#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2ML1	144568	genome.wustl.edu	37	12	8995897	8995897	+	Silent	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr12:8995897G>T	ENST00000299698.7	+	12	1596	c.1416G>T	c.(1414-1416)gtG>gtT	p.V472V	A2ML1_ENST00000539547.1_5'Flank	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						AAGTGCTGGTGGATTATTACA	0.582																																						dbGAP											0													65.0	65.0	65.0					12																	8995897		1938	4145	6083	-	-	-	SO:0001819	synonymous_variant	0			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1416G>T	12.37:g.8995897G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.V472	ENST00000299698.7	37	c.1416	CCDS8596.2	12																																																																																			A2ML1	-	pfam_A2M_N_2	ENSG00000166535		0.582	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	HGNC	protein_coding	OTTHUMT00000250304.3	57	0.00	0	G	NM_144670		8995897	8995897	+1	no_errors	ENST00000299698	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.994	T
ABCC4	10257	genome.wustl.edu	37	13	95830293	95830293	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr13:95830293G>T	ENST00000376887.4	-	12	1712	c.1598C>A	c.(1597-1599)aCc>aAc	p.T533N	ABCC4_ENST00000431522.1_Missense_Mutation_p.T533N|ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000412704.1_Missense_Mutation_p.T533N|ABCC4_ENST00000536256.1_Missense_Mutation_p.T458N	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	533	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	ACTCAGCGTGGTTCCCCGATC	0.483																																						dbGAP											0													169.0	144.0	153.0					13																	95830293		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1598C>A	13.37:g.95830293G>T	ENSP00000366084:p.Thr533Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM	p.T533N	ENST00000376887.4	37	c.1598	CCDS9474.1	13	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352071	0.61183	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27	5.8	5.8	0.92144	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.479111	0.25135	N	0.032875	D	0.90724	0.7089	N	0.12527	0.23	0.24883	N	0.992216	B;B;B;B;B	0.32302	0.332;0.146;0.313;0.293;0.363	B;B;B;B;P	0.48524	0.356;0.181;0.24;0.319;0.58	D	0.84996	0.0897	10	0.72032	D	0.01	.	10.4423	0.44472	0.1436:0.0:0.8564:0.0	.	458;533;533;533;533	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	N	533;533;458;533	ENSP00000388657:T533N;ENSP00000366084:T533N;ENSP00000442024:T458N;ENSP00000398562:T533N	ENSP00000366084:T533N	T	-	2	0	ABCC4	94628294	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	5.334000	0.65923	2.735000	0.93741	0.655000	0.94253	ACC	ABCC4	-	pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000125257		0.483	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2	55	0.00	0	G	NM_005845		95830293	95830293	-1	no_errors	ENST00000376887	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.992	T
ABCC5	10057	genome.wustl.edu	37	3	183639183	183639183	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:183639183C>A	ENST00000334444.6	-	30	4459	c.4219G>T	c.(4219-4221)Gag>Tag	p.E1407*	ABCC5_ENST00000265586.6_Nonsense_Mutation_p.E1364*	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1407	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GTGTCAAACTCCACCACCTGC	0.557																																						dbGAP											0													80.0	87.0	84.0					3																	183639183		2080	4225	6305	-	-	-	SO:0001587	stop_gained	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.4219G>T	3.37:g.183639183C>A	ENSP00000333926:p.Glu1407*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.E1407*	ENST00000334444.6	37	c.4219	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	C	40	8.522563	0.98848	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.0746	17.0977	0.86639	0.0:1.0:0.0:0.0	.	.	.	.	X	1407;1364	.	ENSP00000265586:E1364X	E	-	1	0	ABCC5	185121877	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.670000	0.68088	2.268000	0.75426	0.591000	0.81541	GAG	ABCC5	-	pfscan_ABC_transporter-like	ENSG00000114770		0.557	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1	45	0.00	0	C	NM_005688		183639183	183639183	-1	no_errors	ENST00000334444	ensembl	human	known	69_37n	nonsense	36	10.00	4	SNP	1.000	A
ABCC8	6833	genome.wustl.edu	37	11	17428463	17428463	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:17428463G>T	ENST00000389817.3	-	25	3202	c.3134C>A	c.(3133-3135)cCt>cAt	p.P1045H	ABCC8_ENST00000302539.4_Missense_Mutation_p.P1046H			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1045	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CCTGGCTGCAGGGGTCAGGGT	0.647																																						dbGAP											0													54.0	59.0	57.0					11																	17428463		2200	4293	6493	-	-	-	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3134C>A	11.37:g.17428463G>T	ENSP00000374467:p.Pro1045His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.P1046H	ENST00000389817.3	37	c.3137	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	G	9.752	1.167782	0.21621	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.89485	-2.52;-2.52	5.2	4.3	0.51218	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.550372	0.19193	N	0.120387	D	0.83073	0.5175	N	0.16130	0.375	0.33264	D	0.560155	B	0.29232	0.238	B	0.40101	0.319	D	0.85083	0.0947	10	0.40728	T	0.16	.	11.5564	0.50750	0.082:0.0:0.918:0.0	.	1045	Q09428	ABCC8_HUMAN	H	1045;1046	ENSP00000374467:P1045H;ENSP00000303960:P1046H	ENSP00000303960:P1046H	P	-	2	0	ABCC8	17385039	0.997000	0.39634	0.801000	0.32222	0.005000	0.04900	3.251000	0.51453	1.561000	0.49584	-0.136000	0.14681	CCT	ABCC8	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000006071		0.647	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	42	0.00	0	G	NM_000352		17428463	17428463	-1	no_errors	ENST00000302539	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.763	T
ABCF3	55324	genome.wustl.edu	37	3	183905648	183905648	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:183905648G>T	ENST00000429586.2	+	6	631		c.e6-1		EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Splice_Site	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3						defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCCCTTTAAAGAGTCTTAGAA	0.512																																						dbGAP											0													80.0	83.0	82.0					3																	183905648		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.447-1G>T	3.37:g.183905648G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Splice_Site	SNP	-	e6-1	ENST00000429586.2	37	c.447-1	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516667	0.64634	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	.	.	.	4.57	3.69	0.42338	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5014	0.50439	0.0874:0.0:0.9126:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCF3	185388342	1.000000	0.71417	0.994000	0.49952	0.957000	0.61999	9.593000	0.98250	0.927000	0.37143	0.462000	0.41574	.	ABCF3	-	-	ENSG00000161204		0.512	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	HGNC	protein_coding	OTTHUMT00000346047.1	23	0.00	0	G	NM_018358	Intron	183905648	183905648	+1	no_errors	ENST00000429586	ensembl	human	known	69_37n	splice_site	23	14.81	4	SNP	1.000	T
ADAMTS8	11095	genome.wustl.edu	37	11	130275995	130275995	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:130275995G>T	ENST00000257359.6	-	9	2834	c.2128C>A	c.(2128-2130)Cca>Aca	p.P710T		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	710	Spacer.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GCACCAGCTGGGATGGTGACA	0.552																																						dbGAP											0													49.0	53.0	52.0					11																	130275995		2063	4201	6264	-	-	-	SO:0001583	missense	0			AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.2128C>A	11.37:g.130275995G>T	ENSP00000257359:p.Pro710Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZS0	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS8,prints_Peptidase_M12B_ADAM-TS	p.P710T	ENST00000257359.6	37	c.2128	CCDS41732.1	11	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644395	0.87859	.	.	ENSG00000134917	ENST00000531752;ENST00000257359;ENST00000414575	D	0.85861	-2.04	5.35	5.35	0.76521	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	D	0.95046	0.8396	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96314	0.9231	10	0.87932	D	0	.	19.0627	0.93099	0.0:0.0:1.0:0.0	.	710;191	Q9UP79;B3KVX9	ATS8_HUMAN;.	T	108;710;739	ENSP00000257359:P710T	ENSP00000257359:P710T	P	-	1	0	ADAMTS8	129781205	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.499000	0.84300	0.467000	0.42956	CCA	ADAMTS8	-	pfam_ADAM_spacer1	ENSG00000134917		0.552	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS8	HGNC	protein_coding	OTTHUMT00000385636.1	52	0.00	0	G	NM_007037		130275995	130275995	-1	no_errors	ENST00000257359	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	T
AIPL1	23746	genome.wustl.edu	37	17	6338271	6338271	+	Intron	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:6338271C>T	ENST00000381129.3	-	1	177				AIPL1_ENST00000576776.1_Intron|AIPL1_ENST00000570466.1_Intron|AIPL1_ENST00000575265.1_Intron|AIPL1_ENST00000250087.5_Intron|AIPL1_ENST00000576307.1_Intron|AIPL1_ENST00000574506.1_Intron|AIPL1_ENST00000571740.1_Intron	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1						negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		TGGGGCACACCTGGAATGTTG	0.627																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.96+57G>A	17.37:g.6338271C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	NULL	p.G52S	ENST00000381129.3	37	c.154	CCDS11075.1	17																																																																																			AIPL1	-	NULL	ENSG00000129221		0.627	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AIPL1	HGNC	protein_coding	OTTHUMT00000219828.3	79	0.00	0	C	NM_014336		6338271	6338271	-1	no_errors	ENST00000381128	ensembl	human	known	69_37n	missense	139	12.03	19	SNP	0.000	T
ANK2	287	genome.wustl.edu	37	4	114279050	114279050	+	Silent	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr4:114279050G>T	ENST00000357077.4	+	38	9329	c.9276G>T	c.(9274-9276)ggG>ggT	p.G3092G	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Silent_p.G3059G|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3092					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGAAGAGGGGACCCCAACAA	0.458																																						dbGAP											0													55.0	57.0	56.0					4																	114279050		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9276G>T	4.37:g.114279050G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.G3092	ENST00000357077.4	37	c.9276	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.458	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	35	0.00	0	G	NM_001148		114279050	114279050	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	1.000	T
ANK2	287	genome.wustl.edu	37	4	114279308	114279308	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr4:114279308G>T	ENST00000357077.4	+	38	9587	c.9534G>T	c.(9532-9534)gaG>gaT	p.E3178D	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.E3145D|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3178					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGGATGATGAGGCAGACTTAC	0.473																																						dbGAP											0													63.0	61.0	62.0					4																	114279308		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9534G>T	4.37:g.114279308G>T	ENSP00000349588:p.Glu3178Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.E3178D	ENST00000357077.4	37	c.9534	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	8.159	0.789060	0.16258	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.96136	-0.25;-0.27;-3.92	5.54	-0.231	0.13086	.	0.446291	0.20726	N	0.086814	D	0.90772	0.7103	M	0.62723	1.935	0.35463	D	0.796709	B;B	0.15141	0.012;0.01	B;B	0.13407	0.007;0.009	T	0.80248	-0.1461	10	0.33141	T	0.24	.	1.092	0.01665	0.4924:0.1272:0.1357:0.2447	.	3145;3178	Q01484;Q01484-4	ANK2_HUMAN;.	D	3178;3145;188	ENSP00000349588:E3178D;ENSP00000264366:E3145D;ENSP00000422498:E188D	ENSP00000264366:E3145D	E	+	3	2	ANK2	114498757	0.168000	0.22989	0.874000	0.34290	0.956000	0.61745	0.158000	0.16422	-0.192000	0.10432	-0.440000	0.05779	GAG	ANK2	-	NULL	ENSG00000145362		0.473	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	55	0.00	0	G	NM_001148		114279308	114279308	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.080	T
ANKDD1A	348094	genome.wustl.edu	37	15	65236873	65236873	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:65236873G>T	ENST00000380230.3	+	12	1119	c.1090G>T	c.(1090-1092)Gct>Tct	p.A364S	ANKDD1A_ENST00000357698.3_Intron|ANKDD1A_ENST00000395720.1_Missense_Mutation_p.A364S|ANKDD1A_ENST00000395723.1_Intron	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	364					signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						CCTGGCAGTGGCTGTCCGCAG	0.512																																						dbGAP											0													76.0	68.0	71.0					15																	65236873		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.1090G>T	15.37:g.65236873G>T	ENSP00000369579:p.Ala364Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,prints_Ankyrin_rpt	p.A364S	ENST00000380230.3	37	c.1090	CCDS10197.2	15	.	.	.	.	.	.	.	.	.	.	G	32	5.148488	0.94603	.	.	ENSG00000166839	ENST00000380230;ENST00000395720	D;D	0.81579	-1.51;-1.51	5.23	5.23	0.72850	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000018	D	0.89798	0.6819	M	0.77712	2.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90430	0.4423	10	0.66056	D	0.02	-18.7576	17.5635	0.87913	0.0:0.0:1.0:0.0	.	364	Q495B1	AKD1A_HUMAN	S	364	ENSP00000369579:A364S;ENSP00000379070:A364S	ENSP00000369579:A364S	A	+	1	0	ANKDD1A	63023926	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.228000	0.95250	2.734000	0.93682	0.591000	0.81541	GCT	ANKDD1A	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000166839		0.512	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKDD1A	HGNC	protein_coding	OTTHUMT00000256705.2	34	0.00	0	G	NM_182703		65236873	65236873	+1	no_errors	ENST00000380230	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	T
APOL4	80832	genome.wustl.edu	37	22	36587666	36587666	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:36587666delA	ENST00000352371.1	-	6	734	c.510delT	c.(508-510)attfs	p.I170fs	APOL4_ENST00000404685.3_3'UTR|APOL4_ENST00000429038.2_3'UTR|APOL4_ENST00000332987.1_Frame_Shift_Del_p.I167fs|APOL4_ENST00000405511.1_3'UTR|APOL4_ENST00000479929.1_5'UTR			Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	171					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)			lung(1)	1						CAGCTGCAGTAATGCTCAGGC	0.567																																						dbGAP											0													50.0	52.0	51.0					22																	36587666		2198	4297	6495	-	-	-	SO:0001589	frameshift_variant	0			AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000352371.1:c.510delT	22.37:g.36587666delA	ENSP00000338260:p.Ile170fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQ37|Q9BXQ8	Frame_Shift_Del	DEL	pfam_ApoL	p.T171fs	ENST00000352371.1	37	c.510		22																																																																																			APOL4	-	pfam_ApoL	ENSG00000100336		0.567	APOL4-203	KNOWN	basic|appris_candidate_longest	protein_coding	APOL4	HGNC	protein_coding		60	0.00	0	A	NM_145660		36587666	36587666	-1	no_errors	ENST00000352371	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	0.000	-
ARCN1	372	genome.wustl.edu	37	11	118454639	118454639	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:118454639G>T	ENST00000264028.4	+	4	658	c.563G>T	c.(562-564)aGc>aTc	p.S188I	ARCN1_ENST00000359415.4_Missense_Mutation_p.S229I|ARCN1_ENST00000392859.3_Missense_Mutation_p.S100I|ARCN1_ENST00000534182.2_Intron	NM_001655.4	NP_001646.2	P48444	COPD_HUMAN	archain 1	188					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer maturation (GO:0021691)|COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pigmentation (GO:0043473)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	clathrin adaptor complex (GO:0030131)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|urinary_tract(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GGATTTGGCAGCTCTGCAGTA	0.498																																						dbGAP											0													109.0	96.0	100.0					11																	118454639		2200	4295	6495	-	-	-	SO:0001583	missense	0			X81197	CCDS8400.1, CCDS44749.1	11q23.3	2010-04-21	2003-01-29		ENSG00000095139	ENSG00000095139			649	protein-coding gene	gene with protein product		600820	"""coatomer protein complex, subunit delta"""	COPD		7782067, 8854871	Standard	NM_001655		Approved		uc001ptq.3	P48444	OTTHUMG00000166340	ENST00000264028.4:c.563G>T	11.37:g.118454639G>T	ENSP00000264028:p.Ser188Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1X2|E9PEU4|Q52M80	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pfscan_Clathrin_mu_C	p.S188I	ENST00000264028.4	37	c.563	CCDS8400.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.106397	0.94292	.	.	ENSG00000095139	ENST00000392859;ENST00000359415;ENST00000264028	T;T;T	0.57907	0.37;0.37;0.37	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.71736	0.3375	M	0.79693	2.465	0.80722	D	1	P;D;P	0.61697	0.94;0.99;0.933	P;P;P	0.57679	0.658;0.825;0.564	T	0.70749	-0.4787	10	0.44086	T	0.13	-10.2991	20.1358	0.98028	0.0:0.0:1.0:0.0	.	100;229;188	E9PEU4;B0YIW6;P48444	.;.;COPD_HUMAN	I	100;229;188	ENSP00000376599:S100I;ENSP00000352385:S229I;ENSP00000264028:S188I	ENSP00000264028:S188I	S	+	2	0	ARCN1	117959849	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.387000	0.79785	2.865000	0.98341	0.655000	0.94253	AGC	ARCN1	-	NULL	ENSG00000095139		0.498	ARCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARCN1	HGNC	protein_coding	OTTHUMT00000389278.1	23	0.00	0	G			118454639	118454639	+1	no_errors	ENST00000264028	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
ARHGAP4	393	genome.wustl.edu	37	X	153174928	153174928	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:153174928delC	ENST00000350060.5	-	20	2517	c.2476delG	c.(2476-2478)gagfs	p.E826fs	ARHGAP4_ENST00000467421.1_5'Flank|ARHGAP4_ENST00000370016.1_Frame_Shift_Del_p.E805fs|ARHGAP4_ENST00000537206.1_Frame_Shift_Del_p.E803fs|ARHGAP4_ENST00000370028.3_Frame_Shift_Del_p.E866fs|ARHGAP4_ENST00000393721.1_Frame_Shift_Del_p.E648fs	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	826					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGAGGCCCTCGGGACTGCTC	0.672																																						dbGAP											0													34.0	31.0	32.0					X																	153174928		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0			X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2476delG	X.37:g.153174928delC	ENSP00000203786:p.Glu826fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14144|Q86UY3	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E826fs	ENST00000350060.5	37	c.2476	CCDS14736.1	X																																																																																			ARHGAP4	-	NULL	ENSG00000089820		0.672	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGAP4	HGNC	protein_coding	OTTHUMT00000061119.1	32	0.00	0	C	NM_001666		153174928	153174928	-1	no_errors	ENST00000350060	ensembl	human	known	69_37n	frame_shift_del	5	22.22	2	DEL	0.038	-
ARPC5L	81873	genome.wustl.edu	37	9	127631656	127631658	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:127631656_127631658delGGC	ENST00000353214.2	+	3	1339_1341	c.87_89delGGC	c.(85-90)gaggcg>gag	p.A35del	ARPC5L_ENST00000259477.6_In_Frame_Del_p.A35del			Q9BPX5	ARP5L_HUMAN	actin related protein 2/3 complex, subunit 5-like	35					regulation of actin filament polymerization (GO:0030833)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)				large_intestine(2)|lung(1)	3						AGCAGGAGGAggcggcggcggcg	0.714																																						dbGAP											0										36,2486		5,26,1230						3.9	1.0			7	68,4732		8,52,2340	no	coding	ARPC5L	NM_030978.1		13,78,3570	A1A1,A1R,RR		1.4167,1.4274,1.4204				104,7218				-	-	-	SO:0001651	inframe_deletion	0			AF087842	CCDS6859.1	9q34.11	2011-07-06			ENSG00000136950	ENSG00000136950		"""Actin related protein 2/3 complex subunits"""	23366	protein-coding gene	gene with protein product							Standard	NM_030978		Approved	MGC3038, ARC16-2	uc004bpa.4	Q9BPX5	OTTHUMG00000020660	ENST00000353214.2:c.87_89delGGC	9.37:g.127631665_127631667delGGC	ENSP00000345361:p.Ala35del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z523	In_Frame_Del	DEL	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc	p.A33in_frame_del	ENST00000353214.2	37	c.87_89	CCDS6859.1	9																																																																																			ARPC5L	-	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc	ENSG00000136950		0.714	ARPC5L-002	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	ARPC5L	HGNC	protein_coding	OTTHUMT00000054041.1	9	0.00	0	GGC	NM_030978		127631656	127631658	+1	no_errors	ENST00000259477	ensembl	human	known	69_37n	in_frame_del	7	22.22	2	DEL	1.000:1.000:1.000	-
ASIC2	40	genome.wustl.edu	37	17	32483404	32483404	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr17:32483404C>T	ENST00000359872.6	-	1	909	c.148G>A	c.(148-150)Gtg>Atg	p.V50M		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	50					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.V50M(1)								Amiloride(DB00594)	AGAGAGCCCACGAAGGCCACT	0.592																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											48.0	53.0	52.0					17																	32483404		2203	4298	6501	-	-	-	SO:0001583	missense	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.148G>A	17.37:g.32483404C>T	ENSP00000352934:p.Val50Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.V50M	ENST00000359872.6	37	c.148	CCDS42296.1	17	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668593	0.29604	.	.	ENSG00000108684	ENST00000359872	T	0.65549	-0.16	4.96	1.72	0.24424	.	.	.	.	.	T	0.39172	0.1068	N	0.15975	0.35	0.21933	N	0.999462	B	0.30114	0.269	B	0.22753	0.041	T	0.25433	-1.0132	9	0.54805	T	0.06	.	5.8652	0.18771	0.0:0.592:0.0:0.408	.	50	Q16515	ACCN1_HUMAN	M	50	ENSP00000352934:V50M	ENSP00000352934:V50M	V	-	1	0	ACCN1	29507517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.332000	0.33805	0.681000	0.31386	-0.126000	0.14955	GTG	ASIC2	-	pfam_Na+channel_ASC,prints_Na+channel_ASC	ENSG00000108684		0.592	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	29	0.00	0	C	NM_183377, NM_001094		32483404	32483404	-1	overly_large_intron	ENST00000359872	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	1.000	T
