#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARMCX4	100131755	genome.wustl.edu	37	X	100747136	100747136	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chrX:100747136C>G	ENST00000423738.3	+	2	3762	c.3560C>G	c.(3559-3561)gCc>gGc	p.A1187G		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	0						integral component of membrane (GO:0016021)				lung(1)	1						ggggAGCAGGCCAGTGGAGGG	0.632																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.3560C>G	X.37:g.100747136C>G	ENSP00000404304:p.Ala1187Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.A1187G	ENST00000423738.3	37	c.3560	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	8.855	0.945620	0.18356	.	.	ENSG00000196440	ENST00000423738	.	.	.	3.98	3.1	0.35709	.	.	.	.	.	T	0.32194	0.0821	.	.	.	0.19775	N	0.999954	.	.	.	.	.	.	T	0.19943	-1.0290	4	.	.	.	.	5.8703	0.18799	0.0:0.692:0.1912:0.1168	.	.	.	.	G	1291	.	.	A	+	2	0	ARMCX4	100633792	0.165000	0.22948	0.952000	0.39060	0.813000	0.45954	0.687000	0.25407	0.774000	0.33427	0.490000	0.48405	GCC	ARMCX4	-	NULL	ENSG00000196440		0.632	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	65	0.00	0	C	NM_001256155		100747136	100747136	+1	no_errors	ENST00000423738	ensembl	human	putative	69_37n	missense	58	23.68	18	SNP	0.981	G
ATG4B	23192	genome.wustl.edu	37	2	242590740	242590740	+	Silent	SNP	T	T	C			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr2:242590740T>C	ENST00000404914.3	+	3	277	c.174T>C	c.(172-174)ttT>ttC	p.F58F	ATG4B_ENST00000491867.1_3'UTR|ATG4B_ENST00000402096.1_5'UTR|ATG4B_ENST00000396411.3_5'UTR|ATG4B_ENST00000474739.2_Missense_Mutation_p.F14S|ATG4B_ENST00000405546.3_Silent_p.F58F	NM_013325.4|NM_178326.2	NP_037457.3|NP_847896.1	Q9Y4P1	ATG4B_HUMAN	autophagy related 4B, cysteine peptidase	58					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|positive regulation of autophagy (GO:0010508)|positive regulation of protein catabolic process (GO:0045732)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		GGAAAAACTTTCCAGCCATTG	0.363																																					Melanoma(78;458 1323 6342 12171 39523)	dbGAP											0													99.0	91.0	94.0					2																	242590740		1866	4092	5958	-	-	-	SO:0001819	synonymous_variant	0			AB023160	CCDS46564.1, CCDS46565.1	2q37.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000168397	ENSG00000168397			20790	protein-coding gene	gene with protein product		611338	"""APG4 autophagy 4 homolog B (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog B (S. cerevisiae)"""	APG4B		12446702	Standard	NM_013325		Approved	Apg4B, KIAA0943, DKFZp586D1822, AUTL1	uc002wbv.3	Q9Y4P1	OTTHUMG00000151514	ENST00000404914.3:c.174T>C	2.37:g.242590740T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNK2|Q53NU4|Q6ZUV8|Q8WYM9|Q96K07|Q96K96|Q96SZ1|Q9Y2F2	Missense_Mutation	SNP	pfam_Peptidase_C54	p.F14S	ENST00000404914.3	37	c.41	CCDS46564.1	2	.	.	.	.	.	.	.	.	.	.	T	12.07	1.828746	0.32329	.	.	ENSG00000168397	ENST00000474739	T	0.48836	0.8	5.36	0.578	0.17391	.	0.050126	0.85682	D	0.000000	T	0.35158	0.0922	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.16988	-1.0384	9	0.87932	D	0	-26.6496	7.415	0.27040	0.0:0.4238:0.0:0.5762	.	14	F5H7P2	.	S	14	ENSP00000442378:F14S	ENSP00000344960:F56S	F	+	2	0	ATG4B	242239413	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.559000	0.23485	0.185000	0.20105	-0.361000	0.07541	TTC	ATG4B	-	NULL	ENSG00000168397		0.363	ATG4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4B	HGNC	protein_coding	OTTHUMT00000322967.3	90	0.00	0	T	NM_013325		242590740	242590740	+1	no_errors	ENST00000474739	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	1.000	C
CDH1	999	genome.wustl.edu	37	16	68835697	68835697	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr16:68835697delC	ENST00000261769.5	+	3	479	c.288delC	c.(286-288)atcfs	p.I96fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.I96fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	96					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACCCACAGATCCATTTCTTGG	0.527			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Unknown(2)	breast(2)											161.0	145.0	150.0					16																	68835697		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.288delC	16.37:g.68835697delC	ENSP00000261769:p.Ile96fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H97fs	ENST00000261769.5	37	c.288	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like	ENSG00000039068		0.527	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	41	0.00	0	C	NM_004360		68835697	68835697	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	20	34.38	11	DEL	0.040	-
