B	0.21151	0.033	T	0.55075	-0.8197	10	0.54805	T	0.06	.	9.1874	0.37178	0.0:0.6041:0.0:0.3959	.	520	Q6ZMW3	EMAL6_HUMAN	E	520	ENSP00000348842:D520E	ENSP00000348842:D520E	D	+	3	2	EML6	54934399	0.402000	0.25311	1.000000	0.80357	0.918000	0.54935	0.058000	0.14301	0.791000	0.33826	-0.355000	0.07637	GAC	EML6	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000214595		0.433	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	33	0.00	0	C	XM_001725002		55080895	55080895	+1	no_errors	ENST00000356458	ensembl	human	novel	69_37n	missense	28	17.65	6	SNP	0.999	G
EMR2	30817	genome.wustl.edu	37	19	14876520	14876520	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr19:14876520C>T	ENST00000315576.3	-	8	1182	c.731G>A	c.(730-732)tGg>tAg	p.W244*	EMR2_ENST00000595839.1_Intron|EMR2_ENST00000601345.1_Nonsense_Mutation_p.W244*|EMR2_ENST00000353005.1_Intron|EMR2_ENST00000596991.2_Nonsense_Mutation_p.W244*|EMR2_ENST00000392967.2_Nonsense_Mutation_p.W244*|EMR2_ENST00000594294.1_Nonsense_Mutation_p.W195*|EMR2_ENST00000392964.3_5'UTR|EMR2_ENST00000392965.3_Nonsense_Mutation_p.W244*|EMR2_ENST00000346057.1_Nonsense_Mutation_p.W195*|EMR2_ENST00000353876.1_Nonsense_Mutation_p.W151*|EMR2_ENST00000594076.1_Nonsense_Mutation_p.W151*	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	244	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						TCTGGGCTTCCAGCCTGGGCG	0.592																																						dbGAP											0													80.0	79.0	79.0					19																	14876520		2202	4278	6480	-	-	-	SO:0001587	stop_gained	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.731G>A	19.37:g.14876520C>T	ENSP00000319883:p.Trp244*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like	p.W244*	ENST00000315576.3	37	c.731	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028729	0.54790	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000392965;ENST00000392962	.	.	.	3.13	0.855	0.19013	.	.	.	.	.	.	.	.	.	.	.	0.22226	N	0.999279	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.0693	0.06225	0.2963:0.55:0.0:0.1536	.	.	.	.	X	244;244;195;151;244;195	.	ENSP00000319883:W244X	W	-	2	0	EMR2	14737520	0.023000	0.18921	0.012000	0.15200	0.024000	0.10985	0.532000	0.23067	0.564000	0.29238	0.121000	0.15741	TGG	EMR2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000127507		0.592	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	204	0.00	0	C			14876520	14876520	-1	no_errors	ENST00000315576	ensembl	human	known	69_37n	nonsense	123	25.45	42	SNP	0.046	T
EMR2	30817	genome.wustl.edu	37	19	14876520	14876520	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr19:14876520C>T	ENST00000315576.3	-	8	1182	c.731G>A	c.(730-732)tGg>tAg	p.W244*	EMR2_ENST00000595839.1_Intron|EMR2_ENST00000601345.1_Nonsense_Mutation_p.W244*|EMR2_ENST00000353005.1_Intron|EMR2_ENST00000596991.2_Nonsense_Mutation_p.W244*|EMR2_ENST00000392967.2_Nonsense_Mutation_p.W244*|EMR2_ENST00000594294.1_Nonsense_Mutation_p.W195*|EMR2_ENST00000392964.3_5'UTR|EMR2_ENST00000392965.3_Nonsense_Mutation_p.W244*|EMR2_ENST00000346057.1_Nonsense_Mutation_p.W195*|EMR2_ENST00000353876.1_Nonsense_Mutation_p.W151*|EMR2_ENST00000594076.1_Nonsense_Mutation_p.W151*	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	244	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						TCTGGGCTTCCAGCCTGGGCG	0.592																																						dbGAP											0													80.0	79.0	79.0					19																	14876520		2202	4278	6480	-	-	-	SO:0001587	stop_gained	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.731G>A	19.37:g.14876520C>T	ENSP00000319883:p.Trp244*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like	p.W244*	ENST00000315576.3	37	c.731	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028729	0.54790	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000392965;ENST00000392962	.	.	.	3.13	0.855	0.19013	.	.	.	.	.	.	.	.	.	.	.	0.22226	N	0.999279	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.0693	0.06225	0.2963:0.55:0.0:0.1536	.	.	.	.	X	244;244;195;151;244;195	.	ENSP00000319883:W244X	W	-	2	0	EMR2	14737520	0.023000	0.18921	0.012000	0.15200	0.024000	0.10985	0.532000	0.23067	0.564000	0.29238	0.121000	0.15741	TGG	EMR2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000127507		0.592	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	54	0.00	0	C			14876520	14876520	-1	no_errors	ENST00000315576	ensembl	human	known	69_37n	nonsense	29	32.56	14	SNP	0.046	T
EPHB2	2048	genome.wustl.edu	37	1	23236889	23236889	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:23236889T>G	ENST00000400191.3	+	14	2535	c.2517T>G	c.(2515-2517)atT>atG	p.I839M	EPHB2_ENST00000374632.3_Missense_Mutation_p.I840M|EPHB2_ENST00000374630.3_Missense_Mutation_p.I839M|EPHB2_ENST00000374627.1_Missense_Mutation_p.I834M	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	839	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TCAATGCCATTGAGCAGGACT	0.612																																						dbGAP											0													101.0	74.0	83.0					1																	23236889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2517T>G	1.37:g.23236889T>G	ENSP00000383053:p.Ile839Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.I839M	ENST00000400191.3	37	c.2517		1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.999201	0.54147	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86	4.64	-6.09	0.02145	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88138	0.6356	M	0.81802	2.56	0.80722	D	1	D;D;P;P	0.61080	0.989;0.974;0.929;0.643	D;D;D;D	0.70716	0.97;0.956;0.956;0.926	D	0.85480	0.1178	10	0.87932	D	0	.	6.7834	0.23659	0.2718:0.155:0.0:0.5732	.	781;839;857;840	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	M	781;839;839;840;834	ENSP00000363761:I839M;ENSP00000383053:I839M;ENSP00000363763:I840M;ENSP00000363758:I834M	ENSP00000363755:I781M	I	+	3	3	EPHB2	23109476	0.000000	0.05858	0.971000	0.41717	0.810000	0.45777	-7.206000	0.00041	-0.720000	0.04935	-1.166000	0.01754	ATT	EPHB2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000133216		0.612	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	HGNC	protein_coding	OTTHUMT00000008060.2	86	0.00	0	T	NM_017449		23236889	23236889	+1	no_errors	ENST00000400191	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	0.736	G
EPHB2	2048	genome.wustl.edu	37	1	23236889	23236889	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:23236889T>G	ENST00000400191.3	+	14	2535	c.2517T>G	c.(2515-2517)atT>atG	p.I839M	EPHB2_ENST00000374632.3_Missense_Mutation_p.I840M|EPHB2_ENST00000374630.3_Missense_Mutation_p.I839M|EPHB2_ENST00000374627.1_Missense_Mutation_p.I834M	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	839	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TCAATGCCATTGAGCAGGACT	0.612																																						dbGAP											0													101.0	74.0	83.0					1																	23236889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2517T>G	1.37:g.23236889T>G	ENSP00000383053:p.Ile839Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.I839M	ENST00000400191.3	37	c.2517		1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.999201	0.54147	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86	4.64	-6.09	0.02145	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88138	0.6356	M	0.81802	2.56	0.80722	D	1	D;D;P;P	0.61080	0.989;0.974;0.929;0.643	D;D;D;D	0.70716	0.97;0.956;0.956;0.926	D	0.85480	0.1178	10	0.87932	D	0	.	6.7834	0.23659	0.2718:0.155:0.0:0.5732	.	781;839;857;840	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	M	781;839;839;840;834	ENSP00000363761:I839M;ENSP00000383053:I839M;ENSP00000363763:I840M;ENSP00000363758:I834M	ENSP00000363755:I781M	I	+	3	3	EPHB2	23109476	0.000000	0.05858	0.971000	0.41717	0.810000	0.45777	-7.206000	0.00041	-0.720000	0.04935	-1.166000	0.01754	ATT	EPHB2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000133216		0.612	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	HGNC	protein_coding	OTTHUMT00000008060.2	49	0.00	0	T	NM_017449		23236889	23236889	+1	no_errors	ENST00000400191	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	0.736	G
EPN1	29924	genome.wustl.edu	37	19	56200357	56200357	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr19:56200357C>T	ENST00000270460.6	+	4	911	c.600C>T	c.(598-600)gaC>gaT	p.D200D	EPN1_ENST00000591743.1_3'UTR|EPN1_ENST00000085079.7_Silent_p.D200D|EPN1_ENST00000411543.2_Silent_p.D311D	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	200					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		AGGAGGCCGACCAGGTACTGG	0.726																																						dbGAP											0													13.0	16.0	15.0					19																	56200357		2143	4247	6390	-	-	-	SO:0001819	synonymous_variant	0			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.600C>T	19.37:g.56200357C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86ST3|Q9HA18	Silent	SNP	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.D311	ENST00000270460.6	37	c.933	CCDS46199.1	19																																																																																			EPN1	-	smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	ENSG00000063245		0.726	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	HGNC	protein_coding	OTTHUMT00000453610.1	12	0.00	0	C	NM_013333		56200357	56200357	+1	no_errors	ENST00000411543	ensembl	human	known	69_37n	silent	11	47.62	10	SNP	1.000	T
EPN1	29924	genome.wustl.edu	37	19	56200357	56200357	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr19:56200357C>T	ENST00000270460.6	+	4	911	c.600C>T	c.(598-600)gaC>gaT	p.D200D	EPN1_ENST00000591743.1_3'UTR|EPN1_ENST00000085079.7_Silent_p.D200D|EPN1_ENST00000411543.2_Silent_p.D311D	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	200					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		AGGAGGCCGACCAGGTACTGG	0.726																																						dbGAP											0													13.0	16.0	15.0					19																	56200357		2143	4247	6390	-	-	-	SO:0001819	synonymous_variant	0			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.600C>T	19.37:g.56200357C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86ST3|Q9HA18	Silent	SNP	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.D311	ENST00000270460.6	37	c.933	CCDS46199.1	19																																																																																			EPN1	-	smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	ENSG00000063245		0.726	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	HGNC	protein_coding	OTTHUMT00000453610.1	56	0.00	0	C	NM_013333		56200357	56200357	+1	no_errors	ENST00000411543	ensembl	human	known	69_37n	silent	33	36.54	19	SNP	1.000	T
F2R	2149	genome.wustl.edu	37	5	76029028	76029028	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr5:76029028C>G	ENST00000319211.4	+	2	1243	c.978C>G	c.(976-978)ttC>ttG	p.F326L		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	326					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TCATTTGCTTCGGACCCACAA	0.507																																						dbGAP											0													161.0	126.0	138.0					5																	76029028		2203	4300	6503	-	-	-	SO:0001583	missense	0			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.978C>G	5.37:g.76029028C>G	ENSP00000321326:p.Phe326Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Thrmbn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Protea_act_rcpt,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.F326L	ENST00000319211.4	37	c.978	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	C	19.47	3.832931	0.71258	.	.	ENSG00000181104	ENST00000319211	T	0.72615	-0.67	4.7	-2.73	0.05950	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81173	0.4767	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81116	-0.1079	10	0.87932	D	0	-30.1638	12.5522	0.56233	0.0:0.0988:0.0:0.9012	.	326	P25116	PAR1_HUMAN	L	326	ENSP00000321326:F326L	ENSP00000321326:F326L	F	+	3	2	F2R	76064784	0.998000	0.40836	0.989000	0.46669	0.821000	0.46438	0.481000	0.22260	-0.506000	0.06558	0.561000	0.74099	TTC	F2R	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,prints_Protea_act_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181104		0.507	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	HGNC	protein_coding	OTTHUMT00000254068.2	229	0.00	0	C			76029028	76029028	+1	no_errors	ENST00000319211	ensembl	human	known	69_37n	missense	139	19.65	34	SNP	0.998	G
F2R	2149	genome.wustl.edu	37	5	76029028	76029028	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr5:76029028C>G	ENST00000319211.4	+	2	1243	c.978C>G	c.(976-978)ttC>ttG	p.F326L		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	326					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TCATTTGCTTCGGACCCACAA	0.507																																						dbGAP											0													161.0	126.0	138.0					5																	76029028		2203	4300	6503	-	-	-	SO:0001583	missense	0			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.978C>G	5.37:g.76029028C>G	ENSP00000321326:p.Phe326Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Thrmbn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Protea_act_rcpt,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.F326L	ENST00000319211.4	37	c.978	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	C	19.47	3.832931	0.71258	.	.	ENSG00000181104	ENST00000319211	T	0.72615	-0.67	4.7	-2.73	0.05950	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81173	0.4767	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81116	-0.1079	10	0.87932	D	0	-30.1638	12.5522	0.56233	0.0:0.0988:0.0:0.9012	.	326	P25116	PAR1_HUMAN	L	326	ENSP00000321326:F326L	ENSP00000321326:F326L	F	+	3	2	F2R	76064784	0.998000	0.40836	0.989000	0.46669	0.821000	0.46438	0.481000	0.22260	-0.506000	0.06558	0.561000	0.74099	TTC	F2R	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,prints_Protea_act_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181104		0.507	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	HGNC	protein_coding	OTTHUMT00000254068.2	109	0.00	0	C			76029028	76029028	+1	no_errors	ENST00000319211	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	0.998	G
FAM13B	51306	genome.wustl.edu	37	5	137289955	137289955	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr5:137289955G>A	ENST00000033079.3	-	14	2003	c.1552C>T	c.(1552-1554)Cca>Tca	p.P518S	FAM13B_ENST00000425075.2_Missense_Mutation_p.P422S|FAM13B_ENST00000420893.2_Missense_Mutation_p.P518S	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	518					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						GATAATACTGGAGGACAGTCC	0.453																																						dbGAP											0													104.0	103.0	104.0					5																	137289955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1552C>T	5.37:g.137289955G>A	ENSP00000033079:p.Pro518Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P518S	ENST00000033079.3	37	c.1552	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843964	0.91197	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95103	-3.61;1.54;-3.61	5.49	5.49	0.81192	.	0.133774	0.52532	D	0.000075	D	0.97213	0.9089	M	0.78456	2.415	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.96;0.998;0.913	D	0.97536	1.0083	10	0.66056	D	0.02	-5.8371	18.3606	0.90372	0.0:0.0:1.0:0.0	.	422;518;518	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	S	518;422;518	ENSP00000033079:P518S;ENSP00000394669:P422S;ENSP00000388521:P518S	ENSP00000033079:P518S	P	-	1	0	FAM13B	137317854	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.460000	0.90369	2.576000	0.86940	0.585000	0.79938	CCA	FAM13B	-	NULL	ENSG00000031003		0.453	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	133	0.00	0	G			137289955	137289955	-1	no_errors	ENST00000033079	ensembl	human	known	69_37n	missense	53	50.46	55	SNP	1.000	A
FAM13B	51306	genome.wustl.edu	37	5	137289955	137289955	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr5:137289955G>A	ENST00000033079.3	-	14	2003	c.1552C>T	c.(1552-1554)Cca>Tca	p.P518S	FAM13B_ENST00000425075.2_Missense_Mutation_p.P422S|FAM13B_ENST00000420893.2_Missense_Mutation_p.P518S	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	518					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						GATAATACTGGAGGACAGTCC	0.453																																						dbGAP											0													104.0	103.0	104.0					5																	137289955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1552C>T	5.37:g.137289955G>A	ENSP00000033079:p.Pro518Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P518S	ENST00000033079.3	37	c.1552	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843964	0.91197	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95103	-3.61;1.54;-3.61	5.49	5.49	0.81192	.	0.133774	0.52532	D	0.000075	D	0.97213	0.9089	M	0.78456	2.415	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.96;0.998;0.913	D	0.97536	1.0083	10	0.66056	D	0.02	-5.8371	18.3606	0.90372	0.0:0.0:1.0:0.0	.	422;518;518	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	S	518;422;518	ENSP00000033079:P518S;ENSP00000394669:P422S;ENSP00000388521:P518S	ENSP00000033079:P518S	P	-	1	0	FAM13B	137317854	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.460000	0.90369	2.576000	0.86940	0.585000	0.79938	CCA	FAM13B	-	NULL	ENSG00000031003		0.453	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	42	0.00	0	G			137289955	137289955	-1	no_errors	ENST00000033079	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	1.000	A
FAM21C	253725	genome.wustl.edu	37	10	46261214	46261214	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:46261214T>A	ENST00000336378.4	+	19	1943	c.1825T>A	c.(1825-1827)Tcc>Acc	p.S609T	FAM21C_ENST00000540872.1_Missense_Mutation_p.S609T|FAM21C_ENST00000359860.4_Missense_Mutation_p.S553T|FAM21C_ENST00000537517.1_Missense_Mutation_p.S585T|FAM21C_ENST00000374362.2_Missense_Mutation_p.S609T	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	609					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CTCCGAGCTCTCCAAAAAGAA	0.428																																						dbGAP											0													55.0	58.0	57.0					10																	46261214		1801	4063	5864	-	-	-	SO:0001583	missense	0				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1825T>A	10.37:g.46261214T>A	ENSP00000337541:p.Ser609Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	NULL	p.S609T	ENST00000336378.4	37	c.1825		10	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273403	0.23221	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.18	-2.49	0.06403	.	0.980375	0.08370	N	0.956310	T	0.30759	0.0775	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.23249	0.066;0.082;0.001;0.008	B;B;B;B	0.24006	0.05;0.048;0.005;0.013	T	0.33828	-0.9853	9	0.15952	T	0.53	0.0037	9.1537	0.36978	0.0:0.701:0.0:0.299	.	585;609;609;554	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	T	609;609;585;609;609;553;521	.	ENSP00000337541:S609T	S	+	1	0	FAM21C	45581220	0.000000	0.05858	0.000000	0.03702	0.829000	0.46940	-0.374000	0.07484	-0.359000	0.08150	0.404000	0.27445	TCC	FAM21C	-	NULL	ENSG00000172661		0.428	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	FAM21C	HGNC	protein_coding		302	0.00	0	T			46261214	46261214	+1	no_errors	ENST00000374362	ensembl	human	known	69_37n	missense	319	32.13	151	SNP	0.000	A
FAM21C	253725	genome.wustl.edu	37	10	46261214	46261214	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr10:46261214T>A	ENST00000336378.4	+	19	1943	c.1825T>A	c.(1825-1827)Tcc>Acc	p.S609T	FAM21C_ENST00000540872.1_Missense_Mutation_p.S609T|FAM21C_ENST00000359860.4_Missense_Mutation_p.S553T|FAM21C_ENST00000537517.1_Missense_Mutation_p.S585T|FAM21C_ENST00000374362.2_Missense_Mutation_p.S609T	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	609					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CTCCGAGCTCTCCAAAAAGAA	0.428																																						dbGAP											0													55.0	58.0	57.0					10																	46261214		1801	4063	5864	-	-	-	SO:0001583	missense	0				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1825T>A	10.37:g.46261214T>A	ENSP00000337541:p.Ser609Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	NULL	p.S609T	ENST00000336378.4	37	c.1825		10	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273403	0.23221	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.18	-2.49	0.06403	.	0.980375	0.08370	N	0.956310	T	0.30759	0.0775	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.23249	0.066;0.082;0.001;0.008	B;B;B;B	0.24006	0.05;0.048;0.005;0.013	T	0.33828	-0.9853	9	0.15952	T	0.53	0.0037	9.1537	0.36978	0.0:0.701:0.0:0.299	.	585;609;609;554	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	T	609;609;585;609;609;553;521	.	ENSP00000337541:S609T	S	+	1	0	FAM21C	45581220	0.000000	0.05858	0.000000	0.03702	0.829000	0.46940	-0.374000	0.07484	-0.359000	0.08150	0.404000	0.27445	TCC	FAM21C	-	NULL	ENSG00000172661		0.428	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	FAM21C	HGNC	protein_coding		201	0.00	0	T			46261214	46261214	+1	no_errors	ENST00000374362	ensembl	human	known	69_37n	missense	140	31.37	64	SNP	0.000	A
PLEKHA3	65977	genome.wustl.edu	37	2	179343153	179343153	+	5'Flank	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:179343153C>G	ENST00000234453.5	+	0	0				FKBP7_ENST00000424785.2_Missense_Mutation_p.R25T|FKBP7_ENST00000464248.1_5'UTR|FKBP7_ENST00000434643.2_Missense_Mutation_p.R25T	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TTTCTTTTGTCTCTGAGCAGT	0.428																																						dbGAP											0													114.0	131.0	125.0					2																	179343153		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446		2.37:g.179343153C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG69|Q86TQ1|Q9NXT3	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.R25T	ENST00000234453.5	37	c.74	CCDS33336.1	2	.	.	.	.	.	.	.	.	.	.	C	9.890	1.203883	0.22121	.	.	ENSG00000079150	ENST00000424785;ENST00000350591;ENST00000434643	T;T	0.41758	0.99;1.0	5.83	3.81	0.43845	.	1.146790	0.06135	N	0.671314	T	0.19287	0.0463	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.22211	0.039;0.066;0.0	B;B;B	0.20955	0.019;0.032;0.0	T	0.27706	-1.0066	10	0.12103	T	0.63	-17.539	7.8327	0.29353	0.0:0.7122:0.0:0.2878	.	25;25;25	B4DRE2;Q9Y680-3;Q9Y680-2	.;.;.	T	25	ENSP00000413152:R25T;ENSP00000415486:R25T	ENSP00000233092:R25T	R	-	2	0	FKBP7	179051399	0.002000	0.14202	0.917000	0.36280	0.140000	0.21249	0.368000	0.20399	0.614000	0.30107	0.561000	0.74099	AGA	FKBP7	-	NULL	ENSG00000079150		0.428	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP7	HGNC	protein_coding	OTTHUMT00000335241.2	143	0.00	0	C	NM_019091		179343153	179343153	-1	no_errors	ENST00000424785	ensembl	human	known	69_37n	missense	193	20.58	50	SNP	0.129	G
PLEKHA3	65977	genome.wustl.edu	37	2	179343153	179343153	+	5'Flank	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:179343153C>G	ENST00000234453.5	+	0	0				FKBP7_ENST00000424785.2_Missense_Mutation_p.R25T|FKBP7_ENST00000464248.1_5'UTR|FKBP7_ENST00000434643.2_Missense_Mutation_p.R25T	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TTTCTTTTGTCTCTGAGCAGT	0.428																																						dbGAP											0													114.0	131.0	125.0					2																	179343153		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446		2.37:g.179343153C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG69|Q86TQ1|Q9NXT3	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.R25T	ENST00000234453.5	37	c.74	CCDS33336.1	2	.	.	.	.	.	.	.	.	.	.	C	9.890	1.203883	0.22121	.	.	ENSG00000079150	ENST00000424785;ENST00000350591;ENST00000434643	T;T	0.41758	0.99;1.0	5.83	3.81	0.43845	.	1.146790	0.06135	N	0.671314	T	0.19287	0.0463	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.22211	0.039;0.066;0.0	B;B;B	0.20955	0.019;0.032;0.0	T	0.27706	-1.0066	10	0.12103	T	0.63	-17.539	7.8327	0.29353	0.0:0.7122:0.0:0.2878	.	25;25;25	B4DRE2;Q9Y680-3;Q9Y680-2	.;.;.	T	25	ENSP00000413152:R25T;ENSP00000415486:R25T	ENSP00000233092:R25T	R	-	2	0	FKBP7	179051399	0.002000	0.14202	0.917000	0.36280	0.140000	0.21249	0.368000	0.20399	0.614000	0.30107	0.561000	0.74099	AGA	FKBP7	-	NULL	ENSG00000079150		0.428	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP7	HGNC	protein_coding	OTTHUMT00000335241.2	36	0.00	0	C	NM_019091		179343153	179343153	-1	no_errors	ENST00000424785	ensembl	human	known	69_37n	missense	55	14.06	9	SNP	0.129	G
FLG2	388698	genome.wustl.edu	37	1	152329634	152329634	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:152329634T>A	ENST00000388718.5	-	3	700	c.628A>T	c.(628-630)Aag>Tag	p.K210*	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	210	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTGTGACTTGTTTATTCTT	0.463																																						dbGAP											0													226.0	229.0	228.0					1																	152329634		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.628A>T	1.37:g.152329634T>A	ENSP00000373370:p.Lys210*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Nonsense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.K210*	ENST00000388718.5	37	c.628	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.023931	0.54683	.	.	ENSG00000143520	ENST00000388718	.	.	.	5.43	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2474	6.9624	0.24605	0.0:0.1829:0.0:0.8171	.	.	.	.	X	210	.	ENSP00000373370:K210X	K	-	1	0	FLG2	150596258	0.995000	0.38212	0.738000	0.30950	0.008000	0.06430	2.080000	0.41586	0.368000	0.24481	-0.256000	0.11100	AAG	FLG2	-	NULL	ENSG00000143520		0.463	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	406	0.00	0	T	NM_001014342		152329634	152329634	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	nonsense	887	10.85	108	SNP	0.804	A
FLG2	388698	genome.wustl.edu	37	1	152329634	152329634	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:152329634T>A	ENST00000388718.5	-	3	700	c.628A>T	c.(628-630)Aag>Tag	p.K210*	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	210	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTGTGACTTGTTTATTCTT	0.463																																						dbGAP											0													226.0	229.0	228.0					1																	152329634		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.628A>T	1.37:g.152329634T>A	ENSP00000373370:p.Lys210*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Nonsense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.K210*	ENST00000388718.5	37	c.628	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.023931	0.54683	.	.	ENSG00000143520	ENST00000388718	.	.	.	5.43	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2474	6.9624	0.24605	0.0:0.1829:0.0:0.8171	.	.	.	.	X	210	.	ENSP00000373370:K210X	K	-	1	0	FLG2	150596258	0.995000	0.38212	0.738000	0.30950	0.008000	0.06430	2.080000	0.41586	0.368000	0.24481	-0.256000	0.11100	AAG	FLG2	-	NULL	ENSG00000143520		0.463	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	96	0.00	0	T	NM_001014342		152329634	152329634	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	nonsense	83	15.31	15	SNP	0.804	A
FLNC	2318	genome.wustl.edu	37	7	128485245	128485245	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:128485245C>T	ENST00000325888.8	+	21	3987	c.3726C>T	c.(3724-3726)gtC>gtT	p.V1242V	FLNC_ENST00000346177.6_Silent_p.V1242V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1242					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CCACCCGTGTCCATGTGCAGC	0.592																																						dbGAP											0													50.0	57.0	55.0					7																	128485245		2168	4258	6426	-	-	-	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3726C>T	7.37:g.128485245C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V1242	ENST00000325888.8	37	c.3726	CCDS43644.1	7																																																																																			FLNC	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.592	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	54	0.00	0	C			128485245	128485245	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	silent	69	16.87	14	SNP	0.927	T
FLNC	2318	genome.wustl.edu	37	7	128485245	128485245	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:128485245C>T	ENST00000325888.8	+	21	3987	c.3726C>T	c.(3724-3726)gtC>gtT	p.V1242V	FLNC_ENST00000346177.6_Silent_p.V1242V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1242					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CCACCCGTGTCCATGTGCAGC	0.592																																						dbGAP											0													50.0	57.0	55.0					7																	128485245		2168	4258	6426	-	-	-	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3726C>T	7.37:g.128485245C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V1242	ENST00000325888.8	37	c.3726	CCDS43644.1	7																																																																																			FLNC	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.592	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	104	0.00	0	C			128485245	128485245	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	silent	68	19.05	16	SNP	0.927	T
FRG2B	441581	genome.wustl.edu	37	10	135438635	135438635	+	Missense_Mutation	SNP	T	T	G	rs199913567		TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:135438635T>G	ENST00000425520.1	-	4	857	c.805A>C	c.(805-807)Act>Cct	p.T269P	FRG2B_ENST00000443774.1_Missense_Mutation_p.T270P	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	269						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CCACTGACAGTCTCAGTTATC	0.552																																						dbGAP											0													1.0	1.0	1.0					10																	135438635		315	849	1164	-	-	-	SO:0001583	missense	0			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.805A>C	10.37:g.135438635T>G	ENSP00000401310:p.Thr269Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSQ1	Missense_Mutation	SNP	NULL	p.T270P	ENST00000425520.1	37	c.808	CCDS44502.1	10	.	.	.	.	.	.	.	.	.	.	.	0	-2.836042	0.00069	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.30448	1.53;1.54	0.109	-0.218	0.13142	.	13.202500	0.00868	N	0.001990	T	0.10165	0.0249	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32955	-0.9887	9	0.02654	T	1	5.5293	.	.	.	.	269	Q96QU4	FRG2B_HUMAN	P	270;269	ENSP00000408343:T270P;ENSP00000401310:T269P	ENSP00000401310:T269P	T	-	1	0	FRG2B	135288625	0.003000	0.15002	0.042000	0.18584	0.043000	0.13939	-3.693000	0.00391	-3.055000	0.00258	-3.107000	0.00063	ACT	FRG2B	-	NULL	ENSG00000225899		0.552	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	9	0.00	0	T	NM_001080998		135438635	135438635	-1	no_errors	ENST00000443774	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	0.051	G
FYTTD1	84248	genome.wustl.edu	37	3	197505308	197505308	+	Silent	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr3:197505308G>A	ENST00000241502.4	+	8	1053	c.831G>A	c.(829-831)caG>caA	p.Q277Q	FYTTD1_ENST00000424384.2_Silent_p.Q210Q|FYTTD1_ENST00000415708.2_Silent_p.Q251Q|FYTTD1_ENST00000492360.1_3'UTR|FYTTD1_ENST00000428395.2_Silent_p.Q186Q	NM_032288.6	NP_115664.2	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1	277					mRNA export from nucleus (GO:0006406)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		TTCCCCTGCAGTTTGACATAA	0.353																																						dbGAP											0													74.0	73.0	73.0					3																	197505308		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ344094	CCDS3329.1, CCDS43196.1, CCDS43196.2	3q29	2011-03-03			ENSG00000122068	ENSG00000122068			25407	protein-coding gene	gene with protein product	"""UAP56-interacting factor"""					19836239	Standard	NM_001011537		Approved	DKFZp761B1514, UIF	uc003fyi.2	Q96QD9	OTTHUMG00000155453	ENST00000241502.4:c.831G>A	3.37:g.197505308G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY74|B2RCB2|B7Z3R4|B7Z7V1|B7Z8I0|B7ZAJ3|C9J7P6|C9JNG6|C9JTH3|C9JY50|Q96SL9|Q9BQI8	Silent	SNP	pfam_DUF1346	p.Q277	ENST00000241502.4	37	c.831	CCDS3329.1	3																																																																																			FYTTD1	-	pfam_DUF1346	ENSG00000122068		0.353	FYTTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYTTD1	HGNC	protein_coding	OTTHUMT00000340185.3	138	0.00	0	G	NM_032288		197505308	197505308	+1	no_errors	ENST00000241502	ensembl	human	known	69_37n	silent	139	30.15	60	SNP	1.000	A
FYTTD1	84248	genome.wustl.edu	37	3	197505308	197505308	+	Silent	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr3:197505308G>A	ENST00000241502.4	+	8	1053	c.831G>A	c.(829-831)caG>caA	p.Q277Q	FYTTD1_ENST00000424384.2_Silent_p.Q210Q|FYTTD1_ENST00000415708.2_Silent_p.Q251Q|FYTTD1_ENST00000492360.1_3'UTR|FYTTD1_ENST00000428395.2_Silent_p.Q186Q	NM_032288.6	NP_115664.2	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1	277					mRNA export from nucleus (GO:0006406)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		TTCCCCTGCAGTTTGACATAA	0.353																																						dbGAP											0													74.0	73.0	73.0					3																	197505308		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ344094	CCDS3329.1, CCDS43196.1, CCDS43196.2	3q29	2011-03-03			ENSG00000122068	ENSG00000122068			25407	protein-coding gene	gene with protein product	"""UAP56-interacting factor"""					19836239	Standard	NM_001011537		Approved	DKFZp761B1514, UIF	uc003fyi.2	Q96QD9	OTTHUMG00000155453	ENST00000241502.4:c.831G>A	3.37:g.197505308G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY74|B2RCB2|B7Z3R4|B7Z7V1|B7Z8I0|B7ZAJ3|C9J7P6|C9JNG6|C9JTH3|C9JY50|Q96SL9|Q9BQI8	Silent	SNP	pfam_DUF1346	p.Q277	ENST00000241502.4	37	c.831	CCDS3329.1	3																																																																																			FYTTD1	-	pfam_DUF1346	ENSG00000122068		0.353	FYTTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYTTD1	HGNC	protein_coding	OTTHUMT00000340185.3	89	0.00	0	G	NM_032288		197505308	197505308	+1	no_errors	ENST00000241502	ensembl	human	known	69_37n	silent	54	28.00	21	SNP	1.000	A