ASIC2	40	genome.wustl.edu	37	17	32483404	32483404	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:32483404C>T	ENST00000359872.6	-	1	909	c.148G>A	c.(148-150)Gtg>Atg	p.V50M		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	50					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.V50M(1)								Amiloride(DB00594)	AGAGAGCCCACGAAGGCCACT	0.592																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											48.0	53.0	52.0					17																	32483404		2203	4298	6501	-	-	-	SO:0001583	missense	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.148G>A	17.37:g.32483404C>T	ENSP00000352934:p.Val50Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.V50M	ENST00000359872.6	37	c.148	CCDS42296.1	17	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668593	0.29604	.	.	ENSG00000108684	ENST00000359872	T	0.65549	-0.16	4.96	1.72	0.24424	.	.	.	.	.	T	0.39172	0.1068	N	0.15975	0.35	0.21933	N	0.999462	B	0.30114	0.269	B	0.22753	0.041	T	0.25433	-1.0132	9	0.54805	T	0.06	.	5.8652	0.18771	0.0:0.592:0.0:0.408	.	50	Q16515	ACCN1_HUMAN	M	50	ENSP00000352934:V50M	ENSP00000352934:V50M	V	-	1	0	ACCN1	29507517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.332000	0.33805	0.681000	0.31386	-0.126000	0.14955	GTG	ASIC2	-	pfam_Na+channel_ASC,prints_Na+channel_ASC	ENSG00000108684		0.592	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	49	0.00	0	C	NM_183377, NM_001094		32483404	32483404	-1	overly_large_intron	ENST00000359872	ensembl	human	known	69_37n	missense	81	45.64	68	SNP	1.000	T
ASIC2	40	genome.wustl.edu	37	17	32483404	32483404	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:32483404C>T	ENST00000359872.6	-	1	909	c.148G>A	c.(148-150)Gtg>Atg	p.V50M		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	50					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.V50M(1)								Amiloride(DB00594)	AGAGAGCCCACGAAGGCCACT	0.592																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											48.0	53.0	52.0					17																	32483404		2203	4298	6501	-	-	-	SO:0001583	missense	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.148G>A	17.37:g.32483404C>T	ENSP00000352934:p.Val50Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.V50M	ENST00000359872.6	37	c.148	CCDS42296.1	17	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668593	0.29604	.	.	ENSG00000108684	ENST00000359872	T	0.65549	-0.16	4.96	1.72	0.24424	.	.	.	.	.	T	0.39172	0.1068	N	0.15975	0.35	0.21933	N	0.999462	B	0.30114	0.269	B	0.22753	0.041	T	0.25433	-1.0132	9	0.54805	T	0.06	.	5.8652	0.18771	0.0:0.592:0.0:0.408	.	50	Q16515	ACCN1_HUMAN	M	50	ENSP00000352934:V50M	ENSP00000352934:V50M	V	-	1	0	ACCN1	29507517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.332000	0.33805	0.681000	0.31386	-0.126000	0.14955	GTG	ASIC2	-	pfam_Na+channel_ASC,prints_Na+channel_ASC	ENSG00000108684		0.592	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	49	0.00	0	C	NM_183377, NM_001094		32483404	32483404	-1	overly_large_intron	ENST00000359872	ensembl	human	known	69_37n	missense	27	46.00	23	SNP	1.000	T
BAP1	8314	genome.wustl.edu	37	3	52437315	52437315	+	Splice_Site	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:52437315C>A	ENST00000460680.1	-	14	2201		c.e14-1		BAP1_ENST00000296288.5_Splice_Site	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)						anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TTCCCACCCTCTGGGAAGAGA	0.597			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)	dbGAP		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	1	Unknown(1)	prostate(1)											60.0	58.0	58.0					3																	52437315		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1730-1G>T	3.37:g.52437315C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Splice_Site	SNP	-	e14-1	ENST00000460680.1	37	c.1730-1	CCDS2853.1	3	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126251	0.37533	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000478368	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.538	0.91018	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BAP1	52412355	1.000000	0.71417	0.960000	0.40013	0.736000	0.42039	3.036000	0.49767	2.809000	0.96659	0.655000	0.94253	.	BAP1	-	-	ENSG00000163930		0.597	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAP1	HGNC	protein_coding	OTTHUMT00000350895.1	77	0.00	0	C		Intron	52437315	52437315	-1	no_errors	ENST00000460680	ensembl	human	known	69_37n	splice_site	28	12.50	4	SNP	0.985	A
BCAS3	54828	genome.wustl.edu	37	17	59465991	59465991	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:59465991G>A	ENST00000589222.1	+	25	2740	c.2672G>A	c.(2671-2673)gGa>gAa	p.G891E	BCAS3_ENST00000585744.1_Intron|BCAS3_ENST00000588462.1_Intron|BCAS3_ENST00000588874.1_Intron|BCAS3_ENST00000408905.3_Intron|BCAS3_ENST00000407086.3_Intron|BCAS3_ENST00000585812.1_Intron|RP11-332H18.5_ENST00000585765.1_RNA|BCAS3_ENST00000390652.5_Intron					breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			AAAAAAAAAGGAAAAAAAAAA	0.428																																						dbGAP											0													7.0	6.0	6.0					17																	59465991		852	1934	2786	-	-	-	SO:0001583	missense	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000589222.1:c.2672G>A	17.37:g.59465991G>A	ENSP00000466078:p.Gly891Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BCAS3,pfam_WD40_repeat	p.G891E	ENST00000589222.1	37	c.2672		17	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347890	0.82022	.	.	ENSG00000141376	ENST00000340746	.	.	.	5.78	4.81	0.61882	.	.	.	.	.	T	0.64681	0.2620	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65150	-0.6238	5	0.45353	T	0.12	.	11.0878	0.48097	0.0854:0.0:0.9146:0.0	.	.	.	.	K	25	.	ENSP00000342898:E25K	E	+	1	0	BCAS3	56820773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.745000	0.62125	1.591000	0.50007	0.655000	0.94253	GAA	BCAS3	-	NULL	ENSG00000141376		0.428	BCAS3-004	KNOWN	basic	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449571.1	48	0.00	0	G	NM_017679		59465991	59465991	+1	no_errors	ENST00000589222	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	1.000	A
C19orf66	55337	genome.wustl.edu	37	19	10202760	10202760	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:10202760G>T	ENST00000253110.11	+	8	956	c.658G>T	c.(658-660)Ggg>Tgg	p.G220W	C19orf66_ENST00000591813.1_Missense_Mutation_p.G184W|CTD-2240E14.4_ENST00000589622.1_RNA|C19orf66_ENST00000397881.3_Missense_Mutation_p.G169W	NM_018381.2	NP_060851.2	Q9NUL5	CS066_HUMAN	chromosome 19 open reading frame 66	220										large_intestine(3)|skin(1)	4						CCACGTGCCTGGGACATCCTG	0.637																																						dbGAP											0													80.0	95.0	90.0					19																	10202760		2058	4195	6253	-	-	-	SO:0001583	missense	0				CCDS45957.1	19p13.2	2012-10-26			ENSG00000130813	ENSG00000130813			25649	protein-coding gene	gene with protein product						12477932	Standard	NM_018381		Approved	FLJ11286	uc002mmu.4	Q9NUL5		ENST00000253110.11:c.658G>T	19.37:g.10202760G>T	ENSP00000253110:p.Gly220Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQT9|Q4G188|Q8IYH6|Q8N8V1	Missense_Mutation	SNP	NULL	p.G220W	ENST00000253110.11	37	c.658	CCDS45957.1	19	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693587	0.68386	.	.	ENSG00000130813	ENST00000253110;ENST00000397881	.	.	.	3.9	3.9	0.45041	.	0.089147	0.43110	D	0.000616	T	0.65186	0.2667	L	0.29908	0.895	0.54753	D	0.999983	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.984;1.0;1.0	T	0.70389	-0.4885	9	0.87932	D	0	-21.2974	14.8751	0.70488	0.0:0.0:1.0:0.0	.	169;184;220	Q9NUL5-2;Q9NUL5-4;Q9NUL5	.;.;CS066_HUMAN	W	220;169	.	ENSP00000253110:G220W	G	+	1	0	C19orf66	10063760	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.476000	0.66793	2.012000	0.59069	0.306000	0.20318	GGG	C19orf66	-	NULL	ENSG00000130813		0.637	C19orf66-001	KNOWN	basic|CCDS	protein_coding	C19orf66	HGNC	protein_coding	OTTHUMT00000451129.1	60	0.00	0	G	NM_018381		10202760	10202760	+1	no_errors	ENST00000253110	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
C20orf141	128653	genome.wustl.edu	37	20	2796188	2796188	+	Missense_Mutation	SNP	G	G	T	rs386352285		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:2796188G>T	ENST00000380589.4	+	2	439	c.265G>T	c.(265-267)Gca>Tca	p.A89S	TMEM239_ENST00000380593.4_Intron|TMEM239_ENST00000380585.1_5'Flank|C20orf141_ENST00000603872.1_Missense_Mutation_p.A89S|TMEM239_ENST00000554164.1_Intron|TMEM239_ENST00000361033.1_5'Flank	NM_080739.2	NP_542777.1	Q9NUB4	CT141_HUMAN	chromosome 20 open reading frame 141	89	Leu-rich.					integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	10						CCACAGGCCCGCAGGTCACAC	0.632																																						dbGAP											0													38.0	34.0	36.0					20																	2796188		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13034.1	20p13	2012-10-30			ENSG00000258713	ENSG00000258713			16134	protein-coding gene	gene with protein product							Standard	NM_001256538		Approved	dJ860F19.4	uc002wgw.3	Q9NUB4	OTTHUMG00000031707	ENST00000380589.4:c.265G>T	20.37:g.2796188G>T	ENSP00000369963:p.Ala89Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A89S	ENST00000380589.4	37	c.265	CCDS13034.1	20	.	.	.	.	.	.	.	.	.	.	G	9.885	1.202563	0.22121	.	.	ENSG00000258713	ENST00000380589	.	.	.	3.9	-4.63	0.03359	.	.	.	.	.	T	0.11495	0.0280	N	0.08118	0	0.09310	N	1	P	0.42203	0.773	B	0.35073	0.195	T	0.21109	-1.0255	8	0.54805	T	0.06	-1.4415	6.1302	0.20201	0.6019:0.154:0.2441:0.0	.	89	Q9NUB4	CT141_HUMAN	S	89	.	ENSP00000369963:A89S	A	+	1	0	AL035460.3	2744188	0.000000	0.05858	0.001000	0.08648	0.667000	0.39255	-1.404000	0.02494	-0.642000	0.05480	-0.346000	0.07831	GCA	C20orf141	-	NULL	ENSG00000258713		0.632	C20orf141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf141	Clone_based_vega_gene	protein_coding	OTTHUMT00000077644.2	30	0.00	0	G	NM_080739		2796188	2796188	+1	no_errors	ENST00000380589	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.000	T
C2CD3	26005	genome.wustl.edu	37	11	73804874	73804874	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:73804874C>A	ENST00000334126.7	-	18	3557	c.3331G>T	c.(3331-3333)Gaa>Taa	p.E1111*	C2CD3_ENST00000313663.7_Nonsense_Mutation_p.E1111*			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1111					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CACCAGATTTCAAACTGGACT	0.517																																						dbGAP											0													73.0	65.0	68.0					11																	73804874		2200	4293	6493	-	-	-	SO:0001587	stop_gained	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.3331G>T	11.37:g.73804874C>A	ENSP00000334379:p.Glu1111*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.E1111*	ENST00000334126.7	37	c.3331		11	.	.	.	.	.	.	.	.	.	.	C	44	11.128850	0.99520	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.4621	19.9618	0.97254	0.0:1.0:0.0:0.0	.	.	.	.	X	1111	.	ENSP00000323339:E1111X	E	-	1	0	C2CD3	73482522	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.571000	0.82399	2.894000	0.99253	0.655000	0.94253	GAA	C2CD3	-	smart_C2_Ca-dep	ENSG00000168014		0.517	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		46	0.00	0	C	NM_015531		73804874	73804874	-1	no_errors	ENST00000334126	ensembl	human	known	69_37n	nonsense	25	10.71	3	SNP	1.000	A
C2orf16	84226	genome.wustl.edu	37	2	27801350	27801350	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:27801350G>T	ENST00000408964.2	+	1	1962	c.1911G>T	c.(1909-1911)agG>agT	p.R637S		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	637						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TACTTCCAAGGCCACATCTTC	0.423																																						dbGAP											0													94.0	88.0	90.0					2																	27801350		1869	4113	5982	-	-	-	SO:0001583	missense	0			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.1911G>T	2.37:g.27801350G>T	ENSP00000386190:p.Arg637Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.R637S	ENST00000408964.2	37	c.1911	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	G	10.26	1.300142	0.23650	.	.	ENSG00000221843	ENST00000408964	T	0.08008	3.14	4.52	1.66	0.24008	.	.	.	.	.	T	0.06826	0.0174	N	0.14661	0.345	0.09310	N	1	P	0.50819	0.939	P	0.48425	0.577	T	0.34502	-0.9826	9	0.41790	T	0.15	.	6.2991	0.21103	0.3311:0.0:0.6689:0.0	.	637	Q68DN1	CB016_HUMAN	S	637	ENSP00000386190:R637S	ENSP00000386190:R637S	R	+	3	2	C2orf16	27654854	0.000000	0.05858	0.000000	0.03702	0.179000	0.23085	0.031000	0.13710	0.221000	0.20879	0.511000	0.50034	AGG	C2orf16	-	NULL	ENSG00000221843		0.423	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	45	0.00	0	G	NM_032266		27801350	27801350	+1	no_errors	ENST00000408964	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.000	T
FOXL2NB	401089	genome.wustl.edu	37	3	138669374	138669374	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:138669374G>T	ENST00000383165.3	+	3	619	c.488G>T	c.(487-489)cGg>cTg	p.R163L		NM_001040061.2	NP_001035150.1	Q6ZUU3	FOXNB_HUMAN		163										large_intestine(1)|lung(3)	4						TGGCCTCTGCGGTGCTTGGCT	0.597																																						dbGAP											0													82.0	92.0	89.0					3																	138669374		2022	4192	6214	-	-	-	SO:0001583	missense	0																														ENST00000383165.3:c.488G>T	3.37:g.138669374G>T	ENSP00000372651:p.Arg163Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGX0	Missense_Mutation	SNP	NULL	p.R163L	ENST00000383165.3	37	c.488	CCDS43155.1	3	.	.	.	.	.	.	.	.	.	.	G	9.196	1.027346	0.19512	.	.	ENSG00000206262	ENST00000383165	.	.	.	3.6	-7.19	0.01500	.	.	.	.	.	T	0.14830	0.0358	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.23119	-1.0197	8	0.87932	D	0	.	0.4314	0.00472	0.3475:0.206:0.2397:0.2068	.	163	Q6ZUU3	CC072_HUMAN	L	163	.	ENSP00000372651:R163L	R	+	2	0	C3orf72	140152064	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.798000	0.01747	-2.457000	0.00539	-2.110000	0.00354	CGG	C3orf72	-	NULL	ENSG00000206262		0.597	C3orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf72	HGNC	protein_coding	OTTHUMT00000357986.1	70	0.00	0	G			138669374	138669374	+1	no_errors	ENST00000383165	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	0.000	T
C5orf52	100190949	genome.wustl.edu	37	5	157098750	157098750	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr5:157098750G>T	ENST00000409999.3	+	1	190	c.128G>T	c.(127-129)gGc>gTc	p.G43V	SOX30_ENST00000519442.1_5'Flank	NM_001145132.1	NP_001138604.1	A6NGY3	CE052_HUMAN	chromosome 5 open reading frame 52	43										endometrium(2)|lung(1)	3						GATAGACTCGGCCGCCGCCCA	0.692																																						dbGAP											0													8.0	13.0	12.0					5																	157098750		683	1572	2255	-	-	-	SO:0001583	missense	0			BG721329	CCDS47329.1	5q33.3	2012-02-24			ENSG00000187658	ENSG00000187658			35121	protein-coding gene	gene with protein product							Standard	NM_001145132		Approved		uc011ddt.2	A6NGY3	OTTHUMG00000154518	ENST00000409999.3:c.128G>T	5.37:g.157098750G>T	ENSP00000387027:p.Gly43Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G43V	ENST00000409999.3	37	c.128	CCDS47329.1	5	.	.	.	.	.	.	.	.	.	.	G	6.391	0.440287	0.12104	.	.	ENSG00000187658	ENST00000409999	T	0.31510	1.49	0.946	-0.892	0.10570	.	.	.	.	.	T	0.16041	0.0386	N	0.24115	0.695	0.09310	N	0.999999	B	0.29552	0.248	B	0.26202	0.067	T	0.18903	-1.0322	9	0.45353	T	0.12	-3.0231	3.2944	0.06961	0.6006:0.0:0.3994:0.0	.	43	A6NGY3	CE052_HUMAN	V	43	ENSP00000387027:G43V	ENSP00000387027:G43V	G	+	2	0	C5orf52	157031328	.	.	0.001000	0.08648	0.020000	0.10135	.	.	-0.341000	0.08376	0.313000	0.20887	GGC	C5orf52	-	NULL	ENSG00000187658		0.692	C5orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf52	HGNC	protein_coding	OTTHUMT00000335664.1	26	0.00	0	G	NM_001145132		157098750	157098750	+1	no_errors	ENST00000409999	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.001	T
C9orf117	286207	genome.wustl.edu	37	9	130473553	130473553	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:130473553G>T	ENST00000373295.2	+	4	673	c.633G>T	c.(631-633)gaG>gaT	p.E211D	C9orf117_ENST00000373293.5_5'Flank	NM_001012502.2	NP_001012520.2	Q5JU67	CI117_HUMAN	chromosome 9 open reading frame 117	211										breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						TGGCCAATGAGTTCCACAAGG	0.592																																						dbGAP											0													57.0	58.0	58.0					9																	130473553		2000	4170	6170	-	-	-	SO:0001583	missense	0			AK094948	CCDS43878.1	9q34.11	2012-04-02			ENSG00000160401	ENSG00000160401			27843	protein-coding gene	gene with protein product							Standard	NM_001012502		Approved		uc004brn.1	Q5JU67	OTTHUMG00000020709	ENST00000373295.2:c.633G>T	9.37:g.130473553G>T	ENSP00000362392:p.Glu211Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8T9	Missense_Mutation	SNP	NULL	p.E211D	ENST00000373295.2	37	c.633	CCDS43878.1	9	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621179	0.28889	.	.	ENSG00000160401	ENST00000373295	T	0.45276	0.9	5.56	0.453	0.16639	.	0.050502	0.85682	N	0.000000	T	0.33059	0.0850	M	0.76328	2.33	0.80722	D	1	P	0.43788	0.817	B	0.38378	0.272	T	0.09443	-1.0674	10	0.46703	T	0.11	-27.3515	1.3323	0.02137	0.3096:0.1372:0.4118:0.1413	.	211	Q5JU67	CI117_HUMAN	D	211	ENSP00000362392:E211D	ENSP00000362392:E211D	E	+	3	2	C9orf117	129513374	1.000000	0.71417	0.447000	0.26932	0.163000	0.22366	1.846000	0.39289	-0.183000	0.10585	-0.266000	0.10368	GAG	C9orf117	-	NULL	ENSG00000160401		0.592	C9orf117-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C9orf117	HGNC	protein_coding	OTTHUMT00000054215.2	39	0.00	0	G	NM_001012502		130473553	130473553	+1	no_errors	ENST00000373295	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	0.995	T
CAST	831	genome.wustl.edu	37	5	96103618	96103618	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr5:96103618C>T	ENST00000341926.3	+	27	2096	c.1934C>T	c.(1933-1935)gCa>gTa	p.A645V	CAST_ENST00000395813.1_Missense_Mutation_p.A728V|CAST_ENST00000511049.1_Missense_Mutation_p.A630V|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000309190.5_Missense_Mutation_p.A623V|CAST_ENST00000510756.1_Missense_Mutation_p.A706V|CAST_ENST00000508608.1_Missense_Mutation_p.A691V|CAST_ENST00000338252.3_Missense_Mutation_p.A632V|CAST_ENST00000511782.1_Missense_Mutation_p.A631V|CAST_ENST00000504465.1_Missense_Mutation_p.A573V|CAST_ENST00000508579.1_Missense_Mutation_p.A360V|CAST_ENST00000508830.1_Missense_Mutation_p.A728V|CAST_ENST00000359176.4_Missense_Mutation_p.A709V|CAST_ENST00000515663.1_Missense_Mutation_p.A368V|CAST_ENST00000509903.1_Missense_Mutation_p.A610V|ERAP1_ENST00000296754.3_Intron|CAST_ENST00000325674.7_Missense_Mutation_p.A693V|CAST_ENST00000395812.2_Missense_Mutation_p.A687V			P20810	ICAL_HUMAN	calpastatin	645					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		CAGAAACCTGCAGATGACCAA	0.433																																						dbGAP											0													83.0	81.0	81.0					5																	96103618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.1934C>T	5.37:g.96103618C>T	ENSP00000339914:p.Ala645Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Nonsense_Mutation	SNP	pfam_Prot_inh_calpain	p.Q397*	ENST00000341926.3	37	c.1189		5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.92|10.92	1.485812|1.485812	0.26686|0.26686	.|.	.|.	ENSG00000153113|ENSG00000153113	ENST00000338252;ENST00000508830;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508579;ENST00000515663|ENST00000437034	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.17854|.	2.28;2.25;2.25;2.25;2.25;2.26;2.26;2.26;2.26;2.26;2.26;2.27;2.26;2.26;2.29;2.27|.	4.85|4.85	-3.16|-3.16	0.05217|0.05217	.|.	1.472730|.	0.03637|.	N|.	0.238836|.	T|.	0.33147|.	0.0853|.	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B;P;B;B;P;B;B;B;B|.	0.48503|.	0.0;0.0;0.035;0.263;0.035;0.0;0.0;0.0;0.911;0.0;0.001;0.551;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B|.	0.41946|.	0.001;0.001;0.018;0.071;0.018;0.001;0.001;0.002;0.371;0.001;0.002;0.149;0.002;0.001;0.001;0.002|.	T|.	0.37033|.	-0.9723|.	10|.	0.29301|.	T|.	0.29|.	0.0|0.0	4.3821|4.3821	0.11299|0.11299	0.3841:0.2471:0.3005:0.0683|0.3841:0.2471:0.3005:0.0683	.|.	573;691;368;396;367;630;610;623;604;645;693;687;709;706;728;632|.	E9PDE4;B7Z468;E7EQA0;Q86YM9;E7EPY6;E7EVY3;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2|.	.;.;.;.;.;.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.|.	V|X	632;728;728;709;693;687;706;691;645;630;623;573;610;631;360;368|397	ENSP00000343421:A632V;ENSP00000425721:A728V;ENSP00000379158:A728V;ENSP00000352098:A709V;ENSP00000320319:A693V;ENSP00000379157:A687V;ENSP00000422176:A706V;ENSP00000422677:A691V;ENSP00000339914:A645V;ENSP00000421130:A630V;ENSP00000312523:A623V;ENSP00000425670:A573V;ENSP00000426946:A610V;ENSP00000423638:A631V;ENSP00000425787:A360V;ENSP00000422929:A368V|.	ENSP00000312523:A623V|.	A|Q	+|+	2|1	0|0	CAST|CAST	96129374|96129374	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.034000|0.034000	0.12701|0.12701	-1.235000|-1.235000	0.02928|0.02928	-0.367000|-0.367000	0.08052|0.08052	0.650000|0.650000	0.86243|0.86243	GCA|CAG	CAST	-	NULL	ENSG00000153113		0.433	CAST-004	KNOWN	basic	protein_coding	CAST	HGNC	protein_coding	OTTHUMT00000250199.2	27	0.00	0	C	NM_173062		96103618	96103618	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000437034	ensembl	human	novel	69_37n	nonsense	31	11.43	4	SNP	0.000	T