CNTNAP3B	728577	genome.wustl.edu	37	9	43828154	43828154	+	Silent	SNP	T	T	C	rs140150445	byFrequency	TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr9:43828154T>C	ENST00000377564.3	+	9	1803	c.1410T>C	c.(1408-1410)gaT>gaC	p.D470D		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	470	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						TGGTGGTGGATGATGACACAG	0.488													N|||	1183	0.236222	0.1959	0.2205	5008	,	,		7253	0.4127		0.2316	False		,,,				2504	0.1247					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1410T>C	9.37:g.43828154T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.M519T	ENST00000377564.3	37	c.1556	CCDS55312.1	9	384	0.17582417582417584	58	0.11788617886178862	46	0.1270718232044199	151	0.263986013986014	129	0.17018469656992086	N	2.598	-0.293646	0.05568	.	.	ENSG00000154529	ENST00000377561	.	.	.	2.66	-2.45	0.06481	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.54753	P	1.6000000000016E-5	.	.	.	.	.	.	T	0.26052	-1.0114	3	.	.	.	.	8.7373	0.34537	0.0:0.505:0.0:0.495	.	.	.	.	T	519	.	.	M	+	2	0	CNTNAP3B	43768150	0.002000	0.14202	0.000000	0.03702	0.123000	0.20343	-1.157000	0.03157	-0.975000	0.03546	-2.339000	0.00246	ATG	CNTNAP3B	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000154529		0.488	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	11	0.00	0	T			43828154	43828154	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000377561	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	0.006	C
CYP2A13	1553	genome.wustl.edu	37	19	41596102	41596102	+	Splice_Site	SNP	G	G	T			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr19:41596102G>T	ENST00000330436.3	+	3	493		c.e3+1			NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13						small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GGCACGCACGGTGAGTAGGGG	0.682																																						dbGAP											0													27.0	28.0	28.0					19																	41596102		2202	4297	6499	-	-	-	SO:0001630	splice_region_variant	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.493+1G>T	19.37:g.41596102G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YR8|Q6R569|Q6R570|Q9H2X2	Splice_Site	SNP	-	e3+1	ENST00000330436.3	37	c.493+1	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	14.97	2.694678	0.48202	.	.	ENSG00000197838	ENST00000330436	.	.	.	3.39	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0952	0.65016	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CYP2A13	46287942	1.000000	0.71417	0.943000	0.38184	0.080000	0.17528	6.719000	0.74718	1.903000	0.55091	0.298000	0.19748	.	CYP2A13	-	-	ENSG00000197838		0.682	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	87	0.00	0	G	NM_000766	Intron	41596102	41596102	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	splice_site	65	14.47	11	SNP	0.996	T
DCHS1	8642	genome.wustl.edu	37	11	6646586	6646586	+	Missense_Mutation	SNP	C	C	T	rs200322732		TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr11:6646586C>T	ENST00000299441.3	-	19	7400	c.6989G>A	c.(6988-6990)cGt>cAt	p.R2330H		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2330	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGGAGACACGGCCTCCATA	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20177	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													76.0	73.0	74.0					11																	6646586		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6989G>A	11.37:g.6646586C>T	ENSP00000299441:p.Arg2330His	Somatic		WXS	Illumina GAIIx	Phase_IV	O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R2330H	ENST00000299441.3	37	c.6989	CCDS7771.1	11	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	18.55	3.647971	0.67358	.	.	ENSG00000166341	ENST00000299441	T	0.52295	0.67	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	0.000000	0.43579	D	0.000545	T	0.36441	0.0967	L	0.47716	1.5	0.46542	D	0.999091	P	0.35155	0.487	B	0.32022	0.139	T	0.26121	-1.0112	10	0.44086	T	0.13	.	7.3591	0.26735	0.0:0.8251:0.0:0.1749	.	2330	Q96JQ0	PCD16_HUMAN	H	2330	ENSP00000299441:R2330H	ENSP00000299441:R2330H	R	-	2	0	DCHS1	6603162	0.997000	0.39634	0.996000	0.52242	0.997000	0.91878	3.471000	0.53107	2.563000	0.86464	0.655000	0.94253	CGT	DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.612	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	27	0.00	0	C	NM_003737		6646586	6646586	-1	no_errors	ENST00000299441	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.998	T
PDXDC2P	283970	genome.wustl.edu	37	16	70010458	70010458	+	RNA	SNP	G	G	A	rs3206834	byFrequency	TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr16:70010458G>A	ENST00000531894.1	-	0	3925				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GAGGGTGGAAGGGGAATAAGA	0.512													g|||	1754	0.35024	0.0809	0.5187	5008	,	,		5105	0.2609		0.6292	False		,,,				2504	0.3998					dbGAP											0																																										-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010458G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z5	Missense_Mutation	SNP	pfam_NPIP	p.L274F	ENST00000531894.1	37	c.820		16	1018	0.4661172161172161	104	0.21138211382113822	208	0.574585635359116	267	0.46678321678321677	439	0.579155672823219	.	8.557	0.876801	0.17395	.	.	ENSG00000226232	ENST00000532298	T	0.62105	0.05	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	.	.	.	.	.	.	T	0.48139	-0.9061	3	0.87932	D	0	.	.	.	.	rs3206834;rs3206834	.	.	.	F	274	ENSP00000448651:L274F	ENSP00000448651:L274F	L	-	1	0	RP11-419C5.2	68567959	0.006000	0.16342	0.013000	0.15412	0.013000	0.08279	0.150000	0.16263	0.107000	0.17824	0.109000	0.15622	CTT	RP11-419C5.2	-	pfam_NPIP	ENSG00000226232		0.512	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	52	0.00	0	G			70010458	70010458	-1	no_errors	ENST00000532298	ensembl	human	novel	69_37n	missense	23	14.81	4	SNP	0.014	A