GCLC	2729	genome.wustl.edu	37	6	53373506	53373506	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr6:53373506C>G	ENST00000229416.6	-	8	1315	c.832G>C	c.(832-834)Gct>Cct	p.A278P	RP1-27K12.4_ENST00000508884.1_RNA	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	278					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	GCACTCAAAGCCATCTAAAAA	0.408																																						dbGAP											0													98.0	93.0	95.0					6																	53373506		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.832G>C	6.37:g.53373506C>G	ENSP00000229416:p.Ala278Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14399	Missense_Mutation	SNP	pfam_GCS	p.A278P	ENST00000229416.6	37	c.832	CCDS4952.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.350975	0.95830	.	.	ENSG00000001084	ENST00000229416	D	0.86497	-2.13	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.95389	0.8503	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96079	0.9052	10	0.87932	D	0	-24.4861	19.5569	0.95354	0.0:1.0:0.0:0.0	.	278	P48506	GSH1_HUMAN	P	278	ENSP00000229416:A278P	ENSP00000229416:A278P	A	-	1	0	GCLC	53481465	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.694000	0.91930	0.557000	0.71058	GCT	GCLC	-	pfam_GCS	ENSG00000001084		0.408	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLC	HGNC	protein_coding	OTTHUMT00000359710.2	139	0.00	0	C			53373506	53373506	-1	no_errors	ENST00000229416	ensembl	human	known	69_37n	missense	63	50.00	63	SNP	1.000	G
GCLC	2729	genome.wustl.edu	37	6	53373506	53373506	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr6:53373506C>G	ENST00000229416.6	-	8	1315	c.832G>C	c.(832-834)Gct>Cct	p.A278P	RP1-27K12.4_ENST00000508884.1_RNA	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	278					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	GCACTCAAAGCCATCTAAAAA	0.408																																						dbGAP											0													98.0	93.0	95.0					6																	53373506		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.832G>C	6.37:g.53373506C>G	ENSP00000229416:p.Ala278Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14399	Missense_Mutation	SNP	pfam_GCS	p.A278P	ENST00000229416.6	37	c.832	CCDS4952.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.350975	0.95830	.	.	ENSG00000001084	ENST00000229416	D	0.86497	-2.13	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.95389	0.8503	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96079	0.9052	10	0.87932	D	0	-24.4861	19.5569	0.95354	0.0:1.0:0.0:0.0	.	278	P48506	GSH1_HUMAN	P	278	ENSP00000229416:A278P	ENSP00000229416:A278P	A	-	1	0	GCLC	53481465	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.694000	0.91930	0.557000	0.71058	GCT	GCLC	-	pfam_GCS	ENSG00000001084		0.408	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLC	HGNC	protein_coding	OTTHUMT00000359710.2	23	0.00	0	C			53373506	53373506	-1	no_errors	ENST00000229416	ensembl	human	known	69_37n	missense	13	55.17	16	SNP	1.000	G
GHRL	51738	genome.wustl.edu	37	3	10328735	10328735	+	Intron	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr3:10328735C>G	ENST00000335542.8	-	5	1096				GHRLOS_ENST00000439539.3_RNA|GHRL_ENST00000476283.1_5'UTR|GHRL_ENST00000457360.1_Intron|GHRL_ENST00000449238.2_Intron|GHRL_ENST00000449554.2_Intron|GHRL_ENST00000437422.2_Intron|GHRL_ENST00000430179.1_Intron|LINC00852_ENST00000475197.1_RNA|GHRL_ENST00000429122.1_Intron|GHRL_ENST00000422159.1_Intron|LINC00852_ENST00000538717.1_RNA|GHRL_ENST00000450603.1_Intron|GHRL_ENST00000446937.2_Intron|GHRLOS_ENST00000605105.1_RNA|GHRL_ENST00000439975.2_Intron|GHRL_ENST00000287656.7_Intron|GHRLOS_ENST00000605014.1_RNA|GHRLOS_ENST00000603771.1_RNA			Q9UBU3	GHRL_HUMAN	ghrelin/obestatin prepropeptide						actin polymerization or depolymerization (GO:0008154)|activation of MAPK activity (GO:0000187)|adult feeding behavior (GO:0008343)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|cortisol secretion (GO:0043400)|decidualization (GO:0046697)|dendrite development (GO:0016358)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|glucose metabolic process (GO:0006006)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of locomotion (GO:0040013)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of synapse assembly (GO:0051965)|regulation of cell proliferation (GO:0042127)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to estrogen (GO:0043627)|response to hormone (GO:0009725)	axon (GO:0030424)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|ghrelin receptor binding (GO:0031768)|growth hormone-releasing hormone activity (GO:0016608)|protein tyrosine kinase activator activity (GO:0030296)			breast(2)|large_intestine(1)|lung(1)|ovary(1)	5						GCCTCTCAGCCTTAGCCTCTA	0.478											OREG0015386	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													230.0	187.0	200.0					3																	10328735		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF296558	CCDS33700.1, CCDS46747.1, CCDS46748.1, CCDS46749.1, CCDS46750.1	3p26-p25	2013-02-26	2008-07-02		ENSG00000157017	ENSG00000157017		"""Endogenous ligands"""	18129	protein-coding gene	gene with protein product	"""prepro-appetite regulatory hormone"""	605353	"""ghrelin, growth hormone secretagogue receptor ligand"""			10930375, 10604470, 16284174	Standard	NR_024133		Approved	MTLRP, ghrelin, obestatin	uc010hdj.2	Q9UBU3	OTTHUMG00000155360	ENST00000335542.8:c.226-239G>C	3.37:g.10328735C>G		Somatic	663	WXS	Illumina GAIIx	Phase_IV	A8CF34|A8CF38|A8CF42|A8DN29|A8DN30|Q86YP8|Q8TAT9|Q9H3R3	RNA	SNP	-	NULL	ENST00000335542.8	37	NULL	CCDS33700.1	3																																																																																			GHRL	-	-	ENSG00000157017		0.478	GHRL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GHRL	HGNC	protein_coding	OTTHUMT00000339625.1	71	0.00	0	C	NM_016362		10328735	10328735	-1	no_errors	ENST00000475759	ensembl	human	known	69_37n	rna	42	19.23	10	SNP	0.000	G
HAS2	3037	genome.wustl.edu	37	8	122626391	122626391	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr8:122626391C>A	ENST00000303924.4	-	4	2154	c.1617G>T	c.(1615-1617)agG>agT	p.R539S		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	539					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CCTTCTTCCGCCTGCCACACT	0.433																																						dbGAP											0													199.0	170.0	180.0					8																	122626391		2203	4300	6503	-	-	-	SO:0001583	missense	0			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1617G>T	8.37:g.122626391C>A	ENSP00000306991:p.Arg539Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MM3	Missense_Mutation	SNP	pfam_Chitin_synth_fng	p.R539S	ENST00000303924.4	37	c.1617	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393849	0.42410	.	.	ENSG00000170961	ENST00000303924	T	0.48522	0.81	6.17	6.17	0.99709	.	0.038871	0.85682	D	0.000000	T	0.50000	0.1590	L	0.54323	1.7	0.58432	D	0.999991	B	0.25563	0.129	B	0.26614	0.071	T	0.38779	-0.9645	10	0.49607	T	0.09	-23.1311	20.8794	0.99867	0.0:1.0:0.0:0.0	.	539	Q92819	HAS2_HUMAN	S	539	ENSP00000306991:R539S	ENSP00000306991:R539S	R	-	3	2	HAS2	122695572	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.926000	0.63433	2.941000	0.99782	0.655000	0.94253	AGG	HAS2	-	NULL	ENSG00000170961		0.433	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	HGNC	protein_coding	OTTHUMT00000381150.2	276	0.00	0	C	NM_005328		122626391	122626391	-1	no_errors	ENST00000303924	ensembl	human	known	69_37n	missense	410	23.08	123	SNP	1.000	A
HAS2	3037	genome.wustl.edu	37	8	122626391	122626391	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr8:122626391C>A	ENST00000303924.4	-	4	2154	c.1617G>T	c.(1615-1617)agG>agT	p.R539S		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	539					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CCTTCTTCCGCCTGCCACACT	0.433																																						dbGAP											0													199.0	170.0	180.0					8																	122626391		2203	4300	6503	-	-	-	SO:0001583	missense	0			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1617G>T	8.37:g.122626391C>A	ENSP00000306991:p.Arg539Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MM3	Missense_Mutation	SNP	pfam_Chitin_synth_fng	p.R539S	ENST00000303924.4	37	c.1617	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393849	0.42410	.	.	ENSG00000170961	ENST00000303924	T	0.48522	0.81	6.17	6.17	0.99709	.	0.038871	0.85682	D	0.000000	T	0.50000	0.1590	L	0.54323	1.7	0.58432	D	0.999991	B	0.25563	0.129	B	0.26614	0.071	T	0.38779	-0.9645	10	0.49607	T	0.09	-23.1311	20.8794	0.99867	0.0:1.0:0.0:0.0	.	539	Q92819	HAS2_HUMAN	S	539	ENSP00000306991:R539S	ENSP00000306991:R539S	R	-	3	2	HAS2	122695572	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.926000	0.63433	2.941000	0.99782	0.655000	0.94253	AGG	HAS2	-	NULL	ENSG00000170961		0.433	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	HGNC	protein_coding	OTTHUMT00000381150.2	37	0.00	0	C	NM_005328		122626391	122626391	-1	no_errors	ENST00000303924	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	A
IER5	51278	genome.wustl.edu	37	1	181058504	181058504	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:181058504G>C	ENST00000367577.4	+	1	867	c.466G>C	c.(466-468)Gag>Cag	p.E156Q	RP11-309G3.3_ENST00000606938.1_lincRNA	NM_016545.4	NP_057629.2	Q5VY09	IER5_HUMAN	immediate early response 5	156										lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	4						CAGAGAAGCCGAGGGTACCGC	0.751																																						dbGAP											0													4.0	6.0	5.0					1																	181058504		1986	3870	5856	-	-	-	SO:0001583	missense	0			BC000128	CCDS1343.1	1q25.3	2008-02-05			ENSG00000162783	ENSG00000162783			5393	protein-coding gene	gene with protein product		607177				10049588, 11102586	Standard	NM_016545		Approved		uc001got.4	Q5VY09	OTTHUMG00000035178	ENST00000367577.4:c.466G>C	1.37:g.181058504G>C	ENSP00000356549:p.Glu156Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV3|Q8WY68|Q9NY49|Q9NZP9	Missense_Mutation	SNP	pfam_IER	p.E156Q	ENST00000367577.4	37	c.466	CCDS1343.1	1	.	.	.	.	.	.	.	.	.	.	G	1.717	-0.497570	0.04291	.	.	ENSG00000162783	ENST00000367577	T	0.11712	2.75	2.27	-0.274	0.12910	.	.	.	.	.	T	0.05868	0.0153	N	0.22421	0.69	0.09310	N	1	B	0.32573	0.376	B	0.36289	0.221	T	0.40924	-0.9537	9	0.14252	T	0.57	.	2.1352	0.03760	0.3598:0.0:0.3939:0.2464	.	156	Q5VY09	IER5_HUMAN	Q	156	ENSP00000356549:E156Q	ENSP00000356549:E156Q	E	+	1	0	IER5	179325127	0.000000	0.05858	0.009000	0.14445	0.037000	0.13140	0.205000	0.17356	0.094000	0.17404	0.448000	0.29417	GAG	IER5	-	pfam_IER	ENSG00000162783		0.751	IER5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IER5	HGNC	protein_coding	OTTHUMT00000085142.1	10	0.00	0	G	NM_016545		181058504	181058504	+1	no_errors	ENST00000367577	ensembl	human	known	69_37n	missense	2	77.78	7	SNP	0.000	C
IGKV3D-20	28874	genome.wustl.edu	37	2	90078144	90078144	+	RNA	SNP	C	C	A	rs72490097		TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:90078144C>A	ENST00000390270.2	+	0	278									immunoglobulin kappa variable 3D-20																		CCAGCAGAAACCTGGCCTGGC	0.597																																						dbGAP											0													75.0	75.0	75.0					2																	90078144		1891	4119	6010	-	-	-			0			X12687		2p11.2	2012-02-08			ENSG00000211625	ENSG00000211625		"""Immunoglobulins / IGK locus"""	5825	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151615		2.37:g.90078144C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P61T	ENST00000390270.2	37	c.181		2																																																																																			IGKV3D-20	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211625		0.597	IGKV3D-20-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV3D-20	HGNC	IG_V_gene	OTTHUMT00000323287.1	257	0.00	0	C	NG_000833		90078144	90078144	+1	no_stop_codon	ENST00000390270	ensembl	human	known	69_37n	missense	226	35.80	126	SNP	0.985	A
IGKV3D-20	28874	genome.wustl.edu	37	2	90078144	90078144	+	RNA	SNP	C	C	A	rs72490097		TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:90078144C>A	ENST00000390270.2	+	0	278									immunoglobulin kappa variable 3D-20																		CCAGCAGAAACCTGGCCTGGC	0.597																																						dbGAP											0													75.0	75.0	75.0					2																	90078144		1891	4119	6010	-	-	-			0			X12687		2p11.2	2012-02-08			ENSG00000211625	ENSG00000211625		"""Immunoglobulins / IGK locus"""	5825	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151615		2.37:g.90078144C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P61T	ENST00000390270.2	37	c.181		2																																																																																			IGKV3D-20	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211625		0.597	IGKV3D-20-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV3D-20	HGNC	IG_V_gene	OTTHUMT00000323287.1	157	0.00	0	C	NG_000833		90078144	90078144	+1	no_stop_codon	ENST00000390270	ensembl	human	known	69_37n	missense	114	28.30	45	SNP	0.985	A
IL22RA1	58985	genome.wustl.edu	37	1	24448186	24448186	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:24448186G>C	ENST00000270800.1	-	7	872	c.834C>G	c.(832-834)atC>atG	p.I278M		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	278					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		CGTGCTCCTGGATGAAGCGCA	0.617																																						dbGAP											0													22.0	23.0	23.0					1																	24448186		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.834C>G	1.37:g.24448186G>C	ENSP00000270800:p.Ile278Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.I278M	ENST00000270800.1	37	c.834	CCDS247.1	1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193074	0.58017	.	.	ENSG00000142677	ENST00000270800	T	0.11063	2.81	4.89	3.98	0.46160	.	0.647124	0.13182	N	0.407394	T	0.11495	0.0280	L	0.32530	0.975	0.27609	N	0.948735	P;P	0.44877	0.845;0.845	P;P	0.45037	0.467;0.467	T	0.10109	-1.0644	10	0.46703	T	0.11	-13.6769	9.3086	0.37889	0.1008:0.0:0.8992:0.0	.	210;278	B4E2V9;Q8N6P7	.;I22R1_HUMAN	M	278	ENSP00000270800:I278M	ENSP00000270800:I278M	I	-	3	3	IL22RA1	24320773	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.007000	0.49536	1.054000	0.40438	0.462000	0.41574	ATC	IL22RA1	-	NULL	ENSG00000142677		0.617	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IL22RA1	HGNC	protein_coding	OTTHUMT00000008412.1	99	0.00	0	G			24448186	24448186	-1	no_errors	ENST00000270800	ensembl	human	known	69_37n	missense	78	25.00	26	SNP	1.000	C
IL22RA1	58985	genome.wustl.edu	37	1	24448186	24448186	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:24448186G>C	ENST00000270800.1	-	7	872	c.834C>G	c.(832-834)atC>atG	p.I278M		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	278					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		CGTGCTCCTGGATGAAGCGCA	0.617																																						dbGAP											0													22.0	23.0	23.0					1																	24448186		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.834C>G	1.37:g.24448186G>C	ENSP00000270800:p.Ile278Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.I278M	ENST00000270800.1	37	c.834	CCDS247.1	1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193074	0.58017	.	.	ENSG00000142677	ENST00000270800	T	0.11063	2.81	4.89	3.98	0.46160	.	0.647124	0.13182	N	0.407394	T	0.11495	0.0280	L	0.32530	0.975	0.27609	N	0.948735	P;P	0.44877	0.845;0.845	P;P	0.45037	0.467;0.467	T	0.10109	-1.0644	10	0.46703	T	0.11	-13.6769	9.3086	0.37889	0.1008:0.0:0.8992:0.0	.	210;278	B4E2V9;Q8N6P7	.;I22R1_HUMAN	M	278	ENSP00000270800:I278M	ENSP00000270800:I278M	I	-	3	3	IL22RA1	24320773	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.007000	0.49536	1.054000	0.40438	0.462000	0.41574	ATC	IL22RA1	-	NULL	ENSG00000142677		0.617	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IL22RA1	HGNC	protein_coding	OTTHUMT00000008412.1	28	0.00	0	G			24448186	24448186	-1	no_errors	ENST00000270800	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	1.000	C
ILK	3611	genome.wustl.edu	37	11	6630488	6630490	+	Intron	DEL	GCA	GCA	-			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr11:6630488_6630490delGCA	ENST00000396751.2	+	7	1074				RP11-732A19.2_ENST00000527398.1_RNA|ILK_ENST00000420936.2_Intron|ILK_ENST00000299421.4_Intron|TAF10_ENST00000531760.1_5'Flank|ILK_ENST00000537806.1_Intron|ILK_ENST00000526711.1_3'UTR|ILK_ENST00000528995.1_Intron	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase						branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		CAAGGAAGTGGCAGCAACATTTC	0.512																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.619-40GCA>-	11.37:g.6630491_6630493delGCA		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	RNA	DEL	-	NULL	ENST00000396751.2	37	NULL	CCDS7768.1	11																																																																																			ILK	-	-	ENSG00000166333		0.512	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ILK	HGNC	protein_coding	OTTHUMT00000384519.1	26	0.00	0	GCA	NM_004517		6630488	6630490	+1	no_errors	ENST00000526711	ensembl	human	known	69_37n	rna	15	16.67	3	DEL	0.000:0.000:0.000	-
INTS4L2	644619	genome.wustl.edu	37	7	65160020	65160020	+	RNA	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:65160020A>G	ENST00000430126.2	+	0	1190							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		TGTTTCTCCCAGCATCATACC	0.483																																						dbGAP											0																																										-	-	-			0			BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65160020A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430126.2	37	NULL		7																																																																																			INTS4L2	-	-	ENSG00000232270		0.483	INTS4L2-002	KNOWN	basic	processed_transcript	INTS4L2	HGNC	pseudogene	OTTHUMT00000345545.2	141	0.00	0	A	NR_027392		65160020	65160020	+1	no_errors	ENST00000430126	ensembl	human	known	69_37n	rna	106	13.82	17	SNP	0.000	G
KCNN4	3783	genome.wustl.edu	37	19	44278610	44278610	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr19:44278610C>T	ENST00000262888.3	-	3	812	c.417G>A	c.(415-417)caG>caA	p.Q139Q		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	139					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CCGGCCAGGGCTGCGGGGAGG	0.736											OREG0025535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													7.0	8.0	8.0					19																	44278610		2147	4215	6362	-	-	-	SO:0001819	synonymous_variant	0			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.417G>A	19.37:g.44278610C>T		Somatic	922	WXS	Illumina GAIIx	Phase_IV	Q53XR4	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom	p.Q139	ENST00000262888.3	37	c.417	CCDS12630.1	19																																																																																			KCNN4	-	NULL	ENSG00000104783		0.736	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNN4	HGNC	protein_coding	OTTHUMT00000463598.1	48	0.00	0	C	NM_002250		44278610	44278610	-1	no_errors	ENST00000262888	ensembl	human	known	69_37n	silent	46	32.35	22	SNP	0.264	T
KIF3B	9371	genome.wustl.edu	37	20	30904100	30904100	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr20:30904100A>T	ENST00000375712.3	+	3	1651	c.1484A>T	c.(1483-1485)aAa>aTa	p.K495I	KIF3B_ENST00000418717.2_Missense_Mutation_p.K121I	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	495					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTGGAGCAGAAACGACAGGAA	0.408																																						dbGAP											0													94.0	97.0	96.0					20																	30904100		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1484A>T	20.37:g.30904100A>T	ENSP00000364864:p.Lys495Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K495I	ENST00000375712.3	37	c.1484	CCDS13200.1	20	.	.	.	.	.	.	.	.	.	.	A	19.31	3.802235	0.70682	.	.	ENSG00000101350	ENST00000375712;ENST00000418717	T;T	0.75821	-0.97;0.32	4.63	4.63	0.57726	.	0.098275	0.64402	D	0.000002	T	0.74935	0.3782	M	0.64567	1.98	0.80722	D	1	P;P	0.51351	0.944;0.904	P;P	0.46362	0.511;0.514	T	0.77316	-0.2633	10	0.46703	T	0.11	.	14.1966	0.65675	1.0:0.0:0.0:0.0	.	121;495	B4DSR5;O15066	.;KIF3B_HUMAN	I	495;121	ENSP00000364864:K495I;ENSP00000406287:K121I	ENSP00000364864:K495I	K	+	2	0	KIF3B	30367761	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.245000	0.58734	1.928000	0.55862	0.459000	0.35465	AAA	KIF3B	-	NULL	ENSG00000101350		0.408	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	184	0.00	0	A	NM_004798		30904100	30904100	+1	no_errors	ENST00000375712	ensembl	human	known	69_37n	missense	302	26.52	109	SNP	1.000	T
KIF3B	9371	genome.wustl.edu	37	20	30904100	30904100	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr20:30904100A>T	ENST00000375712.3	+	3	1651	c.1484A>T	c.(1483-1485)aAa>aTa	p.K495I	KIF3B_ENST00000418717.2_Missense_Mutation_p.K121I	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	495					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTGGAGCAGAAACGACAGGAA	0.408																																						dbGAP											0													94.0	97.0	96.0					20																	30904100		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1484A>T	20.37:g.30904100A>T	ENSP00000364864:p.Lys495Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K495I	ENST00000375712.3	37	c.1484	CCDS13200.1	20	.	.	.	.	.	.	.	.	.	.	A	19.31	3.802235	0.70682	.	.	ENSG00000101350	ENST00000375712;ENST00000418717	T;T	0.75821	-0.97;0.32	4.63	4.63	0.57726	.	0.098275	0.64402	D	0.000002	T	0.74935	0.3782	M	0.64567	1.98	0.80722	D	1	P;P	0.51351	0.944;0.904	P;P	0.46362	0.511;0.514	T	0.77316	-0.2633	10	0.46703	T	0.11	.	14.1966	0.65675	1.0:0.0:0.0:0.0	.	121;495	B4DSR5;O15066	.;KIF3B_HUMAN	I	495;121	ENSP00000364864:K495I;ENSP00000406287:K121I	ENSP00000364864:K495I	K	+	2	0	KIF3B	30367761	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.245000	0.58734	1.928000	0.55862	0.459000	0.35465	AAA	KIF3B	-	NULL	ENSG00000101350		0.408	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	46	0.00	0	A	NM_004798		30904100	30904100	+1	no_errors	ENST00000375712	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	1.000	T
KRT17	3872	genome.wustl.edu	37	17	39782585	39782585	+	5'Flank	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr17:39782585G>C	ENST00000311208.8	-	0	0				KRT42P_ENST00000438131.1_RNA|JUP_ENST00000540235.1_Intron	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17						epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				CATTGAACTTGGAGCAAAGCT	0.532																																					Pancreas(92;1242 2086 39193 50508)	dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505		17.37:g.39782585G>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	RNA	SNP	-	NULL	ENST00000311208.8	37	NULL	CCDS11402.1	17																																																																																			KRT42P	-	-	ENSG00000214514		0.532	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT42P	HGNC	protein_coding	OTTHUMT00000257460.1	15	0.00	0	G	NM_000422		39782585	39782585	-1	no_errors	ENST00000398469	ensembl	human	known	69_37n	rna	9	73.53	25	SNP	0.000	C
KRTAP5-1	387264	genome.wustl.edu	37	11	1606146	1606147	+	In_Frame_Ins	INS	-	-	GCC	rs138363822|rs199501537	byFrequency	TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr11:1606146_1606147insGCC	ENST00000382171.2	-	1	366_367	c.333_334insGGC	c.(331-336)tcttgt>tctGGCtgt	p.111_112SC>SGC	KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	111	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GATCCCCCACAAGAGCCACAGC	0.663																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.333_334insGGC	11.37:g.1606146_1606147insGCC	ENSP00000371606:p.Ser111_Cys112insGly	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Ins	INS	NULL	p.111in_frame_insG	ENST00000382171.2	37	c.334_333	CCDS31330.1	11																																																																																			KRTAP5-1	-	NULL	ENSG00000205869		0.663	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	HGNC	protein_coding	OTTHUMT00000127922.1	15	0.00	0	-	NM_001005922		1606146	1606147	-1	no_errors	ENST00000382171	ensembl	human	known	69_37n	in_frame_ins	14	26.32	5	INS	0.458:0.354	GCC
MACF1	23499	genome.wustl.edu	37	1	39799297	39799297	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:39799297C>T	ENST00000372915.3	+	36	7139	c.7052C>T	c.(7051-7053)aCt>aTt	p.T2351I	MACF1_ENST00000539005.1_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.T2346I|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.T786I|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.T2383I			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2351					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCTTTGACAACTGAAGAAGTC	0.448																																						dbGAP											0													75.0	76.0	76.0					1																	39799297		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.7052C>T	1.37:g.39799297C>T	ENSP00000362006:p.Thr2351Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.T2383I	ENST00000372915.3	37	c.7148		1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.230088	0.39399	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.67523	-0.27;-0.27	5.47	5.47	0.80525	.	0.325397	0.26286	N	0.025246	T	0.54902	0.1887	L	0.39898	1.24	0.80722	D	1	B	0.15473	0.013	B	0.11329	0.006	T	0.49123	-0.8972	10	0.13108	T	0.6	.	12.6518	0.56766	0.0:0.9245:0.0:0.0755	.	2351	Q9UPN3	MACF1_HUMAN	I	2351;786	ENSP00000362006:T2351I;ENSP00000289893:T786I	ENSP00000289893:T786I	T	+	2	0	MACF1	39571884	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	3.563000	0.53784	2.561000	0.86390	0.563000	0.77884	ACT	MACF1	-	superfamily_RNaseH-like_dom,smart_Plectin_repeat	ENSG00000127603		0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	136	0.00	0	C	NM_033044		39799297	39799297	+1	no_errors	ENST00000567887	ensembl	human	putative	69_37n	missense	121	35.29	66	SNP	1.000	T
MACF1	23499	genome.wustl.edu	37	1	39799297	39799297	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:39799297C>T	ENST00000372915.3	+	36	7139	c.7052C>T	c.(7051-7053)aCt>aTt	p.T2351I	MACF1_ENST00000539005.1_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.T2346I|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.T786I|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.T2383I			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2351					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCTTTGACAACTGAAGAAGTC	0.448																																						dbGAP											0													75.0	76.0	76.0					1																	39799297		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.7052C>T	1.37:g.39799297C>T	ENSP00000362006:p.Thr2351Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.T2383I	ENST00000372915.3	37	c.7148		1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.230088	0.39399	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.67523	-0.27;-0.27	5.47	5.47	0.80525	.	0.325397	0.26286	N	0.025246	T	0.54902	0.1887	L	0.39898	1.24	0.80722	D	1	B	0.15473	0.013	B	0.11329	0.006	T	0.49123	-0.8972	10	0.13108	T	0.6	.	12.6518	0.56766	0.0:0.9245:0.0:0.0755	.	2351	Q9UPN3	MACF1_HUMAN	I	2351;786	ENSP00000362006:T2351I;ENSP00000289893:T786I	ENSP00000289893:T786I	T	+	2	0	MACF1	39571884	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	3.563000	0.53784	2.561000	0.86390	0.563000	0.77884	ACT	MACF1	-	superfamily_RNaseH-like_dom,smart_Plectin_repeat	ENSG00000127603		0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	56	0.00	0	C	NM_033044		39799297	39799297	+1	no_errors	ENST00000567887	ensembl	human	putative	69_37n	missense	42	38.24	26	SNP	1.000	T
LRRC8C	84230	genome.wustl.edu	37	1	90152042	90152042	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:90152042G>A	ENST00000370454.4	+	2	265	c.10G>A	c.(10-12)Gtg>Atg	p.V4M	LRRC8C_ENST00000479252.1_3'UTR|RP11-302M6.4_ENST00000370453.5_Missense_Mutation_p.V4M	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	4					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CATGATTCCCGTGACAGAATT	0.458																																						dbGAP											0													109.0	103.0	105.0					1																	90152042		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.10G>A	1.37:g.90152042G>A	ENSP00000359483:p.Val4Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V4M	ENST00000370454.4	37	c.10	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519379	0.85495	.	.	ENSG00000171488	ENST00000370454	T	0.28895	1.59	5.43	5.43	0.79202	Leucine-rich repeat-containing protein 8, N-terminal (1);	0.059624	0.64402	D	0.000003	T	0.30978	0.0782	L	0.56769	1.78	0.54753	D	0.999987	D	0.54397	0.966	P	0.46850	0.529	T	0.16660	-1.0395	10	0.87932	D	0	.	19.2255	0.93816	0.0:0.0:1.0:0.0	.	4	Q8TDW0	LRC8C_HUMAN	M	4	ENSP00000359483:V4M	ENSP00000359482:V4M	V	+	1	0	LRRC8C	89924630	1.000000	0.71417	0.953000	0.39169	0.929000	0.56500	6.346000	0.72999	2.530000	0.85305	0.563000	0.77884	GTG	LRRC8C	-	pfam_LRR_protein-8_N	ENSG00000171488		0.458	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	174	0.00	0	G	NM_032270		90152042	90152042	+1	no_errors	ENST00000370454	ensembl	human	known	69_37n	missense	193	26.05	68	SNP	0.999	A
LRRC8C	84230	genome.wustl.edu	37	1	90152042	90152042	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:90152042G>A	ENST00000370454.4	+	2	265	c.10G>A	c.(10-12)Gtg>Atg	p.V4M	LRRC8C_ENST00000479252.1_3'UTR|RP11-302M6.4_ENST00000370453.5_Missense_Mutation_p.V4M	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	4					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CATGATTCCCGTGACAGAATT	0.458																																						dbGAP											0													109.0	103.0	105.0					1																	90152042		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.10G>A	1.37:g.90152042G>A	ENSP00000359483:p.Val4Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V4M	ENST00000370454.4	37	c.10	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519379	0.85495	.	.	ENSG00000171488	ENST00000370454	T	0.28895	1.59	5.43	5.43	0.79202	Leucine-rich repeat-containing protein 8, N-terminal (1);	0.059624	0.64402	D	0.000003	T	0.30978	0.0782	L	0.56769	1.78	0.54753	D	0.999987	D	0.54397	0.966	P	0.46850	0.529	T	0.16660	-1.0395	10	0.87932	D	0	.	19.2255	0.93816	0.0:0.0:1.0:0.0	.	4	Q8TDW0	LRC8C_HUMAN	M	4	ENSP00000359483:V4M	ENSP00000359482:V4M	V	+	1	0	LRRC8C	89924630	1.000000	0.71417	0.953000	0.39169	0.929000	0.56500	6.346000	0.72999	2.530000	0.85305	0.563000	0.77884	GTG	LRRC8C	-	pfam_LRR_protein-8_N	ENSG00000171488		0.458	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	63	0.00	0	G	NM_032270		90152042	90152042	+1	no_errors	ENST00000370454	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.999	A
MAK16	84549	genome.wustl.edu	37	8	33354179	33354179	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr8:33354179G>C	ENST00000360128.6	+	8	1016	c.559G>C	c.(559-561)Gac>Cac	p.D187H	TTI2_ENST00000519356.1_Intron	NM_032509.3	NP_115898.2	Q9BXY0	MAK16_HUMAN	MAK16 homolog (S. cerevisiae)	187						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	8						TCATGCCTTCGACAAAGCCCT	0.393																																						dbGAP											0													150.0	127.0	135.0					8																	33354179		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251062	CCDS6089.1	8p12	2011-10-13	2008-06-04	2008-06-04	ENSG00000198042	ENSG00000198042		"""RNA binding motif (RRM) containing"""	13703	protein-coding gene	gene with protein product			"""RNA binding motif protein 13"""	RBM13			Standard	NM_032509		Approved	MAK16L	uc003xjj.3	Q9BXY0	OTTHUMG00000163957	ENST00000360128.6:c.559G>C	8.37:g.33354179G>C	ENSP00000353246:p.Asp187His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB44|Q5U5T1|Q86UC4|Q96SY6	Missense_Mutation	SNP	pfam_Mak16,pirsf_Mak16	p.D187H	ENST00000360128.6	37	c.559	CCDS6089.1	8	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211789	0.79240	.	.	ENSG00000198042	ENST00000360128	T	0.44482	0.92	5.8	4.93	0.64822	.	0.089115	0.85682	D	0.000000	T	0.67608	0.2911	M	0.84683	2.71	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.73688	-0.3904	10	0.66056	D	0.02	-26.1122	14.3851	0.66940	0.0712:0.0:0.9288:0.0	.	187	Q9BXY0	MAK16_HUMAN	H	187	ENSP00000353246:D187H	ENSP00000353246:D187H	D	+	1	0	MAK16	33473721	1.000000	0.71417	0.982000	0.44146	0.743000	0.42351	9.413000	0.97351	1.470000	0.48102	0.563000	0.77884	GAC	MAK16	-	pfam_Mak16,pirsf_Mak16	ENSG00000198042		0.393	MAK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK16	HGNC	protein_coding	OTTHUMT00000376559.3	397	0.00	0	G	NM_032509		33354179	33354179	+1	no_errors	ENST00000360128	ensembl	human	known	69_37n	missense	169	33.20	84	SNP	1.000	C
MAK16	84549	genome.wustl.edu	37	8	33354179	33354179	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr8:33354179G>C	ENST00000360128.6	+	8	1016	c.559G>C	c.(559-561)Gac>Cac	p.D187H	TTI2_ENST00000519356.1_Intron	NM_032509.3	NP_115898.2	Q9BXY0	MAK16_HUMAN	MAK16 homolog (S. cerevisiae)	187						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	8						TCATGCCTTCGACAAAGCCCT	0.393																																						dbGAP											0													150.0	127.0	135.0					8																	33354179		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251062	CCDS6089.1	8p12	2011-10-13	2008-06-04	2008-06-04	ENSG00000198042	ENSG00000198042		"""RNA binding motif (RRM) containing"""	13703	protein-coding gene	gene with protein product			"""RNA binding motif protein 13"""	RBM13			Standard	NM_032509		Approved	MAK16L	uc003xjj.3	Q9BXY0	OTTHUMG00000163957	ENST00000360128.6:c.559G>C	8.37:g.33354179G>C	ENSP00000353246:p.Asp187His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB44|Q5U5T1|Q86UC4|Q96SY6	Missense_Mutation	SNP	pfam_Mak16,pirsf_Mak16	p.D187H	ENST00000360128.6	37	c.559	CCDS6089.1	8	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211789	0.79240	.	.	ENSG00000198042	ENST00000360128	T	0.44482	0.92	5.8	4.93	0.64822	.	0.089115	0.85682	D	0.000000	T	0.67608	0.2911	M	0.84683	2.71	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.73688	-0.3904	10	0.66056	D	0.02	-26.1122	14.3851	0.66940	0.0712:0.0:0.9288:0.0	.	187	Q9BXY0	MAK16_HUMAN	H	187	ENSP00000353246:D187H	ENSP00000353246:D187H	D	+	1	0	MAK16	33473721	1.000000	0.71417	0.982000	0.44146	0.743000	0.42351	9.413000	0.97351	1.470000	0.48102	0.563000	0.77884	GAC	MAK16	-	pfam_Mak16,pirsf_Mak16	ENSG00000198042		0.393	MAK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK16	HGNC	protein_coding	OTTHUMT00000376559.3	66	0.00	0	G	NM_032509		33354179	33354179	+1	no_errors	ENST00000360128	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	1.000	C