CCDC108	255101	genome.wustl.edu	37	2	219896243	219896243	+	Silent	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:219896243C>A	ENST00000341552.5	-	7	866	c.783G>T	c.(781-783)acG>acT	p.T261T	CCDC108_ENST00000410037.1_Silent_p.T196T|CCDC108_ENST00000409865.3_Silent_p.T250T|CCDC108_ENST00000453220.1_Silent_p.T261T|CCDC108_ENST00000441968.1_Silent_p.T261T	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	261						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGCCTCAGTCGTATCTCCCA	0.622																																						dbGAP											0													176.0	179.0	178.0					2																	219896243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.783G>T	2.37:g.219896243C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	superfamily_PapD-like,pfscan_Major_sperm	p.T261	ENST00000341552.5	37	c.783	CCDS2430.2	2																																																																																			CCDC108	-	superfamily_PapD-like	ENSG00000181378		0.622	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	HGNC	protein_coding	OTTHUMT00000256598.4	72	0.00	0	C	NM_194302		219896243	219896243	-1	no_errors	ENST00000341552	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	0.000	A
CCDC163P	126661	genome.wustl.edu	37	1	45961201	45961201	+	5'UTR	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:45961201C>A	ENST00000502793.2	-	0	352				CCDC163P_ENST00000490551.3_Intron|CCDC163P_ENST00000432082.1_Intron					coiled-coil domain containing 163, pseudogene											cervix(1)|endometrium(1)	2						TTAGATTGGACAACATGAATG	0.463																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC047421		1p34.1	2010-06-14	2009-12-17	2009-12-17	ENSG00000236624	ENSG00000236624			27003	pseudogene	pseudogene			"""chromosome 1 open reading frame 231"""	C1orf231		18672041	Standard	NR_033296		Approved	LOC126661	uc001cnw.3		OTTHUMG00000007741	ENST00000502793.2:c.-1342G>T	1.37:g.45961201C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C116F	ENST00000502793.2	37	c.347		1																																																																																			CCDC163P	-	NULL	ENSG00000236624		0.463	CCDC163P-003	KNOWN	basic	processed_transcript	CCDC163P	HGNC	protein_coding	OTTHUMT00000020863.2	45	0.00	0	C	NM_001102601		45961201	45961201	-1	no_errors	ENST00000415578	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.001	A
CCDC94	55702	genome.wustl.edu	37	19	4251060	4251060	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:4251060G>T	ENST00000262962.7	+	3	230	c.162G>T	c.(160-162)aaG>aaT	p.K54N		NM_018074.4	NP_060544.2	Q9BW85	CCD94_HUMAN	coiled-coil domain containing 94	54										NS(1)|endometrium(1)|lung(2)|ovary(1)|stomach(2)	7				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0348)|STAD - Stomach adenocarcinoma(1328;0.183)		ACAAGGGGAAGAAATTCAATG	0.572																																						dbGAP											0													117.0	113.0	114.0					19																	4251060		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001236	CCDS12124.1	19p13.3	2008-02-05				ENSG00000105248			25518	protein-coding gene	gene with protein product						12477932	Standard	NM_018074		Approved	FLJ10374	uc002lzv.4	Q9BW85		ENST00000262962.7:c.162G>T	19.37:g.4251060G>T	ENSP00000262962:p.Lys54Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O75270|Q9H862|Q9NW16	Missense_Mutation	SNP	pfam_CWC16	p.K54N	ENST00000262962.7	37	c.162	CCDS12124.1	19	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861719	0.91433	.	.	ENSG00000105248	ENST00000262962	T	0.34275	1.37	5.82	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.57770	0.2076	M	0.91406	3.205	0.80722	D	1	P	0.51933	0.949	P	0.51297	0.665	T	0.68432	-0.5410	10	0.66056	D	0.02	-18.5511	12.834	0.57763	0.0827:0.0:0.9173:0.0	.	54	Q9BW85	CCD94_HUMAN	N	54	ENSP00000262962:K54N	ENSP00000262962:K54N	K	+	3	2	CCDC94	4202060	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.758000	0.55220	1.398000	0.46701	0.561000	0.74099	AAG	CCDC94	-	pfam_CWC16	ENSG00000105248		0.572	CCDC94-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC94	HGNC	protein_coding	OTTHUMT00000458007.2	71	0.00	0	G	NM_018074		4251060	4251060	+1	no_errors	ENST00000262962	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
CCNL2	81669	genome.wustl.edu	37	1	1325918	1325918	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:1325918C>A	ENST00000400809.3	-	7	790	c.785G>T	c.(784-786)tGg>tTg	p.W262L	CCNL2_ENST00000408952.5_Missense_Mutation_p.W40L|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	262	Cyclin-like 2.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		CAAAAGAAACCAATGGGGACG	0.393																																						dbGAP											0													97.0	97.0	97.0					1																	1325918		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.785G>T	1.37:g.1325918C>A	ENSP00000383611:p.Trp262Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.W262L	ENST00000400809.3	37	c.785	CCDS30557.1	1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773587	0.69992	.	.	ENSG00000221978	ENST00000400809;ENST00000408952	T;T	0.10960	2.82;2.82	5.72	5.72	0.89469	Cyclin, C-terminal (1);Cyclin-like (3);	0.000000	0.64402	D	0.000001	T	0.43634	0.1256	M	0.90759	3.145	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.50406	-0.8832	10	0.87932	D	0	.	18.8711	0.92315	0.0:1.0:0.0:0.0	.	262	Q96S94	CCNL2_HUMAN	L	262;40	ENSP00000383611:W262L;ENSP00000386132:W40L	ENSP00000383611:W262L	W	-	2	0	CCNL2	1315781	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.563000	0.60823	2.717000	0.92951	0.650000	0.86243	TGG	CCNL2	-	pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	ENSG00000221978		0.393	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	HGNC	protein_coding	OTTHUMT00000008146.2	29	0.00	0	C	NM_030937		1325918	1325918	-1	no_errors	ENST00000400809	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	A
CEP70	80321	genome.wustl.edu	37	3	138219340	138219340	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:138219340G>T	ENST00000264982.3	-	15	1704	c.1438C>A	c.(1438-1440)Cct>Act	p.P480T	CEP70_ENST00000542237.1_Missense_Mutation_p.P460T|CEP70_ENST00000489254.1_Missense_Mutation_p.P328T|CEP70_ENST00000481834.1_Missense_Mutation_p.P480T|CEP70_ENST00000484888.1_Missense_Mutation_p.P480T	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	480					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						TTTAAAGAAGGCACATCAAAT	0.368																																						dbGAP											0													203.0	234.0	223.0					3																	138219340		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1438C>A	3.37:g.138219340G>T	ENSP00000264982:p.Pro480Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P480T	ENST00000264982.3	37	c.1438	CCDS3102.1	3	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819813	0.32145	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000481834	T;T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69;1.69	4.76	3.81	0.43845	.	0.382634	0.25494	N	0.030282	T	0.15696	0.0378	N	0.20807	0.61	0.29700	N	0.840264	B;B;B;B	0.19331	0.019;0.035;0.004;0.009	B;B;B;B	0.17098	0.017;0.01;0.013;0.014	T	0.06807	-1.0806	10	0.22706	T	0.39	-3.4402	11.9261	0.52820	0.0:0.0:0.8155:0.1845	.	328;460;480;480	B7Z2D2;F5GZX8;Q8NHQ1-2;Q8NHQ1	.;.;.;CEP70_HUMAN	T	480;460;328;480;462;480	ENSP00000264982:P480T;ENSP00000444128:P460T;ENSP00000417821:P328T;ENSP00000419231:P480T;ENSP00000419833:P462T;ENSP00000417465:P480T	ENSP00000264982:P480T	P	-	1	0	CEP70	139702030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.209000	0.51122	2.487000	0.83934	0.655000	0.94253	CCT	CEP70	-	NULL	ENSG00000114107		0.368	CEP70-001	KNOWN	basic|CCDS	protein_coding	CEP70	HGNC	protein_coding	OTTHUMT00000358001.1	32	0.00	0	G	NM_024491		138219340	138219340	-1	no_errors	ENST00000264982	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.994	T
CHST6	4166	genome.wustl.edu	37	16	75513101	75513101	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:75513101C>A	ENST00000332272.4	-	3	805	c.626G>T	c.(625-627)cGc>cTc	p.R209L	CHST6_ENST00000390664.2_Missense_Mutation_p.R209L|RP11-77K12.4_ENST00000530512.3_RNA	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	209					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CTCCCGGGAGCGCAGCACGGC	0.706																																						dbGAP											0													21.0	23.0	22.0					16																	75513101		2195	4286	6481	-	-	-	SO:0001583	missense	0			AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.626G>T	16.37:g.75513101C>A	ENSP00000328983:p.Arg209Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUK3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.R209L	ENST00000332272.4	37	c.626	CCDS10918.1	16	.	.	.	.	.	.	.	.	.	.	C	16.17	3.046030	0.55110	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	T;T	0.81163	-1.46;-1.46	4.68	3.61	0.41365	Sulfotransferase domain (1);	0.272858	0.28114	N	0.016546	D	0.83820	0.5337	M	0.73962	2.25	0.41747	D	0.989648	D	0.59357	0.985	D	0.66847	0.947	T	0.80754	-0.1241	10	0.14252	T	0.57	.	4.1468	0.10220	0.0:0.6957:0.0:0.3043	.	209	Q9GZX3	CHST6_HUMAN	L	209	ENSP00000328983:R209L;ENSP00000375079:R209L	ENSP00000328983:R209L	R	-	2	0	CHST6	74070602	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	1.761000	0.38440	2.132000	0.65825	0.591000	0.81541	CGC	CHST6	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	ENSG00000183196		0.706	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHST6	HGNC	protein_coding	OTTHUMT00000435478.1	35	0.00	0	C	NM_021615		75513101	75513101	-1	no_errors	ENST00000332272	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	0.996	A
CIT	11113	genome.wustl.edu	37	12	120150462	120150462	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr12:120150462G>T	ENST00000261833.7	-	35	4544	c.4492C>A	c.(4492-4494)Ccc>Acc	p.P1498T	CIT_ENST00000392521.2_Missense_Mutation_p.P1540T|MIR1178_ENST00000408396.1_RNA|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1498	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TCCCCGTCGGGAAGGCACAGC	0.547																																						dbGAP											0													71.0	67.0	68.0					12																	120150462		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.4492C>A	12.37:g.120150462G>T	ENSP00000261833:p.Pro1498Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.P1498T	ENST00000261833.7	37	c.4492	CCDS9192.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.92|11.92	1.781698|1.781698	0.31502|0.31502	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392520|ENST00000392521;ENST00000261833	.|T;T	.|0.63417	.|-0.02;-0.04	5.92|5.92	5.92|5.92	0.95590|0.95590	.|Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.|0.062043	.|0.64402	.|D	.|0.000004	T|T	0.48857|0.48857	0.1523|0.1523	N|N	0.25647|0.25647	0.755|0.755	0.58432|0.58432	D|D	0.999991|0.999991	.|P;P;B	.|0.45126	.|0.851;0.666;0.014	.|B;B;B	.|0.34418	.|0.182;0.162;0.014	T|T	0.48175|0.48175	-0.9058|-0.9058	5|10	.|0.30078	.|T	.|0.28	.|.	20.3081|20.3081	0.98638|0.98638	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1540;1498;1016	.|Q2M5E1;O14578;O14578-3	.|.;CTRO_HUMAN;.	L|T	1110|1540;1498	.|ENSP00000376306:P1540T;ENSP00000261833:P1498T	.|ENSP00000261833:P1498T	F|P	-|-	3|1	2|0	CIT|CIT	118634845|118634845	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.371000|4.371000	0.59523|0.59523	2.795000|2.795000	0.96236|0.96236	0.655000|0.655000	0.94253|0.94253	TTC|CCC	CIT	-	smart_Pleckstrin_homology,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology	ENSG00000122966		0.547	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	HGNC	protein_coding	OTTHUMT00000259410.4	27	0.00	0	G	NM_007174		120150462	120150462	-1	no_errors	ENST00000261833	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	T
CLPB	81570	genome.wustl.edu	37	11	72091420	72091420	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:72091420T>G	ENST00000294053.3	-	4	724	c.551A>C	c.(550-552)cAg>cCg	p.Q184P	CLPB_ENST00000437826.2_Missense_Mutation_p.Q139P|CLPB_ENST00000445069.2_Missense_Mutation_p.Q80P|CLPB_ENST00000340729.5_Missense_Mutation_p.Q155P|CLPB_ENST00000543042.1_Missense_Mutation_p.Q13P|CLPB_ENST00000538039.1_Missense_Mutation_p.Q184P	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	184					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						AAGCAGGACCTGTACCACACT	0.488																																						dbGAP											0													79.0	70.0	73.0					11																	72091420		2200	4293	6493	-	-	-	SO:0001583	missense	0			BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.551A>C	11.37:g.72091420T>G	ENSP00000294053:p.Gln184Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Missense_Mutation	SNP	pfam_ATPase_AAA-2,pfam_Ankyrin_rpt,pfam_Clp_ATPase_C,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,pfam_Zeta_toxin_domain,pfam_Sigma_54_int,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_AAA+_ATPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Chaprnin_ClpA/B	p.Q184P	ENST00000294053.3	37	c.551	CCDS8215.1	11	.	.	.	.	.	.	.	.	.	.	T	10.15	1.272293	0.23221	.	.	ENSG00000162129	ENST00000294053;ENST00000538039;ENST00000535990;ENST00000340729;ENST00000437826;ENST00000543042;ENST00000544683;ENST00000539148	T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;1.33;-0.17;-0.16;-0.17;-0.17	5.89	2.33	0.28932	Ankyrin repeat-containing domain (4);	0.483690	0.22001	N	0.066002	T	0.60663	0.2286	L	0.59912	1.85	0.30755	N	0.744705	B;B;B;B;B	0.33477	0.046;0.115;0.391;0.057;0.413	B;B;B;B;B	0.41510	0.072;0.118;0.359;0.118;0.187	T	0.62946	-0.6746	10	0.72032	D	0.01	-6.3113	7.9494	0.30006	0.0:0.2317:0.0:0.7683	.	13;155;139;184;184	B4DXW4;F8W7P6;E7EWN6;Q9H078-2;Q9H078	.;.;.;.;CLPB_HUMAN	P	184;184;189;155;139;13;38;38	ENSP00000294053:Q184P;ENSP00000441518:Q184P;ENSP00000443822:Q189P;ENSP00000340385:Q155P;ENSP00000407296:Q139P;ENSP00000439746:Q13P;ENSP00000442651:Q38P;ENSP00000445327:Q38P	ENSP00000294053:Q184P	Q	-	2	0	CLPB	71769068	1.000000	0.71417	0.822000	0.32727	0.184000	0.23303	2.369000	0.44231	0.152000	0.19188	0.459000	0.35465	CAG	CLPB	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000162129		0.488	CLPB-001	KNOWN	basic|CCDS	protein_coding	CLPB	HGNC	protein_coding	OTTHUMT00000396889.1	38	0.00	0	T	NM_030813		72091420	72091420	-1	no_errors	ENST00000294053	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.984	G
COL5A2	1290	genome.wustl.edu	37	2	189918668	189918668	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr2:189918668G>C	ENST00000374866.3	-	37	2726	c.2452C>G	c.(2452-2454)Cct>Gct	p.P818A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	818					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CGAGGACCAGGTTCACCCTAG	0.428																																						dbGAP											0													42.0	42.0	42.0					2																	189918668		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2452C>G	2.37:g.189918668G>C	ENSP00000364000:p.Pro818Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P818A	ENST00000374866.3	37	c.2452	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	G	9.505	1.104304	0.20632	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.96745	-4.11	5.93	5.93	0.95920	.	0.000000	0.52532	D	0.000079	D	0.95392	0.8504	L	0.45051	1.395	0.58432	D	0.999999	B;B	0.20459	0.023;0.045	B;B	0.36244	0.22;0.021	D	0.91702	0.5374	9	.	.	.	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	458;818	Q5PR22;P05997	.;CO5A2_HUMAN	A	818;458	ENSP00000364000:P818A	.	P	-	1	0	COL5A2	189626913	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.600000	0.54052	2.814000	0.96858	0.591000	0.81541	CCT	COL5A2	-	NULL	ENSG00000204262		0.428	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	26	0.00	0	G	NM_000393		189918668	189918668	-1	no_errors	ENST00000374866	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	1.000	C
COL5A2	1290	genome.wustl.edu	37	2	189918668	189918668	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:189918668G>C	ENST00000374866.3	-	37	2726	c.2452C>G	c.(2452-2454)Cct>Gct	p.P818A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	818					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CGAGGACCAGGTTCACCCTAG	0.428																																						dbGAP											0													42.0	42.0	42.0					2																	189918668		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2452C>G	2.37:g.189918668G>C	ENSP00000364000:p.Pro818Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P818A	ENST00000374866.3	37	c.2452	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	G	9.505	1.104304	0.20632	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.96745	-4.11	5.93	5.93	0.95920	.	0.000000	0.52532	D	0.000079	D	0.95392	0.8504	L	0.45051	1.395	0.58432	D	0.999999	B;B	0.20459	0.023;0.045	B;B	0.36244	0.22;0.021	D	0.91702	0.5374	9	.	.	.	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	458;818	Q5PR22;P05997	.;CO5A2_HUMAN	A	818;458	ENSP00000364000:P818A	.	P	-	1	0	COL5A2	189626913	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.600000	0.54052	2.814000	0.96858	0.591000	0.81541	CCT	COL5A2	-	NULL	ENSG00000204262		0.428	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	58	0.00	0	G	NM_000393		189918668	189918668	-1	no_errors	ENST00000374866	ensembl	human	known	69_37n	missense	81	33.06	40	SNP	1.000	C
COL5A2	1290	genome.wustl.edu	37	2	189918668	189918668	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:189918668G>C	ENST00000374866.3	-	37	2726	c.2452C>G	c.(2452-2454)Cct>Gct	p.P818A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	818					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CGAGGACCAGGTTCACCCTAG	0.428																																						dbGAP											0													42.0	42.0	42.0					2																	189918668		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2452C>G	2.37:g.189918668G>C	ENSP00000364000:p.Pro818Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P818A	ENST00000374866.3	37	c.2452	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	G	9.505	1.104304	0.20632	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.96745	-4.11	5.93	5.93	0.95920	.	0.000000	0.52532	D	0.000079	D	0.95392	0.8504	L	0.45051	1.395	0.58432	D	0.999999	B;B	0.20459	0.023;0.045	B;B	0.36244	0.22;0.021	D	0.91702	0.5374	9	.	.	.	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	458;818	Q5PR22;P05997	.;CO5A2_HUMAN	A	818;458	ENSP00000364000:P818A	.	P	-	1	0	COL5A2	189626913	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.600000	0.54052	2.814000	0.96858	0.591000	0.81541	CCT	COL5A2	-	NULL	ENSG00000204262		0.428	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	58	0.00	0	G	NM_000393		189918668	189918668	-1	no_errors	ENST00000374866	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	1.000	C
CPNE8	144402	genome.wustl.edu	37	12	39079360	39079360	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr12:39079360G>T	ENST00000331366.5	-	16	1299	c.1203C>A	c.(1201-1203)taC>taA	p.Y401*	CPNE8_ENST00000538596.2_Nonsense_Mutation_p.Y70*|CPNE8_ENST00000360449.3_Nonsense_Mutation_p.Y389*	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	401	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TCAGACTCCTGTAATAAGCCT	0.403																																						dbGAP											0													150.0	152.0	151.0					12																	39079360		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.1203C>A	12.37:g.39079360G>T	ENSP00000329748:p.Tyr401*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TB41|Q86VY2	Nonsense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.Y401*	ENST00000331366.5	37	c.1203	CCDS8733.1	12	.	.	.	.	.	.	.	.	.	.	G	42	9.398261	0.99159	.	.	ENSG00000139117	ENST00000331366;ENST00000538596;ENST00000360449	.	.	.	4.71	-2.27	0.06846	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-15.987	10.0001	0.41924	0.5157:0.0:0.4843:0.0	.	.	.	.	X	401;70;389	.	ENSP00000329748:Y401X	Y	-	3	2	CPNE8	37365627	0.980000	0.34600	0.956000	0.39512	0.970000	0.65996	0.070000	0.14573	-0.581000	0.05937	-0.793000	0.03317	TAC	CPNE8	-	pfam_Copine,smart_VWF_A,pfscan_VWF_A	ENSG00000139117		0.403	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	81	0.00	0	G	NM_153634		39079360	39079360	-1	no_errors	ENST00000331366	ensembl	human	known	69_37n	nonsense	57	12.31	8	SNP	1.000	T
CTCFL	140690	genome.wustl.edu	37	20	56098905	56098905	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:56098905C>A	ENST00000608263.1	-	1	1018	c.357G>T	c.(355-357)ttG>ttT	p.L119F	CTCFL_ENST00000432255.2_Missense_Mutation_p.L119F|CTCFL_ENST00000608158.1_Missense_Mutation_p.L119F|CTCFL_ENST00000371196.2_Missense_Mutation_p.L119F|CTCFL_ENST00000609232.1_Missense_Mutation_p.L119F|CTCFL_ENST00000429804.3_Missense_Mutation_p.L119F|CTCFL_ENST00000243914.3_Missense_Mutation_p.L119F|CTCFL_ENST00000433949.3_Intron|CTCFL_ENST00000423479.3_Missense_Mutation_p.L119F|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000481655.2_Missense_Mutation_p.L119F|CTCFL_ENST00000422869.2_Missense_Mutation_p.L119F|CTCFL_ENST00000608440.1_Missense_Mutation_p.L119F|CTCFL_ENST00000539382.1_Intron|CTCFL_ENST00000608425.1_Missense_Mutation_p.L119F|CTCFL_ENST00000502686.2_Intron	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	119					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CAAGCCACAGCAACCCAGGGC	0.572																																						dbGAP											0													80.0	76.0	78.0					20																	56098905		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.357G>T	20.37:g.56098905C>A	ENSP00000476783:p.Leu119Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L119F	ENST00000608263.1	37	c.357	CCDS13459.1	20	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379383	0.61845	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000422109;ENST00000426658;ENST00000432255;ENST00000422869	T;T;T;T;T;T;T;T;T	0.15718	2.52;2.4;2.4;2.49;2.45;2.66;2.41;2.91;2.46	4.1	-0.589	0.11683	.	0.228496	0.22070	N	0.065042	T	0.27419	0.0673	L	0.60455	1.87	0.09310	N	1	P;P;P;D;P;D;P;B	0.76494	0.62;0.62;0.952;0.999;0.62;0.983;0.62;0.363	B;B;P;D;B;P;B;B	0.66196	0.22;0.22;0.603;0.942;0.157;0.727;0.22;0.138	T	0.12016	-1.0564	10	0.26408	T	0.33	-16.8507	8.0228	0.30419	0.0:0.4391:0.4675:0.0933	.	119;119;119;119;119;119;119;119	A6XGM3;A6XGM0;A6XGM9;A6XGM8;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;.;.;.;CTCFL_HUMAN	F	119	ENSP00000415579:L119F;ENSP00000243914:L119F;ENSP00000360239:L119F;ENSP00000415329:L119F;ENSP00000392034:L119F;ENSP00000413713:L119F;ENSP00000403369:L119F;ENSP00000409344:L119F;ENSP00000399061:L119F	ENSP00000243914:L119F	L	-	3	2	CTCFL	55532311	0.027000	0.19231	0.001000	0.08648	0.242000	0.25591	0.121000	0.15667	0.039000	0.15632	0.650000	0.86243	TTG	CTCFL	-	NULL	ENSG00000124092		0.572	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CTCFL	HGNC	protein_coding	OTTHUMT00000472040.1	36	0.00	0	C	NM_080618		56098905	56098905	-1	no_errors	ENST00000423479	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.003	A