FANCM	57697	genome.wustl.edu	37	14	45650865	45650865	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr14:45650865C>T	ENST00000267430.5	+	16	4428	c.4343C>T	c.(4342-4344)tCt>tTt	p.S1448F	FANCM_ENST00000555013.1_3'UTR|FANCM_ENST00000542564.2_Missense_Mutation_p.S1422F	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1448					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GAAGTTGATTCTCCACTTCAT	0.323								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													62.0	63.0	63.0					14																	45650865		2203	4296	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4343C>T	14.37:g.45650865C>T	ENSP00000267430:p.Ser1448Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S1448F	ENST00000267430.5	37	c.4343	CCDS32070.1	14	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089482	0.76756	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.42513	1.61;1.61;0.97	5.25	5.25	0.73442	.	0.130483	0.53938	D	0.000047	T	0.66509	0.2796	M	0.78637	2.42	0.44523	D	0.997479	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	T	0.70353	-0.4895	10	0.87932	D	0	.	16.7044	0.85368	0.0:1.0:0.0:0.0	.	1422;1448	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	F	1448;1422;964	ENSP00000267430:S1448F;ENSP00000442493:S1422F;ENSP00000452033:S964F	ENSP00000267430:S1448F	S	+	2	0	FANCM	44720615	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.812000	0.62613	2.624000	0.88883	0.467000	0.42956	TCT	FANCM	-	NULL	ENSG00000187790		0.323	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	49	0.00	0	C	XM_048128		45650865	45650865	+1	no_errors	ENST00000267430	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	T
FBLN5	10516	genome.wustl.edu	37	14	92349417	92349417	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr14:92349417A>G	ENST00000342058.4	-	8	1336	c.743T>C	c.(742-744)aTg>aCg	p.M248T	FBLN5_ENST00000556154.1_Missense_Mutation_p.M253T|FBLN5_ENST00000267620.10_Missense_Mutation_p.M289T	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	248	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				GCACTCGTCCATATCTGGGGT	0.527																																						dbGAP											0													132.0	111.0	118.0					14																	92349417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.743T>C	14.37:g.92349417A>G	ENSP00000345008:p.Met248Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75966|Q6IAL4|Q6UWA3	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,superfamily_TIL_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.M248T	ENST00000342058.4	37	c.743	CCDS9898.1	14	.	.	.	.	.	.	.	.	.	.	A	14.87	2.663055	0.47572	.	.	ENSG00000140092	ENST00000267620;ENST00000342058;ENST00000556154	D;D;D	0.86627	-2.15;-2.15;-2.15	5.1	5.1	0.69264	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.045875	0.85682	D	0.000000	T	0.77377	0.4121	N	0.03608	-0.345	0.80722	D	1	P;P;B	0.48694	0.914;0.73;0.436	P;B;B	0.45881	0.496;0.263;0.077	T	0.82303	-0.0524	10	0.48119	T	0.1	.	15.1998	0.73126	1.0:0.0:0.0:0.0	.	289;253;248	G3XA98;G3V4U0;Q9UBX5	.;.;FBLN5_HUMAN	T	289;248;253	ENSP00000267620:M289T;ENSP00000345008:M248T;ENSP00000451982:M253T	ENSP00000267620:M345T	M	-	2	0	FBLN5	91419170	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.287000	0.95975	2.052000	0.61016	0.459000	0.35465	ATG	FBLN5	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000140092		0.527	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBLN5	HGNC	protein_coding	OTTHUMT00000411787.1	47	0.00	0	A			92349417	92349417	-1	no_errors	ENST00000342058	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	G
GMEB1	10691	genome.wustl.edu	37	1	29041512	29041512	+	IGR	SNP	T	T	C			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr1:29041512T>C	ENST00000294409.2	+	0	1912				GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000373816.1_3'UTR	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1						transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		AATGTCCTAATCATCTTACAC	0.418																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647		1.37:g.29041512T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AT48|Q9NWH1|Q9UKD0	RNA	SNP	-	NULL	ENST00000294409.2	37	NULL	CCDS327.1	1																																																																																			GMEB1	-	-	ENSG00000162419		0.418	GMEB1-003	KNOWN	basic|CCDS	protein_coding	GMEB1	HGNC	protein_coding	OTTHUMT00000010333.1	33	0.00	0	T	NM_006582		29041512	29041512	+1	no_errors	ENST00000480454	ensembl	human	known	69_37n	rna	12	36.84	7	SNP	0.106	C