MMP13	4322	genome.wustl.edu	37	11	102826194	102826194	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr11:102826194G>C	ENST00000260302.3	-	2	177	c.149C>G	c.(148-150)aCa>aGa	p.T50R	MMP13_ENST00000340273.4_Missense_Mutation_p.T50R	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	50					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	CGCGAGATTTGTAGGATGGTA	0.458																																						dbGAP											0													156.0	151.0	153.0					11																	102826194		2202	4299	6501	-	-	-	SO:0001583	missense	0			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.149C>G	11.37:g.102826194G>C	ENSP00000260302:p.Thr50Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.T50R	ENST00000260302.3	37	c.149	CCDS8324.1	11	.	.	.	.	.	.	.	.	.	.	G	0.076	-1.193467	0.01594	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.38560	1.13;1.13	5.67	-11.3	0.00108	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	50.502800	0.00166	N	0.000000	T	0.16685	0.0401	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.17684	-1.0361	10	0.16896	T	0.51	.	0.9717	0.01417	0.1761:0.2184:0.2746:0.3309	.	50	P45452	MMP13_HUMAN	R	50	ENSP00000260302:T50R;ENSP00000339672:T50R	ENSP00000260302:T50R	T	-	2	0	MMP13	102331404	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.365000	0.07573	-2.498000	0.00512	-0.768000	0.03414	ACA	MMP13	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_matrix_strom	ENSG00000137745		0.458	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MMP13	HGNC	protein_coding	OTTHUMT00000386648.1	194	0.00	0	G	NM_002427		102826194	102826194	-1	no_errors	ENST00000340273	ensembl	human	novel	69_37n	missense	163	21.63	45	SNP	0.000	C
MMP13	4322	genome.wustl.edu	37	11	102826194	102826194	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr11:102826194G>C	ENST00000260302.3	-	2	177	c.149C>G	c.(148-150)aCa>aGa	p.T50R	MMP13_ENST00000340273.4_Missense_Mutation_p.T50R	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	50					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	CGCGAGATTTGTAGGATGGTA	0.458																																						dbGAP											0													156.0	151.0	153.0					11																	102826194		2202	4299	6501	-	-	-	SO:0001583	missense	0			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.149C>G	11.37:g.102826194G>C	ENSP00000260302:p.Thr50Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.T50R	ENST00000260302.3	37	c.149	CCDS8324.1	11	.	.	.	.	.	.	.	.	.	.	G	0.076	-1.193467	0.01594	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.38560	1.13;1.13	5.67	-11.3	0.00108	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	50.502800	0.00166	N	0.000000	T	0.16685	0.0401	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.17684	-1.0361	10	0.16896	T	0.51	.	0.9717	0.01417	0.1761:0.2184:0.2746:0.3309	.	50	P45452	MMP13_HUMAN	R	50	ENSP00000260302:T50R;ENSP00000339672:T50R	ENSP00000260302:T50R	T	-	2	0	MMP13	102331404	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.365000	0.07573	-2.498000	0.00512	-0.768000	0.03414	ACA	MMP13	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_matrix_strom	ENSG00000137745		0.458	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MMP13	HGNC	protein_coding	OTTHUMT00000386648.1	77	0.00	0	G	NM_002427		102826194	102826194	-1	no_errors	ENST00000340273	ensembl	human	novel	69_37n	missense	34	29.17	14	SNP	0.000	C
MUC12	10071	genome.wustl.edu	37	7	100639970	100639970	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:100639970C>T	ENST00000379442.3	+	5	6555	c.6555C>T	c.(6553-6555)atC>atT	p.I2185I	MUC12_ENST00000536621.1_Silent_p.I2042I			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	2185	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GCTCAGGCATCGTTGAAGCAT	0.567																																						dbGAP											0													74.0	145.0	124.0					7																	100639970		581	1364	1945	-	-	-	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.6555C>T	7.37:g.100639970C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.I2185	ENST00000379442.3	37	c.6555		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.567	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	1232	0.00	0	C	XM_379904		100639970	100639970	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	silent	1647	17.46	349	SNP	0.000	T
MUC12	10071	genome.wustl.edu	37	7	100639970	100639970	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:100639970C>T	ENST00000379442.3	+	5	6555	c.6555C>T	c.(6553-6555)atC>atT	p.I2185I	MUC12_ENST00000536621.1_Silent_p.I2042I			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	2185	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GCTCAGGCATCGTTGAAGCAT	0.567																																						dbGAP											0													74.0	145.0	124.0					7																	100639970		581	1364	1945	-	-	-	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.6555C>T	7.37:g.100639970C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.I2185	ENST00000379442.3	37	c.6555		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.567	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	221	0.00	0	C	XM_379904		100639970	100639970	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	silent	199	18.44	45	SNP	0.000	T
MYO9A	4649	genome.wustl.edu	37	15	72311424	72311424	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr15:72311424G>T	ENST00000356056.5	-	6	1583	c.1111C>A	c.(1111-1113)Ccc>Acc	p.P371T	MYO9A_ENST00000566885.1_Intron|RP11-390D11.1_ENST00000568391.1_RNA|MYO9A_ENST00000563542.1_Intron|MYO9A_ENST00000424560.1_Missense_Mutation_p.P371T|MYO9A_ENST00000444904.1_Intron|MYO9A_ENST00000564571.1_Missense_Mutation_p.P371T	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	371	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TGTCTGAGGGGTTTCTTTGTT	0.408																																						dbGAP											0													140.0	136.0	138.0					15																	72311424		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.1111C>A	15.37:g.72311424G>T	ENSP00000348349:p.Pro371Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.P371T	ENST00000356056.5	37	c.1111	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221138	0.58560	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000446448	D;D	0.85556	-2.0;-2.0	5.75	4.82	0.62117	Myosin head, motor domain (2);	.	.	.	.	T	0.81621	0.4861	L	0.31926	0.97	0.80722	D	1	B;P	0.36354	0.073;0.549	B;B	0.41332	0.04;0.354	T	0.81988	-0.0680	9	0.54805	T	0.06	.	14.7061	0.69191	0.0:0.1448:0.8552:0.0	.	371;371	B2RTY4-3;B2RTY4	.;MYO9A_HUMAN	T	371	ENSP00000348349:P371T;ENSP00000399162:P371T	ENSP00000348349:P371T	P	-	1	0	MYO9A	70098478	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.209000	0.51122	1.393000	0.46605	0.585000	0.79938	CCC	MYO9A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000066933		0.408	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	41	0.00	0	G	NM_006901		72311424	72311424	-1	no_errors	ENST00000424560	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	T
NBPF10	100132406	genome.wustl.edu	37	1	145311839	145311839	+	Missense_Mutation	SNP	A	A	T	rs58277049	byFrequency	TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:145311839A>T	ENST00000369338.1	+	10	1278	c.1088A>T	c.(1087-1089)cAg>cTg	p.Q363L	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000342960.5_Intron|RP11-458D21.5_ENST00000468030.1_Intron			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	636						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAGGACTCACAGGATAGATGT	0.473																																						dbGAP											0													10.0	11.0	11.0					1																	145311839		680	1587	2267	-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369338.1:c.1088A>T	1.37:g.145311839A>T	ENSP00000358344:p.Gln363Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.Q363L	ENST00000369338.1	37	c.1088		1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.485476	0.00163	.	.	ENSG00000163386	ENST00000369338;ENST00000369364	T	0.02656	4.21	0.711	-1.31	0.09230	.	.	.	.	.	T	0.00241	0.0007	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41342	-0.9514	6	0.02654	T	1	.	1.8806	0.03227	0.2946:0.0:0.2966:0.4088	rs58277049	.	.	.	L	363;40	ENSP00000358344:Q363L	ENSP00000358344:Q363L	Q	+	2	0	NBPF10	144023196	0.962000	0.33011	0.001000	0.08648	0.023000	0.10783	0.125000	0.15749	-2.764000	0.00368	-2.525000	0.00183	CAG	NBPF10	-	pfam_NBPF_dom	ENSG00000163386		0.473	NBPF10-003	KNOWN	not_best_in_genome_evidence|basic	protein_coding	NBPF10	HGNC	protein_coding	OTTHUMT00000038552.1	120	0.83	1	A	NM_001039703		145311839	145311839	+1	no_errors	ENST00000369338	ensembl	human	known	69_37n	missense	71	13.41	11	SNP	0.001	T
NDRG1	10397	genome.wustl.edu	37	8	134251151	134251151	+	Silent	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr8:134251151G>C	ENST00000414097.2	-	16	2022	c.1155C>G	c.(1153-1155)gcC>gcG	p.A385A	NDRG1_ENST00000518066.1_Silent_p.A94A|NDRG1_ENST00000521414.1_5'UTR|NDRG1_ENST00000537882.1_Silent_p.A304A|NDRG1_ENST00000323851.7_Silent_p.A385A|NDRG1_ENST00000354944.5_Silent_p.A315A|NDRG1_ENST00000522476.1_Silent_p.A319A|NDRG1_ENST00000518176.1_Silent_p.A132A	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	385					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)		NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			ACTTGGGCCCGGCGCTGTTCC	0.716			T	ERG	prostate																																	dbGAP		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	0													10.0	9.0	10.0					8																	134251151		2088	4174	6262	-	-	-	SO:0001819	synonymous_variant	0			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.1155C>G	8.37:g.134251151G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Silent	SNP	pfam_Ndr	p.A385	ENST00000414097.2	37	c.1155	CCDS34945.1	8																																																																																			NDRG1	-	NULL	ENSG00000104419		0.716	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDRG1	HGNC	protein_coding	OTTHUMT00000378805.1	46	0.00	0	G			134251151	134251151	-1	no_errors	ENST00000323851	ensembl	human	known	69_37n	silent	47	32.86	23	SNP	0.005	C
NGEF	25791	genome.wustl.edu	37	2	233785249	233785249	+	Silent	SNP	G	G	A	rs577741824		TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:233785249G>A	ENST00000264051.3	-	5	851	c.573C>T	c.(571-573)atC>atT	p.I191I	NGEF_ENST00000373552.4_Silent_p.I99I|NGEF_ENST00000409079.1_Silent_p.I99I	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	191	Regulatory region; modulates activity toward RHOA, RAC1 and CDC42. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TCCTGGTTTCGATTTCTTGGA	0.463													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18505	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													97.0	104.0	101.0					2																	233785249		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.573C>T	2.37:g.233785249G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.I191	ENST00000264051.3	37	c.573	CCDS2500.1	2																																																																																			NGEF	-	NULL	ENSG00000066248		0.463	NGEF-001	KNOWN	basic|CCDS	protein_coding	NGEF	HGNC	protein_coding	OTTHUMT00000257051.2	55	0.00	0	G	XM_044799		233785249	233785249	-1	no_errors	ENST00000264051	ensembl	human	known	69_37n	silent	52	36.14	30	SNP	0.850	A
NGEF	25791	genome.wustl.edu	37	2	233785249	233785249	+	Silent	SNP	G	G	A	rs577741824		TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:233785249G>A	ENST00000264051.3	-	5	851	c.573C>T	c.(571-573)atC>atT	p.I191I	NGEF_ENST00000373552.4_Silent_p.I99I|NGEF_ENST00000409079.1_Silent_p.I99I	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	191	Regulatory region; modulates activity toward RHOA, RAC1 and CDC42. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TCCTGGTTTCGATTTCTTGGA	0.463													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18505	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													97.0	104.0	101.0					2																	233785249		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.573C>T	2.37:g.233785249G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.I191	ENST00000264051.3	37	c.573	CCDS2500.1	2																																																																																			NGEF	-	NULL	ENSG00000066248		0.463	NGEF-001	KNOWN	basic|CCDS	protein_coding	NGEF	HGNC	protein_coding	OTTHUMT00000257051.2	115	0.00	0	G	XM_044799		233785249	233785249	-1	no_errors	ENST00000264051	ensembl	human	known	69_37n	silent	34	32.00	16	SNP	0.850	A
NME7	29922	genome.wustl.edu	37	1	169256497	169256497	+	Intron	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:169256497T>A	ENST00000367811.3	-	7	1011				NME7_ENST00000472647.1_Intron|NME7_ENST00000469474.1_5'UTR	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7						brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TAAACATTGCTCTCCTATTAA	0.299																																						dbGAP											0													118.0	123.0	121.0					1																	169256497		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.754+43A>T	1.37:g.169256497T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	RNA	SNP	-	NULL	ENST00000367811.3	37	NULL	CCDS1277.1	1																																																																																			NME7	-	-	ENSG00000143156		0.299	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	26	0.00	0	T	NM_013330		169256497	169256497	-1	no_errors	ENST00000469474	ensembl	human	known	69_37n	rna	15	37.50	9	SNP	0.137	A
NMUR2	56923	genome.wustl.edu	37	5	151784051	151784051	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr5:151784051C>A	ENST00000255262.3	-	1	789	c.624G>T	c.(622-624)aaG>aaT	p.K208N	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	208					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			TCCACATGGGCTTGATGACCG	0.532																																						dbGAP											0													180.0	171.0	174.0					5																	151784051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.624G>T	5.37:g.151784051C>A	ENSP00000255262:p.Lys208Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NeuromedU_rcpt_2,prints_NeuromedU_rcpt,prints_7TM_GPCR_Rhodpsn	p.K208N	ENST00000255262.3	37	c.624	CCDS4321.1	5	.	.	.	.	.	.	.	.	.	.	C	10.02	1.234887	0.22626	.	.	ENSG00000132911	ENST00000255262	T	0.39592	1.07	5.44	2.23	0.28157	GPCR, rhodopsin-like superfamily (1);	0.545766	0.19573	N	0.111048	T	0.32224	0.0822	L	0.48218	1.51	0.38726	D	0.953566	P	0.39717	0.684	B	0.40329	0.326	T	0.09509	-1.0671	10	0.15952	T	0.53	-10.1145	7.2757	0.26283	0.0:0.5171:0.0:0.4829	.	208	Q9GZQ4	NMUR2_HUMAN	N	208	ENSP00000255262:K208N	ENSP00000255262:K208N	K	-	3	2	NMUR2	151764244	0.910000	0.30920	0.967000	0.41034	0.195000	0.23768	0.187000	0.16998	0.653000	0.30826	0.585000	0.79938	AAG	NMUR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NeuromedU_rcpt	ENSG00000132911		0.532	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	HGNC	protein_coding	OTTHUMT00000252439.1	240	0.00	0	C	NM_020167		151784051	151784051	-1	no_errors	ENST00000255262	ensembl	human	known	69_37n	missense	202	23.77	63	SNP	0.963	A
NMUR2	56923	genome.wustl.edu	37	5	151784051	151784051	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr5:151784051C>A	ENST00000255262.3	-	1	789	c.624G>T	c.(622-624)aaG>aaT	p.K208N	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	208					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			TCCACATGGGCTTGATGACCG	0.532																																						dbGAP											0													180.0	171.0	174.0					5																	151784051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.624G>T	5.37:g.151784051C>A	ENSP00000255262:p.Lys208Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NeuromedU_rcpt_2,prints_NeuromedU_rcpt,prints_7TM_GPCR_Rhodpsn	p.K208N	ENST00000255262.3	37	c.624	CCDS4321.1	5	.	.	.	.	.	.	.	.	.	.	C	10.02	1.234887	0.22626	.	.	ENSG00000132911	ENST00000255262	T	0.39592	1.07	5.44	2.23	0.28157	GPCR, rhodopsin-like superfamily (1);	0.545766	0.19573	N	0.111048	T	0.32224	0.0822	L	0.48218	1.51	0.38726	D	0.953566	P	0.39717	0.684	B	0.40329	0.326	T	0.09509	-1.0671	10	0.15952	T	0.53	-10.1145	7.2757	0.26283	0.0:0.5171:0.0:0.4829	.	208	Q9GZQ4	NMUR2_HUMAN	N	208	ENSP00000255262:K208N	ENSP00000255262:K208N	K	-	3	2	NMUR2	151764244	0.910000	0.30920	0.967000	0.41034	0.195000	0.23768	0.187000	0.16998	0.653000	0.30826	0.585000	0.79938	AAG	NMUR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NeuromedU_rcpt	ENSG00000132911		0.532	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	HGNC	protein_coding	OTTHUMT00000252439.1	114	0.00	0	C	NM_020167		151784051	151784051	-1	no_errors	ENST00000255262	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	0.963	A
NOS2	4843	genome.wustl.edu	37	17	26101297	26101297	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr17:26101297A>C	ENST00000313735.6	-	12	1695	c.1462T>G	c.(1462-1464)Ttc>Gtc	p.F488V		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	488					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TAGTAGTAGAAAGGGGACAGG	0.557																																						dbGAP											0													97.0	88.0	91.0					17																	26101297		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1462T>G	17.37:g.26101297A>C	ENSP00000327251:p.Phe488Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.F488V	ENST00000313735.6	37	c.1462	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274930	0.80580	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.21543	2.0	5.67	5.67	0.87782	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	M	0.75447	2.3	0.58432	D	0.999997	P;D	0.89917	0.859;1.0	P;D	0.97110	0.771;1.0	T	0.40384	-0.9566	10	0.41790	T	0.15	.	15.102	0.72288	1.0:0.0:0.0:0.0	.	488;488	F8WEM3;P35228	.;NOS2_HUMAN	V	488;449;488	ENSP00000327251:F488V	ENSP00000305638:F488V	F	-	1	0	NOS2	23125424	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.221000	0.95188	2.155000	0.67459	0.459000	0.35465	TTC	NOS2	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_met	ENSG00000007171		0.557	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	239	0.00	0	A	NM_000625		26101297	26101297	-1	no_errors	ENST00000313735	ensembl	human	known	69_37n	missense	128	32.28	61	SNP	1.000	C
NOS2	4843	genome.wustl.edu	37	17	26101297	26101297	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr17:26101297A>C	ENST00000313735.6	-	12	1695	c.1462T>G	c.(1462-1464)Ttc>Gtc	p.F488V		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	488					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TAGTAGTAGAAAGGGGACAGG	0.557																																						dbGAP											0													97.0	88.0	91.0					17																	26101297		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1462T>G	17.37:g.26101297A>C	ENSP00000327251:p.Phe488Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.F488V	ENST00000313735.6	37	c.1462	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274930	0.80580	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.21543	2.0	5.67	5.67	0.87782	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	M	0.75447	2.3	0.58432	D	0.999997	P;D	0.89917	0.859;1.0	P;D	0.97110	0.771;1.0	T	0.40384	-0.9566	10	0.41790	T	0.15	.	15.102	0.72288	1.0:0.0:0.0:0.0	.	488;488	F8WEM3;P35228	.;NOS2_HUMAN	V	488;449;488	ENSP00000327251:F488V	ENSP00000305638:F488V	F	-	1	0	NOS2	23125424	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.221000	0.95188	2.155000	0.67459	0.459000	0.35465	TTC	NOS2	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_met	ENSG00000007171		0.557	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	40	0.00	0	A	NM_000625		26101297	26101297	-1	no_errors	ENST00000313735	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	1.000	C
NOTCH2	4853	genome.wustl.edu	37	1	120611960	120611960	+	Missense_Mutation	SNP	C	C	T	rs2603926		TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:120611960C>T	ENST00000256646.2	-	1	280	c.61G>A	c.(61-63)Gcc>Acc	p.A21T		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	21				A -> T (in Ref. 2; AAG37073). {ECO:0000305}.	apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCGCGGGGGCCGCGCAGCAC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													6.0	8.0	8.0					1																	120611960		1705	3725	5430	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.61G>A	1.37:g.120611960C>T	ENSP00000256646:p.Ala21Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A21T	ENST00000256646.2	37	c.61	CCDS908.1	1	338	0.15476190476190477	115	0.23373983739837398	62	0.1712707182320442	66	0.11538461538461539	95	0.12532981530343007	c	6.410	0.443770	0.12164	.	.	ENSG00000134250	ENST00000256646	T	0.57752	0.38	3.09	2.14	0.27477	.	.	.	.	.	T	0.07324	0.0185	N	0.01874	-0.695	0.18873	N	0.999985	B;B	0.18461	0.0;0.028	B;B	0.11329	0.0;0.006	T	0.40813	-0.9543	9	0.13470	T	0.59	.	6.5614	0.22489	0.0:0.8575:0.0:0.1425	.	21;21	Q6IQ50;Q04721	.;NOTC2_HUMAN	T	21	ENSP00000256646:A21T	ENSP00000256646:A21T	A	-	1	0	NOTCH2	120413483	0.972000	0.33761	0.995000	0.50966	0.349000	0.29174	0.433000	0.21477	0.641000	0.30601	0.184000	0.17185	GCC	NOTCH2	-	pirsf_Notch	ENSG00000134250		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	20	0.00	0	C	NM_024408		120611960	120611960	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.990	T
NR1D1	9572	genome.wustl.edu	37	17	38252225	38252225	+	Silent	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr17:38252225T>A	ENST00000246672.3	-	5	1350	c.720A>T	c.(718-720)tcA>tcT	p.S240S		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	240	Crucial for activation of GJA1. {ECO:0000250}.|Hinge.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					GCTGGGTGGGTGAAGTCTCCA	0.642																																						dbGAP											0													20.0	22.0	21.0					17																	38252225		2197	4273	6470	-	-	-	SO:0001819	synonymous_variant	0			X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.720A>T	17.37:g.38252225T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P5Z4|Q15304	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.S240	ENST00000246672.3	37	c.720	CCDS11361.1	17																																																																																			NR1D1	-	NULL	ENSG00000126368		0.642	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D1	HGNC	protein_coding	OTTHUMT00000257135.1	14	0.00	0	T			38252225	38252225	-1	no_errors	ENST00000246672	ensembl	human	known	69_37n	silent	9	60.87	14	SNP	0.913	A
NUP205	23165	genome.wustl.edu	37	7	135287613	135287613	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:135287613delA	ENST00000285968.6	+	18	2599	c.2573delA	c.(2572-2574)caafs	p.Q858fs		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	858					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CTTACTCTGCAAAAGGAAAAT	0.368																																						dbGAP											0													90.0	97.0	95.0					7																	135287613		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.2573delA	7.37:g.135287613delA	ENSP00000285968:p.Gln858fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X3|Q86YC1	Frame_Shift_Del	DEL	pfam_DUF3414	p.K859fs	ENST00000285968.6	37	c.2573	CCDS34759.1	7																																																																																			NUP205	-	pfam_DUF3414	ENSG00000155561		0.368	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1	157	0.00	0	A			135287613	135287613	+1	no_errors	ENST00000285968	ensembl	human	known	69_37n	frame_shift_del	305	23.13	93	DEL	1.000	-
NUP205	23165	genome.wustl.edu	37	7	135287613	135287613	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:135287613delA	ENST00000285968.6	+	18	2599	c.2573delA	c.(2572-2574)caafs	p.Q858fs		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	858					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CTTACTCTGCAAAAGGAAAAT	0.368																																						dbGAP											0													90.0	97.0	95.0					7																	135287613		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.2573delA	7.37:g.135287613delA	ENSP00000285968:p.Gln858fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X3|Q86YC1	Frame_Shift_Del	DEL	pfam_DUF3414	p.K859fs	ENST00000285968.6	37	c.2573	CCDS34759.1	7																																																																																			NUP205	-	pfam_DUF3414	ENSG00000155561		0.368	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1	80	0.00	0	A			135287613	135287613	+1	no_errors	ENST00000285968	ensembl	human	known	69_37n	frame_shift_del	95	21.49	26	DEL	1.000	-
NUPL2	11097	genome.wustl.edu	37	7	23239963	23239963	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:23239963G>C	ENST00000258742.5	+	7	1130	c.871G>C	c.(871-873)Ggg>Cgg	p.G291R		NM_007342.2	NP_031368.1	O15504	NUPL2_HUMAN	nucleoporin like 2	291	Ser-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclear export signal receptor activity (GO:0005049)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTTTGGATTTGGGAAGCCTGA	0.502																																						dbGAP											0													51.0	46.0	48.0					7																	23239963		2203	4300	6503	-	-	-	SO:0001583	missense	0			U97198	CCDS5379.1	7p15	2003-08-07			ENSG00000136243	ENSG00000136243			17010	protein-coding gene	gene with protein product	"""nucleoporin-like protein 1"""					10358091, 9450185	Standard	NM_007342		Approved	NLP_1, CG1, hCG1, H_RG271G13.9	uc003svu.3	O15504	OTTHUMG00000096955	ENST00000258742.5:c.871G>C	7.37:g.23239963G>C	ENSP00000258742:p.Gly291Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D143|B4DP42|Q49AE7|Q9BS49	Missense_Mutation	SNP	smart_Znf_CCCH	p.G291R	ENST00000258742.5	37	c.871	CCDS5379.1	7	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103000	0.37145	.	.	ENSG00000136243	ENST00000258742;ENST00000413919	T;T	0.39056	1.1;1.29	5.87	3.14	0.36123	.	0.139611	0.64402	N	0.000004	T	0.26484	0.0647	N	0.19112	0.55	0.80722	D	1	B	0.25048	0.117	B	0.25759	0.063	T	0.04752	-1.0929	10	0.45353	T	0.12	-0.1055	8.6085	0.33789	0.2977:0.0:0.7023:0.0	.	291	O15504	NUPL2_HUMAN	R	291;316	ENSP00000258742:G291R;ENSP00000401475:G316R	ENSP00000258742:G291R	G	+	1	0	NUPL2	23206488	1.000000	0.71417	0.994000	0.49952	0.951000	0.60555	1.573000	0.36472	0.413000	0.25759	0.655000	0.94253	GGG	NUPL2	-	NULL	ENSG00000136243		0.502	NUPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPL2	HGNC	protein_coding	OTTHUMT00000214017.2	177	0.00	0	G	NM_007342		23239963	23239963	+1	no_errors	ENST00000258742	ensembl	human	known	69_37n	missense	213	32.81	104	SNP	0.999	C
NUPL2	11097	genome.wustl.edu	37	7	23239963	23239963	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:23239963G>C	ENST00000258742.5	+	7	1130	c.871G>C	c.(871-873)Ggg>Cgg	p.G291R		NM_007342.2	NP_031368.1	O15504	NUPL2_HUMAN	nucleoporin like 2	291	Ser-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclear export signal receptor activity (GO:0005049)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTTTGGATTTGGGAAGCCTGA	0.502																																						dbGAP											0													51.0	46.0	48.0					7																	23239963		2203	4300	6503	-	-	-	SO:0001583	missense	0			U97198	CCDS5379.1	7p15	2003-08-07			ENSG00000136243	ENSG00000136243			17010	protein-coding gene	gene with protein product	"""nucleoporin-like protein 1"""					10358091, 9450185	Standard	NM_007342		Approved	NLP_1, CG1, hCG1, H_RG271G13.9	uc003svu.3	O15504	OTTHUMG00000096955	ENST00000258742.5:c.871G>C	7.37:g.23239963G>C	ENSP00000258742:p.Gly291Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D143|B4DP42|Q49AE7|Q9BS49	Missense_Mutation	SNP	smart_Znf_CCCH	p.G291R	ENST00000258742.5	37	c.871	CCDS5379.1	7	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103000	0.37145	.	.	ENSG00000136243	ENST00000258742;ENST00000413919	T;T	0.39056	1.1;1.29	5.87	3.14	0.36123	.	0.139611	0.64402	N	0.000004	T	0.26484	0.0647	N	0.19112	0.55	0.80722	D	1	B	0.25048	0.117	B	0.25759	0.063	T	0.04752	-1.0929	10	0.45353	T	0.12	-0.1055	8.6085	0.33789	0.2977:0.0:0.7023:0.0	.	291	O15504	NUPL2_HUMAN	R	291;316	ENSP00000258742:G291R;ENSP00000401475:G316R	ENSP00000258742:G291R	G	+	1	0	NUPL2	23206488	1.000000	0.71417	0.994000	0.49952	0.951000	0.60555	1.573000	0.36472	0.413000	0.25759	0.655000	0.94253	GGG	NUPL2	-	NULL	ENSG00000136243		0.502	NUPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPL2	HGNC	protein_coding	OTTHUMT00000214017.2	75	0.00	0	G	NM_007342		23239963	23239963	+1	no_errors	ENST00000258742	ensembl	human	known	69_37n	missense	43	34.85	23	SNP	0.999	C
FFAR4	338557	genome.wustl.edu	37	10	95326768	95326768	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:95326768C>T	ENST00000371483.4	+	1	347	c.291C>T	c.(289-291)gcC>gcT	p.A97A	FFAR4_ENST00000604414.1_Silent_p.A97A|FFAR4_ENST00000371481.4_Silent_p.A97A	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	97					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										TGGTGCTGGCCGTGCGCTGGA	0.682																																						dbGAP											0													44.0	42.0	43.0					10																	95326768		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.291C>T	10.37:g.95326768C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A97	ENST00000371483.4	37	c.291	CCDS31248.1	10																																																																																			O3FAR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186188		0.682	FFAR4-002	KNOWN	basic|CCDS	protein_coding	O3FAR1	HGNC	protein_coding	OTTHUMT00000083179.1	70	0.00	0	C	NM_181745		95326768	95326768	+1	no_errors	ENST00000371483	ensembl	human	known	69_37n	silent	31	62.79	54	SNP	0.168	T
FFAR4	338557	genome.wustl.edu	37	10	95326768	95326768	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr10:95326768C>T	ENST00000371483.4	+	1	347	c.291C>T	c.(289-291)gcC>gcT	p.A97A	FFAR4_ENST00000604414.1_Silent_p.A97A|FFAR4_ENST00000371481.4_Silent_p.A97A	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	97					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										TGGTGCTGGCCGTGCGCTGGA	0.682																																						dbGAP											0													44.0	42.0	43.0					10																	95326768		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.291C>T	10.37:g.95326768C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A97	ENST00000371483.4	37	c.291	CCDS31248.1	10																																																																																			O3FAR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186188		0.682	FFAR4-002	KNOWN	basic|CCDS	protein_coding	O3FAR1	HGNC	protein_coding	OTTHUMT00000083179.1	160	0.00	0	C	NM_181745		95326768	95326768	+1	no_errors	ENST00000371483	ensembl	human	known	69_37n	silent	38	56.82	50	SNP	0.168	T
OR52D1	390066	genome.wustl.edu	37	11	5510400	5510400	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr11:5510400G>C	ENST00000322641.5	+	1	486	c.464G>C	c.(463-465)aGt>aCt	p.S155T	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001005163.2	NP_001005163.1	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D, member 1	155					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTATTCCGTAGTGTGGCTATT	0.488																																						dbGAP											0													299.0	277.0	285.0					11																	5510400		2201	4297	6498	-	-	-	SO:0001583	missense	0			BK004276	CCDS31384.1	11p15.4	2012-08-09			ENSG00000181609	ENSG00000181609		"""GPCR / Class A : Olfactory receptors"""	15212	protein-coding gene	gene with protein product							Standard	NM_001005163		Approved		uc010qzg.2	Q9H346	OTTHUMG00000066895	ENST00000322641.5:c.464G>C	11.37:g.5510400G>C	ENSP00000326232:p.Ser155Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGY9|Q6IFI6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S155T	ENST00000322641.5	37	c.464	CCDS31384.1	11	.	.	.	.	.	.	.	.	.	.	g	7.486	0.649688	0.14516	.	.	ENSG00000181609	ENST00000322641	T	0.46451	0.87	5.58	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.069088	0.64402	D	0.000009	T	0.58680	0.2139	M	0.74546	2.27	0.09310	N	1	D	0.63880	0.993	D	0.67725	0.953	T	0.49263	-0.8958	10	0.34782	T	0.22	.	10.6479	0.45632	0.0725:0.1318:0.7956:0.0	.	155	Q9H346	O52D1_HUMAN	T	155	ENSP00000326232:S155T	ENSP00000326232:S155T	S	+	2	0	OR52D1	5466976	0.014000	0.17966	0.181000	0.23098	0.033000	0.12548	1.202000	0.32271	1.614000	0.50241	-0.119000	0.15052	AGT	OR52D1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181609		0.488	OR52D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52D1	HGNC	protein_coding	OTTHUMT00000143372.1	484	0.00	0	G	NM_001005163		5510400	5510400	+1	no_errors	ENST00000322641	ensembl	human	known	69_37n	missense	302	27.34	114	SNP	0.001	C