DCLK1	9201	genome.wustl.edu	37	13	36424764	36424764	+	Intron	SNP	A	A	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr13:36424764A>T	ENST00000360631.3	-	6	1247				DCLK1_ENST00000379893.1_Intron|DCLK1_ENST00000255448.4_Intron|DCLK1_ENST00000460982.1_5'UTR|DCLK1_ENST00000379892.4_3'UTR			O15075	DCLK1_HUMAN	doublecortin-like kinase 1						axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		AGGTATGCAAAACTCTTTTGT	0.313																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1035+3871T>A	13.37:g.36424764A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	RNA	SNP	-	NULL	ENST00000360631.3	37	NULL		13																																																																																			DCLK1	-	-	ENSG00000133083		0.313	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	36	0.00	0	A	NM_004734		36424764	36424764	-1	no_errors	ENST00000460982	ensembl	human	known	69_37n	rna	55	36.05	31	SNP	1.000	T
DENND2C	163259	genome.wustl.edu	37	1	115127989	115127989	+	3'UTR	DEL	A	A	-			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:115127989delA	ENST00000393274.1	-	0	3644				DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393276.3_3'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C						positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGCTGCTATAAAAAAAAAAT	0.408																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.*232T>-	1.37:g.115127989delA		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL26|Q5TCX6|Q6P3R3	RNA	DEL	-	NULL	ENST00000393274.1	37	NULL	CCDS58018.1	1																																																																																			DENND2C	-	-	ENSG00000175984		0.408	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	12	0.00	0	A	NM_198459		115127989	115127989	-1	no_errors	ENST00000495031	ensembl	human	known	69_37n	rna	19	13.64	3	DEL	0.000	-
DGCR8	54487	genome.wustl.edu	37	22	20093775	20093775	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:20093775C>A	ENST00000351989.3	+	10	2293	c.1864C>A	c.(1864-1866)Cag>Aag	p.Q622K	DGCR8_ENST00000407755.1_Missense_Mutation_p.Q589K|DGCR8_ENST00000383024.2_Missense_Mutation_p.Q589K	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	622	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GTCTCCATATCAGATCCTCCA	0.552																																						dbGAP											0													60.0	58.0	59.0					22																	20093775		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.1864C>A	22.37:g.20093775C>A	ENSP00000263209:p.Gln622Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	pfam_Ds-RNA-bd,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_Ds-RNA-bd,pfscan_WW_Rsp5_WWP,pfscan_Ds-RNA-bd	p.Q622K	ENST00000351989.3	37	c.1864	CCDS13773.1	22	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039608	0.75732	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.76186	-1.0;-1.0;-1.0	4.88	4.88	0.63580	Double-stranded RNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.79131	0.4394	L	0.36672	1.1	0.80722	D	1	D;D	0.69078	0.989;0.997	D;P	0.70487	0.969;0.876	T	0.74426	-0.3669	10	0.20519	T	0.43	-17.5757	16.9668	0.86288	0.0:1.0:0.0:0.0	.	589;622	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	K	622;589;589	ENSP00000263209:Q622K;ENSP00000372488:Q589K;ENSP00000384726:Q589K	ENSP00000263209:Q622K	Q	+	1	0	DGCR8	18473775	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.044000	0.76578	2.532000	0.85374	0.467000	0.42956	CAG	DGCR8	-	pfam_Ds-RNA-bd,smart_Ds-RNA-bd	ENSG00000128191		0.552	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR8	HGNC	protein_coding	OTTHUMT00000318654.1	27	0.00	0	C			20093775	20093775	+1	no_errors	ENST00000351989	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	1.000	A
DEPDC5	9681	genome.wustl.edu	37	22	32293469	32293469	+	Splice_Site	SNP	T	T	A			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr22:32293469T>A	ENST00000382112.3	+	39	4248	c.4178T>A	c.(4177-4179)gTc>gAc	p.V1393D	DEPDC5_ENST00000539165.1_Splice_Site_p.V219D|DEPDC5_ENST00000400248.2_Splice_Site_p.V1371D|DEPDC5_ENST00000535622.1_Splice_Site_p.V1302D|DEPDC5_ENST00000266091.3_Splice_Site_p.V1380D|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000400249.2_Splice_Site_p.V1371D|DEPDC5_ENST00000382111.2_Splice_Site_p.V1402D|DEPDC5_ENST00000400246.1_Splice_Site_p.V1402D	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1402					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTCCGCCAGGTCCAAGGTTGG	0.493																																						dbGAP											0													107.0	102.0	104.0					22																	32293469		1881	4110	5991	-	-	-	SO:0001630	splice_region_variant	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4177-1T>A	22.37:g.32293469T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.V1380D	ENST00000382112.3	37	c.4139	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	t	25.5	4.644258	0.87859	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	T;T;T;T;T;T;T	0.44881	0.91;1.34;1.34;1.23;1.34;1.23;1.34	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.996;0.997;0.999;0.997;0.994;0.994	T	0.64491	-0.6395	10	0.87932	D	0	.	15.2207	0.73308	0.0:0.0:0.0:1.0	.	1402;1302;788;1380;1393;1371	B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	D	1302;1380;1371;1302;1402;1393;1402;1371;219	ENSP00000440210:V1302D;ENSP00000266091:V1380D;ENSP00000383108:V1371D;ENSP00000383105:V1402D;ENSP00000371546:V1393D;ENSP00000371545:V1402D;ENSP00000383107:V1371D	ENSP00000266091:V1380D	V	+	2	0	DEPDC5	30623469	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.705000	0.84606	2.193000	0.70182	0.529000	0.55759	GTC	DEPDC5	-	NULL	ENSG00000100150		0.493	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	54	0.00	0	T	NM_014662	Missense_Mutation	32293469	32293469	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	12	50.00	12	SNP	1.000	A
DEPDC5	9681	genome.wustl.edu	37	22	32293469	32293469	+	Splice_Site	SNP	T	T	A			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:32293469T>A	ENST00000382112.3	+	39	4248	c.4178T>A	c.(4177-4179)gTc>gAc	p.V1393D	DEPDC5_ENST00000539165.1_Splice_Site_p.V219D|DEPDC5_ENST00000400248.2_Splice_Site_p.V1371D|DEPDC5_ENST00000535622.1_Splice_Site_p.V1302D|DEPDC5_ENST00000266091.3_Splice_Site_p.V1380D|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000400249.2_Splice_Site_p.V1371D|DEPDC5_ENST00000382111.2_Splice_Site_p.V1402D|DEPDC5_ENST00000400246.1_Splice_Site_p.V1402D	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1402					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTCCGCCAGGTCCAAGGTTGG	0.493																																						dbGAP											0													107.0	102.0	104.0					22																	32293469		1881	4110	5991	-	-	-	SO:0001630	splice_region_variant	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4177-1T>A	22.37:g.32293469T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.V1380D	ENST00000382112.3	37	c.4139	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	t	25.5	4.644258	0.87859	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	T;T;T;T;T;T;T	0.44881	0.91;1.34;1.34;1.23;1.34;1.23;1.34	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.996;0.997;0.999;0.997;0.994;0.994	T	0.64491	-0.6395	10	0.87932	D	0	.	15.2207	0.73308	0.0:0.0:0.0:1.0	.	1402;1302;788;1380;1393;1371	B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	D	1302;1380;1371;1302;1402;1393;1402;1371;219	ENSP00000440210:V1302D;ENSP00000266091:V1380D;ENSP00000383108:V1371D;ENSP00000383105:V1402D;ENSP00000371546:V1393D;ENSP00000371545:V1402D;ENSP00000383107:V1371D	ENSP00000266091:V1380D	V	+	2	0	DEPDC5	30623469	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.705000	0.84606	2.193000	0.70182	0.529000	0.55759	GTC	DEPDC5	-	NULL	ENSG00000100150		0.493	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	91	0.00	0	T	NM_014662	Missense_Mutation	32293469	32293469	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	46	59.29	67	SNP	1.000	A
DEPDC5	9681	genome.wustl.edu	37	22	32293469	32293469	+	Splice_Site	SNP	T	T	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:32293469T>A	ENST00000382112.3	+	39	4248	c.4178T>A	c.(4177-4179)gTc>gAc	p.V1393D	DEPDC5_ENST00000539165.1_Splice_Site_p.V219D|DEPDC5_ENST00000400248.2_Splice_Site_p.V1371D|DEPDC5_ENST00000535622.1_Splice_Site_p.V1302D|DEPDC5_ENST00000266091.3_Splice_Site_p.V1380D|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000400249.2_Splice_Site_p.V1371D|DEPDC5_ENST00000382111.2_Splice_Site_p.V1402D|DEPDC5_ENST00000400246.1_Splice_Site_p.V1402D	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1402					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTCCGCCAGGTCCAAGGTTGG	0.493																																						dbGAP											0													107.0	102.0	104.0					22																	32293469		1881	4110	5991	-	-	-	SO:0001630	splice_region_variant	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4177-1T>A	22.37:g.32293469T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.V1380D	ENST00000382112.3	37	c.4139	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	t	25.5	4.644258	0.87859	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	T;T;T;T;T;T;T	0.44881	0.91;1.34;1.34;1.23;1.34;1.23;1.34	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.996;0.997;0.999;0.997;0.994;0.994	T	0.64491	-0.6395	10	0.87932	D	0	.	15.2207	0.73308	0.0:0.0:0.0:1.0	.	1402;1302;788;1380;1393;1371	B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	D	1302;1380;1371;1302;1402;1393;1402;1371;219	ENSP00000440210:V1302D;ENSP00000266091:V1380D;ENSP00000383108:V1371D;ENSP00000383105:V1402D;ENSP00000371546:V1393D;ENSP00000371545:V1402D;ENSP00000383107:V1371D	ENSP00000266091:V1380D	V	+	2	0	DEPDC5	30623469	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.705000	0.84606	2.193000	0.70182	0.529000	0.55759	GTC	DEPDC5	-	NULL	ENSG00000100150		0.493	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	91	0.00	0	T	NM_014662	Missense_Mutation	32293469	32293469	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	1.000	A
DIP2C	22982	genome.wustl.edu	37	10	409199	409199	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:409199C>T	ENST00000280886.6	-	21	2617	c.2530G>A	c.(2530-2532)Gct>Act	p.A844T	DIP2C_ENST00000381496.3_3'UTR|DIP2C_ENST00000540204.1_Missense_Mutation_p.A165T	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	844						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CTCTGCTCAGCCACGATCACG	0.647																																						dbGAP											0													172.0	114.0	134.0					10																	409199		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.2530G>A	10.37:g.409199C>T	ENSP00000280886:p.Ala844Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPI5|Q5SS78	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.A844T	ENST00000280886.6	37	c.2530	CCDS7054.1	10	.	.	.	.	.	.	.	.	.	.	C	24.6	4.548774	0.86127	.	.	ENSG00000151240	ENST00000280886;ENST00000540204	T;T	0.55760	2.82;0.5	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.76343	0.3974	M	0.87971	2.92	0.80722	D	1	D;D	0.65815	0.995;0.987	P;D	0.65140	0.883;0.932	T	0.76892	-0.2791	10	0.44086	T	0.13	-27.9869	20.0172	0.97481	0.0:1.0:0.0:0.0	.	165;844	B4DPI5;Q9Y2E4	.;DIP2C_HUMAN	T	844;165	ENSP00000280886:A844T;ENSP00000443826:A165T	ENSP00000280886:A844T	A	-	1	0	DIP2C	399199	1.000000	0.71417	0.994000	0.49952	0.128000	0.20619	7.811000	0.86092	2.731000	0.93534	0.557000	0.71058	GCT	DIP2C	-	NULL	ENSG00000151240		0.647	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	53	0.00	0	C	NM_014974		409199	409199	-1	no_errors	ENST00000280886	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
DLST	1743	genome.wustl.edu	37	14	75352289	75352289	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr14:75352289G>T	ENST00000334220.4	+	3	159	c.98G>T	c.(97-99)gGg>gTg	p.G33V	DLST_ENST00000555190.1_Intron|DLST_ENST00000334212.6_5'UTR	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	33					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TTTCTTGCAGGGGTCTCCTTA	0.458																																						dbGAP											0													173.0	156.0	162.0					14																	75352289		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.98-1G>T	14.37:g.75352289G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl,tigrfam_SucB	p.G33V	ENST00000334220.4	37	c.98	CCDS9833.1	14	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659389	0.29515	.	.	ENSG00000119689	ENST00000334220	T	0.15952	2.38	5.09	4.2	0.49525	.	0.067420	0.64402	D	0.000019	T	0.21881	0.0527	N	0.14661	0.345	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;P;D	0.80764	0.994;0.831;0.994	T	0.05068	-1.0908	9	.	.	.	.	11.2012	0.48743	0.0846:0.0:0.9154:0.0	.	33;33;33	Q6IBS5;B7Z6J1;P36957	.;.;ODO2_HUMAN	V	33	ENSP00000335304:G33V	.	G	+	2	0	DLST	74422042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.376000	0.66178	1.388000	0.46506	0.591000	0.81541	GGG	DLST	-	NULL	ENSG00000119689		0.458	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLST	HGNC	protein_coding	OTTHUMT00000413637.1	64	0.00	0	G		Missense_Mutation	75352289	75352289	+1	no_errors	ENST00000334220	ensembl	human	known	69_37n	missense	34	42.37	25	SNP	1.000	T
DLST	1743	genome.wustl.edu	37	14	75352289	75352289	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr14:75352289G>T	ENST00000334220.4	+	3	159	c.98G>T	c.(97-99)gGg>gTg	p.G33V	DLST_ENST00000555190.1_Intron|DLST_ENST00000334212.6_5'UTR	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	33					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TTTCTTGCAGGGGTCTCCTTA	0.458																																						dbGAP											0													173.0	156.0	162.0					14																	75352289		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.98-1G>T	14.37:g.75352289G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl,tigrfam_SucB	p.G33V	ENST00000334220.4	37	c.98	CCDS9833.1	14	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659389	0.29515	.	.	ENSG00000119689	ENST00000334220	T	0.15952	2.38	5.09	4.2	0.49525	.	0.067420	0.64402	D	0.000019	T	0.21881	0.0527	N	0.14661	0.345	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;P;D	0.80764	0.994;0.831;0.994	T	0.05068	-1.0908	9	.	.	.	.	11.2012	0.48743	0.0846:0.0:0.9154:0.0	.	33;33;33	Q6IBS5;B7Z6J1;P36957	.;.;ODO2_HUMAN	V	33	ENSP00000335304:G33V	.	G	+	2	0	DLST	74422042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.376000	0.66178	1.388000	0.46506	0.591000	0.81541	GGG	DLST	-	NULL	ENSG00000119689		0.458	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLST	HGNC	protein_coding	OTTHUMT00000413637.1	157	0.00	0	G		Missense_Mutation	75352289	75352289	+1	no_errors	ENST00000334220	ensembl	human	known	69_37n	missense	168	37.31	100	SNP	1.000	T
DLST	1743	genome.wustl.edu	37	14	75352289	75352289	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr14:75352289G>T	ENST00000334220.4	+	3	159	c.98G>T	c.(97-99)gGg>gTg	p.G33V	DLST_ENST00000555190.1_Intron|DLST_ENST00000334212.6_5'UTR	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	33					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TTTCTTGCAGGGGTCTCCTTA	0.458																																						dbGAP											0													173.0	156.0	162.0					14																	75352289		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.98-1G>T	14.37:g.75352289G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl,tigrfam_SucB	p.G33V	ENST00000334220.4	37	c.98	CCDS9833.1	14	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659389	0.29515	.	.	ENSG00000119689	ENST00000334220	T	0.15952	2.38	5.09	4.2	0.49525	.	0.067420	0.64402	D	0.000019	T	0.21881	0.0527	N	0.14661	0.345	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;P;D	0.80764	0.994;0.831;0.994	T	0.05068	-1.0908	9	.	.	.	.	11.2012	0.48743	0.0846:0.0:0.9154:0.0	.	33;33;33	Q6IBS5;B7Z6J1;P36957	.;.;ODO2_HUMAN	V	33	ENSP00000335304:G33V	.	G	+	2	0	DLST	74422042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.376000	0.66178	1.388000	0.46506	0.591000	0.81541	GGG	DLST	-	NULL	ENSG00000119689		0.458	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLST	HGNC	protein_coding	OTTHUMT00000413637.1	157	0.00	0	G		Missense_Mutation	75352289	75352289	+1	no_errors	ENST00000334220	ensembl	human	known	69_37n	missense	133	21.30	36	SNP	1.000	T
DNAJC15	29103	genome.wustl.edu	37	13	43597806	43597806	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr13:43597806G>T	ENST00000379221.2	+	1	468	c.44G>T	c.(43-45)cGc>cTc	p.R15L	DNAJC15_ENST00000474320.1_3'UTR	NM_013238.2	NP_037370.2	Q9Y5T4	DJC15_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 15	15					cellular response to starvation (GO:0009267)|negative regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902957)|negative regulation of protein complex assembly (GO:0031333)|protein transport (GO:0015031)|regulation of lipid metabolic process (GO:0019216)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|urinary_tract(1)	4		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)		GAGAGTTTGCGCTACGCTGAG	0.677																																						dbGAP											0													32.0	32.0	32.0					13																	43597806		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126743	CCDS9388.1	13q14.1	2011-09-02	2005-06-30	2005-06-30	ENSG00000120675	ENSG00000120675		"""Heat shock proteins / DNAJ (HSP40)"""	20325	protein-coding gene	gene with protein product		615339	"""DnaJ (Hsp40) homolog, subfamily D, member 1"""	DNAJD1		11358853	Standard	NM_013238		Approved	MCJ	uc001uyy.3	Q9Y5T4	OTTHUMG00000016813	ENST00000379221.2:c.44G>T	13.37:g.43597806G>T	ENSP00000368523:p.Arg15Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4L0|Q5T219|Q6X963	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N	p.R15L	ENST00000379221.2	37	c.44	CCDS9388.1	13	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560940	0.65538	.	.	ENSG00000120675	ENST00000379221	T	0.52754	0.65	4.53	2.8	0.32819	.	0.122741	0.52532	D	0.000080	T	0.64068	0.2565	M	0.77616	2.38	0.38268	D	0.942066	D	0.89917	1.0	D	0.85130	0.997	T	0.66131	-0.6000	10	0.87932	D	0	-26.3292	6.7851	0.23670	0.2128:0.0:0.7872:0.0	.	15	Q9Y5T4	DJC15_HUMAN	L	15	ENSP00000368523:R15L	ENSP00000368523:R15L	R	+	2	0	DNAJC15	42495806	0.990000	0.36364	0.424000	0.26647	0.010000	0.07245	1.646000	0.37249	0.543000	0.28864	-0.140000	0.14226	CGC	DNAJC15	-	NULL	ENSG00000120675		0.677	DNAJC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC15	HGNC	protein_coding	OTTHUMT00000044709.2	78	0.00	0	G	NM_013238		43597806	43597806	+1	no_errors	ENST00000379221	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.664	T
DOCK7	85440	genome.wustl.edu	37	1	63024827	63024827	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:63024827C>A	ENST00000340370.5	-	20	2281	c.2264G>T	c.(2263-2265)cGa>cTa	p.R755L	DOCK7_ENST00000251157.5_Missense_Mutation_p.R755L	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	755					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						GTCCCCAATTCGGACTGGGAA	0.393																																						dbGAP											0													88.0	83.0	84.0					1																	63024827		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.2264G>T	1.37:g.63024827C>A	ENSP00000340742:p.Arg755Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.R755L	ENST00000340370.5	37	c.2264	CCDS30734.1	1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.981925	0.93044	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370	T;T	0.27402	1.67;1.67	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.55816	0.1944	M	0.66939	2.045	0.80722	D	1	D;P;D;D	0.89917	1.0;0.87;1.0;1.0	D;P;D;D	0.97110	0.993;0.884;0.999;1.0	T	0.55585	-0.8118	10	0.52906	T	0.07	.	18.6491	0.91423	0.0:1.0:0.0:0.0	.	755;755;755;755	Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.	L	755	ENSP00000251157:R755L;ENSP00000340742:R755L	ENSP00000251157:R755L	R	-	2	0	DOCK7	62797415	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	7.651000	0.83577	2.640000	0.89533	0.561000	0.74099	CGA	DOCK7	-	NULL	ENSG00000116641		0.393	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	30	0.00	0	C	NM_033407		63024827	63024827	-1	no_errors	ENST00000251157	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	A
DPP10	57628	genome.wustl.edu	37	2	116101439	116101439	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr2:116101439C>T	ENST00000410059.1	+	3	702	c.222C>T	c.(220-222)ctC>ctT	p.L74L	DPP10_ENST00000310323.8_Silent_p.L67L|DPP10_ENST00000409163.1_Silent_p.L24L|DPP10_ENST00000393147.2_Silent_p.L78L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	74						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TGGAAGACCTCTTTAGGAAAG	0.338																																						dbGAP											0													94.0	96.0	95.0					2																	116101439		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.222C>T	2.37:g.116101439C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	NULL	p.S29F	ENST00000410059.1	37	c.86	CCDS46400.1	2																																																																																			DPP10	-	NULL	ENSG00000175497		0.338	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	72	0.00	0	C	NM_020868		116101439	116101439	+1	no_errors	ENST00000429914	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	1.000	T
DPP10	57628	genome.wustl.edu	37	2	116101439	116101439	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:116101439C>T	ENST00000410059.1	+	3	702	c.222C>T	c.(220-222)ctC>ctT	p.L74L	DPP10_ENST00000310323.8_Silent_p.L67L|DPP10_ENST00000409163.1_Silent_p.L24L|DPP10_ENST00000393147.2_Silent_p.L78L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	74						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TGGAAGACCTCTTTAGGAAAG	0.338																																						dbGAP											0													94.0	96.0	95.0					2																	116101439		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.222C>T	2.37:g.116101439C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	NULL	p.S29F	ENST00000410059.1	37	c.86	CCDS46400.1	2																																																																																			DPP10	-	NULL	ENSG00000175497		0.338	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	60	0.00	0	C	NM_020868		116101439	116101439	+1	no_errors	ENST00000429914	ensembl	human	known	69_37n	missense	50	34.21	26	SNP	1.000	T