KDM4B	23030	genome.wustl.edu	37	19	5135512	5135512	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr19:5135512G>A	ENST00000159111.4	+	15	2466	c.2248G>A	c.(2248-2250)Ggc>Agc	p.G750S	KDM4B_ENST00000536461.1_Missense_Mutation_p.G784S	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	750					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CTCCTACATCGGCGACGACGG	0.652																																						dbGAP											0													42.0	35.0	37.0					19																	5135512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.2248G>A	19.37:g.5135512G>A	ENSP00000159111:p.Gly750Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.G750S	ENST00000159111.4	37	c.2248	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935906	0.73442	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.18960	2.18;2.18	4.22	4.22	0.49857	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.133119	0.50627	D	0.000114	T	0.37999	0.1024	L	0.57536	1.79	0.25831	N	0.984166	D;D	0.89917	0.989;1.0	P;D	0.91635	0.566;0.999	T	0.14282	-1.0478	10	0.21014	T	0.42	-22.2833	11.7977	0.52110	0.0:0.0:0.8243:0.1757	.	784;750	F5GX28;O94953	.;KDM4B_HUMAN	S	750;784	ENSP00000159111:G750S;ENSP00000440495:G784S	ENSP00000159111:G750S	G	+	1	0	KDM4B	5086512	0.996000	0.38824	0.988000	0.46212	0.957000	0.61999	4.380000	0.59581	1.905000	0.55150	0.561000	0.74099	GGC	KDM4B	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	ENSG00000127663		0.652	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	HGNC	protein_coding	OTTHUMT00000450558.1	90	0.00	0	G	NM_015015		5135512	5135512	+1	no_errors	ENST00000159111	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	0.641	A
JUP	3728	genome.wustl.edu	37	17	39791686	39791686	+	Intron	SNP	T	T	C	rs8070585	byFrequency	TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr17:39791686T>C	ENST00000540235.1	-	5	909				KRT42P_ENST00000438131.1_RNA			P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CGCAGGCTGGTGGCTGGCACC	0.612													N|||	3103	0.619609	0.8616	0.4741	5008	,	,		17973	0.6538		0.4294	False		,,,				2504	0.5562				Colon(16;42 520 6044 17852 28530)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000540235.1:c.910-12402A>G	17.37:g.39791686T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	RNA	SNP	-	NULL	ENST00000540235.1	37	NULL		17																																																																																			KRT42P	-	-	ENSG00000214514		0.612	JUP-201	KNOWN	basic	protein_coding	KRT42P	HGNC	protein_coding		70	0.00	0	T			39791686	39791686	-1	no_errors	ENST00000587390	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.922	C
MUC4	4585	genome.wustl.edu	37	3	195510227	195510228	+	Frame_Shift_Ins	INS	-	-	G	rs199812923		TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr3:195510227_195510228insG	ENST00000463781.3	-	2	8682_8683	c.8223_8224insC	c.(8221-8226)gagactfs	p.T2742fs	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Frame_Shift_Ins_p.T2742fs	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGTCTCGGTGACAA	0.559																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8223_8224insC	3.37:g.195510227_195510228insG	ENSP00000417498:p.Thr2742fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Ins	INS	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T2741fs	ENST00000463781.3	37	c.8224_8223	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.559	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	50	0.00	0	-	NM_018406		195510227	195510228	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	frame_shift_ins	31	20.51	8	INS	0.000:0.000	G
MUC4	4585	genome.wustl.edu	37	3	195510230	195510230	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr3:195510230delC	ENST00000463781.3	-	2	8680	c.8221delG	c.(8221-8223)gagfs	p.E2741fs	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Frame_Shift_Del_p.E2741fs	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTCTCGGTGACAAGA	0.562																																						dbGAP											0									,,	118,1232		44,30,601	4.0	4.0	4.0		,,	-0.1	0.0	3		4	151,3465		23,105,1680	no	intron,frameshift,intron	MUC4	NM_138297.4,NM_018406.6,NM_004532.5	,,	67,135,2281	A1A1,A1R,RR		4.1759,8.7407,5.4168	,,	,,	195510230	269,4697	331	1081	1412	-	-	-	SO:0001589	frameshift_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8221delG	3.37:g.195510230delC	ENSP00000417498:p.Glu2741fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Del	DEL	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.E2741fs	ENST00000463781.3	37	c.8221	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	46	0.00	0	C	NM_018406		195510230	195510230	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	frame_shift_del	28	22.22	8	DEL	0.000	-
NOTCH2	4853	genome.wustl.edu	37	1	120611960	120611960	+	Missense_Mutation	SNP	C	C	T	rs2603926		TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr1:120611960C>T	ENST00000256646.2	-	1	280	c.61G>A	c.(61-63)Gcc>Acc	p.A21T		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	21				A -> T (in Ref. 2; AAG37073). {ECO:0000305}.	apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCGCGGGGGCCGCGCAGCAC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													6.0	8.0	8.0					1																	120611960		1705	3725	5430	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.61G>A	1.37:g.120611960C>T	ENSP00000256646:p.Ala21Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A21T	ENST00000256646.2	37	c.61	CCDS908.1	1	338	0.15476190476190477	115	0.23373983739837398	62	0.1712707182320442	66	0.11538461538461539	95	0.12532981530343007	c	6.410	0.443770	0.12164	.	.	ENSG00000134250	ENST00000256646	T	0.57752	0.38	3.09	2.14	0.27477	.	.	.	.	.	T	0.07324	0.0185	N	0.01874	-0.695	0.18873	N	0.999985	B;B	0.18461	0.0;0.028	B;B	0.11329	0.0;0.006	T	0.40813	-0.9543	9	0.13470	T	0.59	.	6.5614	0.22489	0.0:0.8575:0.0:0.1425	.	21;21	Q6IQ50;Q04721	.;NOTC2_HUMAN	T	21	ENSP00000256646:A21T	ENSP00000256646:A21T	A	-	1	0	NOTCH2	120413483	0.972000	0.33761	0.995000	0.50966	0.349000	0.29174	0.433000	0.21477	0.641000	0.30601	0.184000	0.17185	GCC	NOTCH2	-	pirsf_Notch	ENSG00000134250		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	14	0.00	0	C	NM_024408		120611960	120611960	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.990	T
