#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB8	11194	genome.wustl.edu	37	7	150741305	150741305	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr7:150741305G>T	ENST00000297504.6	+	16	2130	c.2064G>T	c.(2062-2064)tgG>tgT	p.W688C	ABCB8_ENST00000542328.1_Missense_Mutation_p.W583C|ABCB8_ENST00000356058.4_3'UTR|ABCB8_ENST00000498578.1_Intron|ABCB8_ENST00000358849.4_Missense_Mutation_p.W671C			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	688	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	GCCGTGTCTGGGAGGTTAGTT	0.602																																						dbGAP											0													118.0	89.0	99.0					7																	150741305		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.2064G>T	7.37:g.150741305G>T	ENSP00000297504:p.Trp688Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.W688C	ENST00000297504.6	37	c.2064		7	.	.	.	.	.	.	.	.	.	.	G	6.700	0.497782	0.12762	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328	T;T;T	0.65549	-0.16;-0.16;-0.16	4.61	-1.61	0.08399	ABC transporter-like (1);	0.651864	0.16182	N	0.225796	T	0.29321	0.0730	N	0.02181	-0.65	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.01982	-1.1235	10	0.40728	T	0.16	-13.9986	7.636	0.28267	0.0:0.3434:0.1957:0.4609	.	583;688;671	G3XAP3;Q9NUT2;Q9NUT2-2	.;ABCB8_HUMAN;.	C	671;654;688;583	ENSP00000351717:W671C;ENSP00000297504:W688C;ENSP00000438776:W583C	ENSP00000297504:W688C	W	+	3	0	ABCB8	150372238	0.045000	0.20229	0.991000	0.47740	0.577000	0.36160	-0.769000	0.04710	-0.414000	0.07495	0.563000	0.77884	TGG	ABCB8	-	pfscan_ABC_transporter-like	ENSG00000197150		0.602	ABCB8-003	KNOWN	basic	protein_coding	ABCB8	HGNC	protein_coding	OTTHUMT00000351733.2	112	0.00	0	G	NM_007188		150741305	150741305	+1	no_errors	ENST00000297504	ensembl	human	known	69_37n	missense	93	17.70	20	SNP	0.995	T
ABCB8	11194	genome.wustl.edu	37	7	150741305	150741305	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr7:150741305G>T	ENST00000297504.6	+	16	2130	c.2064G>T	c.(2062-2064)tgG>tgT	p.W688C	ABCB8_ENST00000542328.1_Missense_Mutation_p.W583C|ABCB8_ENST00000356058.4_3'UTR|ABCB8_ENST00000498578.1_Intron|ABCB8_ENST00000358849.4_Missense_Mutation_p.W671C			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	688	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	GCCGTGTCTGGGAGGTTAGTT	0.602																																						dbGAP											0													118.0	89.0	99.0					7																	150741305		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.2064G>T	7.37:g.150741305G>T	ENSP00000297504:p.Trp688Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.W688C	ENST00000297504.6	37	c.2064		7	.	.	.	.	.	.	.	.	.	.	G	6.700	0.497782	0.12762	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328	T;T;T	0.65549	-0.16;-0.16;-0.16	4.61	-1.61	0.08399	ABC transporter-like (1);	0.651864	0.16182	N	0.225796	T	0.29321	0.0730	N	0.02181	-0.65	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.01982	-1.1235	10	0.40728	T	0.16	-13.9986	7.636	0.28267	0.0:0.3434:0.1957:0.4609	.	583;688;671	G3XAP3;Q9NUT2;Q9NUT2-2	.;ABCB8_HUMAN;.	C	671;654;688;583	ENSP00000351717:W671C;ENSP00000297504:W688C;ENSP00000438776:W583C	ENSP00000297504:W688C	W	+	3	0	ABCB8	150372238	0.045000	0.20229	0.991000	0.47740	0.577000	0.36160	-0.769000	0.04710	-0.414000	0.07495	0.563000	0.77884	TGG	ABCB8	-	pfscan_ABC_transporter-like	ENSG00000197150		0.602	ABCB8-003	KNOWN	basic	protein_coding	ABCB8	HGNC	protein_coding	OTTHUMT00000351733.2	54	0.00	0	G	NM_007188		150741305	150741305	+1	no_errors	ENST00000297504	ensembl	human	known	69_37n	missense	93	17.70	20	SNP	0.995	T
ATAD2B	54454	genome.wustl.edu	37	2	24092569	24092569	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr2:24092569C>A	ENST00000238789.5	-	9	1383	c.1040G>T	c.(1039-1041)aGa>aTa	p.R347I		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	347						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGATTTCCTTCTTTCAAAGCG	0.313																																						dbGAP											0													126.0	105.0	111.0					2																	24092569		1839	4095	5934	-	-	-	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1040G>T	2.37:g.24092569C>A	ENSP00000238789:p.Arg347Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.R347I	ENST00000238789.5	37	c.1040	CCDS46227.1	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809568	0.90707	.	.	ENSG00000119778	ENST00000238789;ENST00000442596;ENST00000439915	D;T	0.93189	-3.18;-0.93	5.3	5.3	0.74995	.	.	.	.	.	D	0.96488	0.8854	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.99	D	0.95438	0.8523	9	0.37606	T	0.19	.	19.3339	0.94307	0.0:1.0:0.0:0.0	.	361;347	C9JG15;Q9ULI0	.;ATD2B_HUMAN	I	347;199;361	ENSP00000238789:R347I;ENSP00000403177:R361I	ENSP00000238789:R347I	R	-	2	0	ATAD2B	23946073	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.856000	0.69518	2.655000	0.90218	0.555000	0.69702	AGA	ATAD2B	-	NULL	ENSG00000119778		0.313	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	485	0.00	0	C	NM_017552		24092569	24092569	-1	no_errors	ENST00000238789	ensembl	human	known	69_37n	missense	358	23.83	112	SNP	1.000	A
ATAD2B	54454	genome.wustl.edu	37	2	24092569	24092569	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr2:24092569C>A	ENST00000238789.5	-	9	1383	c.1040G>T	c.(1039-1041)aGa>aTa	p.R347I		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	347						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGATTTCCTTCTTTCAAAGCG	0.313																																						dbGAP											0													126.0	105.0	111.0					2																	24092569		1839	4095	5934	-	-	-	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1040G>T	2.37:g.24092569C>A	ENSP00000238789:p.Arg347Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.R347I	ENST00000238789.5	37	c.1040	CCDS46227.1	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809568	0.90707	.	.	ENSG00000119778	ENST00000238789;ENST00000442596;ENST00000439915	D;T	0.93189	-3.18;-0.93	5.3	5.3	0.74995	.	.	.	.	.	D	0.96488	0.8854	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.99	D	0.95438	0.8523	9	0.37606	T	0.19	.	19.3339	0.94307	0.0:1.0:0.0:0.0	.	361;347	C9JG15;Q9ULI0	.;ATD2B_HUMAN	I	347;199;361	ENSP00000238789:R347I;ENSP00000403177:R361I	ENSP00000238789:R347I	R	-	2	0	ATAD2B	23946073	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.856000	0.69518	2.655000	0.90218	0.555000	0.69702	AGA	ATAD2B	-	NULL	ENSG00000119778		0.313	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	652	0.00	0	C	NM_017552		24092569	24092569	-1	no_errors	ENST00000238789	ensembl	human	known	69_37n	missense	358	23.83	112	SNP	1.000	A
BAZ2A	11176	genome.wustl.edu	37	12	56992725	56992725	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr12:56992725C>A	ENST00000551812.1	-	28	5672	c.5479G>T	c.(5479-5481)Gtg>Ttg	p.V1827L	BAZ2A_ENST00000379441.3_Missense_Mutation_p.V1797L|BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000179765.5_Missense_Mutation_p.V1795L|BAZ2A_ENST00000549884.1_Missense_Mutation_p.V1825L	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1827	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						TACCCACTCACCAAACGTGGG	0.537																																						dbGAP											0													30.0	32.0	31.0					12																	56992725		1933	4129	6062	-	-	-	SO:0001583	missense	0			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.5479G>T	12.37:g.56992725C>A	ENSP00000446880:p.Val1827Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.V1827L	ENST00000551812.1	37	c.5479	CCDS44924.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.058434	0.93846	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	5.85	5.85	0.93711	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.37046	0.0989	L	0.43598	1.365	0.80722	D	1	P;P;P;D	0.61697	0.89;0.698;0.86;0.99	D;P;P;D	0.72982	0.929;0.802;0.906;0.979	T	0.01124	-1.1444	10	0.66056	D	0.02	-16.3728	19.3176	0.94223	0.0:1.0:0.0:0.0	.	1825;1823;1827;1800	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	L	1797;1795;1827;759;1825	ENSP00000368754:V1797L;ENSP00000179765:V1795L;ENSP00000446880:V1827L;ENSP00000448760:V759L;ENSP00000447941:V1825L	ENSP00000179765:V1795L	V	-	1	0	BAZ2A	55278992	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.201000	0.77847	2.941000	0.99782	0.655000	0.94253	GTG	BAZ2A	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000076108		0.537	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	HGNC	protein_coding	OTTHUMT00000408561.1	83	0.00	0	C	NM_013449		56992725	56992725	-1	no_errors	ENST00000551812	ensembl	human	known	69_37n	missense	69	37.27	41	SNP	1.000	A
BAZ2A	11176	genome.wustl.edu	37	12	56992725	56992725	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr12:56992725C>A	ENST00000551812.1	-	28	5672	c.5479G>T	c.(5479-5481)Gtg>Ttg	p.V1827L	BAZ2A_ENST00000379441.3_Missense_Mutation_p.V1797L|BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000179765.5_Missense_Mutation_p.V1795L|BAZ2A_ENST00000549884.1_Missense_Mutation_p.V1825L	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1827	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						TACCCACTCACCAAACGTGGG	0.537																																						dbGAP											0													30.0	32.0	31.0					12																	56992725		1933	4129	6062	-	-	-	SO:0001583	missense	0			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.5479G>T	12.37:g.56992725C>A	ENSP00000446880:p.Val1827Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.V1827L	ENST00000551812.1	37	c.5479	CCDS44924.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.058434	0.93846	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	5.85	5.85	0.93711	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.37046	0.0989	L	0.43598	1.365	0.80722	D	1	P;P;P;D	0.61697	0.89;0.698;0.86;0.99	D;P;P;D	0.72982	0.929;0.802;0.906;0.979	T	0.01124	-1.1444	10	0.66056	D	0.02	-16.3728	19.3176	0.94223	0.0:1.0:0.0:0.0	.	1825;1823;1827;1800	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	L	1797;1795;1827;759;1825	ENSP00000368754:V1797L;ENSP00000179765:V1795L;ENSP00000446880:V1827L;ENSP00000448760:V759L;ENSP00000447941:V1825L	ENSP00000179765:V1795L	V	-	1	0	BAZ2A	55278992	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.201000	0.77847	2.941000	0.99782	0.655000	0.94253	GTG	BAZ2A	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000076108		0.537	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	HGNC	protein_coding	OTTHUMT00000408561.1	81	0.00	0	C	NM_013449		56992725	56992725	-1	no_errors	ENST00000551812	ensembl	human	known	69_37n	missense	69	37.27	41	SNP	1.000	A
BCORL1	63035	genome.wustl.edu	37	X	129150177	129150177	+	Silent	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chrX:129150177C>T	ENST00000218147.7	+	4	3626	c.3429C>T	c.(3427-3429)tcC>tcT	p.S1143S	BCORL1_ENST00000303743.5_Silent_p.S1143S|BCORL1_ENST00000540052.1_Silent_p.S1143S|BCORL1_ENST00000359304.2_Silent_p.S1143S			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1143					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TCCGGAGTTCCCACAGACCCA	0.597																																						dbGAP											0													20.0	17.0	18.0					X																	129150177		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3429C>T	X.37:g.129150177C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	NULL	p.P579S	ENST00000218147.7	37	c.1735	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	C	6.034	0.374668	0.11409	.	.	ENSG00000085185	ENST00000441294	.	.	.	5.45	1.7	0.24286	.	.	.	.	.	T	0.26159	0.0638	.	.	.	0.18873	N	0.999984	.	.	.	.	.	.	T	0.22695	-1.0209	4	.	.	.	-7.9468	4.9564	0.14044	0.0:0.437:0.2009:0.3621	.	.	.	.	S	579	.	.	P	+	1	0	BCORL1	128977858	0.225000	0.23685	0.215000	0.23724	0.757000	0.42996	0.141000	0.16076	0.136000	0.18733	0.600000	0.82982	CCA	BCORL1	-	NULL	ENSG00000085185		0.597	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	20	0.00	0	C	NM_021946		129150177	129150177	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441294	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.070	T
BCORL1	63035	genome.wustl.edu	37	X	129150177	129150177	+	Silent	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chrX:129150177C>T	ENST00000218147.7	+	4	3626	c.3429C>T	c.(3427-3429)tcC>tcT	p.S1143S	BCORL1_ENST00000303743.5_Silent_p.S1143S|BCORL1_ENST00000540052.1_Silent_p.S1143S|BCORL1_ENST00000359304.2_Silent_p.S1143S			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1143					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TCCGGAGTTCCCACAGACCCA	0.597																																						dbGAP											0													20.0	17.0	18.0					X																	129150177		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3429C>T	X.37:g.129150177C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	NULL	p.P579S	ENST00000218147.7	37	c.1735	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	C	6.034	0.374668	0.11409	.	.	ENSG00000085185	ENST00000441294	.	.	.	5.45	1.7	0.24286	.	.	.	.	.	T	0.26159	0.0638	.	.	.	0.18873	N	0.999984	.	.	.	.	.	.	T	0.22695	-1.0209	4	.	.	.	-7.9468	4.9564	0.14044	0.0:0.437:0.2009:0.3621	.	.	.	.	S	579	.	.	P	+	1	0	BCORL1	128977858	0.225000	0.23685	0.215000	0.23724	0.757000	0.42996	0.141000	0.16076	0.136000	0.18733	0.600000	0.82982	CCA	BCORL1	-	NULL	ENSG00000085185		0.597	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	29	0.00	0	C	NM_021946		129150177	129150177	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441294	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.070	T