DPP10	57628	genome.wustl.edu	37	2	116101439	116101439	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:116101439C>T	ENST00000410059.1	+	3	702	c.222C>T	c.(220-222)ctC>ctT	p.L74L	DPP10_ENST00000310323.8_Silent_p.L67L|DPP10_ENST00000409163.1_Silent_p.L24L|DPP10_ENST00000393147.2_Silent_p.L78L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	74						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TGGAAGACCTCTTTAGGAAAG	0.338																																						dbGAP											0													94.0	96.0	95.0					2																	116101439		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.222C>T	2.37:g.116101439C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	NULL	p.S29F	ENST00000410059.1	37	c.86	CCDS46400.1	2																																																																																			DPP10	-	NULL	ENSG00000175497		0.338	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	60	0.00	0	C	NM_020868		116101439	116101439	+1	no_errors	ENST00000429914	ensembl	human	known	69_37n	missense	44	22.81	13	SNP	1.000	T
DUOXA2	405753	genome.wustl.edu	37	15	45410045	45410045	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:45410045G>A	ENST00000323030.5	+	6	1186	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	DUOXA1_ENST00000267803.4_Intron|DUOXA1_ENST00000558996.1_3'UTR|DUOXA1_ENST00000559014.1_Intron|DUOXA1_ENST00000430224.2_Intron	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	301					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.G301S(1)					all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		TCTTATCCTCGGCGACCCACT	0.597											OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	lung(1)											59.0	68.0	65.0					15																	45410045		2198	4298	6496	-	-	-	SO:0001583	missense	0			BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.901G>A	15.37:g.45410045G>A	ENSP00000319705:p.Gly301Ser	Somatic	931	WXS	Illumina GAIIx	Phase_IV	B2RPI9|H0YNQ6	Missense_Mutation	SNP	pfam_Dual_oxidase_maturation_fac	p.G301S	ENST00000323030.5	37	c.901	CCDS10118.2	15	.	.	.	.	.	.	.	.	.	.	G	7.498	0.652162	0.14580	.	.	ENSG00000140274	ENST00000323030	T	0.52983	0.64	5.26	2.9	0.33743	.	1.401930	0.04124	N	0.316773	T	0.26593	0.0650	N	0.08118	0	0.18873	N	0.999986	B	0.09022	0.002	B	0.01281	0.0	T	0.22138	-1.0225	10	0.07813	T	0.8	-3.4963	6.8843	0.24191	0.8048:0.0:0.1952:0.0	.	301	Q1HG44	DOXA2_HUMAN	S	301	ENSP00000319705:G301S	ENSP00000319705:G301S	G	+	1	0	DUOXA2	43197337	0.000000	0.05858	0.014000	0.15608	0.000000	0.00434	0.739000	0.26173	0.387000	0.25024	-0.367000	0.07326	GGC	DUOXA2	-	NULL	ENSG00000140274		0.597	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUOXA2	HGNC	protein_coding	OTTHUMT00000254142.1	68	0.00	0	G	NM_207581		45410045	45410045	+1	no_errors	ENST00000323030	ensembl	human	known	69_37n	missense	34	10.26	4	SNP	0.138	A
DYNC1H1	1778	genome.wustl.edu	37	14	102506067	102506067	+	Silent	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr14:102506067G>T	ENST00000360184.4	+	62	11852	c.11688G>T	c.(11686-11688)gtG>gtT	p.V3896V	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3896					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGGGCACCGTGGGGTAAGAGC	0.502																																						dbGAP											0													78.0	73.0	75.0					14																	102506067		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11688G>T	14.37:g.102506067G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.V3896	ENST00000360184.4	37	c.11688	CCDS9966.1	14																																																																																			DYNC1H1	-	NULL	ENSG00000197102		0.502	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	50	0.00	0	G	NM_001376		102506067	102506067	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	silent	24	11.11	3	SNP	0.998	T
ECE1	1889	genome.wustl.edu	37	1	21554433	21554433	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:21554433G>T	ENST00000374893.6	-	15	1846	c.1772C>A	c.(1771-1773)tCc>tAc	p.S591Y	ECE1_ENST00000415912.2_Missense_Mutation_p.S575Y|ECE1_ENST00000436918.2_Missense_Mutation_p.S591Y|ECE1_ENST00000264205.6_Missense_Mutation_p.S588Y|ECE1_ENST00000357071.4_Missense_Mutation_p.S579Y	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	591					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		CTTGGGTGAGGAGCGTGTGTA	0.597																																						dbGAP											0													83.0	65.0	71.0					1																	21554433		2187	4267	6454	-	-	-	SO:0001583	missense	0			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.1772C>A	1.37:g.21554433G>T	ENSP00000364028:p.Ser591Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.S591Y	ENST00000374893.6	37	c.1772	CCDS215.1	1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715757	0.48622	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	4.95	4.95	0.65309	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.284823	0.39083	N	0.001479	T	0.74191	0.3684	N	0.25485	0.75	0.58432	D	0.999991	B;B;B;B;B	0.25312	0.06;0.033;0.102;0.026;0.123	B;B;B;B;B	0.26094	0.057;0.045;0.066;0.027;0.027	T	0.73908	-0.3834	10	0.87932	D	0	-24.3298	12.2837	0.54779	0.0:0.0:0.8304:0.1696	.	591;575;591;579;588	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	Y	575;579;591;591;588	ENSP00000405088:S575Y;ENSP00000349581:S579Y;ENSP00000364028:S591Y;ENSP00000388439:S591Y;ENSP00000264205:S588Y	ENSP00000264205:S588Y	S	-	2	0	ECE1	21427020	0.993000	0.37304	0.998000	0.56505	0.956000	0.61745	4.020000	0.57189	2.448000	0.82819	0.650000	0.86243	TCC	ECE1	-	pfam_Peptidase_M13_C	ENSG00000117298		0.597	ECE1-002	KNOWN	basic|CCDS	protein_coding	ECE1	HGNC	protein_coding	OTTHUMT00000007470.2	56	0.00	0	G	NM_001397		21554433	21554433	-1	no_errors	ENST00000374893	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.852	T
EPHB2	2048	genome.wustl.edu	37	1	23191471	23191471	+	Missense_Mutation	SNP	G	G	A	rs528777153	byFrequency	TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:23191471G>A	ENST00000400191.3	+	5	1087	c.1069G>A	c.(1069-1071)Gtc>Atc	p.V357I	EPHB2_ENST00000465676.1_3'UTR|EPHB2_ENST00000544305.1_Missense_Mutation_p.V357I|EPHB2_ENST00000374632.3_Missense_Mutation_p.V357I|MIR4253_ENST00000581187.1_RNA|EPHB2_ENST00000374627.1_Missense_Mutation_p.V351I|EPHB2_ENST00000374630.3_Missense_Mutation_p.V357I	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	357	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.V357I(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AGAGGACCTCGTCTACAACAT	0.647													G|||	4	0.000798722	0.0	0.0	5008	,	,		16456	0.0		0.0	False		,,,				2504	0.0041					dbGAP											1	Substitution - Missense(1)	kidney(1)											64.0	71.0	68.0					1																	23191471		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1069G>A	1.37:g.23191471G>A	ENSP00000383053:p.Val357Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.V357I	ENST00000400191.3	37	c.1069		1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489664	0.64074	.	.	ENSG00000133216	ENST00000374625;ENST00000544305;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	5.41	5.41	0.78517	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.52008	0.1708	M	0.61703	1.905	0.41412	D	0.987745	B;P;P;P	0.47545	0.029;0.897;0.897;0.756	B;B;B;B	0.43386	0.005;0.418;0.418;0.216	T	0.57435	-0.7812	10	0.59425	D	0.04	.	11.3592	0.49633	0.0824:0.0:0.9176:0.0	.	357;357;375;357	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	I	357;357;357;357;357;351	ENSP00000444174:V357I;ENSP00000363761:V357I;ENSP00000383053:V357I;ENSP00000363763:V357I;ENSP00000363758:V351I	ENSP00000363755:V357I	V	+	1	0	EPHB2	23064058	1.000000	0.71417	0.808000	0.32385	0.981000	0.71138	5.628000	0.67791	2.816000	0.96949	0.563000	0.77884	GTC	EPHB2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000133216		0.647	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	HGNC	protein_coding	OTTHUMT00000008060.2	53	0.00	0	G	NM_017449		23191471	23191471	+1	no_errors	ENST00000400191	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.997	A
FAM72B	653820	genome.wustl.edu	37	1	120839839	120839839	+	Silent	SNP	T	T	C			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr1:120839839T>C	ENST00000369390.3	+	1	835	c.6T>C	c.(4-6)tcT>tcC	p.S2S	RP11-439A17.7_ENST00000412759.1_RNA|FAM72B_ENST00000355228.4_Silent_p.S2S|FAM72B_ENST00000471903.2_Intron	NM_001100910.1	NP_001094380.1	Q86X60	FA72B_HUMAN	family with sequence similarity 72, member B	2										large_intestine(1)|lung(2)	3	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		ACGCCATGTCTACCAACATTT	0.443																																						dbGAP											0													6.0	7.0	7.0					1																	120839839		1624	3651	5275	-	-	-	SO:0001819	synonymous_variant	0			AL357493	CCDS72848.1	1p12	2014-05-06			ENSG00000188610	ENSG00000188610			24805	protein-coding gene	gene with protein product		614711					Standard	NM_001100910		Approved	RP11-439A17.6	uc009whp.3	Q86X60	OTTHUMG00000185025	ENST00000369390.3:c.6T>C	1.37:g.120839839T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPQ5|Q5QP15	Silent	SNP	NULL	p.S2	ENST00000369390.3	37	c.6	CCDS41374.1	1																																																																																			FAM72B	-	NULL	ENSG00000188610		0.443	FAM72B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM72B	HGNC	protein_coding	OTTHUMT00000098437.1	36	0.00	0	T			120839839	120839839	+1	no_errors	ENST00000369390	ensembl	human	known	69_37n	silent	18	14.29	3	SNP	1.000	C
FBLN2	2199	genome.wustl.edu	37	3	13655604	13655604	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:13655604G>T	ENST00000295760.7	+	5	1738	c.1669G>T	c.(1669-1671)Gag>Tag	p.E557*	FBLN2_ENST00000404922.3_Nonsense_Mutation_p.E557*|FBLN2_ENST00000535798.1_Nonsense_Mutation_p.E583*|FBLN2_ENST00000492059.1_Nonsense_Mutation_p.E557*	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	557					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			TGAGGGTGAAGAGCCTCTCAT	0.622																																						dbGAP											0													55.0	62.0	60.0					3																	13655604		2093	4222	6315	-	-	-	SO:0001587	stop_gained	0			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1669G>T	3.37:g.13655604G>T	ENSP00000295760:p.Glu557*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9C5|Q8IUI0|Q8IUI1	Nonsense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_,smart_EGF-like,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.E557*	ENST00000295760.7	37	c.1669	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.920805	0.97105	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	.	.	.	4.27	4.27	0.50696	.	0.499217	0.21602	N	0.071923	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	16.492	0.84203	0.0:0.0:1.0:0.0	.	.	.	.	X	583;557;557;557	.	ENSP00000295760:E557X	E	+	1	0	FBLN2	13630605	1.000000	0.71417	0.258000	0.24420	0.106000	0.19336	5.900000	0.69853	2.226000	0.72624	0.591000	0.81541	GAG	FBLN2	-	NULL	ENSG00000163520		0.622	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	74	0.00	0	G	NM_001004019		13655604	13655604	+1	no_errors	ENST00000404922	ensembl	human	known	69_37n	nonsense	33	10.81	4	SNP	0.981	T
FBRSL1	57666	genome.wustl.edu	37	12	133067417	133067417	+	Silent	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr12:133067417C>A	ENST00000434748.2	+	1	1281	c.261C>A	c.(259-261)atC>atA	p.I87I	FBRSL1_ENST00000261673.6_Silent_p.I14I	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	87							poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						GCTTCGCCATCGCCAGCTTCA	0.756																																						dbGAP											0													12.0	13.0	13.0					12																	133067417		687	1589	2276	-	-	-	SO:0001819	synonymous_variant	0				CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.261C>A	12.37:g.133067417C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XQ1	Silent	SNP	prints_AUTS2	p.I87	ENST00000434748.2	37	c.261	CCDS45010.1	12																																																																																			FBRSL1	-	NULL	ENSG00000112787		0.756	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBRSL1	HGNC	protein_coding	OTTHUMT00000397404.2	21	0.00	0	C			133067417	133067417	+1	no_errors	ENST00000434748	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	1.000	A
FBXL6	26233	genome.wustl.edu	37	8	145580670	145580670	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr8:145580670G>T	ENST00000331890.5	-	4	815	c.751C>A	c.(751-753)Ctg>Atg	p.L251M	FBXL6_ENST00000455319.2_Missense_Mutation_p.L245M|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|FBXL6_ENST00000526524.1_5'UTR|SLC52A2_ENST00000532887.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	251					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGTAGGTCCAGGCTATGGAGC	0.622																																						dbGAP											0													49.0	49.0	49.0					8																	145580670		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.751C>A	8.37:g.145580670G>T	ENSP00000330098:p.Leu251Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp	p.L251M	ENST00000331890.5	37	c.751	CCDS6422.1	8	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502445	0.64298	.	.	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.57595	3.79;0.39	4.78	3.9	0.45041	.	0.101544	0.40469	N	0.001084	T	0.72120	0.3421	M	0.85542	2.76	0.36832	D	0.88693	D;D	0.76494	0.999;0.999	D;D	0.72075	0.946;0.976	T	0.78969	-0.1994	10	0.72032	D	0.01	-3.0348	10.4265	0.44380	0.0963:0.0:0.9037:0.0	.	251;245	Q8N531;Q8N531-2	FBXL6_HUMAN;.	M	245;251	ENSP00000403873:L245M;ENSP00000330098:L251M	ENSP00000330098:L251M	L	-	1	2	FBXL6	145551478	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	0.482000	0.22276	0.997000	0.38969	0.563000	0.77884	CTG	FBXL6	-	NULL	ENSG00000182325		0.622	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL6	HGNC	protein_coding	OTTHUMT00000382413.1	45	0.00	0	G	NM_024555		145580670	145580670	-1	no_errors	ENST00000331890	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
FDX1L	112812	genome.wustl.edu	37	19	10421581	10421581	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:10421581G>T	ENST00000393708.3	-	4	361	c.343C>A	c.(343-345)Cat>Aat	p.H115N	ZGLP1_ENST00000403352.1_5'Flank|ZGLP1_ENST00000403903.3_5'Flank|CTD-2369P2.10_ENST00000452032.2_Missense_Mutation_p.H115N|FDX1L_ENST00000492239.1_5'UTR|FDX1L_ENST00000541276.1_Missense_Mutation_p.H118N|FDX1L_ENST00000494368.1_5'UTR	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like	115	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			ACATACACATGGCAGGTGGAG	0.617																																						dbGAP											0													55.0	47.0	50.0					19																	10421581		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299	ENST00000393708.3:c.343C>A	19.37:g.10421581G>T	ENSP00000377311:p.His115Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8B8	Missense_Mutation	SNP	pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,pfscan_2Fe-2S_ferredoxin-type,prints_Adrenodoxin	p.H115N	ENST00000393708.3	37	c.343	CCDS32905.1	19	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705205	0.68615	.	.	ENSG00000167807	ENST00000541276;ENST00000393708	.	.	.	4.8	4.8	0.61643	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (3);	0.000000	0.85682	D	0.000000	D	0.91643	0.7359	H	0.99830	4.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95380	0.8472	9	0.87932	D	0	-17.0946	15.3471	0.74346	0.0:0.0:1.0:0.0	.	115	Q6P4F2	ADXL_HUMAN	N	118;115	.	ENSP00000377311:H115N	H	-	1	0	FDX1L	10282581	1.000000	0.71417	0.978000	0.43139	0.410000	0.31052	8.296000	0.89940	2.211000	0.71520	0.561000	0.74099	CAT	FDX1L	-	pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,pfscan_2Fe-2S_ferredoxin-type,prints_Adrenodoxin	ENSG00000267673		0.617	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDX1L	Clone_based_vega_gene	protein_coding	OTTHUMT00000280567.2	70	0.00	0	G			10421581	10421581	-1	no_errors	ENST00000393708	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	T
FEZ1	9638	genome.wustl.edu	37	11	125325806	125325806	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:125325806C>T	ENST00000278919.3	-	6	1098	c.864G>A	c.(862-864)atG>atA	p.M288I	FEZ1_ENST00000527350.1_5'UTR	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	288					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		GCCTCTTTTTCATCAGTTCTC	0.522																																					Melanoma(180;509 2033 10762 15939 24711)	dbGAP											0													180.0	161.0	167.0					11																	125325806		2201	4299	6500	-	-	-	SO:0001583	missense	0			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.864G>A	11.37:g.125325806C>T	ENSP00000278919:p.Met288Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O00679|O00728|Q6IBI7	Missense_Mutation	SNP	pfam_FEZ	p.M288I	ENST00000278919.3	37	c.864	CCDS31716.1	11	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194696	0.38806	.	.	ENSG00000149557	ENST00000278919	T	0.28895	1.59	5.62	4.71	0.59529	.	0.351101	0.37857	N	0.001919	T	0.18718	0.0449	N	0.22421	0.69	0.80722	D	1	B;B	0.27416	0.178;0.019	B;B	0.24541	0.054;0.011	T	0.07195	-1.0785	10	0.23302	T	0.38	-13.7856	9.332	0.38027	0.0:0.6498:0.2768:0.0735	.	259;288	B4DKG5;Q99689	.;FEZ1_HUMAN	I	288	ENSP00000278919:M288I	ENSP00000278919:M288I	M	-	3	0	FEZ1	124831016	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.999000	0.29757	1.361000	0.45981	0.563000	0.77884	ATG	FEZ1	-	pfam_FEZ	ENSG00000149557		0.522	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZ1	HGNC	protein_coding	OTTHUMT00000386875.1	58	0.00	0	C	NM_005103		125325806	125325806	-1	no_errors	ENST00000278919	ensembl	human	known	69_37n	missense	27	10.00	3	SNP	0.999	T
FLNB	2317	genome.wustl.edu	37	3	58084492	58084492	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr3:58084492C>A	ENST00000295956.4	+	8	1367	c.1202C>A	c.(1201-1203)aCc>aAc	p.T401N	FLNB_ENST00000429972.2_Missense_Mutation_p.T401N|FLNB_ENST00000357272.4_Missense_Mutation_p.T401N|FLNB_ENST00000348383.5_Missense_Mutation_p.T401N|FLNB_ENST00000358537.3_Missense_Mutation_p.T401N|FLNB_ENST00000490882.1_Missense_Mutation_p.T401N|FLNB_ENST00000419752.2_Missense_Mutation_p.T232N|FLNB_ENST00000493452.1_Missense_Mutation_p.T232N	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	401					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGGAAGAACACCGTGGAGTTG	0.532																																						dbGAP											0													253.0	218.0	230.0					3																	58084492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1202C>A	3.37:g.58084492C>A	ENSP00000295956:p.Thr401Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T401N	ENST00000295956.4	37	c.1202	CCDS2885.1	3	.	.	.	.	.	.	.	.	.	.	C	6.875	0.530845	0.13127	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.28	1.09	0.20402	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.522574	0.22672	N	0.057046	T	0.77039	0.4072	L	0.54908	1.71	0.09310	N	1	B;B;B;B;B;B	0.10296	0.001;0.003;0.003;0.001;0.003;0.003	B;B;B;B;B;B	0.20577	0.005;0.03;0.008;0.008;0.008;0.008	T	0.66756	-0.5843	10	0.62326	D	0.03	.	1.7432	0.02957	0.1374:0.4367:0.1431:0.2828	.	401;401;232;232;401;401	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	N	401;401;401;401;401;401;232;232	ENSP00000295956:T401N;ENSP00000420213:T401N;ENSP00000351339:T401N;ENSP00000415599:T401N;ENSP00000232447:T401N;ENSP00000349819:T401N;ENSP00000418510:T232N;ENSP00000414532:T232N	ENSP00000295956:T401N	T	+	2	0	FLNB	58059532	0.593000	0.26840	0.031000	0.17742	0.039000	0.13416	1.575000	0.36493	0.289000	0.22422	0.561000	0.74099	ACC	FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.532	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	125	0.79	1	C	NM_001457		58084492	58084492	+1	no_errors	ENST00000295956	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.059	A
FLNB	2317	genome.wustl.edu	37	3	58084492	58084492	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:58084492C>A	ENST00000295956.4	+	8	1367	c.1202C>A	c.(1201-1203)aCc>aAc	p.T401N	FLNB_ENST00000429972.2_Missense_Mutation_p.T401N|FLNB_ENST00000357272.4_Missense_Mutation_p.T401N|FLNB_ENST00000348383.5_Missense_Mutation_p.T401N|FLNB_ENST00000358537.3_Missense_Mutation_p.T401N|FLNB_ENST00000490882.1_Missense_Mutation_p.T401N|FLNB_ENST00000419752.2_Missense_Mutation_p.T232N|FLNB_ENST00000493452.1_Missense_Mutation_p.T232N	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	401					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGGAAGAACACCGTGGAGTTG	0.532																																						dbGAP											0													253.0	218.0	230.0					3																	58084492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1202C>A	3.37:g.58084492C>A	ENSP00000295956:p.Thr401Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T401N	ENST00000295956.4	37	c.1202	CCDS2885.1	3	.	.	.	.	.	.	.	.	.	.	C	6.875	0.530845	0.13127	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.28	1.09	0.20402	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.522574	0.22672	N	0.057046	T	0.77039	0.4072	L	0.54908	1.71	0.09310	N	1	B;B;B;B;B;B	0.10296	0.001;0.003;0.003;0.001;0.003;0.003	B;B;B;B;B;B	0.20577	0.005;0.03;0.008;0.008;0.008;0.008	T	0.66756	-0.5843	10	0.62326	D	0.03	.	1.7432	0.02957	0.1374:0.4367:0.1431:0.2828	.	401;401;232;232;401;401	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	N	401;401;401;401;401;401;232;232	ENSP00000295956:T401N;ENSP00000420213:T401N;ENSP00000351339:T401N;ENSP00000415599:T401N;ENSP00000232447:T401N;ENSP00000349819:T401N;ENSP00000418510:T232N;ENSP00000414532:T232N	ENSP00000295956:T401N	T	+	2	0	FLNB	58059532	0.593000	0.26840	0.031000	0.17742	0.039000	0.13416	1.575000	0.36493	0.289000	0.22422	0.561000	0.74099	ACC	FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.532	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	116	0.00	0	C	NM_001457		58084492	58084492	+1	no_errors	ENST00000295956	ensembl	human	known	69_37n	missense	183	10.29	21	SNP	0.059	A