OR52D1	390066	genome.wustl.edu	37	11	5510400	5510400	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr11:5510400G>C	ENST00000322641.5	+	1	486	c.464G>C	c.(463-465)aGt>aCt	p.S155T	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001005163.2	NP_001005163.1	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D, member 1	155					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTATTCCGTAGTGTGGCTATT	0.488																																						dbGAP											0													299.0	277.0	285.0					11																	5510400		2201	4297	6498	-	-	-	SO:0001583	missense	0			BK004276	CCDS31384.1	11p15.4	2012-08-09			ENSG00000181609	ENSG00000181609		"""GPCR / Class A : Olfactory receptors"""	15212	protein-coding gene	gene with protein product							Standard	NM_001005163		Approved		uc010qzg.2	Q9H346	OTTHUMG00000066895	ENST00000322641.5:c.464G>C	11.37:g.5510400G>C	ENSP00000326232:p.Ser155Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGY9|Q6IFI6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S155T	ENST00000322641.5	37	c.464	CCDS31384.1	11	.	.	.	.	.	.	.	.	.	.	g	7.486	0.649688	0.14516	.	.	ENSG00000181609	ENST00000322641	T	0.46451	0.87	5.58	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.069088	0.64402	D	0.000009	T	0.58680	0.2139	M	0.74546	2.27	0.09310	N	1	D	0.63880	0.993	D	0.67725	0.953	T	0.49263	-0.8958	10	0.34782	T	0.22	.	10.6479	0.45632	0.0725:0.1318:0.7956:0.0	.	155	Q9H346	O52D1_HUMAN	T	155	ENSP00000326232:S155T	ENSP00000326232:S155T	S	+	2	0	OR52D1	5466976	0.014000	0.17966	0.181000	0.23098	0.033000	0.12548	1.202000	0.32271	1.614000	0.50241	-0.119000	0.15052	AGT	OR52D1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181609		0.488	OR52D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52D1	HGNC	protein_coding	OTTHUMT00000143372.1	60	0.00	0	G	NM_001005163		5510400	5510400	+1	no_errors	ENST00000322641	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	0.001	C
OVCH2	341277	genome.wustl.edu	37	11	7723282	7723282	+	lincRNA	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr11:7723282G>C	ENST00000527565.1	-	0	1178				OVCH2_ENST00000534193.2_RNA|OVCH2_ENST00000454689.1_RNA																							AGCGGCCCCAGCCTGCAGTTG	0.473																																						dbGAP											0													34.0	33.0	34.0					11																	7723282		1839	4085	5924	-	-	-			0																															11.37:g.7723282G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,smart_Peptidase_S1_S6,smart_CUB,pfscan_CUB,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G180	ENST00000527565.1	37	c.540		11																																																																																			OVCH2	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000183378		0.473	RP11-35J10.5-001	KNOWN	basic|readthrough_transcript	lincRNA	OVCH2	HGNC	lincRNA	OTTHUMT00000385692.1	84	0.00	0	G			7723282	7723282	-1	no_errors	ENST00000454689	ensembl	human	known	69_37n	silent	70	22.22	20	SNP	1.000	C
OVCH2	341277	genome.wustl.edu	37	11	7723282	7723282	+	lincRNA	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr11:7723282G>C	ENST00000527565.1	-	0	1178				OVCH2_ENST00000534193.2_RNA|OVCH2_ENST00000454689.1_RNA																							AGCGGCCCCAGCCTGCAGTTG	0.473																																						dbGAP											0													34.0	33.0	34.0					11																	7723282		1839	4085	5924	-	-	-			0																															11.37:g.7723282G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,smart_Peptidase_S1_S6,smart_CUB,pfscan_CUB,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G180	ENST00000527565.1	37	c.540		11																																																																																			OVCH2	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000183378		0.473	RP11-35J10.5-001	KNOWN	basic|readthrough_transcript	lincRNA	OVCH2	HGNC	lincRNA	OTTHUMT00000385692.1	29	0.00	0	G			7723282	7723282	-1	no_errors	ENST00000454689	ensembl	human	known	69_37n	silent	11	21.43	3	SNP	1.000	C
OR5T3	390154	genome.wustl.edu	37	11	56020650	56020650	+	Silent	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr11:56020650A>G	ENST00000303059.3	+	1	975	c.975A>G	c.(973-975)aaA>aaG	p.K325K		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	325						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TGAGGAACAAAGAAGTAAAAA	0.318																																						dbGAP											0													44.0	42.0	43.0					11																	56020650		2201	4293	6494	-	-	-	SO:0001819	synonymous_variant	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.975A>G	11.37:g.56020650A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFC7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K325	ENST00000303059.3	37	c.975	CCDS31524.1	11																																																																																			OR5T3	-	prints_7TM_GPCR_Rhodpsn	ENSG00000172489		0.318	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	126	0.00	0	A	NM_001004747		56020650	56020650	+1	no_errors	ENST00000303059	ensembl	human	known	69_37n	silent	46	58.93	66	SNP	0.749	G
OR5T3	390154	genome.wustl.edu	37	11	56020650	56020650	+	Silent	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr11:56020650A>G	ENST00000303059.3	+	1	975	c.975A>G	c.(973-975)aaA>aaG	p.K325K		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	325						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TGAGGAACAAAGAAGTAAAAA	0.318																																						dbGAP											0													44.0	42.0	43.0					11																	56020650		2201	4293	6494	-	-	-	SO:0001819	synonymous_variant	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.975A>G	11.37:g.56020650A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFC7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K325	ENST00000303059.3	37	c.975	CCDS31524.1	11																																																																																			OR5T3	-	prints_7TM_GPCR_Rhodpsn	ENSG00000172489		0.318	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	77	0.00	0	A	NM_001004747		56020650	56020650	+1	no_errors	ENST00000303059	ensembl	human	known	69_37n	silent	31	39.22	20	SNP	0.749	G
PAXIP1	22976	genome.wustl.edu	37	7	154760837	154760837	+	Splice_Site	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:154760837C>T	ENST00000404141.1	-	7	1229		c.e7-1		PAXIP1_ENST00000397192.1_Splice_Site|PAXIP1_ENST00000473219.1_Splice_Site			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1						adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		TCTGTAAGATCTACAAAACAA	0.363																																						dbGAP											0													43.0	37.0	39.0					7																	154760837		1914	4128	6042	-	-	-	SO:0001630	splice_region_variant	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1075-1G>A	7.37:g.154760837C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Splice_Site	SNP	-	e7-1	ENST00000404141.1	37	c.1075-1	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666576	0.47677	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8474	0.92212	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PAXIP1	154391770	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	6.284000	0.72652	2.440000	0.82611	0.557000	0.71058	.	PAXIP1	-	-	ENSG00000157212		0.363	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	232	0.00	0	C	NM_007349	Intron	154760837	154760837	-1	no_errors	ENST00000397192	ensembl	human	known	69_37n	splice_site	319	10.89	39	SNP	1.000	T
PAXIP1	22976	genome.wustl.edu	37	7	154760837	154760837	+	Splice_Site	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:154760837C>T	ENST00000404141.1	-	7	1229		c.e7-1		PAXIP1_ENST00000397192.1_Splice_Site|PAXIP1_ENST00000473219.1_Splice_Site			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1						adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		TCTGTAAGATCTACAAAACAA	0.363																																						dbGAP											0													43.0	37.0	39.0					7																	154760837		1914	4128	6042	-	-	-	SO:0001630	splice_region_variant	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1075-1G>A	7.37:g.154760837C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Splice_Site	SNP	-	e7-1	ENST00000404141.1	37	c.1075-1	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666576	0.47677	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8474	0.92212	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PAXIP1	154391770	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	6.284000	0.72652	2.440000	0.82611	0.557000	0.71058	.	PAXIP1	-	-	ENSG00000157212		0.363	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	103	0.00	0	C	NM_007349	Intron	154760837	154760837	-1	no_errors	ENST00000397192	ensembl	human	known	69_37n	splice_site	98	13.27	15	SNP	1.000	T
PCBP2	5094	genome.wustl.edu	37	12	53853067	53853067	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr12:53853067C>G	ENST00000439930.3	+	5	277	c.255C>G	c.(253-255)agC>agG	p.S85R	PCBP2_ENST00000548933.1_Missense_Mutation_p.S85R|PCBP2_ENST00000546463.1_Missense_Mutation_p.S85R|PCBP2_ENST00000359462.5_Missense_Mutation_p.S85R|PCBP2_ENST00000552296.2_Missense_Mutation_p.S85R|PCBP2_ENST00000552819.1_Missense_Mutation_p.S85R|PCBP2_ENST00000359282.5_Missense_Mutation_p.S85R|PCBP2_ENST00000549863.1_Missense_Mutation_p.S85R|PCBP2_ENST00000455667.3_Missense_Mutation_p.S85R|PCBP2_ENST00000447282.1_Missense_Mutation_p.S85R|PCBP2_ENST00000603815.1_Missense_Mutation_p.S85R|PCBP2_ENST00000437231.1_Missense_Mutation_p.S85R|PCBP2_ENST00000541275.1_Missense_Mutation_p.S85R|RP11-793H13.8_ENST00000547717.1_RNA			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	85					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						ACATAAGCAGCTCTATGACCA	0.483																																						dbGAP											0													120.0	121.0	120.0					12																	53853067		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.255C>G	12.37:g.53853067C>G	ENSP00000408949:p.Ser85Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.S85R	ENST00000439930.3	37	c.255	CCDS44901.1	12	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023548	0.75390	.	.	ENSG00000197111	ENST00000541275;ENST00000359282;ENST00000447282;ENST00000437231;ENST00000439930;ENST00000549863;ENST00000359462;ENST00000550927;ENST00000546463;ENST00000551104;ENST00000550520;ENST00000552296;ENST00000552083;ENST00000552819;ENST00000455667;ENST00000548933;ENST00000546652;ENST00000379777	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44482	1.83;1.46;1.47;1.44;1.44;1.47;1.44;1.45;0.92;0.92;1.87;1.46;1.44;1.47	5.01	5.01	0.66863	.	0.127132	0.64402	N	0.000001	T	0.37293	0.0998	L	0.34521	1.04	0.80722	D	1	B;B;B;B;B;B;B;B;B	0.13145	0.005;0.005;0.001;0.0;0.0;0.007;0.0;0.001;0.0	B;B;B;B;B;B;B;B;B	0.25506	0.011;0.047;0.008;0.011;0.007;0.061;0.008;0.011;0.005	T	0.14035	-1.0487	10	0.44086	T	0.13	.	17.232	0.86987	0.0:1.0:0.0:0.0	.	85;46;85;85;85;85;85;85;85	B4DLC0;F8VRG9;Q15366;Q32Q82;G3V0E8;F8VYL7;Q68Y55;Q6IPF4;A8K7X6	.;.;PCBP2_HUMAN;.;.;.;.;.;.	R	85;85;85;85;85;85;85;27;85;85;77;85;46;85;85;85;66;47	ENSP00000446130:S85R;ENSP00000352228:S85R;ENSP00000394116:S85R;ENSP00000390304:S85R;ENSP00000408949:S85R;ENSP00000447670:S85R;ENSP00000352438:S85R;ENSP00000448762:S85R;ENSP00000446601:S85R;ENSP00000448847:S77R;ENSP00000448927:S85R;ENSP00000449070:S85R;ENSP00000388008:S85R;ENSP00000449062:S85R	ENSP00000352228:S85R	S	+	3	2	PCBP2	52139334	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.994000	0.49433	2.589000	0.87451	0.655000	0.94253	AGC	PCBP2	-	NULL	ENSG00000197111		0.483	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	PCBP2	HGNC	protein_coding	OTTHUMT00000407545.2	216	0.00	0	C	NM_005016		53853067	53853067	+1	no_errors	ENST00000546463	ensembl	human	known	69_37n	missense	137	41.20	96	SNP	1.000	G
PCBP2	5094	genome.wustl.edu	37	12	53853067	53853067	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr12:53853067C>G	ENST00000439930.3	+	5	277	c.255C>G	c.(253-255)agC>agG	p.S85R	PCBP2_ENST00000548933.1_Missense_Mutation_p.S85R|PCBP2_ENST00000546463.1_Missense_Mutation_p.S85R|PCBP2_ENST00000359462.5_Missense_Mutation_p.S85R|PCBP2_ENST00000552296.2_Missense_Mutation_p.S85R|PCBP2_ENST00000552819.1_Missense_Mutation_p.S85R|PCBP2_ENST00000359282.5_Missense_Mutation_p.S85R|PCBP2_ENST00000549863.1_Missense_Mutation_p.S85R|PCBP2_ENST00000455667.3_Missense_Mutation_p.S85R|PCBP2_ENST00000447282.1_Missense_Mutation_p.S85R|PCBP2_ENST00000603815.1_Missense_Mutation_p.S85R|PCBP2_ENST00000437231.1_Missense_Mutation_p.S85R|PCBP2_ENST00000541275.1_Missense_Mutation_p.S85R|RP11-793H13.8_ENST00000547717.1_RNA			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	85					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						ACATAAGCAGCTCTATGACCA	0.483																																						dbGAP											0													120.0	121.0	120.0					12																	53853067		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.255C>G	12.37:g.53853067C>G	ENSP00000408949:p.Ser85Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.S85R	ENST00000439930.3	37	c.255	CCDS44901.1	12	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023548	0.75390	.	.	ENSG00000197111	ENST00000541275;ENST00000359282;ENST00000447282;ENST00000437231;ENST00000439930;ENST00000549863;ENST00000359462;ENST00000550927;ENST00000546463;ENST00000551104;ENST00000550520;ENST00000552296;ENST00000552083;ENST00000552819;ENST00000455667;ENST00000548933;ENST00000546652;ENST00000379777	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44482	1.83;1.46;1.47;1.44;1.44;1.47;1.44;1.45;0.92;0.92;1.87;1.46;1.44;1.47	5.01	5.01	0.66863	.	0.127132	0.64402	N	0.000001	T	0.37293	0.0998	L	0.34521	1.04	0.80722	D	1	B;B;B;B;B;B;B;B;B	0.13145	0.005;0.005;0.001;0.0;0.0;0.007;0.0;0.001;0.0	B;B;B;B;B;B;B;B;B	0.25506	0.011;0.047;0.008;0.011;0.007;0.061;0.008;0.011;0.005	T	0.14035	-1.0487	10	0.44086	T	0.13	.	17.232	0.86987	0.0:1.0:0.0:0.0	.	85;46;85;85;85;85;85;85;85	B4DLC0;F8VRG9;Q15366;Q32Q82;G3V0E8;F8VYL7;Q68Y55;Q6IPF4;A8K7X6	.;.;PCBP2_HUMAN;.;.;.;.;.;.	R	85;85;85;85;85;85;85;27;85;85;77;85;46;85;85;85;66;47	ENSP00000446130:S85R;ENSP00000352228:S85R;ENSP00000394116:S85R;ENSP00000390304:S85R;ENSP00000408949:S85R;ENSP00000447670:S85R;ENSP00000352438:S85R;ENSP00000448762:S85R;ENSP00000446601:S85R;ENSP00000448847:S77R;ENSP00000448927:S85R;ENSP00000449070:S85R;ENSP00000388008:S85R;ENSP00000449062:S85R	ENSP00000352228:S85R	S	+	3	2	PCBP2	52139334	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.994000	0.49433	2.589000	0.87451	0.655000	0.94253	AGC	PCBP2	-	NULL	ENSG00000197111		0.483	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	PCBP2	HGNC	protein_coding	OTTHUMT00000407545.2	74	0.00	0	C	NM_005016		53853067	53853067	+1	no_errors	ENST00000546463	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	1.000	G
PCDH19	57526	genome.wustl.edu	37	X	99551448	99551448	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chrX:99551448G>T	ENST00000373034.4	-	6	4949	c.3274C>A	c.(3274-3276)Cgt>Agt	p.R1092S	PCDH19_ENST00000420881.2_Missense_Mutation_p.R1044S|PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000255531.7_Missense_Mutation_p.R1045S	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1092					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TCCAGATCACGGGCTGGGGGA	0.577																																						dbGAP											0													90.0	90.0	90.0					X																	99551448		2067	4176	6243	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3274C>A	X.37:g.99551448G>T	ENSP00000362125:p.Arg1092Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1092S	ENST00000373034.4	37	c.3274	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997945	0.35226	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.53857	0.6;0.68;0.6	5.73	5.73	0.89815	.	0.305697	0.28382	N	0.015542	T	0.47691	0.1459	L	0.36672	1.1	0.80722	D	1	B;P;P	0.39424	0.18;0.673;0.543	B;B;B	0.37943	0.027;0.261;0.134	T	0.47341	-0.9125	10	0.46703	T	0.11	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	1092;1045;1044	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	S	1044;1092;1045	ENSP00000400327:R1044S;ENSP00000362125:R1092S;ENSP00000255531:R1045S	ENSP00000255531:R1045S	R	-	1	0	PCDH19	99438104	1.000000	0.71417	0.026000	0.17262	0.732000	0.41865	4.869000	0.63028	2.413000	0.81919	0.600000	0.82982	CGT	PCDH19	-	NULL	ENSG00000165194		0.577	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	314	0.00	0	G	NM_020766		99551448	99551448	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	127	47.95	117	SNP	0.979	T
PCDH19	57526	genome.wustl.edu	37	X	99551448	99551448	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chrX:99551448G>T	ENST00000373034.4	-	6	4949	c.3274C>A	c.(3274-3276)Cgt>Agt	p.R1092S	PCDH19_ENST00000420881.2_Missense_Mutation_p.R1044S|PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000255531.7_Missense_Mutation_p.R1045S	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1092					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TCCAGATCACGGGCTGGGGGA	0.577																																						dbGAP											0													90.0	90.0	90.0					X																	99551448		2067	4176	6243	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3274C>A	X.37:g.99551448G>T	ENSP00000362125:p.Arg1092Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1092S	ENST00000373034.4	37	c.3274	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997945	0.35226	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.53857	0.6;0.68;0.6	5.73	5.73	0.89815	.	0.305697	0.28382	N	0.015542	T	0.47691	0.1459	L	0.36672	1.1	0.80722	D	1	B;P;P	0.39424	0.18;0.673;0.543	B;B;B	0.37943	0.027;0.261;0.134	T	0.47341	-0.9125	10	0.46703	T	0.11	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	1092;1045;1044	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	S	1044;1092;1045	ENSP00000400327:R1044S;ENSP00000362125:R1092S;ENSP00000255531:R1045S	ENSP00000255531:R1045S	R	-	1	0	PCDH19	99438104	1.000000	0.71417	0.026000	0.17262	0.732000	0.41865	4.869000	0.63028	2.413000	0.81919	0.600000	0.82982	CGT	PCDH19	-	NULL	ENSG00000165194		0.577	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	76	0.00	0	G	NM_020766		99551448	99551448	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	16	54.29	19	SNP	0.979	T
PDCD6	10016	genome.wustl.edu	37	5	314701	314701	+	3'UTR	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr5:314701A>G	ENST00000264933.4	+	0	747				AHRR_ENST00000316418.5_Intron|PDCD6_ENST00000507528.1_3'UTR|AHRR_ENST00000512529.1_Intron|PDCD6_ENST00000505221.1_3'UTR|AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000511482.1_3'UTR	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			CTGTGAGGGAATGGAGCACAG	0.463																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.*71A>G	5.37:g.314701A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.N110S	ENST00000264933.4	37	c.329	CCDS3854.1	5	.	.	.	.	.	.	.	.	.	.	a	4.300	0.054959	0.08291	.	.	ENSG00000249915	ENST00000502359	.	.	.	5.61	-2.67	0.06059	.	.	.	.	.	T	0.20820	0.0501	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28650	-1.0037	4	.	.	.	.	3.5822	0.07958	0.3735:0.0:0.3373:0.2892	.	.	.	.	S	110	.	.	N	+	2	0	PDCD6	367701	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.439000	0.06897	-0.451000	0.07097	0.455000	0.32223	AAT	PDCD6	-	NULL	ENSG00000249915		0.463	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDCD6	HGNC	protein_coding	OTTHUMT00000206609.2	91	0.00	0	A	NM_013232		314701	314701	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000502359	ensembl	human	putative	69_37n	missense	85	50.87	88	SNP	0.000	G
PDCD6	10016	genome.wustl.edu	37	5	314701	314701	+	3'UTR	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr5:314701A>G	ENST00000264933.4	+	0	747				AHRR_ENST00000316418.5_Intron|PDCD6_ENST00000507528.1_3'UTR|AHRR_ENST00000512529.1_Intron|PDCD6_ENST00000505221.1_3'UTR|AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000511482.1_3'UTR	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			CTGTGAGGGAATGGAGCACAG	0.463																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.*71A>G	5.37:g.314701A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.N110S	ENST00000264933.4	37	c.329	CCDS3854.1	5	.	.	.	.	.	.	.	.	.	.	a	4.300	0.054959	0.08291	.	.	ENSG00000249915	ENST00000502359	.	.	.	5.61	-2.67	0.06059	.	.	.	.	.	T	0.20820	0.0501	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28650	-1.0037	4	.	.	.	.	3.5822	0.07958	0.3735:0.0:0.3373:0.2892	.	.	.	.	S	110	.	.	N	+	2	0	PDCD6	367701	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.439000	0.06897	-0.451000	0.07097	0.455000	0.32223	AAT	PDCD6	-	NULL	ENSG00000249915		0.463	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDCD6	HGNC	protein_coding	OTTHUMT00000206609.2	63	0.00	0	A	NM_013232		314701	314701	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000502359	ensembl	human	putative	69_37n	missense	42	55.32	52	SNP	0.000	G
PHF14	9678	genome.wustl.edu	37	7	11022150	11022150	+	Silent	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:11022150A>G	ENST00000403050.3	+	3	716	c.264A>G	c.(262-264)gaA>gaG	p.E88E	PHF14_ENST00000445996.2_Intron	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	88	Glu/Lys-rich.				lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		CAGAGGAAGAAGTACTATCAT	0.294																																						dbGAP											0													14.0	13.0	14.0					7																	11022150		1784	4037	5821	-	-	-	SO:0001819	synonymous_variant	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.264A>G	7.37:g.11022150A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MCZ3|B4DI82	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E88	ENST00000403050.3	37	c.264	CCDS47542.1	7																																																																																			PHF14	-	NULL	ENSG00000106443		0.294	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1	25	0.00	0	A	NM_014660		11022150	11022150	+1	no_errors	ENST00000403050	ensembl	human	known	69_37n	silent	33	40.00	22	SNP	0.857	G
PIPSL	266971	genome.wustl.edu	37	10	95719726	95719726	+	RNA	SNP	A	A	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:95719726A>C	ENST00000480546.1	-	0	1571					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										AACTGGGGTCAGGAGTAGGTG	0.488																																						dbGAP											0																																										-	-	-			0			BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95719726A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUK8	RNA	SNP	-	NULL	ENST00000480546.1	37	NULL		10																																																																																			PIPSL	-	-	ENSG00000180764		0.488	PIPSL-002	PUTATIVE	basic	processed_transcript	PIPSL	HGNC	pseudogene	OTTHUMT00000351483.1	248	0.00	0	A	NR_002319		95719726	95719726	-1	no_errors	ENST00000480546	ensembl	human	putative	69_37n	rna	91	51.60	97	SNP	0.742	C
PIPSL	266971	genome.wustl.edu	37	10	95719726	95719726	+	RNA	SNP	A	A	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr10:95719726A>C	ENST00000480546.1	-	0	1571					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										AACTGGGGTCAGGAGTAGGTG	0.488																																						dbGAP											0																																										-	-	-			0			BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95719726A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUK8	RNA	SNP	-	NULL	ENST00000480546.1	37	NULL		10																																																																																			PIPSL	-	-	ENSG00000180764		0.488	PIPSL-002	PUTATIVE	basic	processed_transcript	PIPSL	HGNC	pseudogene	OTTHUMT00000351483.1	138	0.00	0	A	NR_002319		95719726	95719726	-1	no_errors	ENST00000480546	ensembl	human	putative	69_37n	rna	40	42.03	29	SNP	0.742	C
PLEC	5339	genome.wustl.edu	37	8	144995865	144995865	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr8:144995865C>G	ENST00000322810.4	-	32	8704	c.8535G>C	c.(8533-8535)gaG>gaC	p.E2845D	PLEC_ENST00000356346.3_Missense_Mutation_p.E2694D|PLEC_ENST00000436759.2_Missense_Mutation_p.E2735D|PLEC_ENST00000527096.1_Missense_Mutation_p.E2731D|PLEC_ENST00000398774.2_Missense_Mutation_p.E2676D|PLEC_ENST00000354589.3_Missense_Mutation_p.E2708D|PLEC_ENST00000357649.2_Missense_Mutation_p.E2712D|PLEC_ENST00000354958.2_Missense_Mutation_p.E2686D|PLEC_ENST00000345136.3_Missense_Mutation_p.E2708D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2845	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CACTCAGCTTCTCATTGGTGG	0.672																																						dbGAP											0													42.0	47.0	45.0					8																	144995865		2173	4265	6438	-	-	-	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8535G>C	8.37:g.144995865C>G	ENSP00000323856:p.Glu2845Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2845D	ENST00000322810.4	37	c.8535	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	5.984	0.365579	0.11352	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	4.07	3.18	0.36537	.	0.313895	0.23979	U	0.042693	T	0.74619	0.3740	M	0.66439	2.03	0.31382	N	0.678929	B;B;B;B;B;B;B;B	0.15719	0.011;0.011;0.011;0.014;0.011;0.011;0.011;0.011	B;B;B;B;B;B;B;B	0.19666	0.015;0.015;0.015;0.026;0.015;0.015;0.015;0.015	T	0.75522	-0.3288	10	0.59425	D	0.04	.	11.3551	0.49611	0.0:0.9092:0.0:0.0908	.	2735;2694;2686;2845;2676;2708;2712;2708	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	D	2708;2712;2708;2676;2845;2686;2694;2735;2731	ENSP00000344848:E2708D;ENSP00000350277:E2712D;ENSP00000346602:E2708D;ENSP00000381756:E2676D;ENSP00000323856:E2845D;ENSP00000347044:E2686D;ENSP00000348702:E2694D;ENSP00000388180:E2735D;ENSP00000434583:E2731D	ENSP00000323856:E2845D	E	-	3	2	PLEC	145067853	1.000000	0.71417	0.989000	0.46669	0.361000	0.29550	1.132000	0.31418	1.069000	0.40788	0.442000	0.29010	GAG	PLEC	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000178209		0.672	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	42	0.00	0	C	NM_000445		144995865	144995865	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	missense	41	37.88	25	SNP	1.000	G
PLEC	5339	genome.wustl.edu	37	8	144995865	144995865	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr8:144995865C>G	ENST00000322810.4	-	32	8704	c.8535G>C	c.(8533-8535)gaG>gaC	p.E2845D	PLEC_ENST00000356346.3_Missense_Mutation_p.E2694D|PLEC_ENST00000436759.2_Missense_Mutation_p.E2735D|PLEC_ENST00000527096.1_Missense_Mutation_p.E2731D|PLEC_ENST00000398774.2_Missense_Mutation_p.E2676D|PLEC_ENST00000354589.3_Missense_Mutation_p.E2708D|PLEC_ENST00000357649.2_Missense_Mutation_p.E2712D|PLEC_ENST00000354958.2_Missense_Mutation_p.E2686D|PLEC_ENST00000345136.3_Missense_Mutation_p.E2708D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2845	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CACTCAGCTTCTCATTGGTGG	0.672																																						dbGAP											0													42.0	47.0	45.0					8																	144995865		2173	4265	6438	-	-	-	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8535G>C	8.37:g.144995865C>G	ENSP00000323856:p.Glu2845Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2845D	ENST00000322810.4	37	c.8535	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	5.984	0.365579	0.11352	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	4.07	3.18	0.36537	.	0.313895	0.23979	U	0.042693	T	0.74619	0.3740	M	0.66439	2.03	0.31382	N	0.678929	B;B;B;B;B;B;B;B	0.15719	0.011;0.011;0.011;0.014;0.011;0.011;0.011;0.011	B;B;B;B;B;B;B;B	0.19666	0.015;0.015;0.015;0.026;0.015;0.015;0.015;0.015	T	0.75522	-0.3288	10	0.59425	D	0.04	.	11.3551	0.49611	0.0:0.9092:0.0:0.0908	.	2735;2694;2686;2845;2676;2708;2712;2708	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	D	2708;2712;2708;2676;2845;2686;2694;2735;2731	ENSP00000344848:E2708D;ENSP00000350277:E2712D;ENSP00000346602:E2708D;ENSP00000381756:E2676D;ENSP00000323856:E2845D;ENSP00000347044:E2686D;ENSP00000348702:E2694D;ENSP00000388180:E2735D;ENSP00000434583:E2731D	ENSP00000323856:E2845D	E	-	3	2	PLEC	145067853	1.000000	0.71417	0.989000	0.46669	0.361000	0.29550	1.132000	0.31418	1.069000	0.40788	0.442000	0.29010	GAG	PLEC	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000178209		0.672	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	31	0.00	0	C	NM_000445		144995865	144995865	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	G
POLE3	54107	genome.wustl.edu	37	9	116171999	116172001	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	GTT	GTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr9:116171999_116172001delGTT	ENST00000374171.4	-	4	330_332	c.160_162delAAC	c.(160-162)aacdel	p.N54del	C9orf43_ENST00000374165.1_5'Flank|POLE3_ENST00000479871.1_5'UTR|POLE3_ENST00000374169.3_In_Frame_Del_p.N54del|C9orf43_ENST00000288462.4_5'Flank	NM_001278255.1|NM_017443.4	NP_001265184.1|NP_059139.3	Q9NRF9	DPOE3_HUMAN	polymerase (DNA directed), epsilon 3, accessory subunit	54					DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|epsilon DNA polymerase complex (GO:0008622)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|sequence-specific DNA binding (GO:0043565)			large_intestine(2)|lung(1)	3					Cladribine(DB00242)	TCATTGCAAAGTTGTTAGCACTG	0.512																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF261689	CCDS6795.1	9q33	2012-05-18	2012-05-18		ENSG00000148229	ENSG00000148229		"""DNA polymerases"""	13546	protein-coding gene	gene with protein product	"""histone fold protein CHRAC17"", ""DNA polymerase epsilon p17 subunit"", ""chromatin accessibility complex 17"", ""arsenic transactivated protein"""	607267	"""polymerase (DNA directed), epsilon 3 (p17 subunit)"""			10801849, 10880450	Standard	NM_017443		Approved	CHRAC17, Ybl1, p17, CHARAC17	uc031tet.1	Q9NRF9	OTTHUMG00000020523	ENST00000374171.4:c.160_162delAAC	9.37:g.116172002_116172004delGTT	ENSP00000363286:p.Asn54del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0U1|Q8N758|Q8NCE5|Q9NR32	In_Frame_Del	DEL	pfam_CBFA_NFYB_domain,superfamily_Histone-fold	p.N54in_frame_del	ENST00000374171.4	37	c.162_160	CCDS6795.1	9																																																																																			POLE3	-	pfam_CBFA_NFYB_domain,superfamily_Histone-fold	ENSG00000148229		0.512	POLE3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	POLE3	HGNC	protein_coding	OTTHUMT00000053730.1	136	0.00	0	GTT	NM_017443		116171999	116172001	-1	no_errors	ENST00000374169	ensembl	human	known	69_37n	in_frame_del	73	51.33	77	DEL	1.000:1.000:1.000	-
POLE3	54107	genome.wustl.edu	37	9	116171999	116172001	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	GTT	GTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr9:116171999_116172001delGTT	ENST00000374171.4	-	4	330_332	c.160_162delAAC	c.(160-162)aacdel	p.N54del	C9orf43_ENST00000374165.1_5'Flank|POLE3_ENST00000479871.1_5'UTR|POLE3_ENST00000374169.3_In_Frame_Del_p.N54del|C9orf43_ENST00000288462.4_5'Flank	NM_001278255.1|NM_017443.4	NP_001265184.1|NP_059139.3	Q9NRF9	DPOE3_HUMAN	polymerase (DNA directed), epsilon 3, accessory subunit	54					DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|epsilon DNA polymerase complex (GO:0008622)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|sequence-specific DNA binding (GO:0043565)			large_intestine(2)|lung(1)	3					Cladribine(DB00242)	TCATTGCAAAGTTGTTAGCACTG	0.512																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF261689	CCDS6795.1	9q33	2012-05-18	2012-05-18		ENSG00000148229	ENSG00000148229		"""DNA polymerases"""	13546	protein-coding gene	gene with protein product	"""histone fold protein CHRAC17"", ""DNA polymerase epsilon p17 subunit"", ""chromatin accessibility complex 17"", ""arsenic transactivated protein"""	607267	"""polymerase (DNA directed), epsilon 3 (p17 subunit)"""			10801849, 10880450	Standard	NM_017443		Approved	CHRAC17, Ybl1, p17, CHARAC17	uc031tet.1	Q9NRF9	OTTHUMG00000020523	ENST00000374171.4:c.160_162delAAC	9.37:g.116172002_116172004delGTT	ENSP00000363286:p.Asn54del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0U1|Q8N758|Q8NCE5|Q9NR32	In_Frame_Del	DEL	pfam_CBFA_NFYB_domain,superfamily_Histone-fold	p.N54in_frame_del	ENST00000374171.4	37	c.162_160	CCDS6795.1	9																																																																																			POLE3	-	pfam_CBFA_NFYB_domain,superfamily_Histone-fold	ENSG00000148229		0.512	POLE3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	POLE3	HGNC	protein_coding	OTTHUMT00000053730.1	63	0.00	0	GTT	NM_017443		116171999	116172001	-1	no_errors	ENST00000374169	ensembl	human	known	69_37n	in_frame_del	26	33.33	13	DEL	1.000:1.000:1.000	-
PPA1	5464	genome.wustl.edu	37	10	71978538	71978538	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:71978538C>A	ENST00000373232.3	-	3	258	c.159G>T	c.(157-159)tgG>tgT	p.W53C	PPA1_ENST00000608321.1_Missense_Mutation_p.W53C|PPA1_ENST00000495346.1_5'UTR	NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	53					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						TTGCATTAGACCAGCGTGGTA	0.403																																						dbGAP											0													103.0	87.0	92.0					10																	71978538		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.159G>T	10.37:g.71978538C>A	ENSP00000362329:p.Trp53Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	p.W53C	ENST00000373232.3	37	c.159	CCDS7299.1	10	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707987	0.89018	.	.	ENSG00000180817	ENST00000373232;ENST00000373230	T;T	0.46451	0.87;0.87	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.74366	0.3707	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78826	-0.2051	10	0.62326	D	0.03	-3.8237	19.1847	0.93639	0.0:1.0:0.0:0.0	.	53	Q15181	IPYR_HUMAN	C	53	ENSP00000362329:W53C;ENSP00000362327:W53C	ENSP00000362327:W53C	W	-	3	0	PPA1	71648544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.540000	0.82074	2.882000	0.98803	0.655000	0.94253	TGG	PPA1	-	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	ENSG00000180817		0.403	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPA1	HGNC	protein_coding	OTTHUMT00000048490.2	219	0.00	0	C	NM_021129		71978538	71978538	-1	no_errors	ENST00000373232	ensembl	human	known	69_37n	missense	235	14.49	40	SNP	1.000	A