PKN3	29941	genome.wustl.edu	37	9	131467742	131467742	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr9:131467742G>A	ENST00000291906.4	+	2	578	c.185G>A	c.(184-186)cGc>cAc	p.R62H		NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	62					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TCCTCCAACCGCCGCCTGGAG	0.687																																						dbGAP											0													6.0	6.0	6.0					9																	131467742		2078	4084	6162	-	-	-	SO:0001583	missense	0			AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.185G>A	9.37:g.131467742G>A	ENSP00000291906:p.Arg62His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UM03	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.R62H	ENST00000291906.4	37	c.185	CCDS6908.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.411635	0.96072	.	.	ENSG00000160447	ENST00000291906	T	0.19394	2.15	5.18	5.18	0.71444	.	.	.	.	.	T	0.46983	0.1421	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.47169	-0.9138	9	0.87932	D	0	.	17.713	0.88327	0.0:0.0:1.0:0.0	.	62;62	Q05BU1;Q6P5Z2	.;PKN3_HUMAN	H	62	ENSP00000291906:R62H	ENSP00000291906:R62H	R	+	2	0	PKN3	130507563	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.350000	0.66016	2.420000	0.82092	0.655000	0.94253	CGC	PKN3	-	pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd	ENSG00000160447		0.687	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN3	HGNC	protein_coding	OTTHUMT00000054487.1	56	0.00	0	G	NM_013355		131467742	131467742	+1	no_errors	ENST00000291906	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	1.000	A
PPP1R9A	55607	genome.wustl.edu	37	7	94740610	94740610	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr7:94740610A>G	ENST00000433881.1	+	3	1967	c.1435A>G	c.(1435-1437)Aat>Gat	p.N479D	PPP1R9A_ENST00000433360.1_Missense_Mutation_p.N479D|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.N479D|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.N479D|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.N479D|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.N479D			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	479	Interacts with protein phosphatase 1. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TGACAGGAGAAATGACGAAGT	0.413										HNSCC(28;0.073)																												dbGAP											0													76.0	78.0	77.0					7																	94740610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1435A>G	7.37:g.94740610A>G	ENSP00000398870:p.Asn479Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,superfamily_Smac_DIABLO-like,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.N479D	ENST00000433881.1	37	c.1435	CCDS34683.1	7	.	.	.	.	.	.	.	.	.	.	A	24.7	4.559468	0.86335	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.20200	2.1;2.13;2.09;2.13;2.12;2.09	4.89	4.89	0.63831	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.51635	0.1686	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.996	D;D;D;D;D	0.79108	0.983;0.99;0.992;0.989;0.981	T	0.60727	-0.7206	10	0.72032	D	0.01	.	14.9824	0.71321	1.0:0.0:0.0:0.0	.	479;479;479;479;479	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	D	479	ENSP00000405514:N479D;ENSP00000344524:N479D;ENSP00000411342:N479D;ENSP00000398870:N479D;ENSP00000289495:N479D;ENSP00000402893:N479D	ENSP00000289495:N479D	N	+	1	0	PPP1R9A	94578546	1.000000	0.71417	0.998000	0.56505	0.855000	0.48748	9.074000	0.93998	2.187000	0.69744	0.477000	0.44152	AAT	PPP1R9A	-	superfamily_PDZ	ENSG00000158528		0.413	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	90	0.00	0	A	NM_001166160		94740610	94740610	+1	no_errors	ENST00000289495	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	1.000	G