BIRC6	57448	genome.wustl.edu	37	2	32822992	32822992	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr2:32822992G>T	ENST00000421745.2	+	69	13921	c.13787G>T	c.(13786-13788)aGt>aTt	p.S4596I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4596	Ubiquitin-conjugating.				apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCATCCTCTAGTGTGTTTGTA	0.453																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													116.0	94.0	102.0					2																	32822992		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13787G>T	2.37:g.32822992G>T	ENSP00000393596:p.Ser4596Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.S4596I	ENST00000421745.2	37	c.13787	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886878	0.91814	.	.	ENSG00000115760	ENST00000421745	T	0.73152	-0.72	4.88	4.88	0.63580	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	D	0.83815	0.5336	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85938	0.1456	10	0.87932	D	0	.	18.4115	0.90552	0.0:0.0:1.0:0.0	.	4596	Q9NR09	BIRC6_HUMAN	I	4596	ENSP00000393596:S4596I	ENSP00000393596:S4596I	S	+	2	0	BIRC6	32676496	1.000000	0.71417	0.988000	0.46212	0.905000	0.53344	9.813000	0.99286	2.420000	0.82092	0.585000	0.79938	AGT	BIRC6	-	pfam_UBQ-conjugat_E2,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000115760		0.453	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	195	0.00	0	G	NM_016252		32822992	32822992	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	93	48.90	89	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32822992	32822992	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr2:32822992G>T	ENST00000421745.2	+	69	13921	c.13787G>T	c.(13786-13788)aGt>aTt	p.S4596I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4596	Ubiquitin-conjugating.				apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCATCCTCTAGTGTGTTTGTA	0.453																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													116.0	94.0	102.0					2																	32822992		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13787G>T	2.37:g.32822992G>T	ENSP00000393596:p.Ser4596Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.S4596I	ENST00000421745.2	37	c.13787	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886878	0.91814	.	.	ENSG00000115760	ENST00000421745	T	0.73152	-0.72	4.88	4.88	0.63580	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	D	0.83815	0.5336	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85938	0.1456	10	0.87932	D	0	.	18.4115	0.90552	0.0:0.0:1.0:0.0	.	4596	Q9NR09	BIRC6_HUMAN	I	4596	ENSP00000393596:S4596I	ENSP00000393596:S4596I	S	+	2	0	BIRC6	32676496	1.000000	0.71417	0.988000	0.46212	0.905000	0.53344	9.813000	0.99286	2.420000	0.82092	0.585000	0.79938	AGT	BIRC6	-	pfam_UBQ-conjugat_E2,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000115760		0.453	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	259	0.00	0	G	NM_016252		32822992	32822992	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	93	48.90	89	SNP	1.000	T
CAMKK1	84254	genome.wustl.edu	37	17	3776749	3776749	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr17:3776749T>G	ENST00000348335.2	-	11	1152	c.1004A>C	c.(1003-1005)gAt>gCt	p.D335A	CAMKK1_ENST00000158166.5_Missense_Mutation_p.D373A|CAMKK1_ENST00000381771.2_Missense_Mutation_p.D373A|CAMKK1_ENST00000381769.2_Missense_Mutation_p.D362A	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	335	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		GGCCCATACATCCAAGGCCTG	0.627																																						dbGAP											0													177.0	150.0	159.0					17																	3776749		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.1004A>C	17.37:g.3776749T>G	ENSP00000323118:p.Asp335Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQH3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D373A	ENST00000348335.2	37	c.1118	CCDS11038.1	17	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041650	0.75732	.	.	ENSG00000004660	ENST00000381769;ENST00000348335;ENST00000381771;ENST00000158166	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95790	0.8630	H	0.99197	4.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97569	1.0103	10	0.87932	D	0	-21.1458	14.5798	0.68278	0.0:0.0:0.0:1.0	.	373;335	F8W9H1;Q8N5S9	.;KKCC1_HUMAN	A	362;335;373;373	ENSP00000371188:D362A;ENSP00000323118:D335A;ENSP00000371190:D373A;ENSP00000158166:D373A	ENSP00000158166:D373A	D	-	2	0	CAMKK1	3723498	1.000000	0.71417	0.990000	0.47175	0.609000	0.37215	7.371000	0.79600	2.046000	0.60703	0.533000	0.62120	GAT	CAMKK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000004660		0.627	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKK1	HGNC	protein_coding	OTTHUMT00000207456.1	185	0.00	0	T	NM_032294, NM_172206, NM_172207		3776749	3776749	-1	no_errors	ENST00000381771	ensembl	human	known	69_37n	missense	99	17.50	21	SNP	1.000	G
CDRT15	146822	genome.wustl.edu	37	17	14139888	14139888	+	Splice_Site	SNP	C	C	T	rs11650811	byFrequency	TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr17:14139888C>T	ENST00000420162.2	-	1	278		c.e1+1		CDRT15_ENST00000431716.2_Intron	NM_001007530.1	NP_001007531.1	Q96T59	CDRTF_HUMAN	CMT1A duplicated region transcript 15									p.?(1)		endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		GGCCACCTCACCAAGTGTCTG	0.552													C|||	278	0.0555112	0.0749	0.0259	5008	,	,		19503	0.0784		0.0398	False		,,,				2504	0.0429					dbGAP											1	Unknown(1)	prostate(1)											6.0	6.0	6.0					17																	14139888		2170	4243	6413	-	-	-	SO:0001630	splice_region_variant	0			AF355097	CCDS32569.1	17p12	2012-11-19			ENSG00000223510	ENSG00000223510			14395	protein-coding gene	gene with protein product						11381029	Standard	NM_001007530		Approved		uc010vvu.2	Q96T59	OTTHUMG00000179686	ENST00000420162.2:c.262+1G>A	17.37:g.14139888C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUU5	Splice_Site	SNP	-	e1+1	ENST00000420162.2	37	c.262+1	CCDS32569.1	17	220	0.10073260073260074	29	0.05894308943089431	25	0.06906077348066299	97	0.16958041958041958	69	0.09102902374670185	C	0.056	-1.236753	0.01493	.	.	ENSG00000223510	ENST00000420162	.	.	.	0.128	-0.256	0.12984	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	rs11650811	.	.	.	.	-1	.	.	.	-	.	.	CDRT15	14080613	0.037000	0.19845	0.058000	0.19502	0.061000	0.15899	0.124000	0.15728	-1.023000	0.03342	-1.036000	0.02392	.	CDRT15	-	-	ENSG00000223510		0.552	CDRT15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT15	HGNC	protein_coding	OTTHUMT00000252853.1	29	0.00	0	C	NM_001007530	Intron	14139888	14139888	-1	no_errors	ENST00000420162	ensembl	human	known	69_37n	splice_site	36	16.28	7	SNP	0.071	T
OGFOD3	79701	genome.wustl.edu	37	17	80369359	80369359	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr17:80369359T>A	ENST00000313056.5	-	3	503	c.352A>T	c.(352-354)Acc>Tcc	p.T118S	OGFOD3_ENST00000329197.5_Missense_Mutation_p.T118S	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	118						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										TCCTCCCTGGTGATGACGACA	0.627																																						dbGAP											0													112.0	80.0	91.0					17																	80369359		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.352A>T	17.37:g.80369359T>A	ENSP00000320116:p.Thr118Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	smart_Pro_4_hyd_alph	p.T118S	ENST00000313056.5	37	c.352	CCDS11811.1	17	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484444	0.26598	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.30182	1.99;1.54	4.19	1.77	0.24775	Prolyl 4-hydroxylase, alpha subunit (1);	0.133196	0.48286	N	0.000187	T	0.18045	0.0433	L	0.33293	1	0.40079	D	0.976117	B;B	0.18461	0.028;0.018	B;B	0.16722	0.008;0.016	T	0.12243	-1.0555	10	0.07990	T	0.79	-19.3412	8.6481	0.34018	0.2912:0.0:0.0:0.7088	.	118;118	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	S	118	ENSP00000320116:T118S;ENSP00000330075:T118S	ENSP00000320116:T118S	T	-	1	0	C17orf101	77962648	1.000000	0.71417	0.998000	0.56505	0.704000	0.40688	2.395000	0.44459	0.175000	0.19841	0.402000	0.26972	ACC	C17orf101	-	smart_Pro_4_hyd_alph	ENSG00000181396		0.627	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf101	HGNC	protein_coding	OTTHUMT00000442895.1	81	0.00	0	T	NM_175902		80369359	80369359	-1	no_errors	ENST00000329197	ensembl	human	known	69_37n	missense	61	23.75	19	SNP	1.000	A
OGFOD3	79701	genome.wustl.edu	37	17	80369359	80369359	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr17:80369359T>A	ENST00000313056.5	-	3	503	c.352A>T	c.(352-354)Acc>Tcc	p.T118S	OGFOD3_ENST00000329197.5_Missense_Mutation_p.T118S	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	118						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										TCCTCCCTGGTGATGACGACA	0.627																																						dbGAP											0													112.0	80.0	91.0					17																	80369359		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.352A>T	17.37:g.80369359T>A	ENSP00000320116:p.Thr118Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	smart_Pro_4_hyd_alph	p.T118S	ENST00000313056.5	37	c.352	CCDS11811.1	17	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484444	0.26598	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.30182	1.99;1.54	4.19	1.77	0.24775	Prolyl 4-hydroxylase, alpha subunit (1);	0.133196	0.48286	N	0.000187	T	0.18045	0.0433	L	0.33293	1	0.40079	D	0.976117	B;B	0.18461	0.028;0.018	B;B	0.16722	0.008;0.016	T	0.12243	-1.0555	10	0.07990	T	0.79	-19.3412	8.6481	0.34018	0.2912:0.0:0.0:0.7088	.	118;118	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	S	118	ENSP00000320116:T118S;ENSP00000330075:T118S	ENSP00000320116:T118S	T	-	1	0	C17orf101	77962648	1.000000	0.71417	0.998000	0.56505	0.704000	0.40688	2.395000	0.44459	0.175000	0.19841	0.402000	0.26972	ACC	C17orf101	-	smart_Pro_4_hyd_alph	ENSG00000181396		0.627	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf101	HGNC	protein_coding	OTTHUMT00000442895.1	41	0.00	0	T	NM_175902		80369359	80369359	-1	no_errors	ENST00000329197	ensembl	human	known	69_37n	missense	61	23.75	19	SNP	1.000	A
CNOT3	4849	genome.wustl.edu	37	19	54650352	54650352	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr19:54650352G>C	ENST00000406403.1	+	9	2456	c.853G>C	c.(853-855)Gat>Cat	p.D285H	CNOT3_ENST00000221232.5_Missense_Mutation_p.D285H|CNOT3_ENST00000358389.3_Missense_Mutation_p.D104H			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	285					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTCTGAAGATGATAAGAAGAG	0.567																																						dbGAP											0													123.0	116.0	119.0					19																	54650352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.853G>C	19.37:g.54650352G>C	ENSP00000383954:p.Asp285His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZN7|Q9UF76	Missense_Mutation	SNP	pfam_Not_N,pfam_NOT,pirsf_CCR4-NOT_su3/5	p.D285H	ENST00000406403.1	37	c.853	CCDS12880.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.273152|4.273152	0.80580|0.80580	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000221232;ENST00000358389;ENST00000406403|ENST00000440571	T;T;T|.	0.63096|.	0.88;-0.02;0.88|.	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	0.133140|.	0.51477|.	D|.	0.000095|.	T|T	0.51534|0.51534	0.1680|0.1680	N|N	0.19112|0.19112	0.55|0.55	0.54753|0.54753	D|D	0.999989|0.999989	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.81914|.	0.995;0.995;0.995|.	T|T	0.46721|0.46721	-0.9171|-0.9171	10|5	0.33940|.	T|.	0.23|.	-27.9264|-27.9264	16.5921|16.5921	0.84769|0.84769	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	285;285;209|.	B7Z6J7;O75175;Q6ZMJ6|.	.;CNOT3_HUMAN;.|.	H|I	285;104;285|206	ENSP00000221232:D285H;ENSP00000351159:D104H;ENSP00000383954:D285H|.	ENSP00000221232:D285H|.	D|M	+|+	1|3	0|0	CNOT3|CNOT3	59342164|59342164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	8.122000|8.122000	0.89584|0.89584	2.525000|2.525000	0.85131|0.85131	0.655000|0.655000	0.94253|0.94253	GAT|ATG	CNOT3	-	pirsf_CCR4-NOT_su3/5	ENSG00000088038		0.567	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	HGNC	protein_coding	OTTHUMT00000142130.3	211	0.00	0	G	NM_014516		54650352	54650352	+1	no_errors	ENST00000221232	ensembl	human	known	69_37n	missense	128	21.95	36	SNP	1.000	C