FMNL1	752	genome.wustl.edu	37	17	43323301	43323301	+	Silent	SNP	C	C	A	rs200394335		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:43323301C>A	ENST00000331495.3	+	24	3387	c.3051C>A	c.(3049-3051)ggC>ggA	p.G1017G	MAP3K14-AS1_ENST00000591263.1_RNA|CTD-2020K17.4_ENST00000420431.2_RNA|FMNL1_ENST00000328118.3_Silent_p.G1017G|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|CTD-2020K17.4_ENST00000591361.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|CTD-2020K17.4_ENST00000589518.1_RNA|FMNL1_ENST00000587489.1_Silent_p.G595G|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	1017	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						AGGAGGCAGGCGCTGATACCC	0.622																																					GBM(164;1247 1997 8702 11086 51972)	dbGAP											0													22.0	24.0	23.0					17																	43323301		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.3051C>A	17.37:g.43323301C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Missense_Mutation	SNP	NULL	p.R50S	ENST00000331495.3	37	c.148	CCDS11497.1	17																																																																																			FMNL1	-	NULL	ENSG00000184922		0.622	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL1	HGNC	protein_coding	OTTHUMT00000450198.1	43	0.00	0	C	NM_005892		43323301	43323301	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000586092	ensembl	human	putative	69_37n	missense	34	10.53	4	SNP	0.000	A
GNL1	2794	genome.wustl.edu	37	6	30520272	30520272	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:30520272C>T	ENST00000376621.3	-	8	2041	c.1071G>A	c.(1069-1071)aaG>aaA	p.K357K		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	357	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CCACCCCATCCTTGTAGCGCT	0.577																																						dbGAP											0													164.0	136.0	145.0					6																	30520272		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.1071G>A	6.37:g.30520272C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0S838|Q96CT5	Silent	SNP	pfam_GTP_binding_domain	p.K357	ENST00000376621.3	37	c.1071	CCDS4680.1	6																																																																																			GNL1	-	NULL	ENSG00000204590		0.577	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL1	HGNC	protein_coding	OTTHUMT00000076241.2	54	0.00	0	C			30520272	30520272	-1	no_errors	ENST00000376621	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	1.000	T
GRIN1	2902	genome.wustl.edu	37	9	140055811	140055811	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:140055811G>T	ENST00000371561.3	+	10	2507	c.1410G>T	c.(1408-1410)atG>atT	p.M470I	GRIN1_ENST00000371555.4_Missense_Mutation_p.M491I|GRIN1_ENST00000371550.4_Missense_Mutation_p.M470I|GRIN1_ENST00000315048.3_Missense_Mutation_p.M470I|GRIN1_ENST00000371560.3_Missense_Mutation_p.M491I|GRIN1_ENST00000350902.5_Missense_Mutation_p.M470I|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371553.3_Missense_Mutation_p.M491I|GRIN1_ENST00000371546.4_Missense_Mutation_p.M491I|GRIN1_ENST00000371559.4_Missense_Mutation_p.M470I	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	470					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACGGACCATGAACTTCACCT	0.647																																					NSCLC(113;717 1653 2089 20474 37618)	dbGAP											0													80.0	62.0	68.0					9																	140055811		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.1410G>T	9.37:g.140055811G>T	ENSP00000360616:p.Met470Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_CaM-bd_C0_NMDA_rcpt_NR1,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.M470I	ENST00000371561.3	37	c.1410	CCDS7031.1	9	.	.	.	.	.	.	.	.	.	.	-	12.11	1.840977	0.32513	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	4.13	4.13	0.48395	Extracellular solute-binding protein, family 3 (1);Glutamate receptor, L-glutamate/glycine-binding (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	U	0.000000	T	0.18923	0.0454	N	0.12422	0.21	0.80722	D	1	B;B;B;B;B;B	0.22146	0.038;0.002;0.053;0.03;0.065;0.001	B;B;B;B;B;B	0.26770	0.046;0.004;0.027;0.044;0.073;0.007	T	0.06127	-1.0844	10	0.19147	T	0.46	.	14.976	0.71273	0.0:0.0:1.0:0.0	.	491;491;470;470;470;470	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	I	470;470;470;470;491;491;491;470;491	ENSP00000360616:M470I;ENSP00000316696:M470I;ENSP00000316915:M470I;ENSP00000360605:M470I;ENSP00000360601:M491I;ENSP00000360610:M491I;ENSP00000360608:M491I;ENSP00000360614:M470I;ENSP00000360615:M491I	ENSP00000316696:M470I	M	+	3	0	GRIN1	139175632	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.231000	0.78106	1.849000	0.53698	0.298000	0.19748	ATG	GRIN1	-	pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd	ENSG00000176884		0.647	GRIN1-002	KNOWN	basic|CCDS	protein_coding	GRIN1	HGNC	protein_coding	OTTHUMT00000055267.3	41	0.00	0	G	NM_007327		140055811	140055811	+1	no_errors	ENST00000371561	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	T
GRPR	2925	genome.wustl.edu	37	X	16170652	16170652	+	Silent	SNP	C	C	A	rs199603772		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:16170652C>A	ENST00000380289.2	+	3	1437	c.1039C>A	c.(1039-1041)Cgg>Agg	p.R347R	RP11-431J24.2_ENST00000435789.1_RNA|RP11-431J24.2_ENST00000454712.2_RNA|RP11-431J24.2_ENST00000422438.1_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	347					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					CCTGATCATCCGGTCTCACAG	0.537																																						dbGAP											0													152.0	130.0	137.0					X																	16170652		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.1039C>A	X.37:g.16170652C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R910	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Bombsn_rcpt,prints_Gastrin_pep_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.R347	ENST00000380289.2	37	c.1039	CCDS14174.1	X	.	.	.	.	.	.	.	.	.	.	C	2.489	-0.317787	0.05386	.	.	ENSG00000126010	ENST00000535371	.	.	.	5.47	3.44	0.39384	.	.	.	.	.	T	0.31389	0.0795	.	.	.	0.28748	N	0.901566	.	.	.	.	.	.	T	0.16482	-1.0401	5	0.13108	T	0.6	-10.3179	13.1676	0.59579	0.3968:0.6031:0.0:0.0	.	.	.	.	Q	135	.	ENSP00000442239:P135Q	P	+	2	0	GRPR	16080573	0.316000	0.24580	0.124000	0.21820	0.517000	0.34286	0.928000	0.28831	1.026000	0.39733	0.600000	0.82982	CCG	GRPR	-	prints_Gastrin_pep_rcpt	ENSG00000126010		0.537	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRPR	HGNC	protein_coding	OTTHUMT00000055901.1	41	0.00	0	C	NM_005314		16170652	16170652	+1	no_errors	ENST00000380289	ensembl	human	known	69_37n	silent	23	14.81	4	SNP	0.190	A
GTF2IRD2B	389524	genome.wustl.edu	37	7	74564125	74564125	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr7:74564125G>A	ENST00000312575.7	+	16	2047	c.1872G>A	c.(1870-1872)atG>atA	p.M624I	GTF2IRD2B_ENST00000418185.2_Missense_Mutation_p.M171I	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B	624					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|ovary(2)|prostate(1)	4						ccccagcgatggtggatgcca	0.507																																						dbGAP											0													57.0	58.0	58.0					7																	74564125		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.1872G>A	7.37:g.74564125G>A	ENSP00000308080:p.Met624Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNE9|Q69GU6|Q8N979|Q9H739	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,superfamily_RNaseH-like_dom,pfscan_GTF2I	p.M624I	ENST00000312575.7	37	c.1872	CCDS34659.1	7	.	.	.	.	.	.	.	.	.	.	G	7.534	0.659382	0.14645	.	.	ENSG00000174428	ENST00000312575;ENST00000418185;ENST00000412484	T;T	0.20463	2.07;2.07	1.53	1.53	0.23141	Ribonuclease H-like (1);	.	.	.	.	T	0.38772	0.1053	M	0.66378	2.025	0.09310	N	1	D;P	0.61080	0.989;0.851	D;P	0.72982	0.979;0.775	T	0.06826	-1.0805	9	0.87932	D	0	-21.3084	6.5351	0.22348	0.0:0.0:1.0:0.0	.	119;624	Q86Y00;Q6EKJ0	.;GTD2B_HUMAN	I	624;171;39	ENSP00000308080:M624I;ENSP00000411454:M171I	ENSP00000308080:M624I	M	+	3	0	GTF2IRD2B	74202061	0.876000	0.30132	0.034000	0.17996	0.537000	0.34900	2.212000	0.42835	1.164000	0.42652	0.430000	0.28490	ATG	GTF2IRD2B	-	superfamily_RNaseH-like_dom	ENSG00000174428		0.507	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2B	HGNC	protein_coding	OTTHUMT00000342728.1	77	0.00	0	G	NM_001003795		74564125	74564125	+1	no_errors	ENST00000312575	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	0.043	A
GTF3C1	2975	genome.wustl.edu	37	16	27512555	27512555	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:27512555C>T	ENST00000356183.4	-	12	2033	c.2018G>A	c.(2017-2019)cGa>cAa	p.R673Q	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R673Q	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	673					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CCGATACAATCGCAAGAGACC	0.532																																						dbGAP											0													149.0	118.0	129.0					16																	27512555		2197	4300	6497	-	-	-	SO:0001583	missense	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.2018G>A	16.37:g.27512555C>T	ENSP00000348510:p.Arg673Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.R673Q	ENST00000356183.4	37	c.2018	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222209	0.79464	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.25085	1.82	5.22	5.22	0.72569	.	0.053223	0.64402	D	0.000001	T	0.52996	0.1769	M	0.75447	2.3	0.38465	D	0.947302	D;D	0.89917	1.0;1.0	D;D	0.77004	0.943;0.989	T	0.56013	-0.8049	10	0.48119	T	0.1	-19.5092	18.7695	0.91885	0.0:1.0:0.0:0.0	.	673;673	Q12789;Q12789-3	TF3C1_HUMAN;.	Q	673;671	ENSP00000348510:R673Q	ENSP00000348510:R673Q	R	-	2	0	GTF3C1	27420056	0.998000	0.40836	0.021000	0.16686	0.615000	0.37417	4.255000	0.58804	2.586000	0.87340	0.563000	0.77884	CGA	GTF3C1	-	NULL	ENSG00000077235		0.532	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	40	0.00	0	C	NM_001520		27512555	27512555	-1	no_errors	ENST00000356183	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.956	T
HDAC6	10013	genome.wustl.edu	37	X	48675796	48675796	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:48675796G>T	ENST00000334136.5	+	20	2033	c.1855G>T	c.(1855-1857)Ggt>Tgt	p.G619C	HDAC6_ENST00000444343.2_Missense_Mutation_p.G633C|HDAC6_ENST00000376619.2_Missense_Mutation_p.G619C			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	619	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	TGCAGCTTGCGGTTTTTGCTT	0.597																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													88.0	65.0	73.0					X																	48675796		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1855G>T	X.37:g.48675796G>T	ENSP00000334061:p.Gly619Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.G633C	ENST00000334136.5	37	c.1897	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759010	0.89843	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813	D;D;D	0.97575	-4.44;-4.44;-4.44	5.44	5.44	0.79542	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.99168	0.9712	H	0.98918	4.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98866	1.0764	10	0.87932	D	0	-15.0045	15.568	0.76309	0.0:0.0:1.0:0.0	.	609;267;619	B4DZN1;B3KVK5;Q9UBN7	.;.;HDAC6_HUMAN	C	633;619;619;619	ENSP00000398566:G633C;ENSP00000334061:G619C;ENSP00000365804:G619C	ENSP00000334061:G619C	G	+	1	0	HDAC6	48560740	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.992000	0.93519	2.270000	0.75569	0.544000	0.68410	GGT	HDAC6	-	pfam_His_deacetylse_dom,prints_His_deacetylse	ENSG00000094631		0.597	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	86	0.00	0	G	NM_006044		48675796	48675796	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	T
HDAC6	10013	genome.wustl.edu	37	X	48675830	48675830	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:48675830C>T	ENST00000334136.5	+	20	2067	c.1889C>T	c.(1888-1890)gCt>gTt	p.A630V	HDAC6_ENST00000444343.2_Missense_Mutation_p.A644V|HDAC6_ENST00000376619.2_Missense_Mutation_p.A630V			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	630	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GCTGTGGCTGCTCGCCATGCC	0.602																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													70.0	52.0	58.0					X																	48675830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1889C>T	X.37:g.48675830C>T	ENSP00000334061:p.Ala630Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.A644V	ENST00000334136.5	37	c.1931	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	C	34	5.376767	0.95945	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813	T;T;T	0.74737	-0.87;-0.87;-0.87	5.44	5.44	0.79542	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.85234	0.5650	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.997	D	0.86525	0.1818	10	0.62326	D	0.03	-13.1432	15.568	0.76309	0.0:1.0:0.0:0.0	.	620;278;630	B4DZN1;B3KVK5;Q9UBN7	.;.;HDAC6_HUMAN	V	644;630;630;630	ENSP00000398566:A644V;ENSP00000334061:A630V;ENSP00000365804:A630V	ENSP00000334061:A630V	A	+	2	0	HDAC6	48560774	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.457000	0.66672	2.270000	0.75569	0.544000	0.68410	GCT	HDAC6	-	pfam_His_deacetylse_dom,prints_His_deacetylse	ENSG00000094631		0.602	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	85	0.00	0	C	NM_006044		48675830	48675830	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	missense	25	13.33	4	SNP	1.000	T
HDAC7	51564	genome.wustl.edu	37	12	48192718	48192718	+	5'UTR	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr12:48192718C>A	ENST00000427332.2	-	0	147				HDAC7_ENST00000354334.3_Missense_Mutation_p.Q36H|HDAC7_ENST00000552960.1_Missense_Mutation_p.Q19H|HDAC7_ENST00000380610.4_Missense_Mutation_p.Q53H|HDAC7_ENST00000080059.7_Missense_Mutation_p.Q36H			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7						cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		TGGGCTGCGGCTGAGGGCCTG	0.682																																						dbGAP											0													5.0	7.0	6.0					12																	48192718		2098	4182	6280	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.-10G>T	12.37:g.48192718C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.Q53H	ENST00000427332.2	37	c.159		12	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793571	0.70452	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000430670;ENST00000440293;ENST00000417902	T;T;T;T;T	0.57436	0.46;0.4;0.47;0.42;0.77	3.92	3.92	0.45320	.	1.482200	0.04882	N	0.447809	T	0.65575	0.2704	L	0.36672	1.1	0.80722	D	1	D;D;D	0.60575	0.988;0.988;0.988	D;D;D	0.72338	0.977;0.977;0.977	T	0.54655	-0.8261	10	0.49607	T	0.09	.	11.6317	0.51178	0.0:1.0:0.0:0.0	.	36;19;36	Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.;.;.	H	36;36;19;53;36;19;19	ENSP00000080059:Q36H;ENSP00000351326:Q36H;ENSP00000448532:Q19H;ENSP00000369984:Q53H;ENSP00000396159:Q36H	ENSP00000080059:Q36H	Q	-	3	2	HDAC7	46478985	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.383000	0.44354	2.204000	0.70986	0.561000	0.74099	CAG	HDAC7	-	pirsf_Histone_deAcase_II_euk	ENSG00000061273		0.682	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	HDAC7	HGNC	protein_coding	OTTHUMT00000328804.2	23	0.00	0	C			48192718	48192718	-1	no_errors	ENST00000380610	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	A
MROH7	374977	genome.wustl.edu	37	1	55119150	55119150	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:55119150G>T	ENST00000421030.2	+	3	836	c.551G>T	c.(550-552)aGa>aTa	p.R184I	MROH7_ENST00000472987.1_3'UTR|MROH7_ENST00000339553.5_Missense_Mutation_p.R184I|MROH7_ENST00000545244.1_Intron|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000395690.2_Missense_Mutation_p.R184I|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.R184I|MROH7_ENST00000409996.1_Intron	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	184						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CACCATTCCAGAGAAGGTCTG	0.458																																						dbGAP											0													80.0	77.0	78.0					1																	55119150		1900	4126	6026	-	-	-	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.551G>T	1.37:g.55119150G>T	ENSP00000396622:p.Arg184Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R184I	ENST00000421030.2	37	c.551	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.337740	0.41398	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000339553;ENST00000395690	T;T;T	0.03717	4.35;3.83;3.84	3.39	1.34	0.21922	.	0.680898	0.12142	N	0.495798	T	0.04407	0.0121	L	0.29908	0.895	0.09310	N	1	P;P;P	0.47677	0.899;0.899;0.899	P;B;P	0.48227	0.466;0.371;0.571	T	0.40887	-0.9539	10	0.87932	D	0	.	4.4031	0.11397	0.3863:0.0:0.6137:0.0	.	184;184;184	F8W8P2;Q68CQ1;Q68CQ1-4	.;HEAT8_HUMAN;.	I	184	ENSP00000396622:R184I;ENSP00000343211:R184I;ENSP00000379044:R184I	ENSP00000343211:R184I	R	+	2	0	HEATR8	54891738	0.951000	0.32395	0.002000	0.10522	0.021000	0.10359	1.140000	0.31516	0.347000	0.23924	0.561000	0.74099	AGA	HEATR8	-	NULL	ENSG00000184313		0.458	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	42	0.00	0	G	NM_198547		55119150	55119150	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.003	T
MROH7	374977	genome.wustl.edu	37	1	55144468	55144468	+	Missense_Mutation	SNP	C	C	A	rs201099211		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:55144468C>A	ENST00000421030.2	+	11	2275	c.1990C>A	c.(1990-1992)Cat>Aat	p.H664N	MROH7_ENST00000339553.5_Missense_Mutation_p.H664N|MROH7_ENST00000545244.1_Missense_Mutation_p.H232N|MROH7_ENST00000454855.2_Missense_Mutation_p.H182N|MROH7_ENST00000395690.2_Missense_Mutation_p.H664N|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.H664N|MROH7_ENST00000409996.1_Missense_Mutation_p.H232N	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	664						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GAGCAACAAGCATTTCCTGGG	0.552																																						dbGAP											0													93.0	102.0	100.0					1																	55144468		1973	4142	6115	-	-	-	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.1990C>A	1.37:g.55144468C>A	ENSP00000396622:p.His664Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H664N	ENST00000421030.2	37	c.1990	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580092	0.28180	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	5.05	3.06	0.35304	.	0.697850	0.12581	N	0.456418	T	0.14614	0.0353	N	0.08118	0	0.23204	N	0.998123	B;B;B	0.19817	0.039;0.008;0.001	B;B;B	0.18561	0.022;0.009;0.0	T	0.16041	-1.0416	10	0.39692	T	0.17	0.7027	5.4844	0.16741	0.1973:0.7017:0.0:0.101	.	664;664;232	F8W8P2;Q68CQ1;F5H7R4	.;HEAT8_HUMAN;.	N	664;232;693;664;232;182;664	ENSP00000396622:H664N;ENSP00000442333:H232N;ENSP00000343211:H664N;ENSP00000387048:H232N;ENSP00000401130:H182N;ENSP00000379044:H664N	ENSP00000343211:H664N	H	+	1	0	HEATR8	54917056	0.973000	0.33851	0.999000	0.59377	0.961000	0.63080	1.155000	0.31700	1.123000	0.41961	0.563000	0.77884	CAT	HEATR8	-	superfamily_ARM-type_fold	ENSG00000184313		0.552	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	41	0.00	0	C	NM_198547		55144468	55144468	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.983	A
HIST1H3G	8355	genome.wustl.edu	37	6	26271575	26271575	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr6:26271575C>T	ENST00000305910.3	-	1	37	c.38G>A	c.(37-39)gGt>gAt	p.G13D	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	13					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						CGCTTTGCCACCGGTGGACTT	0.602																																						dbGAP											0													26.0	31.0	29.0					6																	26271575		2198	4298	6496	-	-	-	SO:0001583	missense	0			Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.38G>A	6.37:g.26271575C>T	ENSP00000439660:p.Gly13Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.G13D	ENST00000305910.3	37	c.38	CCDS4602.1	6	.	.	.	.	.	.	.	.	.	.	.	11.02	1.516320	0.27123	.	.	ENSG00000256018	ENST00000305910	T	0.46063	0.88	4.56	4.56	0.56223	.	.	.	.	.	T	0.52208	0.1720	.	.	.	0.44635	D	0.997616	.	.	.	.	.	.	T	0.58042	-0.7706	6	0.66056	D	0.02	.	16.7227	0.85414	0.0:1.0:0.0:0.0	.	.	.	.	D	13	ENSP00000439660:G13D	ENSP00000439660:G13D	G	-	2	0	HIST1H3G	26379554	1.000000	0.71417	0.941000	0.38009	0.081000	0.17604	7.633000	0.83260	2.265000	0.75225	0.563000	0.77884	GGT	HIST1H3G	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000256018		0.602	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3G	HGNC	protein_coding	OTTHUMT00000040099.2	21	0.00	0	C	NM_003534		26271575	26271575	-1	no_errors	ENST00000305910	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	1.000	T
HIST1H3G	8355	genome.wustl.edu	37	6	26271575	26271575	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:26271575C>T	ENST00000305910.3	-	1	37	c.38G>A	c.(37-39)gGt>gAt	p.G13D	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	13					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						CGCTTTGCCACCGGTGGACTT	0.602																																						dbGAP											0													26.0	31.0	29.0					6																	26271575		2198	4298	6496	-	-	-	SO:0001583	missense	0			Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.38G>A	6.37:g.26271575C>T	ENSP00000439660:p.Gly13Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.G13D	ENST00000305910.3	37	c.38	CCDS4602.1	6	.	.	.	.	.	.	.	.	.	.	.	11.02	1.516320	0.27123	.	.	ENSG00000256018	ENST00000305910	T	0.46063	0.88	4.56	4.56	0.56223	.	.	.	.	.	T	0.52208	0.1720	.	.	.	0.44635	D	0.997616	.	.	.	.	.	.	T	0.58042	-0.7706	6	0.66056	D	0.02	.	16.7227	0.85414	0.0:1.0:0.0:0.0	.	.	.	.	D	13	ENSP00000439660:G13D	ENSP00000439660:G13D	G	-	2	0	HIST1H3G	26379554	1.000000	0.71417	0.941000	0.38009	0.081000	0.17604	7.633000	0.83260	2.265000	0.75225	0.563000	0.77884	GGT	HIST1H3G	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000256018		0.602	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3G	HGNC	protein_coding	OTTHUMT00000040099.2	81	0.00	0	C	NM_003534		26271575	26271575	-1	no_errors	ENST00000305910	ensembl	human	known	69_37n	missense	111	46.63	97	SNP	1.000	T