SEC16A	9919	genome.wustl.edu	37	9	139370344	139370344	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr9:139370344G>T	ENST00000371706.3	-	1	1223	c.1190C>A	c.(1189-1191)aCa>aAa	p.T397K	SEC16A_ENST00000290037.6_Missense_Mutation_p.T397K|SEC16A_ENST00000313050.7_Missense_Mutation_p.T575K|SEC16A_ENST00000431893.2_Missense_Mutation_p.T397K			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	397					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTCTCGTCTGTTTCACCTCC	0.493																																						dbGAP											0													27.0	31.0	29.0					9																	139370344		2108	4235	6343	-	-	-	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.1190C>A	9.37:g.139370344G>T	ENSP00000360771:p.Thr397Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.T575K	ENST00000371706.3	37	c.1724		9	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256075	0.39896	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T	0.23950	1.88;1.9;1.89;1.89	5.42	1.06	0.20224	.	0.873151	0.10328	N	0.687957	T	0.24547	0.0595	M	0.63428	1.95	0.22081	N	0.999375	P;P;P;P	0.41848	0.651;0.763;0.763;0.651	B;B;B;B	0.36608	0.115;0.229;0.229;0.113	T	0.13818	-1.0495	10	0.72032	D	0.01	-0.6754	8.3207	0.32128	0.3634:0.0:0.6366:0.0	.	575;397;397;202	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	K	575;397;397;397;202	ENSP00000325827:T575K;ENSP00000360771:T397K;ENSP00000290037:T397K;ENSP00000387583:T397K	ENSP00000290037:T397K	T	-	2	0	SEC16A	138490165	0.008000	0.16893	0.001000	0.08648	0.191000	0.23601	1.699000	0.37804	0.220000	0.20860	0.655000	0.94253	ACA	SEC16A	-	NULL	ENSG00000148396		0.493	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	53	0.00	0	G	XM_088459		139370344	139370344	-1	no_errors	ENST00000313050	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.004	T
SLC3A1	6519	genome.wustl.edu	37	2	44540999	44540999	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr2:44540999T>C	ENST00000260649.6	+	9	1602	c.1526T>C	c.(1525-1527)aTg>aCg	p.M509T	SLC3A1_ENST00000409294.1_Missense_Mutation_p.M129T|SLC3A1_ENST00000409380.1_Missense_Mutation_p.M231T|SLC3A1_ENST00000409740.3_Missense_Mutation_p.M140T|SLC3A1_ENST00000409387.1_Missense_Mutation_p.M509T|SLC3A1_ENST00000409229.3_Missense_Mutation_p.M509T	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	509					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	AAGTCACCAATGCAGTGGGAC	0.393																																						dbGAP											0													106.0	97.0	100.0					2																	44540999		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.1526T>C	2.37:g.44540999T>C	ENSP00000260649:p.Met509Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	p.M509T	ENST00000260649.6	37	c.1526	CCDS1819.1	2	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033697	0.75504	.	.	ENSG00000138079	ENST00000260649;ENST00000409387;ENST00000540334;ENST00000409229;ENST00000541289;ENST00000409380;ENST00000409294;ENST00000409740	D;D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84;-3.84	5.52	5.52	0.82312	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98385	0.9463	H	0.95079	3.62	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73708	0.962;0.981;0.94	D	0.99683	1.0999	10	0.87932	D	0	-26.9024	15.6564	0.77140	0.0:0.0:0.0:1.0	.	509;509;509	Q07837;B8ZZK1;Q4J6B5	SLC31_HUMAN;.;.	T	509;509;445;509;509;231;129;140	ENSP00000260649:M509T;ENSP00000387308:M509T;ENSP00000386620:M509T;ENSP00000386709:M231T;ENSP00000386852:M129T;ENSP00000386677:M140T	ENSP00000260649:M509T	M	+	2	0	SLC3A1	44394503	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.135000	0.77276	2.103000	0.63969	0.455000	0.32223	ATG	SLC3A1	-	superfamily_Glycoside_hydrolase_SF	ENSG00000138079		0.393	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC3A1	HGNC	protein_coding	OTTHUMT00000250676.1	86	0.00	0	T	NM_000341		44540999	44540999	+1	no_errors	ENST00000260649	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	1.000	C
SMC5	23137	genome.wustl.edu	37	9	72930414	72930414	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr9:72930414G>T	ENST00000361138.5	+	13	1784	c.1726G>T	c.(1726-1728)Gta>Tta	p.V576L		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	576	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						ACCTGATCCTGTAATGAGTTA	0.323																																						dbGAP											0													64.0	62.0	63.0					9																	72930414		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1726G>T	9.37:g.72930414G>T	ENSP00000354957:p.Val576Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC	p.V576L	ENST00000361138.5	37	c.1726	CCDS6632.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.250942	0.95305	.	.	ENSG00000198887	ENST00000361138	T	0.36157	1.27	5.95	5.95	0.96441	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.57784	0.2077	L	0.52206	1.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51466	-0.8702	10	0.48119	T	0.1	-16.9848	20.3931	0.98965	0.0:0.0:1.0:0.0	.	576	Q8IY18	SMC5_HUMAN	L	576	ENSP00000354957:V576L	ENSP00000354957:V576L	V	+	1	0	SMC5	72120234	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	6.948000	0.75965	2.824000	0.97209	0.655000	0.94253	GTA	SMC5	-	pfam_RecF/RecN/SMC	ENSG00000198887		0.323	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	64	0.00	0	G	NM_015110		72930414	72930414	+1	no_errors	ENST00000361138	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