CNOT3	4849	genome.wustl.edu	37	19	54650352	54650352	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr19:54650352G>C	ENST00000406403.1	+	9	2456	c.853G>C	c.(853-855)Gat>Cat	p.D285H	CNOT3_ENST00000221232.5_Missense_Mutation_p.D285H|CNOT3_ENST00000358389.3_Missense_Mutation_p.D104H			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	285					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTCTGAAGATGATAAGAAGAG	0.567																																						dbGAP											0													123.0	116.0	119.0					19																	54650352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.853G>C	19.37:g.54650352G>C	ENSP00000383954:p.Asp285His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZN7|Q9UF76	Missense_Mutation	SNP	pfam_Not_N,pfam_NOT,pirsf_CCR4-NOT_su3/5	p.D285H	ENST00000406403.1	37	c.853	CCDS12880.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.273152|4.273152	0.80580|0.80580	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000221232;ENST00000358389;ENST00000406403|ENST00000440571	T;T;T|.	0.63096|.	0.88;-0.02;0.88|.	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	0.133140|.	0.51477|.	D|.	0.000095|.	T|T	0.51534|0.51534	0.1680|0.1680	N|N	0.19112|0.19112	0.55|0.55	0.54753|0.54753	D|D	0.999989|0.999989	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.81914|.	0.995;0.995;0.995|.	T|T	0.46721|0.46721	-0.9171|-0.9171	10|5	0.33940|.	T|.	0.23|.	-27.9264|-27.9264	16.5921|16.5921	0.84769|0.84769	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	285;285;209|.	B7Z6J7;O75175;Q6ZMJ6|.	.;CNOT3_HUMAN;.|.	H|I	285;104;285|206	ENSP00000221232:D285H;ENSP00000351159:D104H;ENSP00000383954:D285H|.	ENSP00000221232:D285H|.	D|M	+|+	1|3	0|0	CNOT3|CNOT3	59342164|59342164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	8.122000|8.122000	0.89584|0.89584	2.525000|2.525000	0.85131|0.85131	0.655000|0.655000	0.94253|0.94253	GAT|ATG	CNOT3	-	pirsf_CCR4-NOT_su3/5	ENSG00000088038		0.567	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	HGNC	protein_coding	OTTHUMT00000142130.3	131	0.00	0	G	NM_014516		54650352	54650352	+1	no_errors	ENST00000221232	ensembl	human	known	69_37n	missense	128	21.95	36	SNP	1.000	C
CROCCP2	84809	genome.wustl.edu	37	1	16950708	16950708	+	lincRNA	SNP	T	T	G	rs1628058	byFrequency	TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr1:16950708T>G	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GGTGAGGCTGTTCATGGCGTG	0.667																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950708T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.667	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	T	NR_026752.1		16950708	16950708	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	8	52.94	9	SNP	0.013	G
DDR2	4921	genome.wustl.edu	37	1	162743378	162743378	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr1:162743378G>C	ENST00000367922.3	+	15	2286	c.1848G>C	c.(1846-1848)aaG>aaC	p.K616N	DDR2_ENST00000367921.3_Missense_Mutation_p.K616N	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	616	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ATGCCAACAAGAATGCCAGGT	0.418																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													102.0	94.0	97.0					1																	162743378		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1848G>C	1.37:g.162743378G>C	ENSP00000356899:p.Lys616Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K616N	ENST00000367922.3	37	c.1848	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641379	0.67244	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	D;D	0.83075	-1.68;-1.68	5.4	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.089532	0.85682	D	0.000000	T	0.77994	0.4214	N	0.20845	0.615	0.40919	D	0.984293	D	0.76494	0.999	D	0.80764	0.994	T	0.79992	-0.1569	9	0.35671	T	0.21	.	12.9207	0.58230	0.079:0.0:0.921:0.0	.	616	Q16832	DDR2_HUMAN	N	616	ENSP00000356899:K616N;ENSP00000356898:K616N	ENSP00000356898:K616N	K	+	3	2	DDR2	161010002	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.317000	0.59184	1.412000	0.46977	0.591000	0.81541	AAG	DDR2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162733		0.418	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	150	0.00	0	G	NM_006182		162743378	162743378	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	missense	130	49.22	126	SNP	1.000	C
DDR2	4921	genome.wustl.edu	37	1	162743378	162743378	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr1:162743378G>C	ENST00000367922.3	+	15	2286	c.1848G>C	c.(1846-1848)aaG>aaC	p.K616N	DDR2_ENST00000367921.3_Missense_Mutation_p.K616N	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	616	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ATGCCAACAAGAATGCCAGGT	0.418																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													102.0	94.0	97.0					1																	162743378		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1848G>C	1.37:g.162743378G>C	ENSP00000356899:p.Lys616Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K616N	ENST00000367922.3	37	c.1848	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641379	0.67244	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	D;D	0.83075	-1.68;-1.68	5.4	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.089532	0.85682	D	0.000000	T	0.77994	0.4214	N	0.20845	0.615	0.40919	D	0.984293	D	0.76494	0.999	D	0.80764	0.994	T	0.79992	-0.1569	9	0.35671	T	0.21	.	12.9207	0.58230	0.079:0.0:0.921:0.0	.	616	Q16832	DDR2_HUMAN	N	616	ENSP00000356899:K616N;ENSP00000356898:K616N	ENSP00000356898:K616N	K	+	3	2	DDR2	161010002	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.317000	0.59184	1.412000	0.46977	0.591000	0.81541	AAG	DDR2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162733		0.418	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	182	0.00	0	G	NM_006182		162743378	162743378	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	missense	130	49.22	126	SNP	1.000	C
DPY19L3	147991	genome.wustl.edu	37	19	32968544	32968544	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr19:32968544G>A	ENST00000342179.5	+	17	2029	c.1814G>A	c.(1813-1815)aGa>aAa	p.R605K	DPY19L3_ENST00000586987.1_Missense_Mutation_p.R605K|DPY19L3_ENST00000392250.2_Missense_Mutation_p.R605K	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	605						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					AGCAGCCTGAGAGAGCGGACC	0.602																																						dbGAP											0													109.0	94.0	99.0					19																	32968544		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1814G>A	19.37:g.32968544G>A	ENSP00000344937:p.Arg605Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	pfam_Dpy-19	p.R605K	ENST00000342179.5	37	c.1814	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	G	19.90	3.913508	0.72983	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	T;T	0.60040	0.22;0.22	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.80352	0.4607	M	0.87617	2.895	0.50632	D	0.999885	D	0.76494	0.999	D	0.83275	0.996	T	0.82625	-0.0365	10	0.54805	T	0.06	-16.3811	19.1561	0.93510	0.0:0.0:1.0:0.0	.	605	Q6ZPD9	D19L3_HUMAN	K	605	ENSP00000376081:R605K;ENSP00000344937:R605K	ENSP00000344937:R605K	R	+	2	0	DPY19L3	37660384	1.000000	0.71417	0.919000	0.36401	0.850000	0.48378	7.903000	0.87398	2.530000	0.85305	0.563000	0.77884	AGA	DPY19L3	-	pfam_Dpy-19	ENSG00000178904		0.602	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	150	0.66	1	G	NM_207325		32968544	32968544	+1	no_errors	ENST00000342179	ensembl	human	known	69_37n	missense	122	23.75	38	SNP	1.000	A
DPY19L3	147991	genome.wustl.edu	37	19	32968544	32968544	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr19:32968544G>A	ENST00000342179.5	+	17	2029	c.1814G>A	c.(1813-1815)aGa>aAa	p.R605K	DPY19L3_ENST00000586987.1_Missense_Mutation_p.R605K|DPY19L3_ENST00000392250.2_Missense_Mutation_p.R605K	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	605						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					AGCAGCCTGAGAGAGCGGACC	0.602																																						dbGAP											0													109.0	94.0	99.0					19																	32968544		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1814G>A	19.37:g.32968544G>A	ENSP00000344937:p.Arg605Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	pfam_Dpy-19	p.R605K	ENST00000342179.5	37	c.1814	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	G	19.90	3.913508	0.72983	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	T;T	0.60040	0.22;0.22	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.80352	0.4607	M	0.87617	2.895	0.50632	D	0.999885	D	0.76494	0.999	D	0.83275	0.996	T	0.82625	-0.0365	10	0.54805	T	0.06	-16.3811	19.1561	0.93510	0.0:0.0:1.0:0.0	.	605	Q6ZPD9	D19L3_HUMAN	K	605	ENSP00000376081:R605K;ENSP00000344937:R605K	ENSP00000344937:R605K	R	+	2	0	DPY19L3	37660384	1.000000	0.71417	0.919000	0.36401	0.850000	0.48378	7.903000	0.87398	2.530000	0.85305	0.563000	0.77884	AGA	DPY19L3	-	pfam_Dpy-19	ENSG00000178904		0.602	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	127	0.00	0	G	NM_207325		32968544	32968544	+1	no_errors	ENST00000342179	ensembl	human	known	69_37n	missense	122	23.75	38	SNP	1.000	A
DSPP	1834	genome.wustl.edu	37	4	88535329	88535329	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr4:88535329T>A	ENST00000282478.7	+	4	1548	c.1515T>A	c.(1513-1515)agT>agA	p.S505R	DSPP_ENST00000399271.1_Missense_Mutation_p.S505R|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	505	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GCAATGGCAGTGACTCAAAAG	0.388																																						dbGAP											0													148.0	141.0	143.0					4																	88535329		2061	4206	6267	-	-	-	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1515T>A	4.37:g.88535329T>A	ENSP00000282478:p.Ser505Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.S505R	ENST00000282478.7	37	c.1515	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	T	9.791	1.177798	0.21787	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.96104	-3.91;-3.91	4.59	3.42	0.39159	.	.	.	.	.	D	0.96614	0.8895	M	0.78456	2.415	0.27480	N	0.952618	D	0.69078	0.997	D	0.66351	0.943	D	0.90754	0.4659	9	0.56958	D	0.05	-2.2937	5.8593	0.18736	0.0:0.2133:0.0:0.7867	.	505	Q9NZW4	DSPP_HUMAN	R	505	ENSP00000382213:S505R;ENSP00000282478:S505R	ENSP00000282478:S505R	S	+	3	2	DSPP	88754353	1.000000	0.71417	0.994000	0.49952	0.194000	0.23727	1.067000	0.30616	0.633000	0.30452	0.366000	0.22137	AGT	DSPP	-	NULL	ENSG00000152591		0.388	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	276	0.00	0	T	NM_014208		88535329	88535329	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	missense	242	21.86	68	SNP	0.998	A
DSPP	1834	genome.wustl.edu	37	4	88535329	88535329	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr4:88535329T>A	ENST00000282478.7	+	4	1548	c.1515T>A	c.(1513-1515)agT>agA	p.S505R	DSPP_ENST00000399271.1_Missense_Mutation_p.S505R|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	505	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GCAATGGCAGTGACTCAAAAG	0.388																																						dbGAP											0													148.0	141.0	143.0					4																	88535329		2061	4206	6267	-	-	-	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1515T>A	4.37:g.88535329T>A	ENSP00000282478:p.Ser505Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.S505R	ENST00000282478.7	37	c.1515	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	T	9.791	1.177798	0.21787	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.96104	-3.91;-3.91	4.59	3.42	0.39159	.	.	.	.	.	D	0.96614	0.8895	M	0.78456	2.415	0.27480	N	0.952618	D	0.69078	0.997	D	0.66351	0.943	D	0.90754	0.4659	9	0.56958	D	0.05	-2.2937	5.8593	0.18736	0.0:0.2133:0.0:0.7867	.	505	Q9NZW4	DSPP_HUMAN	R	505	ENSP00000382213:S505R;ENSP00000282478:S505R	ENSP00000282478:S505R	S	+	3	2	DSPP	88754353	1.000000	0.71417	0.994000	0.49952	0.194000	0.23727	1.067000	0.30616	0.633000	0.30452	0.366000	0.22137	AGT	DSPP	-	NULL	ENSG00000152591		0.388	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	379	0.00	0	T	NM_014208		88535329	88535329	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	missense	242	21.86	68	SNP	0.998	A
FAM169A	26049	genome.wustl.edu	37	5	74077801	74077803	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	CAT	CAT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr5:74077801_74077803delCAT	ENST00000389156.4	-	13	1585_1587	c.1495_1497delATG	c.(1495-1497)atgdel	p.M499del	RNU6-1330P_ENST00000362775.1_RNA|FAM169A_ENST00000510496.1_In_Frame_Del_p.M439del|FAM169A_ENST00000380515.3_3'UTR	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	499						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						TGCCTTCATCCATCAACATTTCT	0.384																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.1495_1497delATG	5.37:g.74077801_74077803delCAT	ENSP00000373808:p.Met499del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T9|Q6MZT0|Q9H989	In_Frame_Del	DEL	NULL	p.M499in_frame_del	ENST00000389156.4	37	c.1497_1495	CCDS43330.1	5																																																																																			FAM169A	-	NULL	ENSG00000198780		0.384	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM169A	HGNC	protein_coding	OTTHUMT00000371092.2	76	0.00	0	CAT			74077801	74077803	-1	no_errors	ENST00000389156	ensembl	human	known	69_37n	in_frame_del	75	21.05	20	DEL	0.000:0.000:0.000	-