PPA1	5464	genome.wustl.edu	37	10	71978538	71978538	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr10:71978538C>A	ENST00000373232.3	-	3	258	c.159G>T	c.(157-159)tgG>tgT	p.W53C	PPA1_ENST00000608321.1_Missense_Mutation_p.W53C|PPA1_ENST00000495346.1_5'UTR	NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	53					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						TTGCATTAGACCAGCGTGGTA	0.403																																						dbGAP											0													103.0	87.0	92.0					10																	71978538		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.159G>T	10.37:g.71978538C>A	ENSP00000362329:p.Trp53Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	p.W53C	ENST00000373232.3	37	c.159	CCDS7299.1	10	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707987	0.89018	.	.	ENSG00000180817	ENST00000373232;ENST00000373230	T;T	0.46451	0.87;0.87	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.74366	0.3707	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78826	-0.2051	10	0.62326	D	0.03	-3.8237	19.1847	0.93639	0.0:1.0:0.0:0.0	.	53	Q15181	IPYR_HUMAN	C	53	ENSP00000362329:W53C;ENSP00000362327:W53C	ENSP00000362327:W53C	W	-	3	0	PPA1	71648544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.540000	0.82074	2.882000	0.98803	0.655000	0.94253	TGG	PPA1	-	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	ENSG00000180817		0.403	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPA1	HGNC	protein_coding	OTTHUMT00000048490.2	38	0.00	0	C	NM_021129		71978538	71978538	-1	no_errors	ENST00000373232	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	A
PRF1	5551	genome.wustl.edu	37	10	72357869	72357869	+	Silent	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:72357869G>A	ENST00000441259.1	-	3	1768	c.1608C>T	c.(1606-1608)gaC>gaT	p.D536D	PRF1_ENST00000373209.2_Silent_p.D536D	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	536					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						GGGGGACATAGTCCAGGCAGG	0.567			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																													dbGAP	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	0													71.0	70.0	71.0					10																	72357869		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1608C>T	10.37:g.72357869G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6X4|Q59F57|Q86WX7	Silent	SNP	pfam_MACPF,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_MACPF,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.D536	ENST00000441259.1	37	c.1608	CCDS7305.1	10																																																																																			PRF1	-	NULL	ENSG00000180644		0.567	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRF1	HGNC	protein_coding	OTTHUMT00000048517.2	141	0.00	0	G	NM_005041		72357869	72357869	-1	no_errors	ENST00000318971	ensembl	human	known	69_37n	silent	193	10.65	23	SNP	0.266	A
PRKDC	5591	genome.wustl.edu	37	8	48730110	48730110	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr8:48730110G>C	ENST00000314191.2	-	69	9511	c.9455C>G	c.(9454-9456)tCt>tGt	p.S3152C	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.S3152C	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3153	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.S3152Y(1)|p.S3153Y(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GGGAACTTGAGATGATAAATT	0.358								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											2	Substitution - Missense(2)	kidney(2)											81.0	84.0	83.0					8																	48730110		1828	4083	5911	-	-	-	SO:0001583	missense	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.9455C>G	8.37:g.48730110G>C	ENSP00000313420:p.Ser3152Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S3152C	ENST00000314191.2	37	c.9455		8	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560666	0.65538	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.03242	4.07;4.0	5.69	5.69	0.88448	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.233058	0.36972	N	0.002310	T	0.18964	0.0455	M	0.75264	2.295	0.80722	D	1	D;D	0.67145	0.996;0.996	D;P	0.65684	0.937;0.907	T	0.00036	-1.2258	10	0.72032	D	0.01	.	19.8013	0.96509	0.0:0.0:1.0:0.0	.	3152;3153	E7EUY0;P78527	.;PRKDC_HUMAN	C	3152	ENSP00000313420:S3152C;ENSP00000345182:S3152C	ENSP00000313420:S3152C	S	-	2	0	PRKDC	48892663	1.000000	0.71417	0.997000	0.53966	0.425000	0.31504	6.422000	0.73357	2.670000	0.90874	0.591000	0.81541	TCT	PRKDC	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT	ENSG00000253729		0.358	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		258	0.00	0	G	NM_001081640		48730110	48730110	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	missense	204	34.41	107	SNP	1.000	C
PRKDC	5591	genome.wustl.edu	37	8	48730110	48730110	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr8:48730110G>C	ENST00000314191.2	-	69	9511	c.9455C>G	c.(9454-9456)tCt>tGt	p.S3152C	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.S3152C	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3153	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.S3152Y(1)|p.S3153Y(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GGGAACTTGAGATGATAAATT	0.358								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											2	Substitution - Missense(2)	kidney(2)											81.0	84.0	83.0					8																	48730110		1828	4083	5911	-	-	-	SO:0001583	missense	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.9455C>G	8.37:g.48730110G>C	ENSP00000313420:p.Ser3152Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S3152C	ENST00000314191.2	37	c.9455		8	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560666	0.65538	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.03242	4.07;4.0	5.69	5.69	0.88448	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.233058	0.36972	N	0.002310	T	0.18964	0.0455	M	0.75264	2.295	0.80722	D	1	D;D	0.67145	0.996;0.996	D;P	0.65684	0.937;0.907	T	0.00036	-1.2258	10	0.72032	D	0.01	.	19.8013	0.96509	0.0:0.0:1.0:0.0	.	3152;3153	E7EUY0;P78527	.;PRKDC_HUMAN	C	3152	ENSP00000313420:S3152C;ENSP00000345182:S3152C	ENSP00000313420:S3152C	S	-	2	0	PRKDC	48892663	1.000000	0.71417	0.997000	0.53966	0.425000	0.31504	6.422000	0.73357	2.670000	0.90874	0.591000	0.81541	TCT	PRKDC	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT	ENSG00000253729		0.358	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		65	0.00	0	G	NM_001081640		48730110	48730110	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	missense	65	33.67	33	SNP	1.000	C
PRPF38B	55119	genome.wustl.edu	37	1	109241420	109241423	+	Frame_Shift_Del	DEL	AGAC	AGAC	-			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	AGAC	AGAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:109241420_109241423delAGAC	ENST00000370025.4	+	5	1022_1025	c.753_756delAGAC	c.(751-756)atagacfs	p.ID251fs	PRPF38B_ENST00000370021.1_Frame_Shift_Del_p.ID140fs	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	251					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		CTGAGGAAATAGACAGACATGTTG	0.343																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.753_756delAGAC	1.37:g.109241424_109241427delAGAC	ENSP00000359042:p.Ile251fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Frame_Shift_Del	DEL	pfam_PRP38	p.R253fs	ENST00000370025.4	37	c.753_756	CCDS788.1	1																																																																																			PRPF38B	-	NULL	ENSG00000134186		0.343	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38B	HGNC	protein_coding	OTTHUMT00000030231.1	104	0.00	0	AGAC	NM_018061		109241420	109241423	+1	no_errors	ENST00000370025	ensembl	human	known	69_37n	frame_shift_del	109	30.57	48	DEL	1.000:1.000:1.000:0.998	-
PRPF38B	55119	genome.wustl.edu	37	1	109241420	109241423	+	Frame_Shift_Del	DEL	AGAC	AGAC	-			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	AGAC	AGAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:109241420_109241423delAGAC	ENST00000370025.4	+	5	1022_1025	c.753_756delAGAC	c.(751-756)atagacfs	p.ID251fs	PRPF38B_ENST00000370021.1_Frame_Shift_Del_p.ID140fs	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	251					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		CTGAGGAAATAGACAGACATGTTG	0.343																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.753_756delAGAC	1.37:g.109241424_109241427delAGAC	ENSP00000359042:p.Ile251fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Frame_Shift_Del	DEL	pfam_PRP38	p.R253fs	ENST00000370025.4	37	c.753_756	CCDS788.1	1																																																																																			PRPF38B	-	NULL	ENSG00000134186		0.343	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38B	HGNC	protein_coding	OTTHUMT00000030231.1	29	0.00	0	AGAC	NM_018061		109241420	109241423	+1	no_errors	ENST00000370025	ensembl	human	known	69_37n	frame_shift_del	25	30.56	11	DEL	1.000:1.000:1.000:0.998	-
PTPLAD1	51495	genome.wustl.edu	37	15	65851018	65851020	+	Splice_Site	DEL	GAA	GAA	-			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr15:65851018_65851020delGAA	ENST00000261875.5	+	5	536_538	c.370_372delGAA	c.(370-372)gaadel	p.E126del	PTPLAD1_ENST00000566074.1_Splice_Site_p.E9del|PTPLAD1_ENST00000562901.1_Splice_Site_p.E9del|PTPLAD1_ENST00000442729.2_Splice_Site_p.E71del|PTPLAD1_ENST00000566511.1_Splice_Site_p.E9del|PTPLAD1_ENST00000569894.1_Splice_Site_p.E9del|PTPLAD1_ENST00000568793.1_Splice_Site_p.E101del|PTPLAD1_ENST00000565299.1_Splice_Site_p.E164del	NM_016395.2	NP_057479.2	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain containing 1	126					activation of JUN kinase activity (GO:0007257)|fatty acid biosynthetic process (GO:0006633)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|positive regulation of GTPase activity (GO:0043547)|Rac protein signal transduction (GO:0016601)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)	GTPase activator activity (GO:0005096)|lyase activity (GO:0016829)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|pancreas(1)	5						TAAATTCTAGGAAGAAGAGCGCC	0.433																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS45282.1	15q22.2	2005-11-11				ENSG00000074696			24175	protein-coding gene	gene with protein product		615940				10747961, 11042152	Standard	NM_016395		Approved	B-ind1, HSPC121	uc002apc.3	Q9P035		ENST00000261875.5:c.370-1GAA>-	15.37:g.65851021_65851023delGAA		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJA1|B4DRF4|Q280Z3|Q6PD63|Q8IUI5|Q8NC86|Q8NCB1|Q96T12|Q9NQA7	In_Frame_Del	DEL	pfam_Tyr_Pase-like_PTPLA,pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.E126in_frame_del	ENST00000261875.5	37	c.370_372	CCDS45282.1	15																																																																																			PTPLAD1	-	NULL	ENSG00000074696		0.433	PTPLAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLAD1	HGNC	protein_coding	OTTHUMT00000419739.1	168	0.00	0	GAA	NM_016395	In_Frame_Del	65851018	65851020	+1	no_errors	ENST00000261875	ensembl	human	known	69_37n	in_frame_del	274	13.52	43	DEL	1.000:1.000:1.000	-
PTPLAD1	51495	genome.wustl.edu	37	15	65851018	65851020	+	Splice_Site	DEL	GAA	GAA	-			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr15:65851018_65851020delGAA	ENST00000261875.5	+	5	536_538	c.370_372delGAA	c.(370-372)gaadel	p.E126del	PTPLAD1_ENST00000566074.1_Splice_Site_p.E9del|PTPLAD1_ENST00000562901.1_Splice_Site_p.E9del|PTPLAD1_ENST00000442729.2_Splice_Site_p.E71del|PTPLAD1_ENST00000566511.1_Splice_Site_p.E9del|PTPLAD1_ENST00000569894.1_Splice_Site_p.E9del|PTPLAD1_ENST00000568793.1_Splice_Site_p.E101del|PTPLAD1_ENST00000565299.1_Splice_Site_p.E164del	NM_016395.2	NP_057479.2	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain containing 1	126					activation of JUN kinase activity (GO:0007257)|fatty acid biosynthetic process (GO:0006633)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|positive regulation of GTPase activity (GO:0043547)|Rac protein signal transduction (GO:0016601)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)	GTPase activator activity (GO:0005096)|lyase activity (GO:0016829)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|pancreas(1)	5						TAAATTCTAGGAAGAAGAGCGCC	0.433																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS45282.1	15q22.2	2005-11-11				ENSG00000074696			24175	protein-coding gene	gene with protein product		615940				10747961, 11042152	Standard	NM_016395		Approved	B-ind1, HSPC121	uc002apc.3	Q9P035		ENST00000261875.5:c.370-1GAA>-	15.37:g.65851021_65851023delGAA		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJA1|B4DRF4|Q280Z3|Q6PD63|Q8IUI5|Q8NC86|Q8NCB1|Q96T12|Q9NQA7	In_Frame_Del	DEL	pfam_Tyr_Pase-like_PTPLA,pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.E126in_frame_del	ENST00000261875.5	37	c.370_372	CCDS45282.1	15																																																																																			PTPLAD1	-	NULL	ENSG00000074696		0.433	PTPLAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLAD1	HGNC	protein_coding	OTTHUMT00000419739.1	75	0.00	0	GAA	NM_016395	In_Frame_Del	65851018	65851020	+1	no_errors	ENST00000261875	ensembl	human	known	69_37n	in_frame_del	82	13.54	13	DEL	1.000:1.000:1.000	-
PTPRB	5787	genome.wustl.edu	37	12	70974955	70974955	+	Silent	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr12:70974955G>C	ENST00000261266.5	-	8	1814	c.1785C>G	c.(1783-1785)gtC>gtG	p.V595V	PTPRB_ENST00000334414.6_Silent_p.V813V|PTPRB_ENST00000550857.1_Silent_p.V505V|PTPRB_ENST00000538708.1_Silent_p.V595V|PTPRB_ENST00000551525.1_Silent_p.V812V|PTPRB_ENST00000451516.2_Silent_p.V505V|PTPRB_ENST00000550358.1_Silent_p.V813V	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	595	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CATTTTTAATGACCACATTTT	0.468																																						dbGAP											0													160.0	159.0	160.0					12																	70974955		1938	4142	6080	-	-	-	SO:0001819	synonymous_variant	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1785C>G	12.37:g.70974955G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V813	ENST00000261266.5	37	c.2439	CCDS44944.1	12																																																																																			PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.468	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	214	0.00	0	G			70974955	70974955	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	silent	83	46.79	73	SNP	1.000	C
PTPRB	5787	genome.wustl.edu	37	12	70974955	70974955	+	Silent	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr12:70974955G>C	ENST00000261266.5	-	8	1814	c.1785C>G	c.(1783-1785)gtC>gtG	p.V595V	PTPRB_ENST00000334414.6_Silent_p.V813V|PTPRB_ENST00000550857.1_Silent_p.V505V|PTPRB_ENST00000538708.1_Silent_p.V595V|PTPRB_ENST00000551525.1_Silent_p.V812V|PTPRB_ENST00000451516.2_Silent_p.V505V|PTPRB_ENST00000550358.1_Silent_p.V813V	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	595	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CATTTTTAATGACCACATTTT	0.468																																						dbGAP											0													160.0	159.0	160.0					12																	70974955		1938	4142	6080	-	-	-	SO:0001819	synonymous_variant	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1785C>G	12.37:g.70974955G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V813	ENST00000261266.5	37	c.2439	CCDS44944.1	12																																																																																			PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.468	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	104	0.00	0	G			70974955	70974955	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	silent	27	55.74	34	SNP	1.000	C
RANBP3	8498	genome.wustl.edu	37	19	5917815	5917815	+	Silent	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr19:5917815G>A	ENST00000340578.6	-	16	1707	c.1650C>T	c.(1648-1650)gcC>gcT	p.A550A	RANBP3_ENST00000591092.1_Silent_p.A477A|RANBP3_ENST00000541471.1_Silent_p.A422A|RANBP3_ENST00000439268.2_Silent_p.A545A|RANBP3_ENST00000034275.8_Silent_p.A482A	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	550					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CAGCTGCGGTGGCCCCTGAAG	0.662																																						dbGAP											0													23.0	28.0	27.0					19																	5917815		2090	4201	6291	-	-	-	SO:0001819	synonymous_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1650C>T	19.37:g.5917815G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.A550	ENST00000340578.6	37	c.1650	CCDS42478.1	19																																																																																			RANBP3	-	NULL	ENSG00000031823		0.662	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	53	0.00	0	G	NM_007322		5917815	5917815	-1	no_errors	ENST00000340578	ensembl	human	known	69_37n	silent	17	52.78	19	SNP	0.004	A
RANBP3	8498	genome.wustl.edu	37	19	5917815	5917815	+	Silent	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr19:5917815G>A	ENST00000340578.6	-	16	1707	c.1650C>T	c.(1648-1650)gcC>gcT	p.A550A	RANBP3_ENST00000591092.1_Silent_p.A477A|RANBP3_ENST00000541471.1_Silent_p.A422A|RANBP3_ENST00000439268.2_Silent_p.A545A|RANBP3_ENST00000034275.8_Silent_p.A482A	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	550					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CAGCTGCGGTGGCCCCTGAAG	0.662																																						dbGAP											0													23.0	28.0	27.0					19																	5917815		2090	4201	6291	-	-	-	SO:0001819	synonymous_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1650C>T	19.37:g.5917815G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.A550	ENST00000340578.6	37	c.1650	CCDS42478.1	19																																																																																			RANBP3	-	NULL	ENSG00000031823		0.662	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	124	0.00	0	G	NM_007322		5917815	5917815	-1	no_errors	ENST00000340578	ensembl	human	known	69_37n	silent	41	41.43	29	SNP	0.004	A
RARG	5916	genome.wustl.edu	37	12	53609502	53609502	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr12:53609502G>C	ENST00000425354.2	-	4	748	c.261C>G	c.(259-261)taC>taG	p.Y87*	RARG_ENST00000543726.1_Intron|RARG_ENST00000327550.3_Nonsense_Mutation_p.Y15*|RARG_ENST00000394426.1_Nonsense_Mutation_p.Y87*|RARG_ENST00000543762.1_Intron|RARG_ENST00000338561.5_Nonsense_Mutation_p.Y76*	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	87	Modulating.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	AGCATGGCTTGTAGACCCGAG	0.612																																						dbGAP											0													104.0	92.0	96.0					12																	53609502		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.261C>G	12.37:g.53609502G>C	ENSP00000388510:p.Tyr87*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Nonsense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.Y87*	ENST00000425354.2	37	c.261	CCDS8850.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.875385|7.875385	0.98537|0.98537	.|.	.|.	ENSG00000172819|ENSG00000172819	ENST00000550265|ENST00000425354;ENST00000394426;ENST00000327550;ENST00000338561	.|.	.|.	.|.	4.29|4.29	2.41|2.41	0.29592|0.29592	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.49406|.	0.1555|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	D|.	0.54964|.	0.969|.	P|.	0.58454|.	0.839|.	T|.	0.58853|.	-0.7563|.	6|.	0.48119|0.30078	T|T	0.1|0.28	.|.	9.4096|9.4096	0.38482|0.38482	0.1984:0.0:0.8015:0.0|0.1984:0.0:0.8015:0.0	.|.	115|.	F8VR45|.	.|.	R|X	115|87;87;15;76	.|.	ENSP00000446565:T115R|ENSP00000332695:Y15X	T|Y	-|-	2|3	0|2	RARG|RARG	51895769|51895769	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.099000|5.099000	0.64554|0.64554	1.127000|1.127000	0.42034|0.42034	0.467000|0.467000	0.42956|0.42956	ACA|TAC	RARG	-	smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000172819		0.612	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARG	HGNC	protein_coding	OTTHUMT00000109404.2	169	0.00	0	G	NM_000966		53609502	53609502	-1	no_errors	ENST00000394426	ensembl	human	known	69_37n	nonsense	166	23.42	52	SNP	1.000	C
RARG	5916	genome.wustl.edu	37	12	53609502	53609502	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr12:53609502G>C	ENST00000425354.2	-	4	748	c.261C>G	c.(259-261)taC>taG	p.Y87*	RARG_ENST00000543726.1_Intron|RARG_ENST00000327550.3_Nonsense_Mutation_p.Y15*|RARG_ENST00000394426.1_Nonsense_Mutation_p.Y87*|RARG_ENST00000543762.1_Intron|RARG_ENST00000338561.5_Nonsense_Mutation_p.Y76*	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	87	Modulating.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	AGCATGGCTTGTAGACCCGAG	0.612																																						dbGAP											0													104.0	92.0	96.0					12																	53609502		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.261C>G	12.37:g.53609502G>C	ENSP00000388510:p.Tyr87*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Nonsense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.Y87*	ENST00000425354.2	37	c.261	CCDS8850.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.875385|7.875385	0.98537|0.98537	.|.	.|.	ENSG00000172819|ENSG00000172819	ENST00000550265|ENST00000425354;ENST00000394426;ENST00000327550;ENST00000338561	.|.	.|.	.|.	4.29|4.29	2.41|2.41	0.29592|0.29592	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.49406|.	0.1555|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	D|.	0.54964|.	0.969|.	P|.	0.58454|.	0.839|.	T|.	0.58853|.	-0.7563|.	6|.	0.48119|0.30078	T|T	0.1|0.28	.|.	9.4096|9.4096	0.38482|0.38482	0.1984:0.0:0.8015:0.0|0.1984:0.0:0.8015:0.0	.|.	115|.	F8VR45|.	.|.	R|X	115|87;87;15;76	.|.	ENSP00000446565:T115R|ENSP00000332695:Y15X	T|Y	-|-	2|3	0|2	RARG|RARG	51895769|51895769	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.099000|5.099000	0.64554|0.64554	1.127000|1.127000	0.42034|0.42034	0.467000|0.467000	0.42956|0.42956	ACA|TAC	RARG	-	smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000172819		0.612	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARG	HGNC	protein_coding	OTTHUMT00000109404.2	87	0.00	0	G	NM_000966		53609502	53609502	-1	no_errors	ENST00000394426	ensembl	human	known	69_37n	nonsense	48	15.79	9	SNP	1.000	C
RASA3	22821	genome.wustl.edu	37	13	114773080	114773080	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr13:114773080G>C	ENST00000334062.7	-	18	1792	c.1671C>G	c.(1669-1671)ttC>ttG	p.F557L	RASA3_ENST00000389544.4_Missense_Mutation_p.F525L	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	557					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCAGATCCAAGAACTAAAGTT	0.542																																						dbGAP											0													89.0	78.0	81.0					13																	114773080		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1671C>G	13.37:g.114773080G>C	ENSP00000335029:p.Phe557Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,prints_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP	p.F557L	ENST00000334062.7	37	c.1671	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589520	0.28357	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.22743	1.94;1.94	4.58	1.84	0.25277	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	M	0.71206	2.165	0.80722	D	1	B	0.29835	0.258	B	0.35312	0.2	T	0.02721	-1.1119	9	.	.	.	.	9.4201	0.38546	0.2474:0.0:0.7525:0.0	.	557	Q14644	RASA3_HUMAN	L	557;525	ENSP00000335029:F557L;ENSP00000374195:F525L	.	F	-	3	2	RASA3	113791182	1.000000	0.71417	0.352000	0.25734	0.142000	0.21351	0.829000	0.27449	0.113000	0.18004	-0.258000	0.10820	TTC	RASA3	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP	ENSG00000185989		0.542	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	265	0.00	0	G	NM_007368		114773080	114773080	-1	no_errors	ENST00000334062	ensembl	human	known	69_37n	missense	124	61.59	202	SNP	0.997	C
RASA3	22821	genome.wustl.edu	37	13	114773080	114773080	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr13:114773080G>C	ENST00000334062.7	-	18	1792	c.1671C>G	c.(1669-1671)ttC>ttG	p.F557L	RASA3_ENST00000389544.4_Missense_Mutation_p.F525L	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	557					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCAGATCCAAGAACTAAAGTT	0.542																																						dbGAP											0													89.0	78.0	81.0					13																	114773080		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1671C>G	13.37:g.114773080G>C	ENSP00000335029:p.Phe557Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,prints_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP	p.F557L	ENST00000334062.7	37	c.1671	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589520	0.28357	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.22743	1.94;1.94	4.58	1.84	0.25277	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	M	0.71206	2.165	0.80722	D	1	B	0.29835	0.258	B	0.35312	0.2	T	0.02721	-1.1119	9	.	.	.	.	9.4201	0.38546	0.2474:0.0:0.7525:0.0	.	557	Q14644	RASA3_HUMAN	L	557;525	ENSP00000335029:F557L;ENSP00000374195:F525L	.	F	-	3	2	RASA3	113791182	1.000000	0.71417	0.352000	0.25734	0.142000	0.21351	0.829000	0.27449	0.113000	0.18004	-0.258000	0.10820	TTC	RASA3	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP	ENSG00000185989		0.542	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	86	0.00	0	G	NM_007368		114773080	114773080	-1	no_errors	ENST00000334062	ensembl	human	known	69_37n	missense	22	54.17	26	SNP	0.997	C
RASL11B	65997	genome.wustl.edu	37	4	53731906	53731906	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr4:53731906G>C	ENST00000248706.3	+	4	899	c.681G>C	c.(679-681)atG>atC	p.M227I	RASL11B_ENST00000505041.1_3'UTR	NM_023940.2	NP_076429.1			RAS-like, family 11, member B											autonomic_ganglia(1)|central_nervous_system(1)|lung(5)|ovary(1)|stomach(1)	9			LUSC - Lung squamous cell carcinoma(32;0.0302)			CACCCAACATGCAGGACCTGA	0.552																																						dbGAP											0													74.0	69.0	71.0					4																	53731906		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK001672	CCDS3490.1	4q12	2014-05-09			ENSG00000128045	ENSG00000128045			23804	protein-coding gene	gene with protein product		612404					Standard	NM_023940		Approved		uc003gzt.3	Q9BPW5	OTTHUMG00000102097	ENST00000248706.3:c.681G>C	4.37:g.53731906G>C	ENSP00000248706:p.Met227Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.M227I	ENST00000248706.3	37	c.681	CCDS3490.1	4	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924630	0.92319	.	.	ENSG00000128045	ENST00000248706	T	0.70045	-0.45	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.79964	0.4537	M	0.67397	2.05	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.80056	-0.1542	10	0.59425	D	0.04	.	18.8619	0.92276	0.0:0.0:1.0:0.0	.	227	Q9BPW5	RSLBB_HUMAN	I	227	ENSP00000248706:M227I	ENSP00000248706:M227I	M	+	3	0	RASL11B	53426663	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.687000	0.91594	0.655000	0.94253	ATG	RASL11B	-	NULL	ENSG00000128045		0.552	RASL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL11B	HGNC	protein_coding	OTTHUMT00000219931.2	105	0.00	0	G	NM_023940		53731906	53731906	+1	no_errors	ENST00000248706	ensembl	human	known	69_37n	missense	59	31.03	27	SNP	1.000	C
RASSF7	8045	genome.wustl.edu	37	11	561784	561784	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr11:561784G>C	ENST00000397583.3	+	2	449	c.16G>C	c.(16-18)Gcg>Ccg	p.A6P	RASSF7_ENST00000397582.3_Missense_Mutation_p.A6P|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000524468.1_Intron|C11orf35_ENST00000329451.3_5'Flank|RASSF7_ENST00000431809.1_Missense_Mutation_p.A6P|RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000344375.4_Missense_Mutation_p.A6P|RASSF7_ENST00000454668.2_Missense_Mutation_p.A6P	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	6	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTGGGACTGGCGGCCATGGA	0.627																																					Pancreas(184;1170 3913 7268)	dbGAP											0													105.0	74.0	84.0					11																	561784		2202	4299	6501	-	-	-	SO:0001583	missense	0			M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.16G>C	11.37:g.561784G>C	ENSP00000380713:p.Ala6Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.A6P	ENST00000397583.3	37	c.16	CCDS7702.1	11	.	.	.	.	.	.	.	.	.	.	G	6.605	0.480042	0.12581	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668;ENST00000528736	T;T;T;T;T	0.33865	1.41;1.41;1.39;1.39;1.42	3.36	-0.0154	0.13976	Ras-association (2);	0.903703	0.09184	N	0.837005	T	0.23492	0.0568	N	0.22421	0.69	0.09310	N	1	P;P;P	0.45396	0.514;0.857;0.729	B;B;B	0.42995	0.147;0.404;0.147	T	0.13308	-1.0514	10	0.52906	T	0.07	0.0601	4.049	0.09786	0.2001:0.0:0.3605:0.4393	.	6;6;6	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	P	6	ENSP00000403068:A6P;ENSP00000380712:A6P;ENSP00000344226:A6P;ENSP00000380713:A6P;ENSP00000405606:A6P	ENSP00000344226:A6P	A	+	1	0	RASSF7	551784	0.002000	0.14202	0.001000	0.08648	0.039000	0.13416	0.760000	0.26475	-0.102000	0.12197	-1.199000	0.01669	GCG	RASSF7	-	smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000099849		0.627	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF7	HGNC	protein_coding	OTTHUMT00000254972.2	92	0.00	0	G	NM_003475		561784	561784	+1	no_errors	ENST00000344375	ensembl	human	known	69_37n	missense	34	59.52	50	SNP	0.000	C
RASSF7	8045	genome.wustl.edu	37	11	561784	561784	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr11:561784G>C	ENST00000397583.3	+	2	449	c.16G>C	c.(16-18)Gcg>Ccg	p.A6P	RASSF7_ENST00000397582.3_Missense_Mutation_p.A6P|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000524468.1_Intron|C11orf35_ENST00000329451.3_5'Flank|RASSF7_ENST00000431809.1_Missense_Mutation_p.A6P|RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000344375.4_Missense_Mutation_p.A6P|RASSF7_ENST00000454668.2_Missense_Mutation_p.A6P	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	6	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTGGGACTGGCGGCCATGGA	0.627																																					Pancreas(184;1170 3913 7268)	dbGAP											0													105.0	74.0	84.0					11																	561784		2202	4299	6501	-	-	-	SO:0001583	missense	0			M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.16G>C	11.37:g.561784G>C	ENSP00000380713:p.Ala6Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.A6P	ENST00000397583.3	37	c.16	CCDS7702.1	11	.	.	.	.	.	.	.	.	.	.	G	6.605	0.480042	0.12581	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668;ENST00000528736	T;T;T;T;T	0.33865	1.41;1.41;1.39;1.39;1.42	3.36	-0.0154	0.13976	Ras-association (2);	0.903703	0.09184	N	0.837005	T	0.23492	0.0568	N	0.22421	0.69	0.09310	N	1	P;P;P	0.45396	0.514;0.857;0.729	B;B;B	0.42995	0.147;0.404;0.147	T	0.13308	-1.0514	10	0.52906	T	0.07	0.0601	4.049	0.09786	0.2001:0.0:0.3605:0.4393	.	6;6;6	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	P	6	ENSP00000403068:A6P;ENSP00000380712:A6P;ENSP00000344226:A6P;ENSP00000380713:A6P;ENSP00000405606:A6P	ENSP00000344226:A6P	A	+	1	0	RASSF7	551784	0.002000	0.14202	0.001000	0.08648	0.039000	0.13416	0.760000	0.26475	-0.102000	0.12197	-1.199000	0.01669	GCG	RASSF7	-	smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000099849		0.627	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF7	HGNC	protein_coding	OTTHUMT00000254972.2	102	0.00	0	G	NM_003475		561784	561784	+1	no_errors	ENST00000344375	ensembl	human	known	69_37n	missense	24	50.00	24	SNP	0.000	C
RBM33	155435	genome.wustl.edu	37	7	155473489	155473489	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:155473489G>A	ENST00000401878.3	+	5	652	c.454G>A	c.(454-456)Gaa>Aaa	p.E152K	RBM33_ENST00000287912.3_Missense_Mutation_p.E152K|RBM33_ENST00000392759.3_Missense_Mutation_p.E152K	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	152	Glu-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		TGAAGGCCACGAAGCTGAGTT	0.418																																						dbGAP											0													96.0	93.0	94.0					7																	155473489		1984	4179	6163	-	-	-	SO:0001583	missense	0			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.454G>A	7.37:g.155473489G>A	ENSP00000384160:p.Glu152Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	smart_RRM_dom	p.E152K	ENST00000401878.3	37	c.454	CCDS5941.2	7	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420545	0.62622	.	.	ENSG00000184863	ENST00000287912;ENST00000401878;ENST00000392759;ENST00000440108	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.35	5.35	0.76521	.	.	.	.	.	T	0.19327	0.0464	N	0.14661	0.345	0.80722	D	1	B;P	0.52577	0.283;0.954	B;B	0.36608	0.038;0.229	T	0.07309	-1.0779	9	0.66056	D	0.02	.	17.2673	0.87090	0.0:0.0:1.0:0.0	.	152;152	Q96EV2;Q96EV2-2	RBM33_HUMAN;.	K	152;152;152;43	ENSP00000287912:E152K;ENSP00000384160:E152K;ENSP00000376513:E152K;ENSP00000394987:E43K	ENSP00000287912:E152K	E	+	1	0	RBM33	155166250	0.995000	0.38212	0.008000	0.14137	0.993000	0.82548	5.137000	0.64789	2.506000	0.84524	0.563000	0.77884	GAA	RBM33	-	NULL	ENSG00000184863		0.418	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3	270	0.00	0	G	NM_001008408		155473489	155473489	+1	no_errors	ENST00000401878	ensembl	human	known	69_37n	missense	344	26.02	121	SNP	0.041	A