SNRNP25	79622	genome.wustl.edu	37	16	103923	103923	+	5'UTR	SNP	C	C	G	rs2562145	byFrequency	TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr16:103923C>G	ENST00000383018.3	+	0	95				SNRNP25_ENST00000493672.1_3'UTR|POLR3K_ENST00000293860.5_5'Flank	NM_024571.3	NP_078847.1	Q9BV90	SNR25_HUMAN	small nuclear ribonucleoprotein 25kDa (U11/U12)						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)				large_intestine(1)|lung(2)	3						AGACGGAGGCCGCGGGTGGGC	0.711											OREG0003709|OREG0003710	type=REGULATORY REGION|Gene=C16orf33|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=POLR3K|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	C|||	2660	0.53115	0.4312	0.513	5008	,	,		10713	0.5843		0.6034	False		,,,				2504	0.5501					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC001381	CCDS10396.1	16p13.3	2011-10-11	2008-10-29	2008-10-29	ENSG00000161981	ENSG00000161981			14161	protein-coding gene	gene with protein product	"""U11/U12 snRNP 25K"""		"""chromosome 16 open reading frame 33"""	C16orf33		15146077	Standard	NM_024571		Approved		uc002cfj.4	Q9BV90	OTTHUMG00000060720	ENST00000383018.3:c.-67C>G	16.37:g.103923C>G		Somatic	585	WXS	Illumina GAIIx	Phase_IV	Q1W6H3|Q6IEF8|Q9H5W4	RNA	SNP	-	NULL	ENST00000383018.3	37	NULL	CCDS10396.1	16																																																																																			SNRNP25	-	-	ENSG00000161981		0.711	SNRNP25-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNRNP25	HGNC	protein_coding		18	0.00	0	C	NM_024571		103923	103923	+1	no_errors	ENST00000493672	ensembl	human	known	69_37n	rna	16	20.00	4	SNP	0.000	G
SPEF2	79925	genome.wustl.edu	37	5	35646801	35646801	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr5:35646801delA	ENST00000356031.3	+	5	772	c.618delA	c.(616-618)atafs	p.I206fs	SPEF2_ENST00000282469.6_Frame_Shift_Del_p.I206fs|SPEF2_ENST00000440995.2_Frame_Shift_Del_p.I206fs|SPEF2_ENST00000509059.1_Frame_Shift_Del_p.I206fs	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	206					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAAATGAAATAATGGCCAAAA	0.328																																						dbGAP											0													108.0	115.0	112.0					5																	35646801		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.618delA	5.37:g.35646801delA	ENSP00000348314:p.Ile206fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Del	DEL	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.M207fs	ENST00000356031.3	37	c.618	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.328	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	23	0.00	0	A	NM_144722		35646801	35646801	+1	no_errors	ENST00000356031	ensembl	human	known	69_37n	frame_shift_del	6	25.00	2	DEL	1.000	-
TBX21	30009	genome.wustl.edu	37	17	45822177	45822177	+	Silent	SNP	G	G	A			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr17:45822177G>A	ENST00000177694.1	+	6	1264	c.1053G>A	c.(1051-1053)ggG>ggA	p.G351G		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	351					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						AATTCCTTGGGGGAGATCACT	0.542																																						dbGAP											0													99.0	97.0	98.0					17																	45822177		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.1053G>A	17.37:g.45822177G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.G351	ENST00000177694.1	37	c.1053	CCDS11514.1	17																																																																																			TBX21	-	NULL	ENSG00000073861		0.542	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX21	HGNC	protein_coding	OTTHUMT00000441365.1	112	0.00	0	G	NM_013351		45822177	45822177	+1	no_errors	ENST00000177694	ensembl	human	known	69_37n	silent	67	16.25	13	SNP	0.981	A
TBX22	50945	genome.wustl.edu	37	X	79279632	79279632	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chrX:79279632G>T	ENST00000373294.5	+	3	455	c.427G>T	c.(427-429)Gat>Tat	p.D143Y	TBX22_ENST00000442340.1_Missense_Mutation_p.D23Y|TBX22_ENST00000373291.1_Missense_Mutation_p.D23Y|TBX22_ENST00000373296.3_Missense_Mutation_p.D143Y	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	143					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TGTGGCCATCGATGTGGTGCC	0.522																																						dbGAP											0													174.0	136.0	149.0					X																	79279632		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.427G>T	X.37:g.79279632G>T	ENSP00000362390:p.Asp143Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.D143Y	ENST00000373294.5	37	c.427	CCDS14445.1	X	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575978	0.45902	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69	4.71	4.71	0.59529	p53-like transcription factor, DNA-binding (1);	0.059066	0.64402	D	0.000005	D	0.97015	0.9025	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.98576	1.0648	10	0.87932	D	0	.	15.3729	0.74581	0.0:0.0:1.0:0.0	.	143	Q9Y458	TBX22_HUMAN	Y	143;23;143;23	ENSP00000362393:D143Y;ENSP00000396394:D23Y;ENSP00000362390:D143Y;ENSP00000362388:D23Y	ENSP00000362388:D23Y	D	+	1	0	TBX22	79166288	1.000000	0.71417	0.014000	0.15608	0.009000	0.06853	8.843000	0.92142	1.922000	0.55676	0.594000	0.82650	GAT	TBX22	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000122145		0.522	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	104	0.00	0	G	NM_016954		79279632	79279632	+1	no_errors	ENST00000373294	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	0.994	T