FAM169A	26049	genome.wustl.edu	37	5	74077801	74077803	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	CAT	CAT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr5:74077801_74077803delCAT	ENST00000389156.4	-	13	1585_1587	c.1495_1497delATG	c.(1495-1497)atgdel	p.M499del	RNU6-1330P_ENST00000362775.1_RNA|FAM169A_ENST00000510496.1_In_Frame_Del_p.M439del|FAM169A_ENST00000380515.3_3'UTR	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	499						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						TGCCTTCATCCATCAACATTTCT	0.384																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.1495_1497delATG	5.37:g.74077801_74077803delCAT	ENSP00000373808:p.Met499del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T9|Q6MZT0|Q9H989	In_Frame_Del	DEL	NULL	p.M499in_frame_del	ENST00000389156.4	37	c.1497_1495	CCDS43330.1	5																																																																																			FAM169A	-	NULL	ENSG00000198780		0.384	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM169A	HGNC	protein_coding	OTTHUMT00000371092.2	102	0.00	0	CAT			74077801	74077803	-1	no_errors	ENST00000389156	ensembl	human	known	69_37n	in_frame_del	75	21.05	20	DEL	0.000:0.000:0.000	-
FAM46A	55603	genome.wustl.edu	37	6	82459981	82459982	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr6:82459981_82459982delTC	ENST00000320172.6	-	3	1073_1074	c.759_760delGA	c.(757-762)gagacafs	p.ET253fs	FAM46A_ENST00000369754.3_Frame_Shift_Del_p.ET272fs|FAM46A_ENST00000369756.3_Frame_Shift_Del_p.ET334fs	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	253					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GGGTGAAATGTCTCAGTCATTG	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.759_760delGA	6.37:g.82459983_82459984delTC	ENSP00000318298:p.Glu253fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Frame_Shift_Del	DEL	pfam_DUF1693	p.E334fs	ENST00000320172.6	37	c.1003_1002	CCDS34489.1	6																																																																																			FAM46A	-	pfam_DUF1693	ENSG00000112773		0.436	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1	168	0.00	0	TC			82459981	82459982	-1	no_errors	ENST00000369756	ensembl	human	known	69_37n	frame_shift_del	94	12.96	14	DEL	1.000:1.000	-
FAM46A	55603	genome.wustl.edu	37	6	82459981	82459982	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr6:82459981_82459982delTC	ENST00000320172.6	-	3	1073_1074	c.759_760delGA	c.(757-762)gagacafs	p.ET253fs	FAM46A_ENST00000369754.3_Frame_Shift_Del_p.ET272fs|FAM46A_ENST00000369756.3_Frame_Shift_Del_p.ET334fs	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	253					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GGGTGAAATGTCTCAGTCATTG	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.759_760delGA	6.37:g.82459983_82459984delTC	ENSP00000318298:p.Glu253fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Frame_Shift_Del	DEL	pfam_DUF1693	p.E334fs	ENST00000320172.6	37	c.1003_1002	CCDS34489.1	6																																																																																			FAM46A	-	pfam_DUF1693	ENSG00000112773		0.436	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1	153	0.00	0	TC			82459981	82459982	-1	no_errors	ENST00000369756	ensembl	human	known	69_37n	frame_shift_del	94	12.96	14	DEL	1.000:1.000	-
FAM26D	221301	genome.wustl.edu	37	6	116879271	116879271	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr6:116879271T>C	ENST00000368596.3	+	2	886	c.842T>C	c.(841-843)tTa>tCa	p.L281S	FAM26D_ENST00000368597.2_Missense_Mutation_p.L95S|FAM26D_ENST00000416171.2_Missense_Mutation_p.L137S|FAM26D_ENST00000405399.1_Missense_Mutation_p.L138S			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	281					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		CCCACTCTTTTATGCATGGGT	0.418																																						dbGAP											0													123.0	121.0	122.0					6																	116879271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.842T>C	6.37:g.116879271T>C	ENSP00000357585:p.Leu281Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Missense_Mutation	SNP	NULL	p.L281S	ENST00000368596.3	37	c.842		6	.	.	.	.	.	.	.	.	.	.	T	15.63	2.891551	0.52014	.	.	ENSG00000164451	ENST00000416171;ENST00000368597;ENST00000452373;ENST00000405399;ENST00000368596	T;T;T;T;T	0.55413	0.52;0.58;0.58;0.6;1.94	5.99	5.99	0.97316	.	0.716985	0.12453	N	0.467551	T	0.58366	0.2117	M	0.63843	1.955	0.09310	N	1	D;D	0.63046	0.992;0.986	P;P	0.59546	0.859;0.859	T	0.57911	-0.7729	10	0.87932	D	0	-24.1188	15.6704	0.77270	0.0:0.0:0.0:1.0	.	137;281	B4DTQ0;Q5JW98	.;FA26D_HUMAN	S	137;95;95;138;281	ENSP00000416976:L137S;ENSP00000357586:L95S;ENSP00000409556:L95S;ENSP00000385836:L138S;ENSP00000357585:L281S	ENSP00000357585:L281S	L	+	2	0	FAM26D	116985964	0.002000	0.14202	0.505000	0.27651	0.327000	0.28475	1.250000	0.32850	2.296000	0.77279	0.533000	0.62120	TTA	FAM26D	-	NULL	ENSG00000164451		0.418	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	215	0.00	0	T	NM_153036		116879271	116879271	+1	no_errors	ENST00000368596	ensembl	human	known	69_37n	missense	56	61.38	89	SNP	0.033	C
FAM26D	221301	genome.wustl.edu	37	6	116879271	116879271	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr6:116879271T>C	ENST00000368596.3	+	2	886	c.842T>C	c.(841-843)tTa>tCa	p.L281S	FAM26D_ENST00000368597.2_Missense_Mutation_p.L95S|FAM26D_ENST00000416171.2_Missense_Mutation_p.L137S|FAM26D_ENST00000405399.1_Missense_Mutation_p.L138S			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	281					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		CCCACTCTTTTATGCATGGGT	0.418																																						dbGAP											0													123.0	121.0	122.0					6																	116879271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.842T>C	6.37:g.116879271T>C	ENSP00000357585:p.Leu281Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Missense_Mutation	SNP	NULL	p.L281S	ENST00000368596.3	37	c.842		6	.	.	.	.	.	.	.	.	.	.	T	15.63	2.891551	0.52014	.	.	ENSG00000164451	ENST00000416171;ENST00000368597;ENST00000452373;ENST00000405399;ENST00000368596	T;T;T;T;T	0.55413	0.52;0.58;0.58;0.6;1.94	5.99	5.99	0.97316	.	0.716985	0.12453	N	0.467551	T	0.58366	0.2117	M	0.63843	1.955	0.09310	N	1	D;D	0.63046	0.992;0.986	P;P	0.59546	0.859;0.859	T	0.57911	-0.7729	10	0.87932	D	0	-24.1188	15.6704	0.77270	0.0:0.0:0.0:1.0	.	137;281	B4DTQ0;Q5JW98	.;FA26D_HUMAN	S	137;95;95;138;281	ENSP00000416976:L137S;ENSP00000357586:L95S;ENSP00000409556:L95S;ENSP00000385836:L138S;ENSP00000357585:L281S	ENSP00000357585:L281S	L	+	2	0	FAM26D	116985964	0.002000	0.14202	0.505000	0.27651	0.327000	0.28475	1.250000	0.32850	2.296000	0.77279	0.533000	0.62120	TTA	FAM26D	-	NULL	ENSG00000164451		0.418	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	220	0.00	0	T	NM_153036		116879271	116879271	+1	no_errors	ENST00000368596	ensembl	human	known	69_37n	missense	56	61.38	89	SNP	0.033	C
GP1BA	2811	genome.wustl.edu	37	17	4837763	4837763	+	Silent	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr17:4837763C>T	ENST00000329125.5	+	2	1939	c.1864C>T	c.(1864-1866)Cta>Tta	p.L622L		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	622					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						TGTGGGGCCTCTAGTGGCAGG	0.627											OREG0024109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													51.0	56.0	55.0					17																	4837763		1954	4153	6107	-	-	-	SO:0001819	synonymous_variant	0				CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1864C>T	17.37:g.4837763C>T		Somatic	621	WXS	Illumina GAIIx	Phase_IV	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L622	ENST00000329125.5	37	c.1864	CCDS54068.1	17																																																																																			GP1BA	-	NULL	ENSG00000185245		0.627	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP1BA	HGNC	protein_coding	OTTHUMT00000439889.1	72	0.00	0	C			4837763	4837763	+1	no_errors	ENST00000329125	ensembl	human	known	69_37n	silent	21	68.66	46	SNP	0.984	T
KCNIP2	30819	genome.wustl.edu	37	10	103588945	103588945	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr10:103588945C>T	ENST00000356640.2	-	4	510	c.235G>A	c.(235-237)Gat>Aat	p.D79N	KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000353068.3_Missense_Mutation_p.D29N|KCNIP2_ENST00000348850.5_Missense_Mutation_p.D34N|KCNIP2_ENST00000343195.4_Missense_Mutation_p.D29N|KCNIP2_ENST00000358038.3_Missense_Mutation_p.D61N|KCNIP2_ENST00000370046.1_Missense_Mutation_p.D29N|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2_ENST00000461105.1_Missense_Mutation_p.D94N	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2	79					clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		TCAAATTCATCGTCCACGCTG	0.632																																						dbGAP											0													60.0	49.0	53.0					10																	103588945		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.235G>A	10.37:g.103588945C>T	ENSP00000349055:p.Asp79Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.D94N	ENST00000356640.2	37	c.280	CCDS7522.1	10	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652190	0.88056	.	.	ENSG00000120049	ENST00000348850;ENST00000358038;ENST00000370059;ENST00000356640;ENST00000370046;ENST00000353068;ENST00000461105;ENST00000343195;ENST00000239117	T;T;T;T;T;T;T;T	0.70869	-0.25;-0.35;-0.48;-0.37;-0.35;-0.52;-0.34;-0.38	4.86	4.86	0.63082	.	0.196755	0.42294	D	0.000726	T	0.63861	0.2547	L	0.42245	1.32	0.58432	D	0.999999	B;P;B;B;B;B;B;B;B;B	0.44627	0.055;0.839;0.021;0.012;0.021;0.351;0.071;0.093;0.172;0.291	B;B;B;B;B;B;B;B;B;B	0.37267	0.035;0.199;0.018;0.008;0.018;0.245;0.056;0.155;0.04;0.027	T	0.71735	-0.4503	10	0.87932	D	0	.	17.5997	0.88022	0.0:1.0:0.0:0.0	.	29;34;29;29;29;61;29;94;79;34	Q9NS61-9;B4DW99;Q9NS61-5;Q3YAC7;Q9NS61-3;Q9NS61-2;Q9NS61-7;Q9NS61-6;Q9NS61;Q3YAC6	.;.;.;.;.;.;.;.;KCIP2_HUMAN;.	N	34;61;61;79;29;29;94;29;29	ENSP00000239118:D34N;ENSP00000350733:D61N;ENSP00000349055:D79N;ENSP00000359063:D29N;ENSP00000341624:D29N;ENSP00000420040:D94N;ENSP00000344169:D29N;ENSP00000239117:D29N	ENSP00000239117:D29N	D	-	1	0	KCNIP2	103578935	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.274000	0.51631	2.261000	0.74972	0.561000	0.74099	GAT	KCNIP2	-	NULL	ENSG00000120049		0.632	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	KCNIP2	HGNC	protein_coding	OTTHUMT00000049973.1	58	0.00	0	C			103588945	103588945	-1	no_errors	ENST00000461105	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	1.000	T
KCNIP2	30819	genome.wustl.edu	37	10	103588945	103588945	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr10:103588945C>T	ENST00000356640.2	-	4	510	c.235G>A	c.(235-237)Gat>Aat	p.D79N	KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000353068.3_Missense_Mutation_p.D29N|KCNIP2_ENST00000348850.5_Missense_Mutation_p.D34N|KCNIP2_ENST00000343195.4_Missense_Mutation_p.D29N|KCNIP2_ENST00000358038.3_Missense_Mutation_p.D61N|KCNIP2_ENST00000370046.1_Missense_Mutation_p.D29N|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2_ENST00000461105.1_Missense_Mutation_p.D94N	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2	79					clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		TCAAATTCATCGTCCACGCTG	0.632																																						dbGAP											0													60.0	49.0	53.0					10																	103588945		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.235G>A	10.37:g.103588945C>T	ENSP00000349055:p.Asp79Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.D94N	ENST00000356640.2	37	c.280	CCDS7522.1	10	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652190	0.88056	.	.	ENSG00000120049	ENST00000348850;ENST00000358038;ENST00000370059;ENST00000356640;ENST00000370046;ENST00000353068;ENST00000461105;ENST00000343195;ENST00000239117	T;T;T;T;T;T;T;T	0.70869	-0.25;-0.35;-0.48;-0.37;-0.35;-0.52;-0.34;-0.38	4.86	4.86	0.63082	.	0.196755	0.42294	D	0.000726	T	0.63861	0.2547	L	0.42245	1.32	0.58432	D	0.999999	B;P;B;B;B;B;B;B;B;B	0.44627	0.055;0.839;0.021;0.012;0.021;0.351;0.071;0.093;0.172;0.291	B;B;B;B;B;B;B;B;B;B	0.37267	0.035;0.199;0.018;0.008;0.018;0.245;0.056;0.155;0.04;0.027	T	0.71735	-0.4503	10	0.87932	D	0	.	17.5997	0.88022	0.0:1.0:0.0:0.0	.	29;34;29;29;29;61;29;94;79;34	Q9NS61-9;B4DW99;Q9NS61-5;Q3YAC7;Q9NS61-3;Q9NS61-2;Q9NS61-7;Q9NS61-6;Q9NS61;Q3YAC6	.;.;.;.;.;.;.;.;KCIP2_HUMAN;.	N	34;61;61;79;29;29;94;29;29	ENSP00000239118:D34N;ENSP00000350733:D61N;ENSP00000349055:D79N;ENSP00000359063:D29N;ENSP00000341624:D29N;ENSP00000420040:D94N;ENSP00000344169:D29N;ENSP00000239117:D29N	ENSP00000239117:D29N	D	-	1	0	KCNIP2	103578935	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.274000	0.51631	2.261000	0.74972	0.561000	0.74099	GAT	KCNIP2	-	NULL	ENSG00000120049		0.632	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	KCNIP2	HGNC	protein_coding	OTTHUMT00000049973.1	31	0.00	0	C			103588945	103588945	-1	no_errors	ENST00000461105	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	1.000	T
NWD2	57495	genome.wustl.edu	37	4	37445614	37445615	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr4:37445614_37445615insA	ENST00000309447.5	+	7	2852_2853	c.2004_2005insA	c.(2005-2007)aaafs	p.K669fs		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		669	NACHT.									breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						TCACCATGGCCAAAATGGGTCT	0.47																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														ENST00000309447.5:c.2008dupA	4.37:g.37445618_37445618dupA	ENSP00000309501:p.Lys669fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRU1	Frame_Shift_Ins	INS	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.M669fs	ENST00000309447.5	37	c.2004_2005	CCDS47040.1	4																																																																																			KIAA1239	-	NULL	ENSG00000174145		0.470	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	126	0.00	0	-			37445614	37445615	+1	no_errors	ENST00000309447	ensembl	human	known	69_37n	frame_shift_ins	110	22.54	32	INS	1.000:1.000	A