RBM33	155435	genome.wustl.edu	37	7	155473489	155473489	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:155473489G>A	ENST00000401878.3	+	5	652	c.454G>A	c.(454-456)Gaa>Aaa	p.E152K	RBM33_ENST00000287912.3_Missense_Mutation_p.E152K|RBM33_ENST00000392759.3_Missense_Mutation_p.E152K	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	152	Glu-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		TGAAGGCCACGAAGCTGAGTT	0.418																																						dbGAP											0													96.0	93.0	94.0					7																	155473489		1984	4179	6163	-	-	-	SO:0001583	missense	0			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.454G>A	7.37:g.155473489G>A	ENSP00000384160:p.Glu152Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	smart_RRM_dom	p.E152K	ENST00000401878.3	37	c.454	CCDS5941.2	7	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420545	0.62622	.	.	ENSG00000184863	ENST00000287912;ENST00000401878;ENST00000392759;ENST00000440108	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.35	5.35	0.76521	.	.	.	.	.	T	0.19327	0.0464	N	0.14661	0.345	0.80722	D	1	B;P	0.52577	0.283;0.954	B;B	0.36608	0.038;0.229	T	0.07309	-1.0779	9	0.66056	D	0.02	.	17.2673	0.87090	0.0:0.0:1.0:0.0	.	152;152	Q96EV2;Q96EV2-2	RBM33_HUMAN;.	K	152;152;152;43	ENSP00000287912:E152K;ENSP00000384160:E152K;ENSP00000376513:E152K;ENSP00000394987:E43K	ENSP00000287912:E152K	E	+	1	0	RBM33	155166250	0.995000	0.38212	0.008000	0.14137	0.993000	0.82548	5.137000	0.64789	2.506000	0.84524	0.563000	0.77884	GAA	RBM33	-	NULL	ENSG00000184863		0.418	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3	72	0.00	0	G	NM_001008408		155473489	155473489	+1	no_errors	ENST00000401878	ensembl	human	known	69_37n	missense	49	25.76	17	SNP	0.041	A
RGS17	26575	genome.wustl.edu	37	6	153345454	153345454	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr6:153345454delA	ENST00000367225.2	-	3	411	c.387delT	c.(385-387)attfs	p.I129fs	RGS17_ENST00000206262.1_Frame_Shift_Del_p.I129fs			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	129	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		CCTTTTCTTCAATTACTTTTT	0.373																																					Esophageal Squamous(78;500 1236 6775 24364 49058)	dbGAP											0													102.0	93.0	96.0					6																	153345454		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.387delT	6.37:g.153345454delA	ENSP00000356194:p.Ile129fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TF49|Q8TD61|Q9UJS8	Frame_Shift_Del	DEL	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.I129fs	ENST00000367225.2	37	c.387	CCDS5244.1	6																																																																																			RGS17	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	ENSG00000091844		0.373	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS17	HGNC	protein_coding	OTTHUMT00000042773.2	342	0.00	0	A			153345454	153345454	-1	no_errors	ENST00000206262	ensembl	human	known	69_37n	frame_shift_del	166	47.53	154	DEL	0.949	-
RGS17	26575	genome.wustl.edu	37	6	153345454	153345454	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr6:153345454delA	ENST00000367225.2	-	3	411	c.387delT	c.(385-387)attfs	p.I129fs	RGS17_ENST00000206262.1_Frame_Shift_Del_p.I129fs			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	129	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		CCTTTTCTTCAATTACTTTTT	0.373																																					Esophageal Squamous(78;500 1236 6775 24364 49058)	dbGAP											0													102.0	93.0	96.0					6																	153345454		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.387delT	6.37:g.153345454delA	ENSP00000356194:p.Ile129fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TF49|Q8TD61|Q9UJS8	Frame_Shift_Del	DEL	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.I129fs	ENST00000367225.2	37	c.387	CCDS5244.1	6																																																																																			RGS17	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	ENSG00000091844		0.373	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS17	HGNC	protein_coding	OTTHUMT00000042773.2	42	0.00	0	A			153345454	153345454	-1	no_errors	ENST00000206262	ensembl	human	known	69_37n	frame_shift_del	10	70.27	26	DEL	0.949	-
RGS7	6000	genome.wustl.edu	37	1	240966282	240966282	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:240966282G>C	ENST00000407727.1	-	15	1280	c.1281C>G	c.(1279-1281)taC>taG	p.Y427*	RGS7_ENST00000331110.7_Nonsense_Mutation_p.Y401*|RGS7_ENST00000446183.2_Nonsense_Mutation_p.Y343*|RGS7_ENST00000348120.2_Nonsense_Mutation_p.Y374*|RGS7_ENST00000366562.4_Nonsense_Mutation_p.Y427*|RGS7_ENST00000401882.1_Nonsense_Mutation_p.Y374*|RGS7_ENST00000366565.1_Nonsense_Mutation_p.Y427*|RGS7_ENST00000366564.1_Nonsense_Mutation_p.Y427*|RGS7_ENST00000366563.1_Nonsense_Mutation_p.Y427*			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	427	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCATCAGTTTGTAAATGTGCT	0.353																																						dbGAP											0													121.0	126.0	124.0					1																	240966282		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1281C>G	1.37:g.240966282G>C	ENSP00000384428:p.Tyr427*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.Y427*	ENST00000407727.1	37	c.1281		1	.	.	.	.	.	.	.	.	.	.	G	33	5.287874	0.95517	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	.	.	.	6.04	6.04	0.98038	.	0.115773	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.583	0.95478	0.0:0.0:1.0:0.0	.	.	.	.	X	401;427;427;427;258;374;343;427;427;374	.	ENSP00000331485:Y401X	Y	-	3	2	RGS7	239032905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.682000	0.84083	2.873000	0.98535	0.563000	0.77884	TAC	RGS7	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000182901		0.353	RGS7-204	KNOWN	basic	protein_coding	RGS7	HGNC	protein_coding		206	0.48	1	G	NM_002924		240966282	240966282	-1	no_errors	ENST00000407727	ensembl	human	known	69_37n	nonsense	319	27.77	123	SNP	1.000	C
RGS7	6000	genome.wustl.edu	37	1	240966282	240966282	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:240966282G>C	ENST00000407727.1	-	15	1280	c.1281C>G	c.(1279-1281)taC>taG	p.Y427*	RGS7_ENST00000331110.7_Nonsense_Mutation_p.Y401*|RGS7_ENST00000446183.2_Nonsense_Mutation_p.Y343*|RGS7_ENST00000348120.2_Nonsense_Mutation_p.Y374*|RGS7_ENST00000366562.4_Nonsense_Mutation_p.Y427*|RGS7_ENST00000401882.1_Nonsense_Mutation_p.Y374*|RGS7_ENST00000366565.1_Nonsense_Mutation_p.Y427*|RGS7_ENST00000366564.1_Nonsense_Mutation_p.Y427*|RGS7_ENST00000366563.1_Nonsense_Mutation_p.Y427*			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	427	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCATCAGTTTGTAAATGTGCT	0.353																																						dbGAP											0													121.0	126.0	124.0					1																	240966282		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1281C>G	1.37:g.240966282G>C	ENSP00000384428:p.Tyr427*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.Y427*	ENST00000407727.1	37	c.1281		1	.	.	.	.	.	.	.	.	.	.	G	33	5.287874	0.95517	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	.	.	.	6.04	6.04	0.98038	.	0.115773	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.583	0.95478	0.0:0.0:1.0:0.0	.	.	.	.	X	401;427;427;427;258;374;343;427;427;374	.	ENSP00000331485:Y401X	Y	-	3	2	RGS7	239032905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.682000	0.84083	2.873000	0.98535	0.563000	0.77884	TAC	RGS7	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000182901		0.353	RGS7-204	KNOWN	basic	protein_coding	RGS7	HGNC	protein_coding		87	0.00	0	G	NM_002924		240966282	240966282	-1	no_errors	ENST00000407727	ensembl	human	known	69_37n	nonsense	113	16.91	23	SNP	1.000	C
RPS6KA2	6196	genome.wustl.edu	37	6	166918092	166918092	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr6:166918092G>C	ENST00000265678.4	-	6	691	c.468C>G	c.(466-468)ttC>ttG	p.F156L	RPS6KA2_ENST00000405189.3_Missense_Mutation_p.F67L|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.F164L|RPS6KA2_ENST00000481261.2_Missense_Mutation_p.F67L|RPS6KA2_ENST00000366863.2_Missense_Mutation_p.F2L|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.F181L	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	156	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CCTCCTCCGTGAACATGACCT	0.433																																						dbGAP											0													116.0	108.0	111.0					6																	166918092		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.468C>G	6.37:g.166918092G>C	ENSP00000265678:p.Phe156Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F181L	ENST00000265678.4	37	c.543	CCDS5294.1	6	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255855	0.59321	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189;ENST00000366863;ENST00000507350;ENST00000512860;ENST00000507371	T;T;T;T;T;T;T;T;T	0.75938	0.17;0.17;0.17;0.17;0.17;0.17;0.17;0.17;-0.98	5.03	1.74	0.24563	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53834	0.1821	N	0.02275	-0.615	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.994;0.993	D;P;D	0.77557	0.99;0.901;0.976	T	0.66662	-0.5867	10	0.87932	D	0	.	9.2615	0.37614	0.3426:0.0:0.6574:0.0	.	181;164;156	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	L	156;181;164;67;67;2;67;67;140	ENSP00000265678:F156L;ENSP00000422435:F181L;ENSP00000427015:F164L;ENSP00000422484:F67L;ENSP00000386050:F67L;ENSP00000355828:F2L;ENSP00000422197:F67L;ENSP00000427605:F67L;ENSP00000423114:F140L	ENSP00000265678:F156L	F	-	3	2	RPS6KA2	166838082	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	1.710000	0.37920	0.522000	0.28464	0.484000	0.47621	TTC	RPS6KA2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000071242		0.433	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2	HGNC	protein_coding	OTTHUMT00000043075.3	176	0.00	0	G	NM_021135		166918092	166918092	-1	no_errors	ENST00000510118	ensembl	human	known	69_37n	missense	79	54.86	96	SNP	1.000	C
RPS6KA2	6196	genome.wustl.edu	37	6	166918092	166918092	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr6:166918092G>C	ENST00000265678.4	-	6	691	c.468C>G	c.(466-468)ttC>ttG	p.F156L	RPS6KA2_ENST00000405189.3_Missense_Mutation_p.F67L|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.F164L|RPS6KA2_ENST00000481261.2_Missense_Mutation_p.F67L|RPS6KA2_ENST00000366863.2_Missense_Mutation_p.F2L|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.F181L	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	156	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CCTCCTCCGTGAACATGACCT	0.433																																						dbGAP											0													116.0	108.0	111.0					6																	166918092		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.468C>G	6.37:g.166918092G>C	ENSP00000265678:p.Phe156Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F181L	ENST00000265678.4	37	c.543	CCDS5294.1	6	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255855	0.59321	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189;ENST00000366863;ENST00000507350;ENST00000512860;ENST00000507371	T;T;T;T;T;T;T;T;T	0.75938	0.17;0.17;0.17;0.17;0.17;0.17;0.17;0.17;-0.98	5.03	1.74	0.24563	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53834	0.1821	N	0.02275	-0.615	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.994;0.993	D;P;D	0.77557	0.99;0.901;0.976	T	0.66662	-0.5867	10	0.87932	D	0	.	9.2615	0.37614	0.3426:0.0:0.6574:0.0	.	181;164;156	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	L	156;181;164;67;67;2;67;67;140	ENSP00000265678:F156L;ENSP00000422435:F181L;ENSP00000427015:F164L;ENSP00000422484:F67L;ENSP00000386050:F67L;ENSP00000355828:F2L;ENSP00000422197:F67L;ENSP00000427605:F67L;ENSP00000423114:F140L	ENSP00000265678:F156L	F	-	3	2	RPS6KA2	166838082	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	1.710000	0.37920	0.522000	0.28464	0.484000	0.47621	TTC	RPS6KA2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000071242		0.433	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2	HGNC	protein_coding	OTTHUMT00000043075.3	49	0.00	0	G	NM_021135		166918092	166918092	-1	no_errors	ENST00000510118	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	1.000	C
RUNDC3B	154661	genome.wustl.edu	37	7	87258230	87258230	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:87258230G>T	ENST00000338056.3	+	1	502	c.91G>T	c.(91-93)Gtg>Ttg	p.V31L	RUNDC3B_ENST00000493037.1_Missense_Mutation_p.V31L|ABCB1_ENST00000265724.3_Intron|RUNDC3B_ENST00000394654.3_Missense_Mutation_p.V31L	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	31										breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					CAATGCTGCGGTGGAGAGGAG	0.721																																						dbGAP											0													22.0	24.0	23.0					7																	87258230		2193	4297	6490	-	-	-	SO:0001583	missense	0				CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.91G>T	7.37:g.87258230G>T	ENSP00000337732:p.Val31Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.V31L	ENST00000338056.3	37	c.91	CCDS5609.1	7	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569216	0.86439	.	.	ENSG00000105784	ENST00000338056;ENST00000493037;ENST00000394654	T;T;T	0.11385	2.78;2.78;2.78	4.23	4.23	0.50019	.	0.144171	0.45867	D	0.000333	T	0.20170	0.0485	L	0.34521	1.04	0.48696	D	0.999695	D;D;B;D	0.58970	0.984;0.984;0.386;0.98	D;D;P;P	0.68192	0.956;0.956;0.558;0.78	T	0.00740	-1.1586	10	0.54805	T	0.06	-6.3644	11.9844	0.53138	0.0:0.0:1.0:0.0	.	31;31;31;31	E9PBR4;B4DFD0;Q96NL0-4;Q96NL0	.;.;.;RUN3B_HUMAN	L	31	ENSP00000337732:V31L;ENSP00000420394:V31L;ENSP00000378149:V31L	ENSP00000337732:V31L	V	+	1	0	RUNDC3B	87096166	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.880000	0.56145	2.170000	0.68504	0.455000	0.32223	GTG	RUNDC3B	-	NULL	ENSG00000105784		0.721	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	HGNC	protein_coding	OTTHUMT00000253679.1	18	0.00	0	G	NM_138290		87258230	87258230	+1	no_errors	ENST00000338056	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	1.000	T
RUNDC3B	154661	genome.wustl.edu	37	7	87258230	87258230	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:87258230G>T	ENST00000338056.3	+	1	502	c.91G>T	c.(91-93)Gtg>Ttg	p.V31L	RUNDC3B_ENST00000493037.1_Missense_Mutation_p.V31L|ABCB1_ENST00000265724.3_Intron|RUNDC3B_ENST00000394654.3_Missense_Mutation_p.V31L	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	31										breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					CAATGCTGCGGTGGAGAGGAG	0.721																																						dbGAP											0													22.0	24.0	23.0					7																	87258230		2193	4297	6490	-	-	-	SO:0001583	missense	0				CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.91G>T	7.37:g.87258230G>T	ENSP00000337732:p.Val31Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.V31L	ENST00000338056.3	37	c.91	CCDS5609.1	7	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569216	0.86439	.	.	ENSG00000105784	ENST00000338056;ENST00000493037;ENST00000394654	T;T;T	0.11385	2.78;2.78;2.78	4.23	4.23	0.50019	.	0.144171	0.45867	D	0.000333	T	0.20170	0.0485	L	0.34521	1.04	0.48696	D	0.999695	D;D;B;D	0.58970	0.984;0.984;0.386;0.98	D;D;P;P	0.68192	0.956;0.956;0.558;0.78	T	0.00740	-1.1586	10	0.54805	T	0.06	-6.3644	11.9844	0.53138	0.0:0.0:1.0:0.0	.	31;31;31;31	E9PBR4;B4DFD0;Q96NL0-4;Q96NL0	.;.;.;RUN3B_HUMAN	L	31	ENSP00000337732:V31L;ENSP00000420394:V31L;ENSP00000378149:V31L	ENSP00000337732:V31L	V	+	1	0	RUNDC3B	87096166	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.880000	0.56145	2.170000	0.68504	0.455000	0.32223	GTG	RUNDC3B	-	NULL	ENSG00000105784		0.721	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	HGNC	protein_coding	OTTHUMT00000253679.1	15	0.00	0	G	NM_138290		87258230	87258230	+1	no_errors	ENST00000338056	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	1.000	T
SGSH	6448	genome.wustl.edu	37	17	78188424	78188424	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr17:78188424G>C	ENST00000326317.6	-	4	582	c.496C>G	c.(496-498)Cag>Gag	p.Q166E	SGSH_ENST00000570923.1_Silent_p.L177L|SGSH_ENST00000572208.1_Intron|SGSH_ENST00000534910.1_5'UTR	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	166					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CGGTCATCCTGAGTCTGCAGG	0.632																																						dbGAP											0													53.0	44.0	47.0					17																	78188424		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.496C>G	17.37:g.78188424G>C	ENSP00000314606:p.Gln166Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E2	Nonsense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.S33*	ENST00000326317.6	37	c.98	CCDS11770.1	17	.	.	.	.	.	.	.	.	.	.	g	1.210	-0.630036	0.03610	.	.	ENSG00000181523	ENST00000326317	D	0.98531	-4.98	4.11	3.12	0.35913	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.347798	0.30575	N	0.009321	D	0.92499	0.7618	N	0.11106	0.095	0.80722	D	1	B;P	0.37573	0.002;0.6	B;B	0.34452	0.014;0.183	D	0.91005	0.4845	10	0.07030	T	0.85	-4.8024	13.7514	0.62910	0.0:0.1556:0.8444:0.0	.	166;169	P51688;Q59EB1	SPHM_HUMAN;.	E	166	ENSP00000314606:Q166E	ENSP00000314606:Q166E	Q	-	1	0	SGSH	75803019	1.000000	0.71417	0.030000	0.17652	0.054000	0.15201	4.911000	0.63328	0.908000	0.36671	0.558000	0.71614	CAG	SGSH	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000181523		0.632	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSH	HGNC	protein_coding	OTTHUMT00000437695.1	93	0.00	0	G	NM_000199		78188424	78188424	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000572257	ensembl	human	putative	69_37n	nonsense	82	32.23	39	SNP	0.962	C
SGSH	6448	genome.wustl.edu	37	17	78188424	78188424	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr17:78188424G>C	ENST00000326317.6	-	4	582	c.496C>G	c.(496-498)Cag>Gag	p.Q166E	SGSH_ENST00000570923.1_Silent_p.L177L|SGSH_ENST00000572208.1_Intron|SGSH_ENST00000534910.1_5'UTR	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	166					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CGGTCATCCTGAGTCTGCAGG	0.632																																						dbGAP											0													53.0	44.0	47.0					17																	78188424		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.496C>G	17.37:g.78188424G>C	ENSP00000314606:p.Gln166Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E2	Nonsense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.S33*	ENST00000326317.6	37	c.98	CCDS11770.1	17	.	.	.	.	.	.	.	.	.	.	g	1.210	-0.630036	0.03610	.	.	ENSG00000181523	ENST00000326317	D	0.98531	-4.98	4.11	3.12	0.35913	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.347798	0.30575	N	0.009321	D	0.92499	0.7618	N	0.11106	0.095	0.80722	D	1	B;P	0.37573	0.002;0.6	B;B	0.34452	0.014;0.183	D	0.91005	0.4845	10	0.07030	T	0.85	-4.8024	13.7514	0.62910	0.0:0.1556:0.8444:0.0	.	166;169	P51688;Q59EB1	SPHM_HUMAN;.	E	166	ENSP00000314606:Q166E	ENSP00000314606:Q166E	Q	-	1	0	SGSH	75803019	1.000000	0.71417	0.030000	0.17652	0.054000	0.15201	4.911000	0.63328	0.908000	0.36671	0.558000	0.71614	CAG	SGSH	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000181523		0.632	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSH	HGNC	protein_coding	OTTHUMT00000437695.1	82	0.00	0	G	NM_000199		78188424	78188424	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000572257	ensembl	human	putative	69_37n	nonsense	62	33.33	31	SNP	0.962	C
SHROOM2	357	genome.wustl.edu	37	X	9864381	9864381	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chrX:9864381G>C	ENST00000380913.3	+	4	2523	c.2433G>C	c.(2431-2433)agG>agC	p.R811S		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	811					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				TTCCCCAGAGGCCTGCCCAGA	0.602																																						dbGAP											0													55.0	53.0	54.0					X																	9864381		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2433G>C	X.37:g.9864381G>C	ENSP00000370299:p.Arg811Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R811S	ENST00000380913.3	37	c.2433	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	4.695	0.129168	0.08981	.	.	ENSG00000146950	ENST00000380913	T	0.14516	2.5	5.07	-1.11	0.09840	.	0.915781	0.09378	N	0.810373	T	0.16599	0.0399	L	0.53249	1.67	0.09310	N	1	D	0.57257	0.979	P	0.49999	0.628	T	0.29458	-1.0011	10	0.22706	T	0.39	-19.1549	6.9207	0.24387	0.4131:0.0:0.4784:0.1085	.	811	Q13796	SHRM2_HUMAN	S	811	ENSP00000370299:R811S	ENSP00000370299:R811S	R	+	3	2	SHROOM2	9824381	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	1.134000	0.31442	-0.184000	0.10567	-0.185000	0.12909	AGG	SHROOM2	-	NULL	ENSG00000146950		0.602	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	104	0.95	1	G	NM_001649		9864381	9864381	+1	no_errors	ENST00000380913	ensembl	human	known	69_37n	missense	121	22.44	35	SNP	0.000	C
SHROOM2	357	genome.wustl.edu	37	X	9864381	9864381	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chrX:9864381G>C	ENST00000380913.3	+	4	2523	c.2433G>C	c.(2431-2433)agG>agC	p.R811S		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	811					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				TTCCCCAGAGGCCTGCCCAGA	0.602																																						dbGAP											0													55.0	53.0	54.0					X																	9864381		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2433G>C	X.37:g.9864381G>C	ENSP00000370299:p.Arg811Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R811S	ENST00000380913.3	37	c.2433	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	4.695	0.129168	0.08981	.	.	ENSG00000146950	ENST00000380913	T	0.14516	2.5	5.07	-1.11	0.09840	.	0.915781	0.09378	N	0.810373	T	0.16599	0.0399	L	0.53249	1.67	0.09310	N	1	D	0.57257	0.979	P	0.49999	0.628	T	0.29458	-1.0011	10	0.22706	T	0.39	-19.1549	6.9207	0.24387	0.4131:0.0:0.4784:0.1085	.	811	Q13796	SHRM2_HUMAN	S	811	ENSP00000370299:R811S	ENSP00000370299:R811S	R	+	3	2	SHROOM2	9824381	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	1.134000	0.31442	-0.184000	0.10567	-0.185000	0.12909	AGG	SHROOM2	-	NULL	ENSG00000146950		0.602	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	63	0.00	0	G	NM_001649		9864381	9864381	+1	no_errors	ENST00000380913	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	0.000	C
SIAH1	6477	genome.wustl.edu	37	16	48396330	48396330	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr16:48396330G>A	ENST00000380006.2	-	1	1463	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	SIAH1_ENST00000573005.1_5'Flank|SIAH1_ENST00000356721.3_Nonsense_Mutation_p.Q35*|SIAH1_ENST00000394725.2_Nonsense_Mutation_p.Q4*			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	4					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				GTAGCAGTCTGACGGCTCATT	0.428																																						dbGAP											0													61.0	58.0	59.0					16																	48396330		2200	4300	6500	-	-	-	SO:0001587	stop_gained	0			U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.10C>T	16.37:g.48396330G>A	ENSP00000369343:p.Gln4*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKF3|O43269|Q49A58|Q92880	Nonsense_Mutation	SNP	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like,pfscan_Znf_RING,pfscan_Znf_SIAH	p.Q35*	ENST00000380006.2	37	c.103	CCDS10735.1	16	.	.	.	.	.	.	.	.	.	.	G	48	14.140680	0.99781	.	.	ENSG00000196470	ENST00000356721;ENST00000394725;ENST00000380006	.	.	.	5.43	5.43	0.79202	.	0.142052	0.48286	U	0.000183	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-0.6805	19.2389	0.93873	0.0:0.0:1.0:0.0	.	.	.	.	X	35;4;20	.	ENSP00000349156:Q35X	Q	-	1	0	SIAH1	46953831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.714000	0.98744	2.555000	0.86185	0.655000	0.94253	CAG	SIAH1	-	NULL	ENSG00000196470		0.428	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	SIAH1	HGNC	protein_coding	OTTHUMT00000256842.12	126	0.00	0	G			48396330	48396330	-1	no_errors	ENST00000356721	ensembl	human	known	69_37n	nonsense	71	25.26	24	SNP	1.000	A
SIAH1	6477	genome.wustl.edu	37	16	48396330	48396330	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr16:48396330G>A	ENST00000380006.2	-	1	1463	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	SIAH1_ENST00000573005.1_5'Flank|SIAH1_ENST00000356721.3_Nonsense_Mutation_p.Q35*|SIAH1_ENST00000394725.2_Nonsense_Mutation_p.Q4*			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	4					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				GTAGCAGTCTGACGGCTCATT	0.428																																						dbGAP											0													61.0	58.0	59.0					16																	48396330		2200	4300	6500	-	-	-	SO:0001587	stop_gained	0			U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.10C>T	16.37:g.48396330G>A	ENSP00000369343:p.Gln4*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKF3|O43269|Q49A58|Q92880	Nonsense_Mutation	SNP	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like,pfscan_Znf_RING,pfscan_Znf_SIAH	p.Q35*	ENST00000380006.2	37	c.103	CCDS10735.1	16	.	.	.	.	.	.	.	.	.	.	G	48	14.140680	0.99781	.	.	ENSG00000196470	ENST00000356721;ENST00000394725;ENST00000380006	.	.	.	5.43	5.43	0.79202	.	0.142052	0.48286	U	0.000183	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-0.6805	19.2389	0.93873	0.0:0.0:1.0:0.0	.	.	.	.	X	35;4;20	.	ENSP00000349156:Q35X	Q	-	1	0	SIAH1	46953831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.714000	0.98744	2.555000	0.86185	0.655000	0.94253	CAG	SIAH1	-	NULL	ENSG00000196470		0.428	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	SIAH1	HGNC	protein_coding	OTTHUMT00000256842.12	49	0.00	0	G			48396330	48396330	-1	no_errors	ENST00000356721	ensembl	human	known	69_37n	nonsense	20	31.03	9	SNP	1.000	A
SLC23A3	151295	genome.wustl.edu	37	2	220032945	220032945	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:220032945G>C	ENST00000409878.3	-	6	802	c.770C>G	c.(769-771)aCt>aGt	p.T257S	SLC23A3_ENST00000455516.2_Missense_Mutation_p.T265S|SLC23A3_ENST00000396775.3_Missense_Mutation_p.H138Q|SLC23A3_ENST00000295738.7_Missense_Mutation_p.L247V	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	257					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGAGAGGAGTGTGAGTTGA	0.587																																						dbGAP											0													48.0	50.0	50.0					2																	220032945		2071	4223	6294	-	-	-	SO:0001583	missense	0			BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.770C>G	2.37:g.220032945G>C	ENSP00000386473:p.Thr257Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.T265S	ENST00000409878.3	37	c.794	CCDS46518.1	2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.03|11.03|11.03	1.519672|1.519672|1.519672	0.27211|0.27211|0.27211	.|.|.	.|.|.	ENSG00000213901|ENSG00000213901|ENSG00000213901	ENST00000396775|ENST00000295738|ENST00000409878;ENST00000455516;ENST00000409370	.|T|T;T;T	.|0.51574|0.44482	.|0.7|2.24;2.24;0.92	4.67|4.67|4.67	3.74|3.74|3.74	0.42951|0.42951|0.42951	.|.|.	.|1.772950|.	.|0.03522|.	.|N|.	.|0.221214|.	T|T|T	0.23688|0.23688|0.23688	0.0573|0.0573|0.0573	.|.|.	.|.|.	.|.|.	0.09310|0.09310|0.09310	N|N|N	1|1|1	P|B|B;B	0.35982|0.17268|0.22146	0.531|0.021|0.065;0.065	B|B|B;B	0.37833|0.18561|0.16722	0.259|0.022|0.016;0.016	T|T|T	0.16600|0.16600|0.16600	-1.0397|-1.0397|-1.0397	6|8|7	.|.|.	.|.|.	.|.|.	.|.|.	4.4246|4.4246|4.4246	0.11497|0.11497|0.11497	0.1484:0.3364:0.5152:0.0|0.1484:0.3364:0.5152:0.0|0.1484:0.3364:0.5152:0.0	.|.|.	109|247|257;265	Q2PYN5|Q6PIS1-2|Q6PIS1;B7Z512	.|.|S23A3_HUMAN;.	Q|V|S	138|247|257;265;257	.|ENSP00000295738:L247V|ENSP00000386473:T257S;ENSP00000406546:T265S;ENSP00000386989:T257S	.|.|.	H|L|T	-|-|-	3|1|2	2|0|0	SLC23A3|SLC23A3|SLC23A3	219741189|219741189|219741189	0.002000|0.002000|0.002000	0.14202|0.14202|0.14202	0.002000|0.002000|0.002000	0.10522|0.10522|0.10522	0.159000|0.159000|0.159000	0.22180|0.22180|0.22180	0.809000|0.809000|0.809000	0.27168|0.27168|0.27168	1.071000|1.071000|1.071000	0.40834|0.40834|0.40834	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	CAC|CTC|ACT	SLC23A3	-	pfam_Xant/urac/vitC	ENSG00000213901		0.587	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC23A3	HGNC	protein_coding	OTTHUMT00000336331.2	94	0.00	0	G	NM_144712		220032945	220032945	-1	no_errors	ENST00000455516	ensembl	human	known	69_37n	missense	94	16.07	18	SNP	0.001	C
SLC23A3	151295	genome.wustl.edu	37	2	220032945	220032945	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr2:220032945G>C	ENST00000409878.3	-	6	802	c.770C>G	c.(769-771)aCt>aGt	p.T257S	SLC23A3_ENST00000455516.2_Missense_Mutation_p.T265S|SLC23A3_ENST00000396775.3_Missense_Mutation_p.H138Q|SLC23A3_ENST00000295738.7_Missense_Mutation_p.L247V	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	257					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGAGAGGAGTGTGAGTTGA	0.587																																						dbGAP											0													48.0	50.0	50.0					2																	220032945		2071	4223	6294	-	-	-	SO:0001583	missense	0			BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.770C>G	2.37:g.220032945G>C	ENSP00000386473:p.Thr257Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.T265S	ENST00000409878.3	37	c.794	CCDS46518.1	2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.03|11.03|11.03	1.519672|1.519672|1.519672	0.27211|0.27211|0.27211	.|.|.	.|.|.	ENSG00000213901|ENSG00000213901|ENSG00000213901	ENST00000396775|ENST00000295738|ENST00000409878;ENST00000455516;ENST00000409370	.|T|T;T;T	.|0.51574|0.44482	.|0.7|2.24;2.24;0.92	4.67|4.67|4.67	3.74|3.74|3.74	0.42951|0.42951|0.42951	.|.|.	.|1.772950|.	.|0.03522|.	.|N|.	.|0.221214|.	T|T|T	0.23688|0.23688|0.23688	0.0573|0.0573|0.0573	.|.|.	.|.|.	.|.|.	0.09310|0.09310|0.09310	N|N|N	1|1|1	P|B|B;B	0.35982|0.17268|0.22146	0.531|0.021|0.065;0.065	B|B|B;B	0.37833|0.18561|0.16722	0.259|0.022|0.016;0.016	T|T|T	0.16600|0.16600|0.16600	-1.0397|-1.0397|-1.0397	6|8|7	.|.|.	.|.|.	.|.|.	.|.|.	4.4246|4.4246|4.4246	0.11497|0.11497|0.11497	0.1484:0.3364:0.5152:0.0|0.1484:0.3364:0.5152:0.0|0.1484:0.3364:0.5152:0.0	.|.|.	109|247|257;265	Q2PYN5|Q6PIS1-2|Q6PIS1;B7Z512	.|.|S23A3_HUMAN;.	Q|V|S	138|247|257;265;257	.|ENSP00000295738:L247V|ENSP00000386473:T257S;ENSP00000406546:T265S;ENSP00000386989:T257S	.|.|.	H|L|T	-|-|-	3|1|2	2|0|0	SLC23A3|SLC23A3|SLC23A3	219741189|219741189|219741189	0.002000|0.002000|0.002000	0.14202|0.14202|0.14202	0.002000|0.002000|0.002000	0.10522|0.10522|0.10522	0.159000|0.159000|0.159000	0.22180|0.22180|0.22180	0.809000|0.809000|0.809000	0.27168|0.27168|0.27168	1.071000|1.071000|1.071000	0.40834|0.40834|0.40834	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	CAC|CTC|ACT	SLC23A3	-	pfam_Xant/urac/vitC	ENSG00000213901		0.587	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC23A3	HGNC	protein_coding	OTTHUMT00000336331.2	47	0.00	0	G	NM_144712		220032945	220032945	-1	no_errors	ENST00000455516	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.001	C
SPEN	23013	genome.wustl.edu	37	1	16261459	16261459	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:16261459C>T	ENST00000375759.3	+	11	8928	c.8724C>T	c.(8722-8724)tcC>tcT	p.S2908S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2908					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATAGGCCATCCTTGGAGAAGC	0.587																																						dbGAP											0													76.0	64.0	68.0					1																	16261459		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8724C>T	1.37:g.16261459C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.S2908	ENST00000375759.3	37	c.8724	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	114	0.00	0	C	NM_015001		16261459	16261459	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	silent	26	55.93	33	SNP	0.049	T
SPEN	23013	genome.wustl.edu	37	1	16261459	16261459	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:16261459C>T	ENST00000375759.3	+	11	8928	c.8724C>T	c.(8722-8724)tcC>tcT	p.S2908S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2908					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATAGGCCATCCTTGGAGAAGC	0.587																																						dbGAP											0													76.0	64.0	68.0					1																	16261459		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8724C>T	1.37:g.16261459C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.S2908	ENST00000375759.3	37	c.8724	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	13	0.00	0	C	NM_015001		16261459	16261459	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	silent	7	46.15	6	SNP	0.049	T
SSPO	23145	genome.wustl.edu	37	7	149482817	149482817	+	RNA	SNP	A	A	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:149482817A>C	ENST00000378016.2	+	0	3233							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACTGTTGTGCACATGCTCAGA	0.627																																						dbGAP											0													21.0	23.0	22.0					7																	149482817		2149	4251	6400	-	-	-			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149482817A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.627	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		66	0.00	0	A			149482817	149482817	+1	no_errors	ENST00000262089	ensembl	human	known	69_37n	rna	45	34.78	24	SNP	1.000	C
STARD9	57519	genome.wustl.edu	37	15	42976692	42976692	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr15:42976692C>T	ENST00000290607.7	+	23	2973	c.2916C>T	c.(2914-2916)acC>acT	p.T972T		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	972					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CCTCTACTACCCAGACCAGAG	0.547																																						dbGAP											0													51.0	42.0	45.0					15																	42976692		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.2916C>T	15.37:g.42976692C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Silent	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T972	ENST00000290607.7	37	c.2916	CCDS53935.1	15																																																																																			STARD9	-	NULL	ENSG00000159433		0.547	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	108	0.00	0	C			42976692	42976692	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	silent	39	54.65	47	SNP	0.004	T