HIST1H3G	8355	genome.wustl.edu	37	6	26271575	26271575	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:26271575C>T	ENST00000305910.3	-	1	37	c.38G>A	c.(37-39)gGt>gAt	p.G13D	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	13					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						CGCTTTGCCACCGGTGGACTT	0.602																																						dbGAP											0													26.0	31.0	29.0					6																	26271575		2198	4298	6496	-	-	-	SO:0001583	missense	0			Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.38G>A	6.37:g.26271575C>T	ENSP00000439660:p.Gly13Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.G13D	ENST00000305910.3	37	c.38	CCDS4602.1	6	.	.	.	.	.	.	.	.	.	.	.	11.02	1.516320	0.27123	.	.	ENSG00000256018	ENST00000305910	T	0.46063	0.88	4.56	4.56	0.56223	.	.	.	.	.	T	0.52208	0.1720	.	.	.	0.44635	D	0.997616	.	.	.	.	.	.	T	0.58042	-0.7706	6	0.66056	D	0.02	.	16.7227	0.85414	0.0:1.0:0.0:0.0	.	.	.	.	D	13	ENSP00000439660:G13D	ENSP00000439660:G13D	G	-	2	0	HIST1H3G	26379554	1.000000	0.71417	0.941000	0.38009	0.081000	0.17604	7.633000	0.83260	2.265000	0.75225	0.563000	0.77884	GGT	HIST1H3G	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000256018		0.602	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3G	HGNC	protein_coding	OTTHUMT00000040099.2	81	0.00	0	C	NM_003534		26271575	26271575	-1	no_errors	ENST00000305910	ensembl	human	known	69_37n	missense	92	35.21	50	SNP	1.000	T
HLA-DRB5	3127	genome.wustl.edu	37	6	32489813	32489813	+	Missense_Mutation	SNP	G	G	C	rs79606458	byFrequency	TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:32489813G>C	ENST00000374975.3	-	2	301	c.239C>G	c.(238-240)aCg>aGg	p.T80R		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						CCCCAGCTCCGTCACCGCCCG	0.627																																						dbGAP											0													40.0	36.0	38.0					6																	32489813		2164	4222	6386	-	-	-	SO:0001583	missense	0				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.239C>G	6.37:g.32489813G>C	ENSP00000364114:p.Thr80Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.T80R	ENST00000374975.3	37	c.239	CCDS4751.1	6	364	0.16666666666666666	117	0.23780487804878048	54	0.14917127071823205	79	0.1381118881118881	114	0.1503957783641161	.	16.99	3.274195	0.59649	.	.	ENSG00000198502	ENST00000374975	T	0.00402	7.56	4.72	3.83	0.44106	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (3);MHC classes I/II-like antigen recognition protein (1);	0.544494	0.19749	N	0.106959	T	0.01765	0.0056	H	0.99944	5.01	0.54753	P	1.4999999999987246E-5	D;D	0.89917	0.989;1.0	D;D	0.91635	0.937;0.999	T	0.02257	-1.1187	9	0.72032	D	0.01	.	12.6105	0.56547	0.0:0.1687:0.8313:0.0	rs41543012	7;80	Q29973;Q30154	.;DRB5_HUMAN	R	80	ENSP00000364114:T80R	ENSP00000364114:T80R	T	-	2	0	HLA-DRB5	32597791	0.241000	0.23857	0.004000	0.12327	0.936000	0.57629	1.145000	0.31577	0.958000	0.37956	0.430000	0.28490	ACG	HLA-DRB5	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000198502		0.627	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB5	HGNC	protein_coding	OTTHUMT00000076022.2	23	0.00	0	G	NM_002125		32489813	32489813	-1	no_errors	ENST00000374975	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.050	C
HS3ST6	64711	genome.wustl.edu	37	16	1961621	1961621	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:1961621C>A	ENST00000293937.3	-	2	998	c.999G>T	c.(997-999)caG>caT	p.Q333H	HS3ST6_ENST00000454677.2_Missense_Mutation_p.Q350H|HS3ST6_ENST00000443547.1_Missense_Mutation_p.Q302H			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	333					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						GGCCCGTCATCTGGTAGAACC	0.692																																						dbGAP											0													10.0	13.0	12.0					16																	1961621		2031	4185	6216	-	-	-	SO:0001583	missense	0					16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.999G>T	16.37:g.1961621C>A	ENSP00000293937:p.Gln333His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96RX7	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.Q333H	ENST00000293937.3	37	c.999		16	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783299	0.49891	.	.	ENSG00000162040	ENST00000293937;ENST00000443547;ENST00000454677	T;T	0.56611	0.45;0.45	4.99	4.03	0.46877	.	0.055758	0.64402	D	0.000001	T	0.49355	0.1552	L	0.55990	1.75	0.80722	D	1	B	0.26744	0.158	B	0.29267	0.1	T	0.50750	-0.8791	10	0.56958	D	0.05	.	12.8483	0.57842	0.0:0.9198:0.0:0.0802	.	333	Q96QI5	HS3S6_HUMAN	H	333;302;372	ENSP00000293937:Q333H;ENSP00000390354:Q302H	ENSP00000293937:Q333H	Q	-	3	2	HS3ST6	1901622	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.067000	0.41461	1.103000	0.41568	0.505000	0.49811	CAG	HS3ST6	-	NULL	ENSG00000162040		0.692	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	HS3ST6	HGNC	protein_coding		67	0.00	0	C	NM_001009606		1961621	1961621	-1	no_errors	ENST00000293937	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	1.000	A
HSD11B2	3291	genome.wustl.edu	37	16	67470185	67470185	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:67470185G>T	ENST00000326152.5	+	4	830	c.698G>T	c.(697-699)gGa>gTa	p.G233V	ATP6V0D1_ENST00000567694.1_5'Flank	NM_000196.3	NP_000187.3	P80365	DHI2_HUMAN	hydroxysteroid (11-beta) dehydrogenase 2	233					female pregnancy (GO:0007565)|glucocorticoid biosynthetic process (GO:0006704)|regulation of blood volume by renal aldosterone (GO:0002017)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)	11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)|NAD binding (GO:0051287)|steroid binding (GO:0005496)			breast(1)|endometrium(1)|liver(2)|lung(3)|upper_aerodigestive_tract(1)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0401)|Epithelial(162;0.0891)		GGGGCCTATGGAACCTCCAAA	0.617																																						dbGAP											0													115.0	118.0	117.0					16																	67470185		2198	4300	6498	-	-	-	SO:0001583	missense	0			U14631	CCDS10837.1	16q22	2011-09-14			ENSG00000176387	ENSG00000176387	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5209	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 3"""	614232				7859916, 8611140, 19027726	Standard	NM_000196		Approved	SDR9C3	uc002etd.3	P80365	OTTHUMG00000137507	ENST00000326152.5:c.698G>T	16.37:g.67470185G>T	ENSP00000316786:p.Gly233Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7LB28|C5HTY7|Q13194|Q6P2G9|Q8N439|Q96QN8|Q9UC50|Q9UC51|Q9UCW5|Q9UCW6|Q9UCW7|Q9UCW8	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH	p.G233V	ENST00000326152.5	37	c.698	CCDS10837.1	16	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615961	0.87359	.	.	ENSG00000176387	ENST00000326152	D	0.87966	-2.32	5.29	5.29	0.74685	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.91129	0.7207	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91667	0.5347	10	0.59425	D	0.04	.	17.5064	0.87747	0.0:0.0:1.0:0.0	.	233	P80365	DHI2_HUMAN	V	233	ENSP00000316786:G233V	ENSP00000316786:G233V	G	+	2	0	HSD11B2	66027686	1.000000	0.71417	0.999000	0.59377	0.922000	0.55478	7.514000	0.81750	2.452000	0.82932	0.563000	0.77884	GGA	HSD11B2	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH	ENSG00000176387		0.617	HSD11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD11B2	HGNC	protein_coding	OTTHUMT00000268826.3	68	0.00	0	G	NM_000196		67470185	67470185	+1	no_errors	ENST00000326152	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	T
ICK	22858	genome.wustl.edu	37	6	52884080	52884080	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:52884080A>C	ENST00000350082.5	-	6	782	c.436T>G	c.(436-438)Ttg>Gtg	p.L146V	ICK_ENST00000356971.3_Missense_Mutation_p.L146V	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					TCTCGGGCCAAACCAAAGTCT	0.383																																						dbGAP											0													91.0	87.0	88.0					6																	52884080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.436T>G	6.37:g.52884080A>C	ENSP00000263043:p.Leu146Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L146V	ENST00000350082.5	37	c.436	CCDS4949.1	6	.	.	.	.	.	.	.	.	.	.	A	18.42	3.619872	0.66787	.	.	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.70516	-0.49;-0.49	5.04	0.0735	0.14391	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.72581	0.3478	M	0.67625	2.065	0.53005	D	0.99996	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.98	T	0.74456	-0.3659	10	0.87932	D	0	-18.692	10.068	0.42315	0.5477:0.0:0.4523:0.0	.	146;146	Q9UPZ9-2;Q9UPZ9	.;ICK_HUMAN	V	146	ENSP00000263043:L146V;ENSP00000349458:L146V	ENSP00000263043:L146V	L	-	1	2	ICK	52992039	0.990000	0.36364	0.584000	0.28653	0.997000	0.91878	1.876000	0.39588	-0.055000	0.13244	0.533000	0.62120	TTG	ICK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000112144		0.383	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICK	HGNC	protein_coding	OTTHUMT00000040952.1	59	0.00	0	A	NM_016513		52884080	52884080	-1	no_errors	ENST00000350082	ensembl	human	known	69_37n	missense	73	13.10	11	SNP	0.771	C
IGLV4-3	28786	genome.wustl.edu	37	22	23214055	23214055	+	RNA	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:23214055G>T	ENST00000390318.2	+	0	244									immunoglobulin lambda variable 4-3																		AAGGTTAAGAGTGATGGCAGC	0.562																																						dbGAP											0													120.0	124.0	122.0					22																	23214055		1972	4151	6123	-	-	-			0			X57828		22q11.2	2012-02-08			ENSG00000211672	ENSG00000211672		"""Immunoglobulins / IGL locus"""	5919	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151244		22.37:g.23214055G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S71I	ENST00000390318.2	37	c.212		22																																																																																			IGLV4-3	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211672		0.562	IGLV4-3-001	KNOWN	basic|appris_principal	IG_V_gene	IGLV4-3	HGNC	IG_V_gene	OTTHUMT00000321849.1	101	0.00	0	G	NG_000002		23214055	23214055	+1	no_errors	ENST00000390318	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.001	T
IL17RC	84818	genome.wustl.edu	37	3	9959658	9959658	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr3:9959658T>G	ENST00000295981.3	+	3	610	c.392T>G	c.(391-393)gTg>gGg	p.V131G	IL17RC_ENST00000455057.1_Missense_Mutation_p.V60G|IL17RC_ENST00000383812.4_Missense_Mutation_p.V60G|IL17RC_ENST00000413608.1_Missense_Mutation_p.V60G|IL17RC_ENST00000498214.1_3'UTR|RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000416074.2_5'UTR|IL17RC_ENST00000403601.3_Missense_Mutation_p.V60G	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	131					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGGGCCCCGTGCTGGCGCCT	0.627																																						dbGAP											0													61.0	62.0	61.0					3																	9959658		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.392T>G	3.37:g.9959658T>G	ENSP00000295981:p.Val131Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	pfam_SEFIR	p.V131G	ENST00000295981.3	37	c.392	CCDS2590.1	3	.	.	.	.	.	.	.	.	.	.	T	16.50	3.141400	0.57044	.	.	ENSG00000163702	ENST00000383812;ENST00000438091;ENST00000295981;ENST00000436503;ENST00000403601;ENST00000455057;ENST00000413608	T;T;T;T;T;T	0.61859	1.11;0.38;1.03;1.06;0.07;1.05	5.36	5.36	0.76844	.	0.000000	0.53938	D	0.000056	T	0.69424	0.3109	L	0.49778	1.585	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.997	D;D;D;D;D;D;D;D	0.87578	0.998;0.996;0.996;0.994;0.994;0.998;0.996;0.93	T	0.72023	-0.4415	10	0.72032	D	0.01	-22.3166	11.7486	0.51835	0.0:0.0:0.0:1.0	.	60;60;60;60;60;60;131;60	Q8NAC3-4;E9PHG1;A8BWD5;E9PHJ6;A8BWC9;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;I17RC_HUMAN;.	G	60;60;131;60;60;60;60	ENSP00000373323:V60G;ENSP00000414609:V60G;ENSP00000295981:V131G;ENSP00000384969:V60G;ENSP00000407894:V60G;ENSP00000396064:V60G	ENSP00000295981:V131G	V	+	2	0	IL17RC	9934658	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	3.851000	0.55926	2.030000	0.59900	0.459000	0.35465	GTG	IL17RC	-	NULL	ENSG00000163702		0.627	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	HGNC	protein_coding	OTTHUMT00000250526.2	41	0.00	0	T	NM_032732		9959658	9959658	+1	no_errors	ENST00000295981	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	1.000	G
IL17RC	84818	genome.wustl.edu	37	3	9959658	9959658	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:9959658T>G	ENST00000295981.3	+	3	610	c.392T>G	c.(391-393)gTg>gGg	p.V131G	IL17RC_ENST00000455057.1_Missense_Mutation_p.V60G|IL17RC_ENST00000383812.4_Missense_Mutation_p.V60G|IL17RC_ENST00000413608.1_Missense_Mutation_p.V60G|IL17RC_ENST00000498214.1_3'UTR|RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000416074.2_5'UTR|IL17RC_ENST00000403601.3_Missense_Mutation_p.V60G	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	131					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGGGCCCCGTGCTGGCGCCT	0.627																																						dbGAP											0													61.0	62.0	61.0					3																	9959658		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.392T>G	3.37:g.9959658T>G	ENSP00000295981:p.Val131Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	pfam_SEFIR	p.V131G	ENST00000295981.3	37	c.392	CCDS2590.1	3	.	.	.	.	.	.	.	.	.	.	T	16.50	3.141400	0.57044	.	.	ENSG00000163702	ENST00000383812;ENST00000438091;ENST00000295981;ENST00000436503;ENST00000403601;ENST00000455057;ENST00000413608	T;T;T;T;T;T	0.61859	1.11;0.38;1.03;1.06;0.07;1.05	5.36	5.36	0.76844	.	0.000000	0.53938	D	0.000056	T	0.69424	0.3109	L	0.49778	1.585	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.997	D;D;D;D;D;D;D;D	0.87578	0.998;0.996;0.996;0.994;0.994;0.998;0.996;0.93	T	0.72023	-0.4415	10	0.72032	D	0.01	-22.3166	11.7486	0.51835	0.0:0.0:0.0:1.0	.	60;60;60;60;60;60;131;60	Q8NAC3-4;E9PHG1;A8BWD5;E9PHJ6;A8BWC9;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;I17RC_HUMAN;.	G	60;60;131;60;60;60;60	ENSP00000373323:V60G;ENSP00000414609:V60G;ENSP00000295981:V131G;ENSP00000384969:V60G;ENSP00000407894:V60G;ENSP00000396064:V60G	ENSP00000295981:V131G	V	+	2	0	IL17RC	9934658	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	3.851000	0.55926	2.030000	0.59900	0.459000	0.35465	GTG	IL17RC	-	NULL	ENSG00000163702		0.627	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	HGNC	protein_coding	OTTHUMT00000250526.2	35	0.00	0	T	NM_032732		9959658	9959658	+1	no_errors	ENST00000295981	ensembl	human	known	69_37n	missense	31	46.55	27	SNP	1.000	G
IL17RC	84818	genome.wustl.edu	37	3	9959658	9959658	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:9959658T>G	ENST00000295981.3	+	3	610	c.392T>G	c.(391-393)gTg>gGg	p.V131G	IL17RC_ENST00000455057.1_Missense_Mutation_p.V60G|IL17RC_ENST00000383812.4_Missense_Mutation_p.V60G|IL17RC_ENST00000413608.1_Missense_Mutation_p.V60G|IL17RC_ENST00000498214.1_3'UTR|RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000416074.2_5'UTR|IL17RC_ENST00000403601.3_Missense_Mutation_p.V60G	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	131					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGGGCCCCGTGCTGGCGCCT	0.627																																						dbGAP											0													61.0	62.0	61.0					3																	9959658		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.392T>G	3.37:g.9959658T>G	ENSP00000295981:p.Val131Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	pfam_SEFIR	p.V131G	ENST00000295981.3	37	c.392	CCDS2590.1	3	.	.	.	.	.	.	.	.	.	.	T	16.50	3.141400	0.57044	.	.	ENSG00000163702	ENST00000383812;ENST00000438091;ENST00000295981;ENST00000436503;ENST00000403601;ENST00000455057;ENST00000413608	T;T;T;T;T;T	0.61859	1.11;0.38;1.03;1.06;0.07;1.05	5.36	5.36	0.76844	.	0.000000	0.53938	D	0.000056	T	0.69424	0.3109	L	0.49778	1.585	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.997	D;D;D;D;D;D;D;D	0.87578	0.998;0.996;0.996;0.994;0.994;0.998;0.996;0.93	T	0.72023	-0.4415	10	0.72032	D	0.01	-22.3166	11.7486	0.51835	0.0:0.0:0.0:1.0	.	60;60;60;60;60;60;131;60	Q8NAC3-4;E9PHG1;A8BWD5;E9PHJ6;A8BWC9;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;I17RC_HUMAN;.	G	60;60;131;60;60;60;60	ENSP00000373323:V60G;ENSP00000414609:V60G;ENSP00000295981:V131G;ENSP00000384969:V60G;ENSP00000407894:V60G;ENSP00000396064:V60G	ENSP00000295981:V131G	V	+	2	0	IL17RC	9934658	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	3.851000	0.55926	2.030000	0.59900	0.459000	0.35465	GTG	IL17RC	-	NULL	ENSG00000163702		0.627	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	HGNC	protein_coding	OTTHUMT00000250526.2	35	0.00	0	T	NM_032732		9959658	9959658	+1	no_errors	ENST00000295981	ensembl	human	known	69_37n	missense	9	50.00	9	SNP	1.000	G
INPP5J	27124	genome.wustl.edu	37	22	31522448	31522448	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:31522448G>A	ENST00000331075.5	+	3	1407	c.1358G>A	c.(1357-1359)aGc>aAc	p.S453N	INPP5J_ENST00000401755.1_5'Flank|INPP5J_ENST00000412277.2_Missense_Mutation_p.S386N|INPP5J_ENST00000405300.1_Missense_Mutation_p.S86N|INPP5J_ENST00000404453.1_5'Flank|INPP5J_ENST00000400294.2_Missense_Mutation_p.S86N|INPP5J_ENST00000404390.3_Missense_Mutation_p.S85N|INPP5J_ENST00000402238.1_5'Flank	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	453	Catalytic. {ECO:0000255}.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						GGTGACGACAGCGACGGCGCA	0.677																																						dbGAP											0													130.0	137.0	135.0					22																	31522448		2165	4247	6412	-	-	-	SO:0001583	missense	0			U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.1358G>A	22.37:g.31522448G>A	ENSP00000333262:p.Ser453Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.S453N	ENST00000331075.5	37	c.1358		22	.	.	.	.	.	.	.	.	.	.	G	0.511	-0.866569	0.02590	.	.	ENSG00000185133	ENST00000331075;ENST00000412277;ENST00000420017;ENST00000400294;ENST00000405300;ENST00000404390	D;D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66;-3.66	4.8	1.42	0.22433	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.325453	0.34411	N	0.003990	D	0.83482	0.5264	N	0.10707	0.03	0.26127	N	0.980461	B;B	0.19706	0.003;0.038	B;B	0.18871	0.003;0.023	T	0.70842	-0.4762	10	0.15952	T	0.53	.	7.3241	0.26545	0.4603:0.0:0.5397:0.0	.	453;85	Q15735;Q15735-3	PI5PA_HUMAN;.	N	453;386;18;86;86;85	ENSP00000333262:S453N;ENSP00000392924:S386N;ENSP00000383150:S86N;ENSP00000384596:S86N;ENSP00000384534:S85N	ENSP00000333262:S453N	S	+	2	0	INPP5J	29852448	0.991000	0.36638	0.506000	0.27664	0.074000	0.17049	2.341000	0.43983	0.554000	0.29061	-0.224000	0.12420	AGC	INPP5J	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000185133		0.677	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	INPP5J	HGNC	protein_coding	OTTHUMT00000321784.1	76	0.00	0	G	NM_001002837		31522448	31522448	+1	no_errors	ENST00000331075	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.591	A
ISL2	64843	genome.wustl.edu	37	15	76633612	76633612	+	Frame_Shift_Del	DEL	C	C	-	rs138984043	byFrequency	TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:76633612delC	ENST00000290759.4	+	5	1093	c.933delC	c.(931-933)agcfs	p.S311fs	RP11-685G9.4_ENST00000602530.1_lincRNA|RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	311					negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						CCCTCCAGAGCGACCTGGACC	0.667																																					GBM(97;953 1391 16164 31496 36951)	dbGAP											0													25.0	24.0	25.0					15																	76633612		2197	4293	6490	-	-	-	SO:0001589	frameshift_variant	0			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.933delC	15.37:g.76633612delC	ENSP00000290759:p.Ser311fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KM37	Frame_Shift_Del	DEL	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.S311fs	ENST00000290759.4	37	c.933	CCDS10290.1	15																																																																																			ISL2	-	NULL	ENSG00000159556		0.667	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL2	HGNC	protein_coding	OTTHUMT00000289779.1	54	0.00	0	C			76633612	76633612	+1	no_errors	ENST00000290759	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	0.998	-
ITPR3	3710	genome.wustl.edu	37	6	33657115	33657115	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:33657115C>T	ENST00000374316.5	+	51	7855	c.6795C>T	c.(6793-6795)atC>atT	p.I2265I	ITPR3_ENST00000605930.1_Silent_p.I2265I			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2265					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GCCCCCTCATCGTGGCGCTCA	0.607																																						dbGAP											0													129.0	109.0	116.0					6																	33657115		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6795C>T	6.37:g.33657115C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14649|Q5TAQ2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,pfscan_MIR_motif,prints_InsP3_rcpt-bd	p.I2265	ENST00000374316.5	37	c.6795	CCDS4783.1	6																																																																																			ITPR3	-	NULL	ENSG00000096433		0.607	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	73	0.00	0	C	NM_002224		33657115	33657115	+1	no_errors	ENST00000374316	ensembl	human	known	69_37n	silent	31	11.43	4	SNP	0.830	T
IYD	389434	genome.wustl.edu	37	6	150716718	150716718	+	Intron	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:150716718G>A	ENST00000344419.3	+	4	827				IYD_ENST00000229447.5_Intron|IYD_ENST00000500320.3_Missense_Mutation_p.G272D|IYD_ENST00000392255.3_Intron|IYD_ENST00000392256.2_Intron	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase						cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TCTGCAGCAGGCAGTCTTTTT	0.522											OREG0017729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													44.0	47.0	46.0					6																	150716718		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.687+1327G>A	6.37:g.150716718G>A		Somatic	1734	WXS	Illumina GAIIx	Phase_IV	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	pfam_Nitroreductase-like,superfamily_Nitroreductase-like	p.G272D	ENST00000344419.3	37	c.815	CCDS5227.1	6	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.479674	0.01035	.	.	ENSG00000009765	ENST00000500320	D	0.88896	-2.44	3.9	2.99	0.34606	.	.	.	.	.	T	0.76912	0.4054	.	.	.	0.19575	N	0.999967	.	.	.	.	.	.	T	0.66988	-0.5784	5	.	.	.	.	9.1752	0.37107	0.0:0.3029:0.6971:0.0	.	.	.	.	D	272	ENSP00000441276:G272D	.	G	+	2	0	IYD	150758411	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	0.648000	0.24828	0.890000	0.36211	0.467000	0.42956	GGC	IYD	-	NULL	ENSG00000009765		0.522	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IYD	HGNC	protein_coding	OTTHUMT00000043754.3	44	0.00	0	G	NM_203395		150716718	150716718	+1	no_errors	ENST00000500320	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.001	A