NWD2	57495	genome.wustl.edu	37	4	37445614	37445615	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr4:37445614_37445615insA	ENST00000309447.5	+	7	2852_2853	c.2004_2005insA	c.(2005-2007)aaafs	p.K669fs		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		669	NACHT.									breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						TCACCATGGCCAAAATGGGTCT	0.47																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														ENST00000309447.5:c.2008dupA	4.37:g.37445618_37445618dupA	ENSP00000309501:p.Lys669fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRU1	Frame_Shift_Ins	INS	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.M669fs	ENST00000309447.5	37	c.2004_2005	CCDS47040.1	4																																																																																			KIAA1239	-	NULL	ENSG00000174145		0.470	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	116	0.00	0	-			37445614	37445615	+1	no_errors	ENST00000309447	ensembl	human	known	69_37n	frame_shift_ins	110	22.54	32	INS	1.000:1.000	A
KRTAP4-6	81871	genome.wustl.edu	37	17	39296423	39296423	+	Missense_Mutation	SNP	C	C	T	rs349790	byFrequency	TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr17:39296423C>T	ENST00000345847.4	-	1	316	c.317G>A	c.(316-318)cGt>cAt	p.R106H		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	106	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						GCAGCTGGGACGGCAGCAAGT	0.652													C|||	64	0.0127796	0.0023	0.0303	5008	,	,		18713	0.006		0.0149	False		,,,				2504	0.0194					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.317G>A	17.37:g.39296423C>T	ENSP00000328270:p.Arg106His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BYR1	Missense_Mutation	SNP	pfam_Keratin-assoc	p.R106H	ENST00000345847.4	37	c.317	CCDS54125.1	17	31	0.014194139194139194	5	0.01016260162601626	4	0.011049723756906077	6	0.01048951048951049	16	0.021108179419525065	.	11.71	1.719810	0.30503	.	.	ENSG00000198090	ENST00000345847	T	0.01505	4.82	5.0	-8.28	0.01013	.	209.318000	0.00520	U	0.000185	T	0.01695	0.0054	M	0.76838	2.35	0.09310	N	1	.	.	.	.	.	.	T	0.38373	-0.9664	8	0.38643	T	0.18	.	4.1396	0.10188	0.0982:0.3223:0.0969:0.4827	.	.	.	.	H	106	ENSP00000328270:R106H	ENSP00000328270:R106H	R	-	2	0	KRTAP4-6	36549949	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.922000	0.04004	-1.133000	0.02903	-2.248000	0.00284	CGT	KRTAP4-6	-	NULL	ENSG00000198090		0.652	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-6	HGNC	protein_coding	OTTHUMT00000257779.1	77	0.00	0	C			39296423	39296423	-1	no_errors	ENST00000345847	ensembl	human	known	69_37n	missense	76	21.65	21	SNP	0.000	T
KRTAP4-6	81871	genome.wustl.edu	37	17	39296423	39296423	+	Missense_Mutation	SNP	C	C	T	rs349790	byFrequency	TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr17:39296423C>T	ENST00000345847.4	-	1	316	c.317G>A	c.(316-318)cGt>cAt	p.R106H		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	106	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						GCAGCTGGGACGGCAGCAAGT	0.652													C|||	64	0.0127796	0.0023	0.0303	5008	,	,		18713	0.006		0.0149	False		,,,				2504	0.0194					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.317G>A	17.37:g.39296423C>T	ENSP00000328270:p.Arg106His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BYR1	Missense_Mutation	SNP	pfam_Keratin-assoc	p.R106H	ENST00000345847.4	37	c.317	CCDS54125.1	17	31	0.014194139194139194	5	0.01016260162601626	4	0.011049723756906077	6	0.01048951048951049	16	0.021108179419525065	.	11.71	1.719810	0.30503	.	.	ENSG00000198090	ENST00000345847	T	0.01505	4.82	5.0	-8.28	0.01013	.	209.318000	0.00520	U	0.000185	T	0.01695	0.0054	M	0.76838	2.35	0.09310	N	1	.	.	.	.	.	.	T	0.38373	-0.9664	8	0.38643	T	0.18	.	4.1396	0.10188	0.0982:0.3223:0.0969:0.4827	.	.	.	.	H	106	ENSP00000328270:R106H	ENSP00000328270:R106H	R	-	2	0	KRTAP4-6	36549949	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.922000	0.04004	-1.133000	0.02903	-2.248000	0.00284	CGT	KRTAP4-6	-	NULL	ENSG00000198090		0.652	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-6	HGNC	protein_coding	OTTHUMT00000257779.1	49	0.00	0	C			39296423	39296423	-1	no_errors	ENST00000345847	ensembl	human	known	69_37n	missense	76	21.65	21	SNP	0.000	T
LTBP2	4053	genome.wustl.edu	37	14	74975371	74975371	+	Silent	SNP	G	G	A	rs202022201		TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr14:74975371G>A	ENST00000261978.4	-	24	3974	c.3588C>T	c.(3586-3588)caC>caT	p.H1196H	LTBP2_ENST00000556690.1_Silent_p.H1196H	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1196	Cys-rich.|EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		AGAAAGACCCGTGGCTGTTGA	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18082	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													48.0	59.0	55.0					14																	74975371		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3588C>T	14.37:g.74975371G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q99907|Q9NS51	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.R129W	ENST00000261978.4	37	c.385	CCDS9831.1	14	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	3.553	-0.091218	0.07053	.	.	ENSG00000119681	ENST00000556206	.	.	.	5.2	-3.83	0.04269	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29882	-0.9997	4	.	.	.	.	2.8965	0.05692	0.4587:0.2055:0.2357:0.1002	.	.	.	.	W	129	.	.	R	-	1	2	LTBP2	74045124	0.000000	0.05858	0.289000	0.24876	0.497000	0.33675	-2.555000	0.00925	-1.114000	0.02977	-1.263000	0.01449	CGG	LTBP2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000119681		0.627	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	64	0.00	0	G	NM_000428		74975371	74975371	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000556206	ensembl	human	novel	69_37n	missense	22	37.14	13	SNP	0.304	A
LTBP2	4053	genome.wustl.edu	37	14	74975371	74975371	+	Silent	SNP	G	G	A	rs202022201		TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr14:74975371G>A	ENST00000261978.4	-	24	3974	c.3588C>T	c.(3586-3588)caC>caT	p.H1196H	LTBP2_ENST00000556690.1_Silent_p.H1196H	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1196	Cys-rich.|EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		AGAAAGACCCGTGGCTGTTGA	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18082	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													48.0	59.0	55.0					14																	74975371		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3588C>T	14.37:g.74975371G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q99907|Q9NS51	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.R129W	ENST00000261978.4	37	c.385	CCDS9831.1	14	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	3.553	-0.091218	0.07053	.	.	ENSG00000119681	ENST00000556206	.	.	.	5.2	-3.83	0.04269	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29882	-0.9997	4	.	.	.	.	2.8965	0.05692	0.4587:0.2055:0.2357:0.1002	.	.	.	.	W	129	.	.	R	-	1	2	LTBP2	74045124	0.000000	0.05858	0.289000	0.24876	0.497000	0.33675	-2.555000	0.00925	-1.114000	0.02977	-1.263000	0.01449	CGG	LTBP2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000119681		0.627	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	19	0.00	0	G	NM_000428		74975371	74975371	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000556206	ensembl	human	novel	69_37n	missense	22	37.14	13	SNP	0.304	A
MUC2	4583	genome.wustl.edu	37	11	1101090	1101090	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr11:1101090G>A	ENST00000441003.2	+	41	7516	c.7489G>A	c.(7489-7491)Gtt>Att	p.V2497I		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4859					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCAGAAGCCCGTTACCCACTG	0.602																																						dbGAP											0													86.0	95.0	92.0					11																	1101090		2113	4218	6331	-	-	-	SO:0001583	missense	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7489G>A	11.37:g.1101090G>A	ENSP00000415183:p.Val2497Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V2497I	ENST00000441003.2	37	c.7489		11	.	.	.	.	.	.	.	.	.	.	G	6.394	0.440886	0.12104	.	.	ENSG00000198788	ENST00000441003	T	0.12147	2.71	3.25	-0.0734	0.13735	.	.	.	.	.	T	0.04452	0.0122	N	0.04508	-0.205	0.09310	N	1	B	0.27117	0.168	B	0.10450	0.005	T	0.40059	-0.9583	9	0.25751	T	0.34	.	2.6826	0.05098	0.2604:0.2388:0.3967:0.1041	.	2497	E7EUV1	.	I	2497	ENSP00000415183:V2497I	ENSP00000415183:V2497I	V	+	1	0	MUC2	1091090	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.082000	0.03400	0.032000	0.15435	-0.510000	0.04470	GTT	MUC2	-	smart_VWF_C,pfscan_VWF_C	ENSG00000198788		0.602	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	102	0.00	0	G	NM_002457		1101090	1101090	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	missense	68	16.87	14	SNP	0.000	A
MUC2	4583	genome.wustl.edu	37	11	1101090	1101090	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr11:1101090G>A	ENST00000441003.2	+	41	7516	c.7489G>A	c.(7489-7491)Gtt>Att	p.V2497I		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4859					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCAGAAGCCCGTTACCCACTG	0.602																																						dbGAP											0													86.0	95.0	92.0					11																	1101090		2113	4218	6331	-	-	-	SO:0001583	missense	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7489G>A	11.37:g.1101090G>A	ENSP00000415183:p.Val2497Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V2497I	ENST00000441003.2	37	c.7489		11	.	.	.	.	.	.	.	.	.	.	G	6.394	0.440886	0.12104	.	.	ENSG00000198788	ENST00000441003	T	0.12147	2.71	3.25	-0.0734	0.13735	.	.	.	.	.	T	0.04452	0.0122	N	0.04508	-0.205	0.09310	N	1	B	0.27117	0.168	B	0.10450	0.005	T	0.40059	-0.9583	9	0.25751	T	0.34	.	2.6826	0.05098	0.2604:0.2388:0.3967:0.1041	.	2497	E7EUV1	.	I	2497	ENSP00000415183:V2497I	ENSP00000415183:V2497I	V	+	1	0	MUC2	1091090	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.082000	0.03400	0.032000	0.15435	-0.510000	0.04470	GTT	MUC2	-	smart_VWF_C,pfscan_VWF_C	ENSG00000198788		0.602	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	46	0.00	0	G	NM_002457		1101090	1101090	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	missense	68	16.87	14	SNP	0.000	A
OBSCN	84033	genome.wustl.edu	37	1	228506585	228506585	+	Splice_Site	SNP	T	T	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr1:228506585T>C	ENST00000422127.1	+	54	14176	c.14132T>C	c.(14131-14133)gTg>gCg	p.V4711A	OBSCN_ENST00000284548.11_Splice_Site_p.V4711A|OBSCN_ENST00000570156.2_Splice_Site_p.V5668A|OBSCN_ENST00000366709.4_Splice_Site_p.V1830A|OBSCN_ENST00000366707.4_Splice_Site_p.V2345A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4711	Ig-like 47.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCTTCCTCAGTGGCACTGAGC	0.627																																						dbGAP											0													14.0	16.0	15.0					1																	228506585		2058	4182	6240	-	-	-	SO:0001630	splice_region_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14132-1T>C	1.37:g.228506585T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.V4711A	ENST00000422127.1	37	c.14132	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	T	16.72	3.202462	0.58234	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.63255	0.39;-0.03;0.04;0.51	3.59	3.59	0.41128	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.390122	0.18816	N	0.130394	T	0.72581	0.3478	M	0.61703	1.905	0.35910	D	0.831006	D;P	0.69078	0.997;0.865	D;P	0.76071	0.987;0.508	T	0.76561	-0.2914	9	.	.	.	.	8.8054	0.34934	0.0:0.0:0.0:1.0	.	4711;4711	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	A	4711;4711;2345;1830	ENSP00000284548:V4711A;ENSP00000409493:V4711A;ENSP00000355668:V2345A;ENSP00000355670:V1830A	.	V	+	2	0	OBSCN	226573208	1.000000	0.71417	0.966000	0.40874	0.209000	0.24338	2.291000	0.43540	1.656000	0.50722	0.254000	0.18369	GTG	OBSCN	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000154358		0.627	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		20	0.00	0	T	NM_052843	Missense_Mutation	228506585	228506585	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	0.993	C
OR5R1	219479	genome.wustl.edu	37	11	56185039	56185039	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr11:56185039C>T	ENST00000312253.1	-	1	669	c.670G>A	c.(670-672)Gct>Act	p.A224T		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					CTTAGGATAGCGGCAATAATA	0.443																																						dbGAP											0													121.0	109.0	113.0					11																	56185039		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.670G>A	11.37:g.56185039C>T	ENSP00000308595:p.Ala224Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A224T	ENST00000312253.1	37	c.670	CCDS31530.1	11	.	.	.	.	.	.	.	.	.	.	C	11.73	1.725524	0.30593	.	.	ENSG00000174942	ENST00000312253	T	0.00188	8.59	5.53	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32608	U	0.005877	T	0.00144	0.0004	N	0.25060	0.705	0.09310	N	1	B	0.29531	0.247	B	0.31191	0.125	T	0.15407	-1.0438	10	0.23302	T	0.38	-7.8759	9.7227	0.40313	0.0:0.7777:0.0:0.2223	.	224	Q8NH85	OR5R1_HUMAN	T	224	ENSP00000308595:A224T	ENSP00000308595:A224T	A	-	1	0	OR5R1	55941615	0.000000	0.05858	0.417000	0.26559	0.745000	0.42441	-0.383000	0.07398	1.339000	0.45563	0.579000	0.79373	GCT	OR5R1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174942		0.443	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5R1	HGNC	protein_coding	OTTHUMT00000334444.1	242	0.00	0	C	NM_001004744		56185039	56185039	-1	no_errors	ENST00000312253	ensembl	human	known	69_37n	missense	118	48.47	111	SNP	0.003	T