STARD9	57519	genome.wustl.edu	37	15	42976692	42976692	+	Silent	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr15:42976692C>T	ENST00000290607.7	+	23	2973	c.2916C>T	c.(2914-2916)acC>acT	p.T972T		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	972					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CCTCTACTACCCAGACCAGAG	0.547																																						dbGAP											0													51.0	42.0	45.0					15																	42976692		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.2916C>T	15.37:g.42976692C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Silent	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T972	ENST00000290607.7	37	c.2916	CCDS53935.1	15																																																																																			STARD9	-	NULL	ENSG00000159433		0.547	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	52	0.00	0	C			42976692	42976692	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	silent	11	59.26	16	SNP	0.004	T
STRA6	64220	genome.wustl.edu	37	15	74472355	74472355	+	3'UTR	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr15:74472355G>C	ENST00000323940.5	-	0	2315				STRA6_ENST00000563965.1_3'UTR|STRA6_ENST00000574278.1_3'UTR|STRA6_ENST00000449139.2_3'UTR|STRA6_ENST00000395105.4_3'UTR|STRA6_ENST00000574439.1_5'UTR|STRA6_ENST00000416286.3_3'UTR|STRA6_ENST00000423167.2_3'UTR|STRA6_ENST00000535552.1_3'UTR|RP11-665J16.1_ENST00000561647.1_RNA	NM_001142617.1|NM_001142618.1|NM_001142619.1	NP_001136089.1|NP_001136090.1|NP_001136091.1	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid 6						adrenal gland development (GO:0030325)|alveolar primary septum development (GO:0061143)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|cognition (GO:0050890)|developmental growth (GO:0048589)|diaphragm development (GO:0060539)|digestive tract morphogenesis (GO:0048546)|ductus arteriosus closure (GO:0097070)|ear development (GO:0043583)|embryonic camera-type eye formation (GO:0060900)|embryonic digestive tract development (GO:0048566)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|feeding behavior (GO:0007631)|female genitalia development (GO:0030540)|head development (GO:0060322)|head morphogenesis (GO:0060323)|heart development (GO:0007507)|kidney development (GO:0001822)|learning (GO:0007612)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung vasculature development (GO:0060426)|neuromuscular process (GO:0050905)|nose morphogenesis (GO:0043585)|paramesonephric duct development (GO:0061205)|phototransduction, visible light (GO:0007603)|positive regulation of behavior (GO:0048520)|positive regulation of JAK-STAT cascade (GO:0046427)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol transport (GO:0034633)|smooth muscle tissue development (GO:0048745)|uterus morphogenesis (GO:0061038)|ventricular septum development (GO:0003281)|vitamin A import (GO:0071939)|vocal learning (GO:0042297)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	receptor activity (GO:0004872)|vitamin transporter activity (GO:0051183)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|stomach(2)	26						AGCCGGGGAGGGAGGAGGATG	0.647																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF352728	CCDS10261.1, CCDS45301.1, CCDS45302.1, CCDS55973.1, CCDS55974.1, CCDS58387.1	15q24.1	2014-07-14	2012-12-07		ENSG00000137868	ENSG00000137868			30650	protein-coding gene	gene with protein product	"""retinol binding protein 4 receptor"""	610745	"""stimulated by retinoic acid gene 6 homolog (mouse)"", ""stimulated by retinoic acid 6 homolog (mouse)"""			17255476, 17273977	Standard	NM_022369		Approved	FLJ12541	uc002axj.3	Q9BX79	OTTHUMG00000138998	ENST00000323940.5:c.*66C>G	15.37:g.74472355G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7F1|B7Z5M9|B7Z862|D3DW54|F5GYI8|I3L1G8|Q6PJF8|Q71RB9|Q7L9G1|Q7Z3U9|Q8TB21|Q9BX78|Q9H9U8	RNA	SNP	-	NULL	ENST00000323940.5	37	NULL	CCDS10261.1	15																																																																																			STRA6	-	-	ENSG00000137868		0.647	STRA6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STRA6	HGNC	protein_coding	OTTHUMT00000272891.1	86	0.00	0	G			74472355	74472355	-1	no_errors	ENST00000574439	ensembl	human	known	69_37n	rna	44	20.00	11	SNP	0.020	C
SYNC	81493	genome.wustl.edu	37	1	33160479	33160479	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:33160479A>G	ENST00000409190.3	-	2	1678	c.1220T>C	c.(1219-1221)gTg>gCg	p.V407A	SYNC_ENST00000373484.3_Missense_Mutation_p.V407A	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	407	Coil 2.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						GTACTGCTGCACCTCTTCATC	0.547																																						dbGAP											0													338.0	343.0	341.0					1																	33160479		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.1220T>C	1.37:g.33160479A>G	ENSP00000386439:p.Val407Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNK8|B4DY58|C9IY41	Missense_Mutation	SNP	pfam_F	p.V407A	ENST00000409190.3	37	c.1220	CCDS367.2	1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.599901	0.66332	.	.	ENSG00000162520	ENST00000373484;ENST00000409190	D;D	0.88431	-2.38;-2.38	4.3	4.3	0.51218	Filament (1);	0.150208	0.44285	D	0.000470	D	0.88629	0.6488	N	0.24115	0.695	0.40961	D	0.98462	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	D	0.85352	0.1102	10	0.15066	T	0.55	-13.0855	12.9509	0.58401	1.0:0.0:0.0:0.0	.	407;407	Q9H7C4-2;Q9H7C4	.;SYNCI_HUMAN	A	407	ENSP00000362583:V407A;ENSP00000386439:V407A	ENSP00000362583:V407A	V	-	2	0	SYNC	32933066	1.000000	0.71417	0.998000	0.56505	0.881000	0.50899	3.568000	0.53820	1.732000	0.51606	0.402000	0.26972	GTG	SYNC	-	pfam_F	ENSG00000162520		0.547	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNC	HGNC	protein_coding	OTTHUMT00000022129.3	56	0.00	0	A	NM_030786		33160479	33160479	-1	no_errors	ENST00000409190	ensembl	human	known	69_37n	missense	38	33.33	19	SNP	1.000	G
STX6	10228	genome.wustl.edu	37	1	180959152	180959152	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:180959152G>C	ENST00000258301.5	-	5	694	c.457C>G	c.(457-459)Cat>Gat	p.H153D	STX6_ENST00000542060.1_Missense_Mutation_p.H52D|STX6_ENST00000469135.1_5'Flank	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	153					endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						TCAATGAAATGAGAATTGGCT	0.557																																						dbGAP											0													91.0	83.0	86.0					1																	180959152		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.457C>G	1.37:g.180959152G>C	ENSP00000258301:p.His153Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R652|B4DR17|Q5VY08|Q6FH83	Missense_Mutation	SNP	pfam_Syntaxin-6_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.H153D	ENST00000258301.5	37	c.457	CCDS1341.1	1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.776152	0.31411	.	.	ENSG00000135823	ENST00000258301;ENST00000542060	.	.	.	5.38	4.44	0.53790	.	0.199847	0.53938	D	0.000057	T	0.42086	0.1187	L	0.40543	1.245	0.31743	N	0.6355299999999999	B;B	0.26318	0.146;0.001	B;B	0.22152	0.038;0.002	T	0.52808	-0.8526	8	0.33940	T	0.23	-15.1342	12.326	0.55011	0.0:0.0:0.7068:0.2932	.	52;153	B4DR17;O43752	.;STX6_HUMAN	D	153;52	.	ENSP00000258301:H153D	H	-	1	0	STX6	179225775	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	4.786000	0.62425	2.531000	0.85337	0.563000	0.77884	CAT	STX6	-	NULL	ENSG00000135823		0.557	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX6	HGNC	protein_coding	OTTHUMT00000085143.1	85	0.00	0	G	NM_005819		180959152	180959152	-1	no_errors	ENST00000258301	ensembl	human	known	69_37n	missense	104	11.86	14	SNP	1.000	C
TEKT5	146279	genome.wustl.edu	37	16	10769864	10769864	+	Silent	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr16:10769864G>T	ENST00000283025.2	-	5	1109	c.1038C>A	c.(1036-1038)atC>atA	p.I346I		NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	346						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						TCACCTCAGAGATGCGGGCGT	0.597																																						dbGAP											0													138.0	116.0	124.0					16																	10769864		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1038C>A	16.37:g.10769864G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3Z3	Silent	SNP	pfam_Tektin,prints_Tektin	p.I346	ENST00000283025.2	37	c.1038	CCDS10542.1	16																																																																																			TEKT5	-	pfam_Tektin	ENSG00000153060		0.597	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT5	HGNC	protein_coding	OTTHUMT00000251963.1	66	0.00	0	G	NM_144674		10769864	10769864	-1	no_errors	ENST00000283025	ensembl	human	known	69_37n	silent	43	12.24	6	SNP	0.999	T
TJP1	7082	genome.wustl.edu	37	15	30025016	30025016	+	Silent	SNP	A	A	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr15:30025016A>C	ENST00000346128.6	-	14	2214	c.1740T>G	c.(1738-1740)gcT>gcG	p.A580A	TJP1_ENST00000400011.2_Silent_p.A584A|TJP1_ENST00000545208.2_Silent_p.A580A|TJP1_ENST00000356107.6_Silent_p.A580A	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	580	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CTAGCTGCTCAGCTCTACACA	0.408																																					Melanoma(77;681 1843 6309 6570)	dbGAP											0													33.0	32.0	32.0					15																	30025016		1835	4091	5926	-	-	-	SO:0001819	synonymous_variant	0				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1740T>G	15.37:g.30025016A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.A580	ENST00000346128.6	37	c.1740	CCDS42007.1	15																																																																																			TJP1	-	pfam_SH3_2,superfamily_SH3_domain,pfscan_SH3_domain	ENSG00000104067		0.408	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	35	0.00	0	A	NM_003257		30025016	30025016	-1	no_errors	ENST00000346128	ensembl	human	known	69_37n	silent	5	64.29	9	SNP	1.000	C
TMEM120B	144404	genome.wustl.edu	37	12	122213016	122213016	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr12:122213016G>T	ENST00000449592.2	+	11	987	c.886G>T	c.(886-888)Gag>Tag	p.E296*	TMEM120B_ENST00000540377.1_5'UTR	NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	296						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CTCCAGCCACGAGGAATGCAG	0.647																																						dbGAP											0													33.0	35.0	34.0					12																	122213016		1951	4142	6093	-	-	-	SO:0001587	stop_gained	0			BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.886G>T	12.37:g.122213016G>T	ENSP00000404991:p.Glu296*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK01|B3KX33	Nonsense_Mutation	SNP	pfam_TMPIT	p.E296*	ENST00000449592.2	37	c.886	CCDS41852.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.040470	0.97226	.	.	ENSG00000188735	ENST00000449592	.	.	.	5.19	4.3	0.51218	.	0.095002	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-19.8368	10.0569	0.42250	0.1658:0.0:0.8342:0.0	.	.	.	.	X	296	.	ENSP00000345152:E296X	E	+	1	0	TMEM120B	120697399	0.357000	0.24938	0.922000	0.36590	0.957000	0.61999	2.058000	0.41374	1.183000	0.42943	0.561000	0.74099	GAG	TMEM120B	-	pfam_TMPIT	ENSG00000188735		0.647	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM120B	HGNC	protein_coding	OTTHUMT00000402158.1	69	0.00	0	G	NM_001080825		122213016	122213016	+1	no_errors	ENST00000342607	ensembl	human	known	69_37n	nonsense	23	50.00	23	SNP	0.990	T
TP53	7157	genome.wustl.edu	37	17	7578188	7578188	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr17:7578188C>A	ENST00000269305.4	-	6	850	c.661G>T	c.(661-663)Gag>Tag	p.E221*	TP53_ENST00000455263.2_Nonsense_Mutation_p.E221*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E221*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E221*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.E221*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E221*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	221	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E221*(14)|p.?(11)|p.0?(8)|p.E221fs*4(3)|p.E128*(3)|p.E221K(2)|p.Y220_P223delYEPP(1)|p.E221fs*2(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y220fs*25(1)|p.E221fs*26(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCAGGCGGCTCATAGGGCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	48	Substitution - Nonsense(17)|Unknown(11)|Whole gene deletion(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Insertion - Frameshift(3)|Substitution - Missense(2)	upper_aerodigestive_tract(9)|biliary_tract(5)|endometrium(5)|urinary_tract(5)|lung(5)|bone(4)|central_nervous_system(3)|oesophagus(2)|ovary(2)|vulva(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|salivary_gland(1)|breast(1)|skin(1)|large_intestine(1)|liver(1)											100.0	92.0	94.0					17																	7578188		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.661G>T	17.37:g.7578188C>A	ENSP00000269305:p.Glu221*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E221*	ENST00000269305.4	37	c.661	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.353387	0.95830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.31	0.51392	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.6014	12.2235	0.54447	0.0:0.9162:0.0:0.0838	.	.	.	.	X	221;221;221;221;221;221;210;128;89;128	.	ENSP00000269305:E221X	E	-	1	0	TP53	7518913	1.000000	0.71417	0.299000	0.25016	0.996000	0.88848	6.045000	0.71020	1.364000	0.46038	0.563000	0.77884	GAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	296	0.00	0	C	NM_000546		7578188	7578188	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	133	73.29	365	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578188	7578188	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr17:7578188C>A	ENST00000269305.4	-	6	850	c.661G>T	c.(661-663)Gag>Tag	p.E221*	TP53_ENST00000455263.2_Nonsense_Mutation_p.E221*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E221*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E221*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.E221*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E221*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	221	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E221*(14)|p.?(11)|p.0?(8)|p.E221fs*4(3)|p.E128*(3)|p.E221K(2)|p.Y220_P223delYEPP(1)|p.E221fs*2(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y220fs*25(1)|p.E221fs*26(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCAGGCGGCTCATAGGGCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	48	Substitution - Nonsense(17)|Unknown(11)|Whole gene deletion(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Insertion - Frameshift(3)|Substitution - Missense(2)	upper_aerodigestive_tract(9)|biliary_tract(5)|endometrium(5)|urinary_tract(5)|lung(5)|bone(4)|central_nervous_system(3)|oesophagus(2)|ovary(2)|vulva(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|salivary_gland(1)|breast(1)|skin(1)|large_intestine(1)|liver(1)											100.0	92.0	94.0					17																	7578188		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.661G>T	17.37:g.7578188C>A	ENSP00000269305:p.Glu221*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E221*	ENST00000269305.4	37	c.661	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.353387	0.95830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.31	0.51392	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.6014	12.2235	0.54447	0.0:0.9162:0.0:0.0838	.	.	.	.	X	221;221;221;221;221;221;210;128;89;128	.	ENSP00000269305:E221X	E	-	1	0	TP53	7518913	1.000000	0.71417	0.299000	0.25016	0.996000	0.88848	6.045000	0.71020	1.364000	0.46038	0.563000	0.77884	GAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	80	0.00	0	C	NM_000546		7578188	7578188	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	34	58.54	48	SNP	1.000	A
TMEM220	388335	genome.wustl.edu	37	17	10632347	10632347	+	Splice_Site	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr17:10632347C>A	ENST00000341871.3	-	2	567		c.e2+1		CTC-297N7.5_ENST00000579114.1_RNA|TMEM220_ENST00000455996.2_Intron|CTC-297N7.5_ENST00000584714.1_RNA|CTC-297N7.5_ENST00000583115.1_RNA|CTC-297N7.5_ENST00000583012.1_RNA|TMEM220_ENST00000578345.1_Intron|CTC-297N7.5_ENST00000580899.1_RNA|CTC-297N7.5_ENST00000581366.1_RNA|TMEM220_ENST00000580186.1_5'Flank|CTC-297N7.5_ENST00000583343.1_RNA	NM_001004313.1	NP_001004313.1	Q6QAJ8	TM220_HUMAN	transmembrane protein 220							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(1)|prostate(2)	5						CTCATACTCACCACCCACACC	0.468																																						dbGAP											0													103.0	88.0	93.0					17																	10632347		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS32567.1	17p13.1	2008-08-08			ENSG00000187824	ENSG00000187824			33757	protein-coding gene	gene with protein product							Standard	NM_001004313		Approved		uc002gmx.3	Q6QAJ8		ENST00000341871.3:c.102+1G>T	17.37:g.10632347C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1YRJ4|B2RNE4|B4DJ52|B9EGW3	Splice_Site	SNP	-	e2+1	ENST00000341871.3	37	c.102+1	CCDS32567.1	17	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667154	0.47677	.	.	ENSG00000187824	ENST00000341871	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6562	0.56788	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM220	10573072	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	3.646000	0.54396	2.353000	0.79882	0.467000	0.42956	.	TMEM220	-	-	ENSG00000187824		0.468	TMEM220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM220	HGNC	protein_coding	OTTHUMT00000440333.1	168	0.00	0	C	NM_001004313	Intron	10632347	10632347	-1	no_errors	ENST00000341871	ensembl	human	known	69_37n	splice_site	105	27.59	40	SNP	1.000	A
TMEM220	388335	genome.wustl.edu	37	17	10632347	10632347	+	Splice_Site	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr17:10632347C>A	ENST00000341871.3	-	2	567		c.e2+1		CTC-297N7.5_ENST00000579114.1_RNA|TMEM220_ENST00000455996.2_Intron|CTC-297N7.5_ENST00000584714.1_RNA|CTC-297N7.5_ENST00000583115.1_RNA|CTC-297N7.5_ENST00000583012.1_RNA|TMEM220_ENST00000578345.1_Intron|CTC-297N7.5_ENST00000580899.1_RNA|CTC-297N7.5_ENST00000581366.1_RNA|TMEM220_ENST00000580186.1_5'Flank|CTC-297N7.5_ENST00000583343.1_RNA	NM_001004313.1	NP_001004313.1	Q6QAJ8	TM220_HUMAN	transmembrane protein 220							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(1)|prostate(2)	5						CTCATACTCACCACCCACACC	0.468																																						dbGAP											0													103.0	88.0	93.0					17																	10632347		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS32567.1	17p13.1	2008-08-08			ENSG00000187824	ENSG00000187824			33757	protein-coding gene	gene with protein product							Standard	NM_001004313		Approved		uc002gmx.3	Q6QAJ8		ENST00000341871.3:c.102+1G>T	17.37:g.10632347C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1YRJ4|B2RNE4|B4DJ52|B9EGW3	Splice_Site	SNP	-	e2+1	ENST00000341871.3	37	c.102+1	CCDS32567.1	17	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667154	0.47677	.	.	ENSG00000187824	ENST00000341871	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6562	0.56788	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM220	10573072	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	3.646000	0.54396	2.353000	0.79882	0.467000	0.42956	.	TMEM220	-	-	ENSG00000187824		0.468	TMEM220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM220	HGNC	protein_coding	OTTHUMT00000440333.1	57	0.00	0	C	NM_001004313	Intron	10632347	10632347	-1	no_errors	ENST00000341871	ensembl	human	known	69_37n	splice_site	36	28.00	14	SNP	1.000	A
TRGJP	6970	genome.wustl.edu	37	7	38313225	38313225	+	RNA	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:38313225G>C	ENST00000390338.2	-	0	23				TRGJP1_ENST00000390339.1_RNA					T cell receptor gamma joining P																		CAAATACCTTGATTTTTTTGC	0.398																																						dbGAP											0													117.0	125.0	122.0					7																	38313225		1805	4069	5874	-	-	-			0			M12950		7p14	2012-02-07			ENSG00000211691	ENSG00000211691		"""T cell receptors / TRG locus"""	12279	other	T cell receptor gene	"""T-cell receptor, gamma, joining segment JP"""			TCRGJP		2938743	Standard	NG_001336		Approved	JP			OTTHUMG00000155220		7.37:g.38313225G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.I8M	ENST00000390338.2	37	c.24		7																																																																																			TRGJP	-	NULL	ENSG00000211691		0.398	TRGJP-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	TR_J_gene	TRGJP	HGNC	TR_J_gene	OTTHUMT00000338826.1	159	0.00	0	G	NG_001336		38313225	38313225	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390338	ensembl	human	known	69_37n	missense	421	12.84	62	SNP	0.002	C
TRGJP	6970	genome.wustl.edu	37	7	38313225	38313225	+	RNA	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:38313225G>C	ENST00000390338.2	-	0	23				TRGJP1_ENST00000390339.1_RNA					T cell receptor gamma joining P																		CAAATACCTTGATTTTTTTGC	0.398																																						dbGAP											0													117.0	125.0	122.0					7																	38313225		1805	4069	5874	-	-	-			0			M12950		7p14	2012-02-07			ENSG00000211691	ENSG00000211691		"""T cell receptors / TRG locus"""	12279	other	T cell receptor gene	"""T-cell receptor, gamma, joining segment JP"""			TCRGJP		2938743	Standard	NG_001336		Approved	JP			OTTHUMG00000155220		7.37:g.38313225G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.I8M	ENST00000390338.2	37	c.24		7																																																																																			TRGJP	-	NULL	ENSG00000211691		0.398	TRGJP-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	TR_J_gene	TRGJP	HGNC	TR_J_gene	OTTHUMT00000338826.1	91	0.00	0	G	NG_001336		38313225	38313225	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390338	ensembl	human	known	69_37n	missense	100	12.28	14	SNP	0.002	C
TRMT2A	27037	genome.wustl.edu	37	22	20100266	20100266	+	Silent	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr22:20100266G>C	ENST00000252136.7	-	12	2086	c.1698C>G	c.(1696-1698)gtC>gtG	p.V566V	TRMT2A_ENST00000403707.3_Silent_p.V566V|TRMT2A_ENST00000492988.1_5'Flank|TRMT2A_ENST00000439169.2_Silent_p.V584V|TRMT2A_ENST00000404751.3_3'UTR|AC006547.8_ENST00000412713.1_RNA	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	Q8IZ69	TRM2A_HUMAN	tRNA methyltransferase 2 homolog A (S. cerevisiae)	566					RNA processing (GO:0006396)		nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)			breast(2)|endometrium(2)|lung(5)	9						CCACAGCCTTGACCGGCCGGA	0.627																																						dbGAP											0													46.0	48.0	47.0					22																	20100266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017184	CCDS13774.1, CCDS58793.1	22q11.21	2014-02-12	2012-06-12		ENSG00000099899	ENSG00000099899			24974	protein-coding gene	gene with protein product	"""HpaII tiny fragments locus 9C"""	611151				9417108, 18075473	Standard	NM_022727		Approved	HTF9C	uc002zrl.2	Q8IZ69	OTTHUMG00000150454	ENST00000252136.7:c.1698C>G	22.37:g.20100266G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX25|Q32P57|Q96ME6|Q9H732	Nonsense_Mutation	SNP	NULL	p.S84*	ENST00000252136.7	37	c.251	CCDS13774.1	22	.	.	.	.	.	.	.	.	.	.	G	7.649	0.682553	0.14907	.	.	ENSG00000099899	ENST00000444256	.	.	.	5.32	1.99	0.26369	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-46.8599	8.166	0.31226	0.1441:0.3972:0.4587:0.0	.	.	.	.	X	84	.	.	S	-	2	0	TRMT2A	18480266	1.000000	0.71417	0.993000	0.49108	0.457000	0.32468	0.703000	0.25646	0.357000	0.24183	0.561000	0.74099	TCA	TRMT2A	-	NULL	ENSG00000099899		0.627	TRMT2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT2A	HGNC	protein_coding	OTTHUMT00000318168.3	48	0.00	0	G	NM_022727		20100266	20100266	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000444256	ensembl	human	novel	69_37n	nonsense	61	25.61	21	SNP	0.997	C
TRMT2A	27037	genome.wustl.edu	37	22	20100266	20100266	+	Silent	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr22:20100266G>C	ENST00000252136.7	-	12	2086	c.1698C>G	c.(1696-1698)gtC>gtG	p.V566V	TRMT2A_ENST00000403707.3_Silent_p.V566V|TRMT2A_ENST00000492988.1_5'Flank|TRMT2A_ENST00000439169.2_Silent_p.V584V|TRMT2A_ENST00000404751.3_3'UTR|AC006547.8_ENST00000412713.1_RNA	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	Q8IZ69	TRM2A_HUMAN	tRNA methyltransferase 2 homolog A (S. cerevisiae)	566					RNA processing (GO:0006396)		nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)			breast(2)|endometrium(2)|lung(5)	9						CCACAGCCTTGACCGGCCGGA	0.627																																						dbGAP											0													46.0	48.0	47.0					22																	20100266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017184	CCDS13774.1, CCDS58793.1	22q11.21	2014-02-12	2012-06-12		ENSG00000099899	ENSG00000099899			24974	protein-coding gene	gene with protein product	"""HpaII tiny fragments locus 9C"""	611151				9417108, 18075473	Standard	NM_022727		Approved	HTF9C	uc002zrl.2	Q8IZ69	OTTHUMG00000150454	ENST00000252136.7:c.1698C>G	22.37:g.20100266G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX25|Q32P57|Q96ME6|Q9H732	Nonsense_Mutation	SNP	NULL	p.S84*	ENST00000252136.7	37	c.251	CCDS13774.1	22	.	.	.	.	.	.	.	.	.	.	G	7.649	0.682553	0.14907	.	.	ENSG00000099899	ENST00000444256	.	.	.	5.32	1.99	0.26369	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-46.8599	8.166	0.31226	0.1441:0.3972:0.4587:0.0	.	.	.	.	X	84	.	.	S	-	2	0	TRMT2A	18480266	1.000000	0.71417	0.993000	0.49108	0.457000	0.32468	0.703000	0.25646	0.357000	0.24183	0.561000	0.74099	TCA	TRMT2A	-	NULL	ENSG00000099899		0.627	TRMT2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT2A	HGNC	protein_coding	OTTHUMT00000318168.3	49	0.00	0	G	NM_022727		20100266	20100266	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000444256	ensembl	human	novel	69_37n	nonsense	33	32.65	16	SNP	0.997	C
TRPM3	80036	genome.wustl.edu	37	9	73399144	73399144	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr9:73399144T>C	ENST00000377111.2	-	7	1268	c.1025A>G	c.(1024-1026)aAt>aGt	p.N342S	TRPM3_ENST00000377101.1_Missense_Mutation_p.N189S|TRPM3_ENST00000377110.3_Missense_Mutation_p.N342S|TRPM3_ENST00000408909.2_Missense_Mutation_p.N189S|TRPM3_ENST00000358082.3_Missense_Mutation_p.N214S|TRPM3_ENST00000361823.5_Missense_Mutation_p.N189S|TRPM3_ENST00000357533.2_Missense_Mutation_p.N344S|TRPM3_ENST00000377106.1_Missense_Mutation_p.N214S|TRPM3_ENST00000396285.1_Missense_Mutation_p.N189S|TRPM3_ENST00000423814.3_Missense_Mutation_p.N369S|TRPM3_ENST00000396283.1_Missense_Mutation_p.N214S|TRPM3_ENST00000360823.2_Missense_Mutation_p.N214S|TRPM3_ENST00000396280.5_Missense_Mutation_p.N189S|TRPM3_ENST00000396292.4_Missense_Mutation_p.N214S|TRPM3_ENST00000377105.1_Missense_Mutation_p.N189S	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	367					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CGAGATCACATTGGGTCCTCC	0.488																																						dbGAP											0													102.0	80.0	88.0					9																	73399144		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1025A>G	9.37:g.73399144T>C	ENSP00000366315:p.Asn342Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.N369S	ENST00000377111.2	37	c.1106		9	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563906	0.45694	.	.	ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101;ENST00000396283;ENST00000361823	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.67345	4.12;4.12;0.53;0.53;4.12;4.12;4.12;4.12;0.53;0.53;0.55;1.3;-0.26;1.3	6.17	5.04	0.67666	.	0.095422	0.64402	D	0.000001	T	0.64305	0.2586	M	0.62209	1.925	0.47905	D	0.999545	B;B;B;B;B;B;B;B;B;B	0.29301	0.212;0.063;0.039;0.196;0.241;0.102;0.001;0.241;0.164;0.024	B;B;B;B;B;B;B;B;B;B	0.31869	0.137;0.03;0.087;0.053;0.092;0.04;0.012;0.057;0.087;0.027	T	0.60919	-0.7167	10	0.36615	T	0.2	-6.8165	12.3147	0.54948	0.0:0.0655:0.0:0.9345	.	367;189;342;342;342;344;214;189;342;189	Q9HCF6;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	TRPM3_HUMAN;.;.;.;.;.;.;.;.;.	S	342;342;214;214;189;344;189;189;214;214;369;189;214;189	ENSP00000366315:N342S;ENSP00000366314:N342S;ENSP00000366310:N214S;ENSP00000354066:N214S;ENSP00000366309:N189S;ENSP00000350140:N344S;ENSP00000386127:N189S;ENSP00000379581:N189S;ENSP00000379587:N214S;ENSP00000350791:N214S;ENSP00000389542:N369S;ENSP00000366305:N189S;ENSP00000379579:N214S;ENSP00000355395:N189S	ENSP00000350140:N344S	N	-	2	0	TRPM3	72588964	1.000000	0.71417	0.757000	0.31301	0.830000	0.47004	8.033000	0.88852	1.155000	0.42497	0.533000	0.62120	AAT	TRPM3	-	NULL	ENSG00000083067		0.488	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	148	0.00	0	T	NM_206945		73399144	73399144	-1	no_errors	ENST00000423814	ensembl	human	known	69_37n	missense	112	23.29	34	SNP	0.997	C
TSGA13	114960	genome.wustl.edu	37	7	130357607	130357607	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:130357607T>A	ENST00000456951.1	-	7	1348	c.497A>T	c.(496-498)gAt>gTt	p.D166V	TSGA13_ENST00000356588.3_Missense_Mutation_p.D166V			Q96PP4	TSG13_HUMAN	testis specific, 13	166										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					TGTGGGATCATCCGACAGTAT	0.433																																						dbGAP											0													194.0	182.0	186.0					7																	130357607		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.497A>T	7.37:g.130357607T>A	ENSP00000406047:p.Asp166Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSC9	Missense_Mutation	SNP	NULL	p.D166V	ENST00000456951.1	37	c.497	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	T	14.61	2.587354	0.46110	.	.	ENSG00000213265	ENST00000456951;ENST00000418126;ENST00000356588	.	.	.	5.52	-1.16	0.09678	.	1.360770	0.04761	N	0.426324	T	0.29158	0.0725	N	0.19112	0.55	0.09310	N	0.999992	P	0.47677	0.899	P	0.44990	0.466	T	0.37753	-0.9692	9	0.66056	D	0.02	-0.0326	9.0958	0.36638	0.0:0.416:0.0:0.584	.	166	Q96PP4	TSG13_HUMAN	V	166	.	ENSP00000348996:D166V	D	-	2	0	TSGA13	130008147	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.018000	0.13422	-0.357000	0.08175	-0.250000	0.11733	GAT	TSGA13	-	NULL	ENSG00000213265		0.433	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	HGNC	protein_coding	OTTHUMT00000337997.1	394	0.00	0	T	NM_052933		130357607	130357607	-1	no_errors	ENST00000356588	ensembl	human	known	69_37n	missense	502	16.28	98	SNP	0.000	A
TSGA13	114960	genome.wustl.edu	37	7	130357607	130357607	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:130357607T>A	ENST00000456951.1	-	7	1348	c.497A>T	c.(496-498)gAt>gTt	p.D166V	TSGA13_ENST00000356588.3_Missense_Mutation_p.D166V			Q96PP4	TSG13_HUMAN	testis specific, 13	166										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					TGTGGGATCATCCGACAGTAT	0.433																																						dbGAP											0													194.0	182.0	186.0					7																	130357607		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.497A>T	7.37:g.130357607T>A	ENSP00000406047:p.Asp166Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSC9	Missense_Mutation	SNP	NULL	p.D166V	ENST00000456951.1	37	c.497	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	T	14.61	2.587354	0.46110	.	.	ENSG00000213265	ENST00000456951;ENST00000418126;ENST00000356588	.	.	.	5.52	-1.16	0.09678	.	1.360770	0.04761	N	0.426324	T	0.29158	0.0725	N	0.19112	0.55	0.09310	N	0.999992	P	0.47677	0.899	P	0.44990	0.466	T	0.37753	-0.9692	9	0.66056	D	0.02	-0.0326	9.0958	0.36638	0.0:0.416:0.0:0.584	.	166	Q96PP4	TSG13_HUMAN	V	166	.	ENSP00000348996:D166V	D	-	2	0	TSGA13	130008147	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.018000	0.13422	-0.357000	0.08175	-0.250000	0.11733	GAT	TSGA13	-	NULL	ENSG00000213265		0.433	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	HGNC	protein_coding	OTTHUMT00000337997.1	100	0.00	0	T	NM_052933		130357607	130357607	-1	no_errors	ENST00000356588	ensembl	human	known	69_37n	missense	79	21.00	21	SNP	0.000	A
TTF2	8458	genome.wustl.edu	37	1	117620594	117620594	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr1:117620594G>A	ENST00000369466.4	+	8	1674	c.1630G>A	c.(1630-1632)Ggt>Agt	p.G544S		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	544					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TGAAGCCATCGGTCAACTGCA	0.493																																						dbGAP											0													208.0	167.0	181.0					1																	117620594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.1630G>A	1.37:g.117620594G>A	ENSP00000358478:p.Gly544Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G544S	ENST00000369466.4	37	c.1630	CCDS892.1	1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457786	0.43634	.	.	ENSG00000116830	ENST00000369466	D	0.86097	-2.07	5.88	5.88	0.94601	.	0.185219	0.26499	N	0.024031	T	0.62502	0.2433	N	0.14661	0.345	0.29784	N	0.833726	B;B	0.18013	0.025;0.023	B;B	0.13407	0.006;0.009	T	0.49428	-0.8941	10	0.22706	T	0.39	-11.559	17.7148	0.88333	0.0:0.0:1.0:0.0	.	544;544	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	S	544	ENSP00000358478:G544S	ENSP00000358478:G544S	G	+	1	0	TTF2	117422117	1.000000	0.71417	0.989000	0.46669	0.016000	0.09150	3.124000	0.50461	2.792000	0.96026	0.555000	0.69702	GGT	TTF2	-	NULL	ENSG00000116830		0.493	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	227	0.44	1	G			117620594	117620594	+1	no_errors	ENST00000369466	ensembl	human	known	69_37n	missense	210	29.05	86	SNP	1.000	A