TMEM63C	57156	genome.wustl.edu	37	14	77714719	77714719	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr14:77714719T>G	ENST00000298351.4	+	19	1775	c.1631T>G	c.(1630-1632)tTc>tGc	p.F544C		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	544					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		AACGGCGCCTTCTTTGTCAAC	0.567																																						dbGAP											0													49.0	49.0	49.0					14																	77714719		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.1631T>G	14.37:g.77714719T>G	ENSP00000298351:p.Phe544Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Missense_Mutation	SNP	pfam_DUF221	p.F544C	ENST00000298351.4	37	c.1631	CCDS45141.1	14	.	.	.	.	.	.	.	.	.	.	T	16.15	3.041971	0.55003	.	.	ENSG00000165548	ENST00000298351;ENST00000536110	T	0.63255	-0.03	5.29	5.29	0.74685	Domain of unknown function DUF221 (1);	0.045125	0.85682	D	0.000000	T	0.80065	0.4555	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83304	-0.0026	10	0.87932	D	0	-31.1542	15.2256	0.73348	0.0:0.0:0.0:1.0	.	544	Q9P1W3	TM63C_HUMAN	C	544;114	ENSP00000298351:F544C	ENSP00000298351:F544C	F	+	2	0	TMEM63C	76784472	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	7.806000	0.86020	2.009000	0.58944	0.454000	0.30748	TTC	TMEM63C	-	pfam_DUF221	ENSG00000165548		0.567	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63C	HGNC	protein_coding	OTTHUMT00000414193.1	56	0.00	0	T			77714719	77714719	+1	no_errors	ENST00000298351	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	G
TRIM10	10107	genome.wustl.edu	37	6	30122026	30122026	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr6:30122026T>A	ENST00000449742.2	-	7	1241	c.1166A>T	c.(1165-1167)cAg>cTg	p.Q389L	TRIM10_ENST00000376704.3_Intron	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	389	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			ovary(1)	1						CCCCTTCCGCTGCACATCCTC	0.682																																						dbGAP											0													44.0	32.0	36.0					6																	30122026		1510	2707	4217	-	-	-	SO:0001583	missense	0			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.1166A>T	6.37:g.30122026T>A	ENSP00000397073:p.Gln389Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q389L	ENST00000449742.2	37	c.1166	CCDS34375.1	6	.	.	.	.	.	.	.	.	.	.	T	7.904	0.735086	0.15574	.	.	ENSG00000204613	ENST00000449742;ENST00000376706	T	0.69926	-0.44	5.49	-5.73	0.02398	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	1.286820	0.05168	N	0.499100	T	0.27663	0.0680	L	0.27975	0.815	0.09310	N	1	B	0.25007	0.116	B	0.22152	0.038	T	0.10567	-1.0624	10	0.27082	T	0.32	.	12.078	0.53655	0.0:0.1541:0.112:0.7339	.	389	Q9UDY6	TRI10_HUMAN	L	389	ENSP00000397073:Q389L	ENSP00000365896:Q389L	Q	-	2	0	TRIM10	30230005	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.334000	0.02665	-1.719000	0.01382	-1.085000	0.02201	CAG	TRIM10	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000204613		0.682	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	HGNC	protein_coding	OTTHUMT00000076634.1	57	0.00	0	T			30122026	30122026	-1	no_errors	ENST00000449742	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	0.000	A
YY1	7528	genome.wustl.edu	37	14	100741061	100741061	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A13H-01A-11D-A228-09	TCGA-A7-A13H-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2627a43c-a8fc-4f43-8774-746689bf1246	6f9cf2eb-b5fd-4530-a92f-6460811f111f	g.chr14:100741061A>G	ENST00000262238.4	+	3	1129	c.869A>G	c.(868-870)gAt>gGt	p.D290G		NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	290	Involved in nuclear matrix association.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				ATTAAAGAAGATGATGCTCCA	0.348																																						dbGAP											0													86.0	88.0	88.0					14																	100741061		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.869A>G	14.37:g.100741061A>G	ENSP00000262238:p.Asp290Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14935	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.D290G	ENST00000262238.4	37	c.869	CCDS9957.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.92|14.92	2.679332|2.679332	0.47886|0.47886	.|.	.|.	ENSG00000100811|ENSG00000100811	ENST00000262238|ENST00000554804	T|.	0.11821|.	2.74|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.46034|0.46034	0.1372|0.1372	N|N	0.11064|0.11064	0.09|0.09	0.80722|0.80722	D|D	1|1	B|.	0.24317|.	0.101|.	B|.	0.22152|.	0.038|.	T|T	0.43718|0.43718	-0.9374|-0.9374	10|5	0.15499|.	T|.	0.54|.	.|.	16.1297|16.1297	0.81418|0.81418	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	290|.	P25490|.	TYY1_HUMAN|.	G|V	290|119	ENSP00000262238:D290G|.	ENSP00000262238:D290G|.	D|M	+|+	2|1	0|0	YY1|YY1	99810814|99810814	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.691000|8.691000	0.91279|0.91279	2.270000|2.270000	0.75569|0.75569	0.460000|0.460000	0.39030|0.39030	GAT|ATG	YY1	-	pirsf_TF_Yin_yang	ENSG00000100811		0.348	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY1	HGNC	protein_coding	OTTHUMT00000318277.1	24	0.00	0	A	NM_003403		100741061	100741061	+1	no_errors	ENST00000262238	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	G