OR5R1	219479	genome.wustl.edu	37	11	56185039	56185039	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr11:56185039C>T	ENST00000312253.1	-	1	669	c.670G>A	c.(670-672)Gct>Act	p.A224T		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					CTTAGGATAGCGGCAATAATA	0.443																																						dbGAP											0													121.0	109.0	113.0					11																	56185039		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.670G>A	11.37:g.56185039C>T	ENSP00000308595:p.Ala224Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A224T	ENST00000312253.1	37	c.670	CCDS31530.1	11	.	.	.	.	.	.	.	.	.	.	C	11.73	1.725524	0.30593	.	.	ENSG00000174942	ENST00000312253	T	0.00188	8.59	5.53	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32608	U	0.005877	T	0.00144	0.0004	N	0.25060	0.705	0.09310	N	1	B	0.29531	0.247	B	0.31191	0.125	T	0.15407	-1.0438	10	0.23302	T	0.38	-7.8759	9.7227	0.40313	0.0:0.7777:0.0:0.2223	.	224	Q8NH85	OR5R1_HUMAN	T	224	ENSP00000308595:A224T	ENSP00000308595:A224T	A	-	1	0	OR5R1	55941615	0.000000	0.05858	0.417000	0.26559	0.745000	0.42441	-0.383000	0.07398	1.339000	0.45563	0.579000	0.79373	GCT	OR5R1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174942		0.443	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5R1	HGNC	protein_coding	OTTHUMT00000334444.1	263	0.00	0	C	NM_001004744		56185039	56185039	-1	no_errors	ENST00000312253	ensembl	human	known	69_37n	missense	118	48.47	111	SNP	0.003	T
PEX2	5828	genome.wustl.edu	37	8	77895909	77895909	+	Missense_Mutation	SNP	C	C	T	rs564144139		TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr8:77895909C>T	ENST00000419564.2	-	4	970	c.506G>A	c.(505-507)cGt>cAt	p.R169H	PEX2_ENST00000520103.1_Missense_Mutation_p.R169H|PEX2_ENST00000522527.1_Missense_Mutation_p.R169H|PEX2_ENST00000357039.4_Missense_Mutation_p.R169H	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	169					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						ACCTAGGAGACGTTCTGTCAA	0.373													C|||	1	0.000199681	0.0	0.0	5008	,	,		19517	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													73.0	78.0	77.0					8																	77895909		2203	4300	6503	-	-	-	SO:0001583	missense	0			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.506G>A	8.37:g.77895909C>T	ENSP00000400984:p.Arg169His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567S6|Q9BW41	Missense_Mutation	SNP	pfam_Pex_N,smart_Znf_RING,pfscan_Znf_RING	p.R169H	ENST00000419564.2	37	c.506	CCDS6221.1	8	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222127	0.79464	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527;ENST00000518986	D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24	5.08	4.2	0.49525	Pex, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93746	0.8001	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94532	0.7737	10	0.72032	D	0.01	-19.582	13.74	0.62842	0.0:0.9259:0.0:0.0741	.	169	P28328	PEX2_HUMAN	H	169	ENSP00000349543:R169H;ENSP00000400984:R169H;ENSP00000428590:R169H;ENSP00000428638:R169H;ENSP00000429304:R169H	ENSP00000349543:R169H	R	-	2	0	PEX2	78058464	1.000000	0.71417	0.903000	0.35520	0.911000	0.54048	7.127000	0.77210	1.363000	0.46019	0.563000	0.77884	CGT	PEX2	-	pfam_Pex_N	ENSG00000164751		0.373	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1	138	0.00	0	C	NM_000318		77895909	77895909	-1	no_errors	ENST00000357039	ensembl	human	known	69_37n	missense	143	15.38	26	SNP	1.000	T
PRKCE	5581	genome.wustl.edu	37	2	46070194	46070194	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr2:46070194C>T	ENST00000306156.3	+	2	731	c.404C>T	c.(403-405)tCg>tTg	p.S135L	PRKCE_ENST00000467135.1_3'UTR	NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	135					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TCAGGGTCGTCGGGTGAAGGT	0.488																																						dbGAP											0													339.0	308.0	319.0					2																	46070194		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.404C>T	2.37:g.46070194C>T	ENSP00000306124:p.Ser135Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.S135L	ENST00000306156.3	37	c.404	CCDS1824.1	2	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550276	0.45383	.	.	ENSG00000171132	ENST00000306156	T	0.68624	-0.34	5.43	5.43	0.79202	C2 calcium/lipid-binding domain, CaLB (1);	0.132776	0.52532	D	0.000071	T	0.60077	0.2241	L	0.44542	1.39	0.80722	D	1	B	0.19706	0.038	B	0.11329	0.006	T	0.53301	-0.8458	9	.	.	.	.	18.1605	0.89706	0.0:1.0:0.0:0.0	.	135	Q02156	KPCE_HUMAN	L	135	ENSP00000306124:S135L	.	S	+	2	0	PRKCE	45923698	0.997000	0.39634	0.170000	0.22879	0.816000	0.46133	5.153000	0.64888	2.825000	0.97269	0.655000	0.94253	TCG	PRKCE	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Prot_kin_PKC_delta	ENSG00000171132		0.488	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	HGNC	protein_coding	OTTHUMT00000250751.2	503	0.00	0	C			46070194	46070194	+1	no_errors	ENST00000306156	ensembl	human	known	69_37n	missense	300	24.24	96	SNP	0.749	T
PRKCE	5581	genome.wustl.edu	37	2	46070194	46070194	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr2:46070194C>T	ENST00000306156.3	+	2	731	c.404C>T	c.(403-405)tCg>tTg	p.S135L	PRKCE_ENST00000467135.1_3'UTR	NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	135					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TCAGGGTCGTCGGGTGAAGGT	0.488																																						dbGAP											0													339.0	308.0	319.0					2																	46070194		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.404C>T	2.37:g.46070194C>T	ENSP00000306124:p.Ser135Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.S135L	ENST00000306156.3	37	c.404	CCDS1824.1	2	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550276	0.45383	.	.	ENSG00000171132	ENST00000306156	T	0.68624	-0.34	5.43	5.43	0.79202	C2 calcium/lipid-binding domain, CaLB (1);	0.132776	0.52532	D	0.000071	T	0.60077	0.2241	L	0.44542	1.39	0.80722	D	1	B	0.19706	0.038	B	0.11329	0.006	T	0.53301	-0.8458	9	.	.	.	.	18.1605	0.89706	0.0:1.0:0.0:0.0	.	135	Q02156	KPCE_HUMAN	L	135	ENSP00000306124:S135L	.	S	+	2	0	PRKCE	45923698	0.997000	0.39634	0.170000	0.22879	0.816000	0.46133	5.153000	0.64888	2.825000	0.97269	0.655000	0.94253	TCG	PRKCE	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Prot_kin_PKC_delta	ENSG00000171132		0.488	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	HGNC	protein_coding	OTTHUMT00000250751.2	427	0.00	0	C			46070194	46070194	+1	no_errors	ENST00000306156	ensembl	human	known	69_37n	missense	300	24.24	96	SNP	0.749	T
RPGRIP1	57096	genome.wustl.edu	37	14	21796707	21796707	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr14:21796707A>T	ENST00000400017.2	+	18	3020	c.3020A>T	c.(3019-3021)cAt>cTt	p.H1007L	RPGRIP1_ENST00000206660.6_Missense_Mutation_p.H1007L|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.H969L|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.H664L|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.H333L|RPGRIP1_ENST00000307974.4_Missense_Mutation_p.H366L	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	1007					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AGAAGAAAACATGGCAAAAGA	0.413																																						dbGAP											0													101.0	96.0	98.0					14																	21796707		1868	4108	5976	-	-	-	SO:0001583	missense	0			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.3020A>T	14.37:g.21796707A>T	ENSP00000382895:p.His1007Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	pfam_DUF3250,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.H1007L	ENST00000400017.2	37	c.3020	CCDS45080.1	14	.	.	.	.	.	.	.	.	.	.	A	17.43	3.388337	0.61956	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	T;T;T;T;T;T;T	0.78816	-0.06;-0.86;-0.9;-0.9;-0.44;-1.21;-1.2	4.74	4.74	0.60224	.	0.506657	0.21506	N	0.073444	D	0.84857	0.5565	M	0.65975	2.015	0.35965	D	0.834873	D;D;D;D;D;D	0.89917	0.997;0.997;0.997;0.981;1.0;0.999	D;D;D;P;D;D	0.85130	0.939;0.944;0.939;0.899;0.997;0.996	D	0.86604	0.1868	10	0.36615	T	0.2	-11.6272	10.5597	0.45138	1.0:0.0:0.0:0.0	.	390;366;482;333;623;1007	Q96KN7-2;Q96KN7-3;G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;.;.;RPGR1_HUMAN	L	664;969;1007;1007;333;482;366	ENSP00000450445:H664L;ENSP00000451219:H969L;ENSP00000382895:H1007L;ENSP00000206660:H1007L;ENSP00000372391:H333L;ENSP00000451262:H482L;ENSP00000309721:H366L	ENSP00000206660:H1007L	H	+	2	0	RPGRIP1	20866547	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.007000	0.57093	2.005000	0.58758	0.528000	0.53228	CAT	RPGRIP1	-	NULL	ENSG00000092200		0.413	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPGRIP1	HGNC	protein_coding	OTTHUMT00000410258.1	216	0.00	0	A	NM_020366		21796707	21796707	+1	no_errors	ENST00000206660	ensembl	human	known	69_37n	missense	41	73.03	111	SNP	1.000	T
RPGRIP1	57096	genome.wustl.edu	37	14	21796707	21796707	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr14:21796707A>T	ENST00000400017.2	+	18	3020	c.3020A>T	c.(3019-3021)cAt>cTt	p.H1007L	RPGRIP1_ENST00000206660.6_Missense_Mutation_p.H1007L|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.H969L|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.H664L|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.H333L|RPGRIP1_ENST00000307974.4_Missense_Mutation_p.H366L	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	1007					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AGAAGAAAACATGGCAAAAGA	0.413																																						dbGAP											0													101.0	96.0	98.0					14																	21796707		1868	4108	5976	-	-	-	SO:0001583	missense	0			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.3020A>T	14.37:g.21796707A>T	ENSP00000382895:p.His1007Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	pfam_DUF3250,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.H1007L	ENST00000400017.2	37	c.3020	CCDS45080.1	14	.	.	.	.	.	.	.	.	.	.	A	17.43	3.388337	0.61956	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	T;T;T;T;T;T;T	0.78816	-0.06;-0.86;-0.9;-0.9;-0.44;-1.21;-1.2	4.74	4.74	0.60224	.	0.506657	0.21506	N	0.073444	D	0.84857	0.5565	M	0.65975	2.015	0.35965	D	0.834873	D;D;D;D;D;D	0.89917	0.997;0.997;0.997;0.981;1.0;0.999	D;D;D;P;D;D	0.85130	0.939;0.944;0.939;0.899;0.997;0.996	D	0.86604	0.1868	10	0.36615	T	0.2	-11.6272	10.5597	0.45138	1.0:0.0:0.0:0.0	.	390;366;482;333;623;1007	Q96KN7-2;Q96KN7-3;G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;.;.;RPGR1_HUMAN	L	664;969;1007;1007;333;482;366	ENSP00000450445:H664L;ENSP00000451219:H969L;ENSP00000382895:H1007L;ENSP00000206660:H1007L;ENSP00000372391:H333L;ENSP00000451262:H482L;ENSP00000309721:H366L	ENSP00000206660:H1007L	H	+	2	0	RPGRIP1	20866547	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.007000	0.57093	2.005000	0.58758	0.528000	0.53228	CAT	RPGRIP1	-	NULL	ENSG00000092200		0.413	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPGRIP1	HGNC	protein_coding	OTTHUMT00000410258.1	269	0.00	0	A	NM_020366		21796707	21796707	+1	no_errors	ENST00000206660	ensembl	human	known	69_37n	missense	41	73.03	111	SNP	1.000	T
SMCR8	140775	genome.wustl.edu	37	17	18221324	18221324	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr17:18221324G>A	ENST00000406438.3	+	1	2701	c.2221G>A	c.(2221-2223)Gcc>Acc	p.A741T		NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	741						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						GGAAGATGAGGCCATAGTCAG	0.557																																						dbGAP											0													127.0	97.0	107.0					17																	18221324		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.2221G>A	17.37:g.18221324G>A	ENSP00000385025:p.Ala741Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	pfam_Folliculin	p.A741T	ENST00000406438.3	37	c.2221	CCDS11195.2	17	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968994	0.34754	.	.	ENSG00000176994	ENST00000406438	T	0.23552	1.9	5.55	-1.44	0.08856	.	0.508733	0.21061	N	0.080836	T	0.20941	0.0504	L	0.53249	1.67	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.18493	-1.0335	10	0.40728	T	0.16	-2.8043	9.8733	0.41189	0.4469:0.0:0.5531:0.0	.	741	Q8TEV9	SMCR8_HUMAN	T	741	ENSP00000385025:A741T	ENSP00000385025:A741T	A	+	1	0	SMCR8	18162049	0.616000	0.27035	0.908000	0.35775	0.903000	0.53119	0.175000	0.16762	-0.418000	0.07450	-0.783000	0.03347	GCC	SMCR8	-	NULL	ENSG00000176994		0.557	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2	156	0.00	0	G	NM_144775		18221324	18221324	+1	no_errors	ENST00000406438	ensembl	human	known	69_37n	missense	77	31.25	35	SNP	0.280	A