TTF2	8458	genome.wustl.edu	37	1	117620594	117620594	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:117620594G>A	ENST00000369466.4	+	8	1674	c.1630G>A	c.(1630-1632)Ggt>Agt	p.G544S		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	544					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TGAAGCCATCGGTCAACTGCA	0.493																																						dbGAP											0													208.0	167.0	181.0					1																	117620594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.1630G>A	1.37:g.117620594G>A	ENSP00000358478:p.Gly544Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G544S	ENST00000369466.4	37	c.1630	CCDS892.1	1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457786	0.43634	.	.	ENSG00000116830	ENST00000369466	D	0.86097	-2.07	5.88	5.88	0.94601	.	0.185219	0.26499	N	0.024031	T	0.62502	0.2433	N	0.14661	0.345	0.29784	N	0.833726	B;B	0.18013	0.025;0.023	B;B	0.13407	0.006;0.009	T	0.49428	-0.8941	10	0.22706	T	0.39	-11.559	17.7148	0.88333	0.0:0.0:1.0:0.0	.	544;544	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	S	544	ENSP00000358478:G544S	ENSP00000358478:G544S	G	+	1	0	TTF2	117422117	1.000000	0.71417	0.989000	0.46669	0.016000	0.09150	3.124000	0.50461	2.792000	0.96026	0.555000	0.69702	GGT	TTF2	-	NULL	ENSG00000116830		0.493	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	65	0.00	0	G			117620594	117620594	+1	no_errors	ENST00000369466	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	1.000	A
TUBB	203068	genome.wustl.edu	37	6	30691194	30691194	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr6:30691194G>A	ENST00000327892.8	+	4	661	c.355G>A	c.(355-357)Gtg>Atg	p.V119M	TUBB_ENST00000435534.1_Missense_Mutation_p.V119M|TUBB_ENST00000396389.1_Missense_Mutation_p.V101M|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000330914.3_Missense_Mutation_p.V47M|TUBB_ENST00000396384.1_Missense_Mutation_p.V47M	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	119					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	TGTCCTGGATGTGGTACGGAA	0.592																																						dbGAP											0													37.0	36.0	37.0					6																	30691194		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.355G>A	6.37:g.30691194G>A	ENSP00000339001:p.Val119Met	Somatic		WXS	Illumina GAIIx	Phase_IV	P05218|Q8WUC1|Q9CY33	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.V119M	ENST00000327892.8	37	c.355	CCDS4687.1	6	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818093	0.50633	.	.	ENSG00000196230	ENST00000327892;ENST00000435534;ENST00000330914;ENST00000396389;ENST00000396384	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	5.03	5.03	0.67393	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	D	0.000001	T	0.76485	0.3994	M	0.81614	2.55	0.80722	D	1	P;P	0.52061	0.693;0.95	P;P	0.59761	0.863;0.717	T	0.80752	-0.1242	10	0.87932	D	0	.	15.8464	0.78895	0.0:0.0:1.0:0.0	.	119;119	P07437;F8VW92	TBB5_HUMAN;.	M	119;119;47;101;47	ENSP00000339001:V119M;ENSP00000391672:V119M;ENSP00000365578:V47M;ENSP00000379672:V101M;ENSP00000379668:V47M	ENSP00000339001:V119M	V	+	1	0	TUBB	30799173	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.544000	0.98092	2.330000	0.79161	0.491000	0.48974	GTG	TUBB	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	ENSG00000196230		0.592	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB	HGNC	protein_coding	OTTHUMT00000076074.2	174	0.57	1	G	NM_178014		30691194	30691194	+1	no_errors	ENST00000327892	ensembl	human	known	69_37n	missense	63	52.99	71	SNP	1.000	A
TUBB	203068	genome.wustl.edu	37	6	30691194	30691194	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr6:30691194G>A	ENST00000327892.8	+	4	661	c.355G>A	c.(355-357)Gtg>Atg	p.V119M	TUBB_ENST00000435534.1_Missense_Mutation_p.V119M|TUBB_ENST00000396389.1_Missense_Mutation_p.V101M|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000330914.3_Missense_Mutation_p.V47M|TUBB_ENST00000396384.1_Missense_Mutation_p.V47M	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	119					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	TGTCCTGGATGTGGTACGGAA	0.592																																						dbGAP											0													37.0	36.0	37.0					6																	30691194		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.355G>A	6.37:g.30691194G>A	ENSP00000339001:p.Val119Met	Somatic		WXS	Illumina GAIIx	Phase_IV	P05218|Q8WUC1|Q9CY33	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.V119M	ENST00000327892.8	37	c.355	CCDS4687.1	6	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818093	0.50633	.	.	ENSG00000196230	ENST00000327892;ENST00000435534;ENST00000330914;ENST00000396389;ENST00000396384	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	5.03	5.03	0.67393	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	D	0.000001	T	0.76485	0.3994	M	0.81614	2.55	0.80722	D	1	P;P	0.52061	0.693;0.95	P;P	0.59761	0.863;0.717	T	0.80752	-0.1242	10	0.87932	D	0	.	15.8464	0.78895	0.0:0.0:1.0:0.0	.	119;119	P07437;F8VW92	TBB5_HUMAN;.	M	119;119;47;101;47	ENSP00000339001:V119M;ENSP00000391672:V119M;ENSP00000365578:V47M;ENSP00000379672:V101M;ENSP00000379668:V47M	ENSP00000339001:V119M	V	+	1	0	TUBB	30799173	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.544000	0.98092	2.330000	0.79161	0.491000	0.48974	GTG	TUBB	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	ENSG00000196230		0.592	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB	HGNC	protein_coding	OTTHUMT00000076074.2	116	0.00	0	G	NM_178014		30691194	30691194	+1	no_errors	ENST00000327892	ensembl	human	known	69_37n	missense	30	49.15	29	SNP	1.000	A
UBE3C	9690	genome.wustl.edu	37	7	157046809	157046809	+	Silent	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr7:157046809C>G	ENST00000348165.5	+	20	3216	c.2856C>G	c.(2854-2856)ctC>ctG	p.L952L		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	952	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TCGAGTGGCTCCGAATGTTTG	0.517																																						dbGAP											0													55.0	53.0	53.0					7																	157046809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2856C>G	7.37:g.157046809C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.L952	ENST00000348165.5	37	c.2856	CCDS34789.1	7																																																																																			UBE3C	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000009335		0.517	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1	116	0.00	0	C	NM_014671		157046809	157046809	+1	no_errors	ENST00000348165	ensembl	human	known	69_37n	silent	170	25.76	59	SNP	0.993	G
UBE3C	9690	genome.wustl.edu	37	7	157046809	157046809	+	Silent	SNP	C	C	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr7:157046809C>G	ENST00000348165.5	+	20	3216	c.2856C>G	c.(2854-2856)ctC>ctG	p.L952L		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	952	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TCGAGTGGCTCCGAATGTTTG	0.517																																						dbGAP											0													55.0	53.0	53.0					7																	157046809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2856C>G	7.37:g.157046809C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.L952	ENST00000348165.5	37	c.2856	CCDS34789.1	7																																																																																			UBE3C	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000009335		0.517	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1	67	0.00	0	C	NM_014671		157046809	157046809	+1	no_errors	ENST00000348165	ensembl	human	known	69_37n	silent	72	30.10	31	SNP	0.993	G
UGT1A6	54578	genome.wustl.edu	37	2	234676964	234676964	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr2:234676964G>T	ENST00000305139.6	+	4	1319	c.1180G>T	c.(1180-1182)Ggt>Tgt	p.G394C	UGT1A6_ENST00000373424.1_Missense_Mutation_p.G127C|UGT1A3_ENST00000482026.1_Missense_Mutation_p.G396C|UGT1A1_ENST00000609767.1_Missense_Mutation_p.G396C|UGT1A8_ENST00000305208.5_Missense_Mutation_p.G395C|UGT1A6_ENST00000406651.1_Missense_Mutation_p.G127C|UGT1A10_ENST00000373445.1_Missense_Mutation_p.G392C|UGT1A1_ENST00000608383.1_Missense_Mutation_p.G395C|UGT1A9_ENST00000354728.4_Missense_Mutation_p.G392C|UGT1A7_ENST00000373426.3_Missense_Mutation_p.G392C|UGT1A1_ENST00000608381.1_Missense_Mutation_p.G396C|UGT1A1_ENST00000609637.1_Missense_Mutation_p.G392C|UGT1A1_ENST00000360418.3_Missense_Mutation_p.G395C|UGT1A4_ENST00000373409.3_Missense_Mutation_p.G396C|UGT1A5_ENST00000373414.3_Missense_Mutation_p.G396C|UGT1A1_ENST00000373450.4_Missense_Mutation_p.G392C|UGT1A10_ENST00000344644.5_Missense_Mutation_p.G392C	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	394					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GCCCTTGTTTGGTGATCAGAT	0.468																																						dbGAP											0													217.0	188.0	198.0					2																	234676964		2203	4300	6503	-	-	-	SO:0001583	missense	0			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1180G>T	2.37:g.234676964G>T	ENSP00000303174:p.Gly394Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.G396C	ENST00000305139.6	37	c.1186	CCDS2507.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162144	0.78226	.	.	ENSG00000242366;ENSG00000242515;ENSG00000242515;ENSG00000241119;ENSG00000244122;ENSG00000167165;ENSG00000167165;ENSG00000167165;ENSG00000240224;ENSG00000244474;ENSG00000243135;ENSG00000241635;ENSG00000241635	ENST00000373450;ENST00000344644;ENST00000373445;ENST00000354728;ENST00000373426;ENST00000373424;ENST00000305139;ENST00000406651;ENST00000373414;ENST00000373409;ENST00000482026;ENST00000305208;ENST00000360418	T;T;T;T;T;T;T;T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.88	5.01	0.66863	.	0.053378	0.85682	D	0.000000	D	0.85195	0.5641	M	0.91717	3.235	0.48571	D	0.999677	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.984;1.0;0.996;1.0;0.999;0.999;0.988;0.99;1.0;1.0;1.0;1.0;1.0;0.999;0.988;0.993;1.0;0.99	D	0.88757	0.3254	10	0.87932	D	0	.	15.0691	0.72021	0.0679:0.0:0.9321:0.0	.	395;396;396;396;394;392;392;392;395;396;396;396;394;392;392;392;392;392	A6NJC3;Q5DT01;B8K288;Q5DSZ9;B8K289;Q5DSZ7;Q5DSZ5;Q5DSZ6;P22309;P35503;P22310;P35504;P19224;Q9HAW7;O60656;Q9HAW8;Q7Z6H8;Q9HAW9	.;.;.;.;.;.;.;.;UD11_HUMAN;UD13_HUMAN;UD14_HUMAN;UD15_HUMAN;UD16_HUMAN;UD17_HUMAN;UD19_HUMAN;UD110_HUMAN;.;UD18_HUMAN	C	392;392;392;392;392;127;394;127;396;396;396;395;395	ENSP00000362549:G392C;ENSP00000343838:G392C;ENSP00000362544:G392C;ENSP00000346768:G392C;ENSP00000362525:G392C;ENSP00000362523:G127C;ENSP00000303174:G394C;ENSP00000386107:G127C;ENSP00000362513:G396C;ENSP00000362508:G396C;ENSP00000418532:G396C;ENSP00000304845:G395C;ENSP00000353593:G395C	ENSP00000343838:G392C	G	+	1	0	UGT1A7;UGT1A6;UGT1A10;UGT1A9;UGT1A8;UGT1A3;UGT1A5;UGT1A4;UGT1A1	234341703	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	9.218000	0.95166	1.489000	0.48450	-0.140000	0.14226	GGT	UGT1A4	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000244474		0.468	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A4	HGNC	protein_coding	OTTHUMT00000130988.1	413	0.00	0	G	NM_205862		234676964	234676964	+1	no_errors	ENST00000373409	ensembl	human	known	69_37n	missense	315	18.39	71	SNP	1.000	T
UMODL1	89766	genome.wustl.edu	37	21	43542941	43542941	+	Splice_Site	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr21:43542941G>T	ENST00000408910.2	+	17	2828	c.2828G>T	c.(2827-2829)gGt>gTt	p.G943V	UMODL1_ENST00000400424.2_Splice_Site_p.G871V|UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000408989.2_Splice_Site_p.G1071V|UMODL1_ENST00000400427.1_Splice_Site_p.G999V	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	943					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TGCCTTGCAGGTGACTCTCCT	0.617																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													41.0	46.0	44.0					21																	43542941		2090	4207	6297	-	-	-	SO:0001630	splice_region_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.2828-1G>T	21.37:g.43542941G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.G1071V	ENST00000408910.2	37	c.3212	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	G	5.872	0.345114	0.11126	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.73469	-0.75;-0.75;-0.74;-0.75	3.11	0.288	0.15719	.	0.984119	0.08254	N	0.974163	T	0.72614	0.3482	L	0.32530	0.975	0.52099	D	0.99994	D;P	0.63880	0.993;0.651	P;B	0.58660	0.843;0.116	T	0.65142	-0.6240	9	.	.	.	.	6.0701	0.19885	0.4842:0.0:0.5158:0.0	.	1071;943	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	V	999;871;1071;943	ENSP00000383279:G999V;ENSP00000383276:G871V;ENSP00000386126:G1071V;ENSP00000386147:G943V	.	G	+	2	0	UMODL1	42416010	0.021000	0.18746	0.978000	0.43139	0.143000	0.21401	-0.385000	0.07379	0.052000	0.16007	-0.772000	0.03388	GGT	UMODL1	-	NULL	ENSG00000177398		0.617	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	93	0.00	0	G		Missense_Mutation	43542941	43542941	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	missense	95	20.17	24	SNP	0.979	T
UMODL1	89766	genome.wustl.edu	37	21	43542941	43542941	+	Splice_Site	SNP	G	G	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr21:43542941G>T	ENST00000408910.2	+	17	2828	c.2828G>T	c.(2827-2829)gGt>gTt	p.G943V	UMODL1_ENST00000400424.2_Splice_Site_p.G871V|UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000408989.2_Splice_Site_p.G1071V|UMODL1_ENST00000400427.1_Splice_Site_p.G999V	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	943					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TGCCTTGCAGGTGACTCTCCT	0.617																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													41.0	46.0	44.0					21																	43542941		2090	4207	6297	-	-	-	SO:0001630	splice_region_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.2828-1G>T	21.37:g.43542941G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.G1071V	ENST00000408910.2	37	c.3212	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	G	5.872	0.345114	0.11126	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.73469	-0.75;-0.75;-0.74;-0.75	3.11	0.288	0.15719	.	0.984119	0.08254	N	0.974163	T	0.72614	0.3482	L	0.32530	0.975	0.52099	D	0.99994	D;P	0.63880	0.993;0.651	P;B	0.58660	0.843;0.116	T	0.65142	-0.6240	9	.	.	.	.	6.0701	0.19885	0.4842:0.0:0.5158:0.0	.	1071;943	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	V	999;871;1071;943	ENSP00000383279:G999V;ENSP00000383276:G871V;ENSP00000386126:G1071V;ENSP00000386147:G943V	.	G	+	2	0	UMODL1	42416010	0.021000	0.18746	0.978000	0.43139	0.143000	0.21401	-0.385000	0.07379	0.052000	0.16007	-0.772000	0.03388	GGT	UMODL1	-	NULL	ENSG00000177398		0.617	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	59	0.00	0	G		Missense_Mutation	43542941	43542941	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	missense	48	25.00	16	SNP	0.979	T
USPL1	10208	genome.wustl.edu	37	13	31205414	31205414	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr13:31205414C>A	ENST00000255304.4	+	4	1013	c.671C>A	c.(670-672)gCt>gAt	p.A224D	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	224					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TTTCCCCAGGCTTTATGTGTC	0.453																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													216.0	191.0	199.0					13																	31205414		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.671C>A	13.37:g.31205414C>A	ENSP00000255304:p.Ala224Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.A224D	ENST00000255304.4	37	c.671	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	C	9.825	1.186847	0.21870	.	.	ENSG00000132952	ENST00000255304	T	0.06449	3.3	6.07	5.21	0.72293	.	1.079220	0.06995	N	0.822255	T	0.03053	0.0090	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.44636	-0.9315	10	0.10636	T	0.68	-5.0569	5.8033	0.18426	0.1924:0.6456:0.0:0.162	.	224	Q5W0Q7	USPL1_HUMAN	D	224	ENSP00000255304:A224D	ENSP00000255304:A224D	A	+	2	0	USPL1	30103414	0.032000	0.19561	0.120000	0.21714	0.160000	0.22226	1.989000	0.40707	1.512000	0.48834	0.655000	0.94253	GCT	USPL1	-	NULL	ENSG00000132952		0.453	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	317	0.00	0	C	NM_005800		31205414	31205414	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	missense	134	53.45	155	SNP	0.018	A
USPL1	10208	genome.wustl.edu	37	13	31205414	31205414	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr13:31205414C>A	ENST00000255304.4	+	4	1013	c.671C>A	c.(670-672)gCt>gAt	p.A224D	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	224					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TTTCCCCAGGCTTTATGTGTC	0.453																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													216.0	191.0	199.0					13																	31205414		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.671C>A	13.37:g.31205414C>A	ENSP00000255304:p.Ala224Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.A224D	ENST00000255304.4	37	c.671	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	C	9.825	1.186847	0.21870	.	.	ENSG00000132952	ENST00000255304	T	0.06449	3.3	6.07	5.21	0.72293	.	1.079220	0.06995	N	0.822255	T	0.03053	0.0090	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.44636	-0.9315	10	0.10636	T	0.68	-5.0569	5.8033	0.18426	0.1924:0.6456:0.0:0.162	.	224	Q5W0Q7	USPL1_HUMAN	D	224	ENSP00000255304:A224D	ENSP00000255304:A224D	A	+	2	0	USPL1	30103414	0.032000	0.19561	0.120000	0.21714	0.160000	0.22226	1.989000	0.40707	1.512000	0.48834	0.655000	0.94253	GCT	USPL1	-	NULL	ENSG00000132952		0.453	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	100	0.00	0	C	NM_005800		31205414	31205414	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	missense	37	40.32	25	SNP	0.018	A
VPS13A	23230	genome.wustl.edu	37	9	79890418	79890418	+	Silent	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr9:79890418A>G	ENST00000360280.3	+	25	2777	c.2517A>G	c.(2515-2517)tcA>tcG	p.S839S	VPS13A_ENST00000357409.5_Silent_p.S839S|VPS13A_ENST00000376636.3_Silent_p.S839S|VPS13A_ENST00000376634.4_Silent_p.S839S	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	839					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATGTAGATTCAGAGGAGGAAT	0.318																																						dbGAP											0													95.0	98.0	97.0					9																	79890418		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2517A>G	9.37:g.79890418A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.S839	ENST00000360280.3	37	c.2517	CCDS6655.1	9																																																																																			VPS13A	-	NULL	ENSG00000197969		0.318	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	208	0.00	0	A	NM_015186		79890418	79890418	+1	no_errors	ENST00000360280	ensembl	human	known	69_37n	silent	103	59.85	155	SNP	0.986	G
VPS13A	23230	genome.wustl.edu	37	9	79890418	79890418	+	Silent	SNP	A	A	G			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr9:79890418A>G	ENST00000360280.3	+	25	2777	c.2517A>G	c.(2515-2517)tcA>tcG	p.S839S	VPS13A_ENST00000357409.5_Silent_p.S839S|VPS13A_ENST00000376636.3_Silent_p.S839S|VPS13A_ENST00000376634.4_Silent_p.S839S	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	839					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATGTAGATTCAGAGGAGGAAT	0.318																																						dbGAP											0													95.0	98.0	97.0					9																	79890418		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2517A>G	9.37:g.79890418A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.S839	ENST00000360280.3	37	c.2517	CCDS6655.1	9																																																																																			VPS13A	-	NULL	ENSG00000197969		0.318	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	58	0.00	0	A	NM_015186		79890418	79890418	+1	no_errors	ENST00000360280	ensembl	human	known	69_37n	silent	16	55.56	20	SNP	0.986	G
VWA8	23078	genome.wustl.edu	37	13	42263507	42263509	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	CAA	CAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr13:42263507_42263509delCAA	ENST00000379310.3	-	34	4180_4182	c.4112_4114delTTG	c.(4111-4116)gttggt>ggt	p.V1371del	VWA8_ENST00000478987.1_5'Flank	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1371						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										TCTGGAAAACCAACAACTATTGT	0.365																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.4112_4114delTTG	13.37:g.42263510_42263512delCAA	ENSP00000368612:p.Val1371del	Somatic		WXS	Illumina GAIIx	Phase_IV	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	In_Frame_Del	DEL	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.V1371in_frame_del	ENST00000379310.3	37	c.4114_4112	CCDS41881.1	13																																																																																			VWA8	-	NULL	ENSG00000102763		0.365	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2	180	0.00	0	CAA	NM_015058		42263507	42263509	-1	no_errors	ENST00000379310	ensembl	human	known	69_37n	in_frame_del	189	22.18	55	DEL	1.000:1.000:1.000	-
VWA8	23078	genome.wustl.edu	37	13	42263507	42263509	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	CAA	CAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr13:42263507_42263509delCAA	ENST00000379310.3	-	34	4180_4182	c.4112_4114delTTG	c.(4111-4116)gttggt>ggt	p.V1371del	VWA8_ENST00000478987.1_5'Flank	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1371						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										TCTGGAAAACCAACAACTATTGT	0.365																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.4112_4114delTTG	13.37:g.42263510_42263512delCAA	ENSP00000368612:p.Val1371del	Somatic		WXS	Illumina GAIIx	Phase_IV	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	In_Frame_Del	DEL	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.V1371in_frame_del	ENST00000379310.3	37	c.4114_4112	CCDS41881.1	13																																																																																			VWA8	-	NULL	ENSG00000102763		0.365	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2	57	0.00	0	CAA	NM_015058		42263507	42263509	-1	no_errors	ENST00000379310	ensembl	human	known	69_37n	in_frame_del	36	21.28	10	DEL	1.000:1.000:1.000	-
WDFY4	57705	genome.wustl.edu	37	10	49939380	49939380	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr10:49939380T>C	ENST00000325239.5	+	8	1382	c.1355T>C	c.(1354-1356)cTa>cCa	p.L452P	WDFY4_ENST00000413659.2_Missense_Mutation_p.L452P|WDFY4_ENST00000360890.2_Missense_Mutation_p.L452P	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	452						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TTCCAGCTTCTAGAGGCCCTG	0.572																																						dbGAP											0													73.0	71.0	71.0					10																	49939380		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.1355T>C	10.37:g.49939380T>C	ENSP00000320563:p.Leu452Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L452P	ENST00000325239.5	37	c.1355	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104809	0.77096	.	.	ENSG00000128815	ENST00000360890;ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T;T	0.63417	-0.04;2.56;2.56	5.58	5.58	0.84498	.	.	.	.	.	T	0.79275	0.4418	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.76575	0.921;0.988	T	0.82206	-0.0572	9	0.87932	D	0	.	14.9432	0.71009	0.0:0.0:0.0:1.0	.	452;452	Q6ZS81;Q6ZS81-2	WDFY4_HUMAN;.	P	452;461;452;452;452	ENSP00000354141:L452P;ENSP00000320563:L452P;ENSP00000403789:L452P	ENSP00000320563:L452P	L	+	2	0	WDFY4	49609386	1.000000	0.71417	0.997000	0.53966	0.814000	0.46013	7.698000	0.84413	2.134000	0.65973	0.460000	0.39030	CTA	WDFY4	-	superfamily_ARM-type_fold	ENSG00000128815		0.572	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		137	0.00	0	T	XM_033379		49939380	49939380	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	missense	160	16.67	32	SNP	1.000	C
WDFY4	57705	genome.wustl.edu	37	10	49939380	49939380	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr10:49939380T>C	ENST00000325239.5	+	8	1382	c.1355T>C	c.(1354-1356)cTa>cCa	p.L452P	WDFY4_ENST00000413659.2_Missense_Mutation_p.L452P|WDFY4_ENST00000360890.2_Missense_Mutation_p.L452P	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	452						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TTCCAGCTTCTAGAGGCCCTG	0.572																																						dbGAP											0													73.0	71.0	71.0					10																	49939380		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.1355T>C	10.37:g.49939380T>C	ENSP00000320563:p.Leu452Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L452P	ENST00000325239.5	37	c.1355	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104809	0.77096	.	.	ENSG00000128815	ENST00000360890;ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T;T	0.63417	-0.04;2.56;2.56	5.58	5.58	0.84498	.	.	.	.	.	T	0.79275	0.4418	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.76575	0.921;0.988	T	0.82206	-0.0572	9	0.87932	D	0	.	14.9432	0.71009	0.0:0.0:0.0:1.0	.	452;452	Q6ZS81;Q6ZS81-2	WDFY4_HUMAN;.	P	452;461;452;452;452	ENSP00000354141:L452P;ENSP00000320563:L452P;ENSP00000403789:L452P	ENSP00000320563:L452P	L	+	2	0	WDFY4	49609386	1.000000	0.71417	0.997000	0.53966	0.814000	0.46013	7.698000	0.84413	2.134000	0.65973	0.460000	0.39030	CTA	WDFY4	-	superfamily_ARM-type_fold	ENSG00000128815		0.572	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		52	0.00	0	T	XM_033379		49939380	49939380	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	C
WNT8B	7479	genome.wustl.edu	37	10	102242188	102242188	+	Missense_Mutation	SNP	C	C	G	rs61744263		TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr10:102242188C>G	ENST00000343737.5	+	6	799	c.671C>G	c.(670-672)gCt>gGt	p.A224G		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	224					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		CTGCAGGGTGCTGGCAACAGC	0.677											OREG0020440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													23.0	26.0	25.0					10																	102242188		2199	4293	6492	-	-	-	SO:0001583	missense	0			X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.671C>G	10.37:g.102242188C>G	ENSP00000340677:p.Ala224Gly	Somatic	1365	WXS	Illumina GAIIx	Phase_IV	O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt8	p.A224G	ENST00000343737.5	37	c.671	CCDS7494.1	10	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779443	0.49891	.	.	ENSG00000075290	ENST00000343737	T	0.75260	-0.92	5.0	5.0	0.66597	.	0.159260	0.53938	D	0.000042	T	0.57373	0.2049	N	0.16602	0.42	0.58432	D	0.999998	B	0.16166	0.016	B	0.29077	0.098	T	0.52223	-0.8604	10	0.02654	T	1	.	13.6864	0.62520	0.0:0.9224:0.0:0.0776	.	224	Q93098	WNT8B_HUMAN	G	224	ENSP00000340677:A224G	ENSP00000340677:A224G	A	+	2	0	WNT8B	102232178	0.999000	0.42202	0.196000	0.23383	0.753000	0.42808	4.020000	0.57189	2.310000	0.77875	0.313000	0.20887	GCT	WNT8B	-	pfam_Wnt,smart_Wnt,prints_Wnt8	ENSG00000075290		0.677	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT8B	HGNC	protein_coding	OTTHUMT00000049867.1	37	0.00	0	C	NM_003393		102242188	102242188	+1	no_errors	ENST00000343737	ensembl	human	known	69_37n	missense	8	52.94	9	SNP	0.990	G
ZC3H12A	80149	genome.wustl.edu	37	1	37949403	37949403	+	3'UTR	SNP	T	T	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr1:37949403T>C	ENST00000373087.6	+	0	2107					NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCAGCACCTCTAGCTGTCTGC	0.552																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.*191T>C	1.37:g.37949403T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000373087.6	37	NULL	CCDS417.1	1																																																																																			ZC3H12A	-	-	ENSG00000163874		0.552	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12A	HGNC	protein_coding	OTTHUMT00000012154.2	8	0.00	0	T	NM_025079		37949403	37949403	+1	no_errors	ENST00000492829	ensembl	human	known	69_37n	rna	5	44.44	4	SNP	0.000	C
ZNF451	26036	genome.wustl.edu	37	6	56955148	56955148	+	Intron	SNP	C	C	T			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr6:56955148C>T	ENST00000370706.4	+	1	265				ZNF451_ENST00000491832.2_Intron|ZNF451_ENST00000370710.6_Intron|ZNF451_ENST00000357489.3_Intron|ZNF451_ENST00000370702.1_Intron|ZNF451_ENST00000370708.4_Intron	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GGTCTGAGGCCTGGTGCTCCG	0.642																																						dbGAP											0													30.0	32.0	32.0					6																	56955148		692	1578	2270	-	-	-	SO:0001627	intron_variant	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.21+76C>T	6.37:g.56955148C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	RNA	SNP	-	NULL	ENST00000370706.4	37	NULL	CCDS43477.1	6																																																																																			ZNF451	-	-	ENSG00000112200		0.642	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	136	0.00	0	C	NM_015555		56955148	56955148	+1	no_errors	ENST00000477046	ensembl	human	known	69_37n	rna	67	19.28	16	SNP	0.763	T
ZNF615	284370	genome.wustl.edu	37	19	52497053	52497053	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr19:52497053T>A	ENST00000602063.1	-	6	1625	c.1276A>T	c.(1276-1278)Aaa>Taa	p.K426*	ZNF615_ENST00000391795.3_Nonsense_Mutation_p.K431*|ZNF615_ENST00000598071.1_Nonsense_Mutation_p.K437*|ZNF615_ENST00000376716.5_Nonsense_Mutation_p.K426*|ZNF615_ENST00000594083.1_Nonsense_Mutation_p.K437*			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TTATAAGGTTTCTCTCCAGTA	0.413																																						dbGAP											0													81.0	72.0	75.0					19																	52497053		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1276A>T	19.37:g.52497053T>A	ENSP00000473089:p.Lys426*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K431*	ENST00000602063.1	37	c.1291	CCDS12846.1	19	.	.	.	.	.	.	.	.	.	.	T	36	5.957215	0.97145	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	.	.	.	2.87	2.87	0.33458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2863	0.43568	0.0:0.0:0.0:1.0	.	.	.	.	X	426;436;431;436	.	ENSP00000347019:K436X	K	-	1	0	ZNF615	57188865	1.000000	0.71417	0.991000	0.47740	0.987000	0.75469	3.988000	0.56951	1.299000	0.44798	0.477000	0.44152	AAA	ZNF615	-	pfscan_Znf_C2H2	ENSG00000197619		0.413	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF615	HGNC	protein_coding	OTTHUMT00000462391.1	285	0.00	0	T	NM_198480		52497053	52497053	-1	no_errors	ENST00000391795	ensembl	human	known	69_37n	nonsense	336	14.07	55	SNP	1.000	A
ZNF79	7633	genome.wustl.edu	37	9	130207444	130207444	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A12Q-09	TCGA-A7-A13D-10A-02D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	418e916b-7a4e-4fab-8616-15dcec4d79f8	dbc462f5-f723-4cf7-a48d-84001d2d51e9	g.chr9:130207444G>C	ENST00000342483.5	+	5	1871	c.1465G>C	c.(1465-1467)Gtt>Ctt	p.V489L	RPL12_ENST00000497322.1_5'Flank|ZNF79_ENST00000543471.1_Missense_Mutation_p.V465L	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						CTCTGCCTTCGTTAGACATCA	0.557																																						dbGAP											0													106.0	107.0	107.0					9																	130207444		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.1465G>C	9.37:g.130207444G>C	ENSP00000362446:p.Val489Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVW1|Q96NV1	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V489L	ENST00000342483.5	37	c.1465	CCDS6871.1	9	.	.	.	.	.	.	.	.	.	.	G	6.625	0.483832	0.12581	.	.	ENSG00000196152	ENST00000342483;ENST00000543471	T;T	0.59772	0.24;0.24	4.07	-4.1	0.03940	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34832	0.0911	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15122	-1.0448	9	0.48119	T	0.1	.	6.6779	0.23103	0.4293:0.139:0.4317:0.0	.	489	Q15937	ZNF79_HUMAN	L	489;465	ENSP00000362446:V489L;ENSP00000438418:V465L	ENSP00000362446:V489L	V	+	1	0	ZNF79	129247265	0.000000	0.05858	0.021000	0.16686	0.338000	0.28826	-1.546000	0.02188	-1.110000	0.02992	-0.960000	0.02634	GTT	ZNF79	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196152		0.557	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF79	HGNC	protein_coding	OTTHUMT00000054188.1	57	0.00	0	G	NM_007135		130207444	130207444	+1	no_errors	ENST00000342483	ensembl	human	known	69_37n	missense	27	57.14	36	SNP	0.000	C
ZNF79	7633	genome.wustl.edu	37	9	130207444	130207444	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13D-01A-13D-A272-09	TCGA-A7-A13D-10A-02D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3e0f9b90-88f4-41f1-91b2-2f4bcdfaaebb	2fc0129f-0a1c-4f01-85a1-d447fc9d348b	g.chr9:130207444G>C	ENST00000342483.5	+	5	1871	c.1465G>C	c.(1465-1467)Gtt>Ctt	p.V489L	RPL12_ENST00000497322.1_5'Flank|ZNF79_ENST00000543471.1_Missense_Mutation_p.V465L	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						CTCTGCCTTCGTTAGACATCA	0.557																																						dbGAP											0													106.0	107.0	107.0					9																	130207444		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.1465G>C	9.37:g.130207444G>C	ENSP00000362446:p.Val489Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVW1|Q96NV1	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V489L	ENST00000342483.5	37	c.1465	CCDS6871.1	9	.	.	.	.	.	.	.	.	.	.	G	6.625	0.483832	0.12581	.	.	ENSG00000196152	ENST00000342483;ENST00000543471	T;T	0.59772	0.24;0.24	4.07	-4.1	0.03940	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34832	0.0911	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15122	-1.0448	9	0.48119	T	0.1	.	6.6779	0.23103	0.4293:0.139:0.4317:0.0	.	489	Q15937	ZNF79_HUMAN	L	489;465	ENSP00000362446:V489L;ENSP00000438418:V465L	ENSP00000362446:V489L	V	+	1	0	ZNF79	129247265	0.000000	0.05858	0.021000	0.16686	0.338000	0.28826	-1.546000	0.02188	-1.110000	0.02992	-0.960000	0.02634	GTT	ZNF79	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196152		0.557	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF79	HGNC	protein_coding	OTTHUMT00000054188.1	62	0.00	0	G	NM_007135		130207444	130207444	+1	no_errors	ENST00000342483	ensembl	human	known	69_37n	missense	20	47.37	18	SNP	0.000	C