SMCR8	140775	genome.wustl.edu	37	17	18221324	18221324	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr17:18221324G>A	ENST00000406438.3	+	1	2701	c.2221G>A	c.(2221-2223)Gcc>Acc	p.A741T		NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	741						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						GGAAGATGAGGCCATAGTCAG	0.557																																						dbGAP											0													127.0	97.0	107.0					17																	18221324		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.2221G>A	17.37:g.18221324G>A	ENSP00000385025:p.Ala741Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	pfam_Folliculin	p.A741T	ENST00000406438.3	37	c.2221	CCDS11195.2	17	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968994	0.34754	.	.	ENSG00000176994	ENST00000406438	T	0.23552	1.9	5.55	-1.44	0.08856	.	0.508733	0.21061	N	0.080836	T	0.20941	0.0504	L	0.53249	1.67	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.18493	-1.0335	10	0.40728	T	0.16	-2.8043	9.8733	0.41189	0.4469:0.0:0.5531:0.0	.	741	Q8TEV9	SMCR8_HUMAN	T	741	ENSP00000385025:A741T	ENSP00000385025:A741T	A	+	1	0	SMCR8	18162049	0.616000	0.27035	0.908000	0.35775	0.903000	0.53119	0.175000	0.16762	-0.418000	0.07450	-0.783000	0.03347	GCC	SMCR8	-	NULL	ENSG00000176994		0.557	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2	112	0.00	0	G	NM_144775		18221324	18221324	+1	no_errors	ENST00000406438	ensembl	human	known	69_37n	missense	77	31.25	35	SNP	0.280	A
SNAI1	6615	genome.wustl.edu	37	20	48604456	48604456	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr20:48604456C>T	ENST00000244050.2	+	3	719	c.658C>T	c.(658-660)Cgc>Tgc	p.R220C		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	220	Required for nuclear localization and interaction with KPNB1, NOTCH1 and PARP1.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CTTCGCTGACCGCTCCAACCT	0.637																																						dbGAP											0													111.0	94.0	100.0					20																	48604456		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.658C>T	20.37:g.48604456C>T	ENSP00000244050:p.Arg220Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R220C	ENST00000244050.2	37	c.658	CCDS13423.1	20	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010514	0.75046	.	.	ENSG00000124216	ENST00000244050	T	0.07800	3.16	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.27559	0.0677	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00926	-1.1512	10	0.72032	D	0.01	-42.1747	18.5926	0.91218	0.0:1.0:0.0:0.0	.	220	O95863	SNAI1_HUMAN	C	220	ENSP00000244050:R220C	ENSP00000244050:R220C	R	+	1	0	SNAI1	48037863	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	4.582000	0.60957	2.462000	0.83206	0.455000	0.32223	CGC	SNAI1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124216		0.637	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI1	HGNC	protein_coding	OTTHUMT00000080350.1	165	0.00	0	C			48604456	48604456	+1	no_errors	ENST00000244050	ensembl	human	known	69_37n	missense	83	29.06	34	SNP	1.000	T
SNAI1	6615	genome.wustl.edu	37	20	48604456	48604456	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr20:48604456C>T	ENST00000244050.2	+	3	719	c.658C>T	c.(658-660)Cgc>Tgc	p.R220C		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	220	Required for nuclear localization and interaction with KPNB1, NOTCH1 and PARP1.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CTTCGCTGACCGCTCCAACCT	0.637																																						dbGAP											0													111.0	94.0	100.0					20																	48604456		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.658C>T	20.37:g.48604456C>T	ENSP00000244050:p.Arg220Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R220C	ENST00000244050.2	37	c.658	CCDS13423.1	20	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010514	0.75046	.	.	ENSG00000124216	ENST00000244050	T	0.07800	3.16	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.27559	0.0677	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00926	-1.1512	10	0.72032	D	0.01	-42.1747	18.5926	0.91218	0.0:1.0:0.0:0.0	.	220	O95863	SNAI1_HUMAN	C	220	ENSP00000244050:R220C	ENSP00000244050:R220C	R	+	1	0	SNAI1	48037863	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	4.582000	0.60957	2.462000	0.83206	0.455000	0.32223	CGC	SNAI1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124216		0.637	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI1	HGNC	protein_coding	OTTHUMT00000080350.1	79	0.00	0	C			48604456	48604456	+1	no_errors	ENST00000244050	ensembl	human	known	69_37n	missense	83	29.06	34	SNP	1.000	T
SPHK2	56848	genome.wustl.edu	37	19	49129267	49129267	+	Silent	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr19:49129267C>T	ENST00000245222.4	+	3	525	c.159C>T	c.(157-159)ggC>ggT	p.G53G	SPHK2_ENST00000600537.1_Intron|SPHK2_ENST00000601712.1_Silent_p.G17G|SPHK2_ENST00000598088.1_Silent_p.G53G|SPHK2_ENST00000340932.3_Silent_p.G17G|SPHK2_ENST00000599748.1_Silent_p.G17G|SPHK2_ENST00000599029.1_Silent_p.G17G|AC022154.7_ENST00000594850.1_RNA|AC022154.7_ENST00000598735.1_RNA|AC022154.7_ENST00000600303.1_RNA|SPHK2_ENST00000599033.1_Intron|SPHK2_ENST00000443164.1_Silent_p.G115G	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	53	Required for binding to sulfatide and phosphoinositides and for membrane localization.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		TCCTCCATGGCGAGTTTGGCT	0.701																																						dbGAP											0													34.0	33.0	33.0					19																	49129267		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.159C>T	19.37:g.49129267C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.G115	ENST00000245222.4	37	c.345	CCDS12727.1	19																																																																																			SPHK2	-	NULL	ENSG00000063176		0.701	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466153.1	18	0.00	0	C			49129267	49129267	+1	no_errors	ENST00000443164	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	1.000	T
SPHK2	56848	genome.wustl.edu	37	19	49129267	49129267	+	Silent	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr19:49129267C>T	ENST00000245222.4	+	3	525	c.159C>T	c.(157-159)ggC>ggT	p.G53G	SPHK2_ENST00000600537.1_Intron|SPHK2_ENST00000601712.1_Silent_p.G17G|SPHK2_ENST00000598088.1_Silent_p.G53G|SPHK2_ENST00000340932.3_Silent_p.G17G|SPHK2_ENST00000599748.1_Silent_p.G17G|SPHK2_ENST00000599029.1_Silent_p.G17G|AC022154.7_ENST00000594850.1_RNA|AC022154.7_ENST00000598735.1_RNA|AC022154.7_ENST00000600303.1_RNA|SPHK2_ENST00000599033.1_Intron|SPHK2_ENST00000443164.1_Silent_p.G115G	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	53	Required for binding to sulfatide and phosphoinositides and for membrane localization.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		TCCTCCATGGCGAGTTTGGCT	0.701																																						dbGAP											0													34.0	33.0	33.0					19																	49129267		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.159C>T	19.37:g.49129267C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.G115	ENST00000245222.4	37	c.345	CCDS12727.1	19																																																																																			SPHK2	-	NULL	ENSG00000063176		0.701	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466153.1	8	0.00	0	C			49129267	49129267	+1	no_errors	ENST00000443164	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	1.000	T
TFAP2A	7020	genome.wustl.edu	37	6	10410138	10410138	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr6:10410138A>G	ENST00000482890.1	-	3	828	c.476T>C	c.(475-477)gTc>gCc	p.V159A	TFAP2A-AS1_ENST00000420777.1_RNA|TFAP2A_ENST00000379608.3_Missense_Mutation_p.V153A|TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000319516.4_Missense_Mutation_p.V155A|TFAP2A_ENST00000379604.2_Missense_Mutation_p.V159A|TFAP2A_ENST00000379613.3_Missense_Mutation_p.V161A			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	159					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				TCTTACCGGGACCTCCTCGAT	0.637																																						dbGAP											0													10.0	10.0	10.0					6																	10410138		2089	4100	6189	-	-	-	SO:0001583	missense	0			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.476T>C	6.37:g.10410138A>G	ENSP00000418541:p.Val159Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_alpha_N	p.V159A	ENST00000482890.1	37	c.476	CCDS4510.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.96|18.96	3.733859|3.733859	0.69189|0.69189	.|.	.|.	ENSG00000137203|ENSG00000137203	ENST00000475264|ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890;ENST00000466073	.|T;T;T;T;T;T	.|0.81330	.|-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83078|0.83078	0.5176|0.5176	M|M	0.64170|0.64170	1.965|1.965	0.80722|0.80722	D|D	1|1	.|D;P;P;B;B;B;B	.|0.69078	.|0.997;0.469;0.955;0.009;0.0;0.0;0.001	.|D;B;P;B;B;B;B	.|0.72625	.|0.978;0.097;0.74;0.01;0.002;0.001;0.003	T|T	0.81741|0.81741	-0.0794|-0.0794	5|10	.|0.27785	.|T	.|0.31	-10.8568|-10.8568	13.6286|13.6286	0.62181|0.62181	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|161;159;159;161;155;159;153	.|Q96SH1;C1K3N0;P05549-2;Q96SH0;Q5TAV5;P05549;Q8N1C6	.|.;.;.;.;.;AP2A_HUMAN;.	P|A	64|161;159;155;153;159;159	.|ENSP00000368933:V161A;ENSP00000368924:V159A;ENSP00000316516:V155A;ENSP00000368928:V153A;ENSP00000418541:V159A;ENSP00000417495:V159A	.|ENSP00000316516:V155A	S|V	-|-	1|2	0|0	TFAP2A|TFAP2A	10518124|10518124	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	8.885000|8.885000	0.92439|0.92439	1.892000|1.892000	0.54788|0.54788	0.482000|0.482000	0.46254|0.46254	TCC|GTC	TFAP2A	-	NULL	ENSG00000137203		0.637	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	TFAP2A	HGNC	protein_coding	OTTHUMT00000353619.2	37	0.00	0	A	NM_003220		10410138	10410138	-1	no_errors	ENST00000379604	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	G
TFAP2A	7020	genome.wustl.edu	37	6	10410138	10410138	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr6:10410138A>G	ENST00000482890.1	-	3	828	c.476T>C	c.(475-477)gTc>gCc	p.V159A	TFAP2A-AS1_ENST00000420777.1_RNA|TFAP2A_ENST00000379608.3_Missense_Mutation_p.V153A|TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000319516.4_Missense_Mutation_p.V155A|TFAP2A_ENST00000379604.2_Missense_Mutation_p.V159A|TFAP2A_ENST00000379613.3_Missense_Mutation_p.V161A			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	159					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				TCTTACCGGGACCTCCTCGAT	0.637																																						dbGAP											0													10.0	10.0	10.0					6																	10410138		2089	4100	6189	-	-	-	SO:0001583	missense	0			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.476T>C	6.37:g.10410138A>G	ENSP00000418541:p.Val159Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_alpha_N	p.V159A	ENST00000482890.1	37	c.476	CCDS4510.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.96|18.96	3.733859|3.733859	0.69189|0.69189	.|.	.|.	ENSG00000137203|ENSG00000137203	ENST00000475264|ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890;ENST00000466073	.|T;T;T;T;T;T	.|0.81330	.|-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83078|0.83078	0.5176|0.5176	M|M	0.64170|0.64170	1.965|1.965	0.80722|0.80722	D|D	1|1	.|D;P;P;B;B;B;B	.|0.69078	.|0.997;0.469;0.955;0.009;0.0;0.0;0.001	.|D;B;P;B;B;B;B	.|0.72625	.|0.978;0.097;0.74;0.01;0.002;0.001;0.003	T|T	0.81741|0.81741	-0.0794|-0.0794	5|10	.|0.27785	.|T	.|0.31	-10.8568|-10.8568	13.6286|13.6286	0.62181|0.62181	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|161;159;159;161;155;159;153	.|Q96SH1;C1K3N0;P05549-2;Q96SH0;Q5TAV5;P05549;Q8N1C6	.|.;.;.;.;.;AP2A_HUMAN;.	P|A	64|161;159;155;153;159;159	.|ENSP00000368933:V161A;ENSP00000368924:V159A;ENSP00000316516:V155A;ENSP00000368928:V153A;ENSP00000418541:V159A;ENSP00000417495:V159A	.|ENSP00000316516:V155A	S|V	-|-	1|2	0|0	TFAP2A|TFAP2A	10518124|10518124	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	8.885000|8.885000	0.92439|0.92439	1.892000|1.892000	0.54788|0.54788	0.482000|0.482000	0.46254|0.46254	TCC|GTC	TFAP2A	-	NULL	ENSG00000137203		0.637	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	TFAP2A	HGNC	protein_coding	OTTHUMT00000353619.2	28	0.00	0	A	NM_003220		10410138	10410138	-1	no_errors	ENST00000379604	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	G
TRPC1	7220	genome.wustl.edu	37	3	142503607	142503607	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr3:142503607G>A	ENST00000476941.1	+	7	1508	c.1022G>A	c.(1021-1023)gGt>gAt	p.G341D	TRPC1_ENST00000273482.6_Missense_Mutation_p.G307D	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	341					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						CAGATGTCGGGTTACCGACGC	0.413																																						dbGAP											0													123.0	113.0	116.0					3																	142503607		2203	4300	6503	-	-	-	SO:0001583	missense	0			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1022G>A	3.37:g.142503607G>A	ENSP00000419313:p.Gly341Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CE4	Missense_Mutation	SNP	pfam_TRP_dom,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC1_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.G341D	ENST00000476941.1	37	c.1022	CCDS58856.1	3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152095	0.78001	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	T;T	0.78481	-1.18;-1.18	5.76	5.76	0.90799	.	0.041945	0.85682	D	0.000000	T	0.81049	0.4742	M	0.69185	2.1	0.80722	D	1	P;P	0.47106	0.89;0.845	B;P	0.44860	0.381;0.462	D	0.83398	0.0021	10	0.87932	D	0	-11.8405	19.9576	0.97228	0.0:0.0:1.0:0.0	.	341;307	P48995;P48995-2	TRPC1_HUMAN;.	D	341;307	ENSP00000419313:G341D;ENSP00000273482:G307D	ENSP00000273482:G307D	G	+	2	0	TRPC1	143986297	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.430000	0.97488	2.706000	0.92434	0.591000	0.81541	GGT	TRPC1	-	tigrfam_TRP_channel	ENSG00000144935		0.413	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	HGNC	protein_coding	OTTHUMT00000354520.1	226	0.44	1	G	NM_003304		142503607	142503607	+1	no_errors	ENST00000476941	ensembl	human	known	69_37n	missense	196	42.01	142	SNP	1.000	A
TRPC1	7220	genome.wustl.edu	37	3	142503607	142503607	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr3:142503607G>A	ENST00000476941.1	+	7	1508	c.1022G>A	c.(1021-1023)gGt>gAt	p.G341D	TRPC1_ENST00000273482.6_Missense_Mutation_p.G307D	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	341					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						CAGATGTCGGGTTACCGACGC	0.413																																						dbGAP											0													123.0	113.0	116.0					3																	142503607		2203	4300	6503	-	-	-	SO:0001583	missense	0			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1022G>A	3.37:g.142503607G>A	ENSP00000419313:p.Gly341Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CE4	Missense_Mutation	SNP	pfam_TRP_dom,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC1_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.G341D	ENST00000476941.1	37	c.1022	CCDS58856.1	3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152095	0.78001	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	T;T	0.78481	-1.18;-1.18	5.76	5.76	0.90799	.	0.041945	0.85682	D	0.000000	T	0.81049	0.4742	M	0.69185	2.1	0.80722	D	1	P;P	0.47106	0.89;0.845	B;P	0.44860	0.381;0.462	D	0.83398	0.0021	10	0.87932	D	0	-11.8405	19.9576	0.97228	0.0:0.0:1.0:0.0	.	341;307	P48995;P48995-2	TRPC1_HUMAN;.	D	341;307	ENSP00000419313:G341D;ENSP00000273482:G307D	ENSP00000273482:G307D	G	+	2	0	TRPC1	143986297	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.430000	0.97488	2.706000	0.92434	0.591000	0.81541	GGT	TRPC1	-	tigrfam_TRP_channel	ENSG00000144935		0.413	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	HGNC	protein_coding	OTTHUMT00000354520.1	274	0.00	0	G	NM_003304		142503607	142503607	+1	no_errors	ENST00000476941	ensembl	human	known	69_37n	missense	196	42.01	142	SNP	1.000	A
VAV1	7409	genome.wustl.edu	37	19	6833625	6833625	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr19:6833625G>A	ENST00000602142.1	+	17	1779	c.1697G>A	c.(1696-1698)cGa>cAa	p.R566Q	VAV1_ENST00000304076.2_Missense_Mutation_p.R566Q|VAV1_ENST00000539284.1_Missense_Mutation_p.R469Q|VAV1_ENST00000599806.1_Missense_Mutation_p.R511Q|VAV1_ENST00000596764.1_Missense_Mutation_p.R534Q	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	566					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCATGTGGCCGACATGGGCAA	0.577																																						dbGAP											0													146.0	127.0	133.0					19																	6833625		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1697G>A	19.37:g.6833625G>A	ENSP00000472929:p.Arg566Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.R566Q	ENST00000602142.1	37	c.1697	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162210	0.57368	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.76448	-0.07;-1.02	4.73	3.69	0.42338	.	0.221523	0.33772	N	0.004578	T	0.75817	0.3901	L	0.33485	1.01	0.46437	D	0.999047	D;D;D;D	0.71674	0.986;0.995;0.97;0.998	B;P;P;D	0.62955	0.423;0.722;0.708;0.909	T	0.70414	-0.4878	10	0.20519	T	0.43	.	7.8636	0.29524	0.1118:0.0:0.8882:0.0	.	469;566;511;566	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	Q	566;469	ENSP00000302269:R566Q;ENSP00000443242:R469Q	ENSP00000302269:R566Q	R	+	2	0	VAV1	6784625	1.000000	0.71417	0.738000	0.30950	0.267000	0.26476	3.931000	0.56529	2.199000	0.70637	0.491000	0.48974	CGA	VAV1	-	NULL	ENSG00000141968		0.577	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1	384	0.00	0	G			6833625	6833625	+1	no_errors	ENST00000304076	ensembl	human	known	69_37n	missense	303	20.89	80	SNP	0.665	A
VAV1	7409	genome.wustl.edu	37	19	6833625	6833625	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr19:6833625G>A	ENST00000602142.1	+	17	1779	c.1697G>A	c.(1696-1698)cGa>cAa	p.R566Q	VAV1_ENST00000304076.2_Missense_Mutation_p.R566Q|VAV1_ENST00000539284.1_Missense_Mutation_p.R469Q|VAV1_ENST00000599806.1_Missense_Mutation_p.R511Q|VAV1_ENST00000596764.1_Missense_Mutation_p.R534Q	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	566					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCATGTGGCCGACATGGGCAA	0.577																																						dbGAP											0													146.0	127.0	133.0					19																	6833625		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1697G>A	19.37:g.6833625G>A	ENSP00000472929:p.Arg566Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.R566Q	ENST00000602142.1	37	c.1697	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162210	0.57368	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.76448	-0.07;-1.02	4.73	3.69	0.42338	.	0.221523	0.33772	N	0.004578	T	0.75817	0.3901	L	0.33485	1.01	0.46437	D	0.999047	D;D;D;D	0.71674	0.986;0.995;0.97;0.998	B;P;P;D	0.62955	0.423;0.722;0.708;0.909	T	0.70414	-0.4878	10	0.20519	T	0.43	.	7.8636	0.29524	0.1118:0.0:0.8882:0.0	.	469;566;511;566	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	Q	566;469	ENSP00000302269:R566Q;ENSP00000443242:R469Q	ENSP00000302269:R566Q	R	+	2	0	VAV1	6784625	1.000000	0.71417	0.738000	0.30950	0.267000	0.26476	3.931000	0.56529	2.199000	0.70637	0.491000	0.48974	CGA	VAV1	-	NULL	ENSG00000141968		0.577	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1	340	0.29	1	G			6833625	6833625	+1	no_errors	ENST00000304076	ensembl	human	known	69_37n	missense	303	20.89	80	SNP	0.665	A
WDR44	54521	genome.wustl.edu	37	X	117540916	117540916	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chrX:117540916C>T	ENST00000254029.3	+	10	1855	c.1460C>T	c.(1459-1461)gCa>gTa	p.A487V	WDR44_ENST00000371822.5_Missense_Mutation_p.A462V|WDR44_ENST00000371825.3_Missense_Mutation_p.A487V	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	487						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AAATTCAAAGCAGCACACGGT	0.363																																						dbGAP											0													180.0	156.0	164.0					X																	117540916		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.1460C>T	X.37:g.117540916C>T	ENSP00000254029:p.Ala487Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A487V	ENST00000254029.3	37	c.1460	CCDS14572.1	X	.	.	.	.	.	.	.	.	.	.	C	35	5.522152	0.96416	.	.	ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825	T;T;T	0.74106	-0.81;-0.22;-0.08	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.83353	0.5236	L	0.49778	1.585	0.80722	D	1	P;D;D;D	0.76494	0.712;0.994;0.999;0.996	P;D;D;P	0.71184	0.525;0.917;0.972;0.901	D	0.83381	0.0012	10	0.51188	T	0.08	-15.6549	18.8839	0.92367	0.0:1.0:0.0:0.0	.	462;487;487;487	F8W913;E9PCI7;Q5JSH3-2;Q5JSH3	.;.;.;WDR44_HUMAN	V	462;487;487	ENSP00000360887:A462V;ENSP00000254029:A487V;ENSP00000360890:A487V	ENSP00000254029:A487V	A	+	2	0	WDR44	117424944	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.770000	0.85390	2.406000	0.81754	0.544000	0.68410	GCA	WDR44	-	NULL	ENSG00000131725		0.363	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR44	HGNC	protein_coding	OTTHUMT00000058001.1	468	0.00	0	C	NM_019045		117540916	117540916	+1	no_errors	ENST00000254029	ensembl	human	known	69_37n	missense	292	34.38	153	SNP	1.000	T
WDR44	54521	genome.wustl.edu	37	X	117540916	117540916	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chrX:117540916C>T	ENST00000254029.3	+	10	1855	c.1460C>T	c.(1459-1461)gCa>gTa	p.A487V	WDR44_ENST00000371822.5_Missense_Mutation_p.A462V|WDR44_ENST00000371825.3_Missense_Mutation_p.A487V	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	487						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AAATTCAAAGCAGCACACGGT	0.363																																						dbGAP											0													180.0	156.0	164.0					X																	117540916		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.1460C>T	X.37:g.117540916C>T	ENSP00000254029:p.Ala487Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A487V	ENST00000254029.3	37	c.1460	CCDS14572.1	X	.	.	.	.	.	.	.	.	.	.	C	35	5.522152	0.96416	.	.	ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825	T;T;T	0.74106	-0.81;-0.22;-0.08	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.83353	0.5236	L	0.49778	1.585	0.80722	D	1	P;D;D;D	0.76494	0.712;0.994;0.999;0.996	P;D;D;P	0.71184	0.525;0.917;0.972;0.901	D	0.83381	0.0012	10	0.51188	T	0.08	-15.6549	18.8839	0.92367	0.0:1.0:0.0:0.0	.	462;487;487;487	F8W913;E9PCI7;Q5JSH3-2;Q5JSH3	.;.;.;WDR44_HUMAN	V	462;487;487	ENSP00000360887:A462V;ENSP00000254029:A487V;ENSP00000360890:A487V	ENSP00000254029:A487V	A	+	2	0	WDR44	117424944	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.770000	0.85390	2.406000	0.81754	0.544000	0.68410	GCA	WDR44	-	NULL	ENSG00000131725		0.363	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR44	HGNC	protein_coding	OTTHUMT00000058001.1	559	0.00	0	C	NM_019045		117540916	117540916	+1	no_errors	ENST00000254029	ensembl	human	known	69_37n	missense	292	34.38	153	SNP	1.000	T
MAP3K19	80122	genome.wustl.edu	37	2	135745195	135745195	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	8060bafc-8b8c-44ba-91ba-8a9035b52f44	g.chr2:135745195G>C	ENST00000375845.3	-	7	1277	c.1247C>G	c.(1246-1248)gCt>gGt	p.A416G	MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.A433G|MAP3K19_ENST00000358371.4_Missense_Mutation_p.A303G|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	416							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A416D(1)									TCTTTTTGAAGCAGCTTTATT	0.343																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											92.0	93.0	92.0					2																	135745195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1247C>G	2.37:g.135745195G>C	ENSP00000365005:p.Ala416Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A416G	ENST00000375845.3	37	c.1247	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	2.924	-0.222469	0.06061	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915	T;T;T	0.70399	-0.48;-0.47;1.9	5.03	-0.156	0.13391	.	0.624908	0.14188	N	0.335550	T	0.47581	0.1453	N	0.22421	0.69	0.09310	N	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.23084	-1.0198	10	0.34782	T	0.22	.	1.8085	0.03085	0.1292:0.1518:0.1446:0.5744	.	303;433;416	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	G	416;303;433	ENSP00000365005:A416G;ENSP00000351140:A303G;ENSP00000376647:A433G	ENSP00000351140:A303G	A	-	2	0	YSK4	135461665	0.000000	0.05858	0.004000	0.12327	0.073000	0.16967	0.081000	0.14823	0.065000	0.16485	-1.081000	0.02215	GCT	YSK4	-	NULL	ENSG00000176601		0.343	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	HGNC	protein_coding	OTTHUMT00000158244.1	215	0.00	0	G	NM_025052		135745195	135745195	-1	no_errors	ENST00000375845	ensembl	human	known	69_37n	missense	152	21.24	41	SNP	0.000	C
MAP3K19	80122	genome.wustl.edu	37	2	135745195	135745195	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A13F-01A-11D-A12Q-09	TCGA-A7-A13F-11A-42D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f9ad889c-2135-40e3-97e6-c022d7eb6a92	9b12ed02-9183-4b84-b638-fd56f00f411a	g.chr2:135745195G>C	ENST00000375845.3	-	7	1277	c.1247C>G	c.(1246-1248)gCt>gGt	p.A416G	MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.A433G|MAP3K19_ENST00000358371.4_Missense_Mutation_p.A303G|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	416							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A416D(1)									TCTTTTTGAAGCAGCTTTATT	0.343																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											92.0	93.0	92.0					2																	135745195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1247C>G	2.37:g.135745195G>C	ENSP00000365005:p.Ala416Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A416G	ENST00000375845.3	37	c.1247	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	2.924	-0.222469	0.06061	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915	T;T;T	0.70399	-0.48;-0.47;1.9	5.03	-0.156	0.13391	.	0.624908	0.14188	N	0.335550	T	0.47581	0.1453	N	0.22421	0.69	0.09310	N	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.23084	-1.0198	10	0.34782	T	0.22	.	1.8085	0.03085	0.1292:0.1518:0.1446:0.5744	.	303;433;416	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	G	416;303;433	ENSP00000365005:A416G;ENSP00000351140:A303G;ENSP00000376647:A433G	ENSP00000351140:A303G	A	-	2	0	YSK4	135461665	0.000000	0.05858	0.004000	0.12327	0.073000	0.16967	0.081000	0.14823	0.065000	0.16485	-1.081000	0.02215	GCT	YSK4	-	NULL	ENSG00000176601		0.343	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	HGNC	protein_coding	OTTHUMT00000158244.1	337	0.00	0	G	NM_025052		135745195	135745195	-1	no_errors	ENST00000375845	ensembl	human	known	69_37n	missense	152	21.24	41	SNP	0.000	C