PLA2G4B	100137049	genome.wustl.edu	37	15	42132397	42132397	+	Silent	SNP	G	G	A			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:42132397G>A	ENST00000452633.1	+	3	403	c.51G>A	c.(49-51)ctG>ctA	p.L17L	PLA2G4B_ENST00000542534.2_Silent_p.L248L|JMJD7-PLA2G4B_ENST00000342159.4_Silent_p.L248L|JMJD7-PLA2G4B_ENST00000476036.1_3'UTR|JMJD7-PLA2G4B_ENST00000382448.4_Silent_p.L248L|PLA2G4B_ENST00000458483.1_Silent_p.L17L			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	17	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		TTCGTGTCCTGCAGGCCCATC	0.667																																						dbGAP											0													58.0	49.0	52.0					15																	42132397		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.51G>A	15.37:g.42132397G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Silent	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_JmjC_dom,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.L248	ENST00000452633.1	37	c.744	CCDS45241.1	15																																																																																			JMJD7-PLA2G4B	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_JmjC_dom,smart_C2_Ca-dep,pfscan_JmjC_dom,pfscan_C2_membr_targeting	ENSG00000168970		0.667	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1	91	0.00	0	G	NM_001114633		42132397	42132397	+1	no_errors	ENST00000382448	ensembl	human	known	69_37n	silent	117	10.00	13	SNP	0.997	A
KIAA0100	9703	genome.wustl.edu	37	17	26962127	26962127	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:26962127C>T	ENST00000528896.2	-	16	2552	c.2478G>A	c.(2476-2478)gtG>gtA	p.V826V	KIAA0100_ENST00000389003.3_Silent_p.V683V|KIAA0100_ENST00000544884.1_Silent_p.V683V|RP11-192H23.7_ENST00000577814.1_RNA|RP11-192H23.7_ENST00000583787.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	826						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					AAGGAAACTCCACCGAGACTG	0.547																																						dbGAP											0													140.0	156.0	151.0					17																	26962127		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2478G>A	17.37:g.26962127C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.V826	ENST00000528896.2	37	c.2478	CCDS32595.1	17																																																																																			KIAA0100	-	NULL	ENSG00000007202		0.547	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	34	0.00	0	C	NM_014680		26962127	26962127	-1	no_errors	ENST00000005905	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	1.000	T
KIF26A	26153	genome.wustl.edu	37	14	104642183	104642183	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr14:104642183C>A	ENST00000423312.2	+	12	3058	c.3058C>A	c.(3058-3060)Ctg>Atg	p.L1020M	KIF26A_ENST00000315264.7_Missense_Mutation_p.L881M	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1020					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CACAGTGACCCTGCAGCGGCC	0.721																																						dbGAP											0													6.0	8.0	7.0					14																	104642183		1913	4027	5940	-	-	-	SO:0001583	missense	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.3058C>A	14.37:g.104642183C>A	ENSP00000388241:p.Leu1020Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L1020M	ENST00000423312.2	37	c.3058	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847858	0.32606	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	D;D	0.83673	-1.75;-1.74	3.87	-0.543	0.11851	.	.	.	.	.	D	0.85750	0.5769	L	0.61218	1.895	0.41392	D	0.987622	D	0.76494	0.999	D	0.68353	0.957	T	0.81486	-0.0911	9	0.72032	D	0.01	.	5.3	0.15773	0.0:0.3432:0.1486:0.5083	.	1020	Q9ULI4	KI26A_HUMAN	M	1020;881	ENSP00000388241:L1020M;ENSP00000325452:L881M	ENSP00000325452:L881M	L	+	1	2	KIF26A	103711936	0.016000	0.18221	0.985000	0.45067	0.125000	0.20455	0.117000	0.15583	-0.386000	0.07821	0.313000	0.20887	CTG	KIF26A	-	NULL	ENSG00000066735		0.721	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	26	0.00	0	C			104642183	104642183	+1	no_errors	ENST00000423312	ensembl	human	known	69_37n	missense	11	21.43	3	SNP	0.769	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46048138	46048138	+	3'UTR	SNP	C	C	G	rs112351109		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr21:46048138C>G	ENST00000397911.3	+	0	1099				TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						ACCTCCCCCCCGGGCAGGCGA	0.697																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*171C>G	21.37:g.46048138C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRG1|A6NIR9|Q70LJ1	RNA	SNP	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			KRTAP10-9	-	-	ENSG00000221837		0.697	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	113	0.88	1	C			46048138	46048138	+1	no_errors	ENST00000484861	ensembl	human	known	69_37n	rna	65	15.38	12	SNP	0.000	G
LARGE	9215	genome.wustl.edu	37	22	33679244	33679244	+	Silent	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:33679244G>T	ENST00000354992.2	-	14	2392	c.1821C>A	c.(1819-1821)ccC>ccA	p.P607P	LARGE_ENST00000437602.2_Intron|LARGE_ENST00000402320.1_Silent_p.P555P|LARGE_ENST00000452586.2_Silent_p.P406P|LARGE_ENST00000397394.2_Silent_p.P607P|LARGE_ENST00000337431.2_Silent_p.P555P	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	607					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				CTTTTGACTTGGGGAAGGACA	0.547																																					Colon(70;397 1175 4573 19089 45288)	dbGAP											0													136.0	117.0	124.0					22																	33679244		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1821C>A	22.37:g.33679244G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Silent	SNP	pfam_Glyco_trans_8	p.P607	ENST00000354992.2	37	c.1821	CCDS13912.1	22																																																																																			LARGE	-	NULL	ENSG00000133424		0.547	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	86	0.00	0	G	NM_133642		33679244	33679244	-1	no_errors	ENST00000354992	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	1.000	T
LCTL	197021	genome.wustl.edu	37	15	66856218	66856218	+	Intron	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:66856218C>A	ENST00000341509.5	-	3	502				LCTL_ENST00000563438.1_5'UTR|LCTL_ENST00000537670.1_Intron	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like						carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGGGGCCTCACTTGGGTTCAA	0.607																																						dbGAP											0													65.0	66.0	65.0					15																	66856218		2201	4299	6500	-	-	-	SO:0001627	intron_variant	0			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.370+30G>T	15.37:g.66856218C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQY0	RNA	SNP	-	NULL	ENST00000341509.5	37	NULL	CCDS10220.1	15																																																																																			LCTL	-	-	ENSG00000188501		0.607	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCTL	HGNC	protein_coding	OTTHUMT00000256921.2	36	0.00	0	C	NM_207338		66856218	66856218	-1	no_errors	ENST00000563438	ensembl	human	known	69_37n	rna	9	30.77	4	SNP	0.000	A
LDLR	3949	genome.wustl.edu	37	19	11224354	11224354	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:11224354C>T	ENST00000558518.1	+	10	1689	c.1502C>T	c.(1501-1503)gCg>gTg	p.A501V	LDLR_ENST00000535915.1_Missense_Mutation_p.A460V|LDLR_ENST00000455727.2_Missense_Mutation_p.A333V|LDLR_ENST00000557933.1_Missense_Mutation_p.A501V|LDLR_ENST00000558013.1_Missense_Mutation_p.A501V|LDLR_ENST00000545707.1_Missense_Mutation_p.A374V	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	501					cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	GTCTCTGTTGCGGATACCAAG	0.582																																					GBM(18;201 575 7820 21545)	dbGAP											1	Unknown(1)	lung(1)	GRCh37	CI042243|CM043859|CM055393	LDLR	I|M							106.0	87.0	93.0					19																	11224354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.1502C>T	19.37:g.11224354C>T	ENSP00000454071:p.Ala501Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A501V	ENST00000558518.1	37	c.1502	CCDS12254.1	19	.	.	.	.	.	.	.	.	.	.	C	17.30	3.355373	0.61293	.	.	ENSG00000130164	ENST00000252444;ENST00000545707;ENST00000535915;ENST00000455727	D;D;D	0.90504	-2.68;-2.68;-2.68	4.72	4.72	0.59763	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.56097	D	0.000022	D	0.93145	0.7817	M	0.69358	2.11	0.58432	D	0.999999	P;P;P;P;P;P	0.51537	0.944;0.946;0.9;0.944;0.797;0.835	P;P;P;P;P;P	0.55161	0.77;0.675;0.627;0.694;0.581;0.552	D	0.94129	0.7386	10	0.87932	D	0	.	16.4495	0.83974	0.0:1.0:0.0:0.0	.	333;374;380;460;513;501	B4DR00;B4DJZ8;B4DII3;B4DTQ3;Q59FQ1;P01130	.;.;.;.;.;LDLR_HUMAN	V	501;374;460;333	ENSP00000437639:A374V;ENSP00000440520:A460V;ENSP00000397829:A333V	ENSP00000252444:A501V	A	+	2	0	LDLR	11085354	0.997000	0.39634	0.907000	0.35723	0.004000	0.04260	3.616000	0.54174	2.186000	0.69663	0.555000	0.69702	GCG	LDLR	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000130164		0.582	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	HGNC	protein_coding	OTTHUMT00000415973.2	88	0.00	0	C			11224354	11224354	+1	no_errors	ENST00000558518	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.998	T
SPACA6P-AS	102238594	genome.wustl.edu	37	19	52197736	52197736	+	lincRNA	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:52197736G>T	ENST00000602324.1	-	0	0				MIR99B_ENST00000384819.1_RNA|MIRLET7E_ENST00000362102.1_RNA|MIR125A_ENST00000385273.1_RNA|LINC00085_ENST00000573266.1_RNA	NR_029482.1|NR_029693.1																						GCCAGACTATGATGAGAGAAG	0.612																																						dbGAP											0																																										-	-	-			0																															19.37:g.52197736G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000602324.1	37	NULL		19																																																																																			LINC00085	-	-	ENSG00000182310		0.612	hsa-mir-125a.1-001	KNOWN	basic	lincRNA	LINC00085	HGNC	lincRNA	OTTHUMT00000467329.1	33	0.00	0	G			52197736	52197736	+1	no_errors	ENST00000573266	ensembl	human	known	69_37n	rna	16	15.79	3	SNP	0.049	T
LLGL1	3996	genome.wustl.edu	37	17	18146095	18146095	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:18146095C>A	ENST00000316843.4	+	22	3251	c.3155C>A	c.(3154-3156)gCa>gAa	p.A1052E		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	1052					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					AGGAACCTGGCAGAAGACGAG	0.667																																						dbGAP											0													43.0	34.0	37.0					17																	18146095		2185	4279	6464	-	-	-	SO:0001583	missense	0				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.3155C>A	17.37:g.18146095C>A	ENSP00000321537:p.Ala1052Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Lethal2_giant,pfscan_WD40_repeat	p.A1052E	ENST00000316843.4	37	c.3155	CCDS32586.1	17	.	.	.	.	.	.	.	.	.	.	C	7.833	0.720160	0.15372	.	.	ENSG00000131899	ENST00000316843	T	0.04758	3.56	5.52	-4.42	0.03579	.	1.517260	0.03783	N	0.261683	T	0.02230	0.0069	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42783	-0.9431	10	0.33141	T	0.24	-0.5936	0.8372	0.01142	0.303:0.271:0.0995:0.3265	.	1052	Q15334	L2GL1_HUMAN	E	1052	ENSP00000321537:A1052E	ENSP00000321537:A1052E	A	+	2	0	LLGL1	18086820	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	-0.060000	0.11712	-0.671000	0.05274	-0.157000	0.13467	GCA	LLGL1	-	NULL	ENSG00000131899		0.667	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LLGL1	HGNC	protein_coding	OTTHUMT00000132067.3	52	0.00	0	C			18146095	18146095	+1	no_errors	ENST00000316843	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	0.000	A
LRP1B	53353	genome.wustl.edu	37	2	141707954	141707954	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:141707954C>A	ENST00000389484.3	-	20	3957	c.2986G>T	c.(2986-2988)Ggg>Tgg	p.G996W		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	996	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCATCACTCCCGTCCCCACAG	0.448										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													106.0	75.0	85.0					2																	141707954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2986G>T	2.37:g.141707954C>A	ENSP00000374135:p.Gly996Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.G996W	ENST00000389484.3	37	c.2986	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	19.14	3.768977	0.69992	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.96619	-4.07;-4.07	5.8	4.0	0.46444	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.222920	0.37669	U	0.001990	D	0.98052	0.9358	M	0.88181	2.935	0.41599	D	0.988843	D;D	0.69078	0.997;0.99	D;P	0.76575	0.988;0.823	D	0.98260	1.0498	10	0.87932	D	0	.	11.4811	0.50326	0.0:0.8064:0.1263:0.0673	.	179;996	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	W	996;934;141	ENSP00000374135:G996W;ENSP00000413239:G141W	ENSP00000374135:G996W	G	-	1	0	LRP1B	141424424	0.938000	0.31826	0.754000	0.31244	0.993000	0.82548	2.109000	0.41863	0.797000	0.33971	0.563000	0.77884	GGG	LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.448	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	53	0.00	0	C	NM_018557		141707954	141707954	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.983	A
LZTR1	8216	genome.wustl.edu	37	22	21347108	21347108	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:21347108C>T	ENST00000215739.8	+	11	1534	c.1175C>T	c.(1174-1176)gCg>gTg	p.A392V	LZTR1_ENST00000389355.3_Missense_Mutation_p.A373V|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	392					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTCTTCCACGCGGCTGCTGTC	0.642																																						dbGAP											0													49.0	35.0	40.0					22																	21347108		2197	4298	6495	-	-	-	SO:0001583	missense	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.1175C>T	22.37:g.21347108C>T	ENSP00000215739:p.Ala392Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14776|Q20WK0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.A392V	ENST00000215739.8	37	c.1175	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	C	18.80	3.699987	0.68501	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.32515	1.45;1.45	4.98	4.98	0.66077	Kelch-type beta propeller (1);	0.104805	0.64402	D	0.000003	T	0.58221	0.2107	M	0.85299	2.745	0.80722	D	1	D;D;D;B	0.89917	0.996;1.0;1.0;0.375	P;D;D;B	0.91635	0.878;0.987;0.999;0.089	T	0.60393	-0.7272	10	0.42905	T	0.14	-21.7272	13.6201	0.62132	0.0:1.0:0.0:0.0	.	373;351;392;351	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	V	351;392;373	ENSP00000215739:A392V;ENSP00000374006:A373V	ENSP00000215739:A392V	A	+	2	0	LZTR1	19677108	1.000000	0.71417	0.267000	0.24556	0.303000	0.27691	7.562000	0.82300	2.582000	0.87167	0.655000	0.94253	GCG	LZTR1	-	NULL	ENSG00000099949		0.642	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	63	0.00	0	C	NM_006767		21347108	21347108	+1	no_errors	ENST00000215739	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.992	T
MAMLD1	10046	genome.wustl.edu	37	X	149638787	149638787	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:149638787G>T	ENST00000370401.2	+	4	1252	c.942G>T	c.(940-942)aaG>aaT	p.K314N	MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.K314N|MAMLD1_ENST00000432680.2_Missense_Mutation_p.K289N|MAMLD1_ENST00000426613.2_Missense_Mutation_p.K289N			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	314					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCCAGCAAGCAGGGGTCTG	0.642																																						dbGAP											0													83.0	57.0	66.0					X																	149638787		2203	4300	6503	-	-	-	SO:0001583	missense	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.942G>T	X.37:g.149638787G>T	ENSP00000359428:p.Lys314Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NULL	p.K289N	ENST00000370401.2	37	c.867	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172296	0.38315	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.71817	-0.17;-0.6;-0.17;-0.18	5.3	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.79907	0.4527	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.985;0.996	T	0.79475	-0.1788	9	.	.	.	-24.7875	9.1589	0.37009	0.1671:0.0:0.8329:0.0	.	276;289;289;314	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	N	276;314;289;314;289	ENSP00000359428:K314N;ENSP00000414517:K289N;ENSP00000262858:K314N;ENSP00000397438:K289N	.	K	+	3	2	MAMLD1	149389445	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	2.138000	0.42140	2.223000	0.72356	0.600000	0.82982	AAG	MAMLD1	-	NULL	ENSG00000013619		0.642	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2	36	0.00	0	G	NM_005491		149638787	149638787	+1	no_errors	ENST00000432680	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
MBD5	55777	genome.wustl.edu	37	2	149226951	149226951	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:149226951A>T	ENST00000407073.1	+	9	2436	c.1439A>T	c.(1438-1440)cAg>cTg	p.Q480L	MBD5_ENST00000404807.1_Missense_Mutation_p.Q480L	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	480					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GTAGGACCCCAGGCCACTTCT	0.507																																						dbGAP											0													65.0	64.0	64.0					2																	149226951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.1439A>T	2.37:g.149226951A>T	ENSP00000386049:p.Gln480Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP	p.Q480L	ENST00000407073.1	37	c.1439	CCDS33302.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.34|14.34	2.507598|2.507598	0.44558|0.44558	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000407073;ENST00000404807|ENST00000416015	T;T|.	0.52295|.	0.68;0.67|.	4.39|4.39	3.21|3.21	0.36854|0.36854	.|.	0.122270|.	0.36932|.	N|.	0.002321|.	T|T	0.47637|0.47637	0.1456|0.1456	N|N	0.24115|0.24115	0.695|0.695	0.54753|0.54753	D|D	0.999986|0.999986	P|.	0.36535|.	0.557|.	B|.	0.33121|.	0.158|.	T|T	0.29701|0.29701	-1.0003|-1.0003	10|5	0.52906|.	T|.	0.07|.	-2.6075|-2.6075	11.4024|11.4024	0.49878|0.49878	0.8484:0.1516:0.0:0.0|0.8484:0.1516:0.0:0.0	.|.	480|.	Q9P267|.	MBD5_HUMAN|.	L|W	480|220	ENSP00000386049:Q480L;ENSP00000384672:Q480L|.	ENSP00000384672:Q480L|.	Q|R	+|+	2|1	0|2	MBD5|MBD5	148943421|148943421	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.595000|6.595000	0.74109|0.74109	0.814000|0.814000	0.34374|0.34374	0.533000|0.533000	0.62120|0.62120	CAG|AGG	MBD5	-	NULL	ENSG00000204406		0.507	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	19	0.00	0	A			149226951	149226951	+1	no_errors	ENST00000407073	ensembl	human	known	69_37n	missense	8	27.27	3	SNP	1.000	T
MIR4330	100422930	genome.wustl.edu	37	X	150336752	150336752	+	RNA	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:150336752C>A	ENST00000579077.1	+	0	59					NR_036256.1				microRNA 4330																		CTTTTTGACGCCTACTTCATC	0.493																																						dbGAP											0																																										-	-	-			0					X	2011-09-12				ENSG00000265789		"""ncRNAs / Micro RNAs"""	38273	non-coding RNA	RNA, micro							Standard	NR_036256		Approved	hsa-mir-4330	uc022cgs.1				X.37:g.150336752C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000579077.1	37	NULL		X																																																																																			MIR4330	-	-	ENSG00000265789		0.493	MIR4330-201	KNOWN	basic	miRNA	MIR4330	HGNC	miRNA		35	0.00	0	C	NR_036256		150336752	150336752	+1	no_errors	ENST00000579077	ensembl	human	known	69_37n	rna	23	14.81	4	SNP	0.004	A
MLLT3	4300	genome.wustl.edu	37	9	20414379	20414379	+	Silent	SNP	G	G	A	rs373338988		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:20414379G>A	ENST00000380338.4	-	5	751	c.465C>T	c.(463-465)agC>agT	p.S155S	MLLT3_ENST00000429426.2_Silent_p.S152S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	155	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S155S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.532			T	MLL	ALL																																	dbGAP		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	4	Substitution - coding silent(4)	urinary_tract(1)|large_intestine(1)|lung(1)|kidney(1)											10.0	15.0	14.0					9																	20414379		1871	3851	5722	-	-	-	SO:0001819	synonymous_variant	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.465C>T	9.37:g.20414379G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S155	ENST00000380338.4	37	c.465	CCDS6494.1	9																																																																																			MLLT3	-	NULL	ENSG00000171843		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1	55	0.00	0	G	NM_004529		20414379	20414379	-1	no_errors	ENST00000380338	ensembl	human	known	69_37n	silent	48	12.73	7	SNP	0.991	A
STRBP	55342	genome.wustl.edu	37	9	125876195	125876195	+	Intron	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:125876195G>A	ENST00000530364.1	-	2	31				MIR600HG_ENST00000385007.1_RNA			Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein						cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						tggcagagctgagcagttgtg	0.488																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000530364.1:c.255-4163C>T	9.37:g.125876195G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	RNA	SNP	-	NULL	ENST00000530364.1	37	NULL		9																																																																																			MIR600HG	-	-	ENSG00000236901		0.488	STRBP-009	PUTATIVE	basic	processed_transcript	MIR600HG	HGNC	protein_coding	OTTHUMT00000392598.1	54	0.00	0	G			125876195	125876195	-1	no_errors	ENST00000449175	ensembl	human	known	69_37n	rna	28	12.50	4	SNP	0.000	A
MS4A2	2206	genome.wustl.edu	37	11	59861502	59861502	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr11:59861502C>T	ENST00000278888.3	+	6	705	c.603C>T	c.(601-603)atC>atT	p.I201I		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	201					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	CACTCACAATCTGTGGAGCTG	0.388																																						dbGAP											0													117.0	104.0	109.0					11																	59861502		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.603C>T	11.37:g.59861502C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q54A81	Silent	SNP	pfam_CD20-like	p.I201	ENST00000278888.3	37	c.603	CCDS7980.1	11																																																																																			MS4A2	-	pfam_CD20-like	ENSG00000149534		0.388	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A2	HGNC	protein_coding	OTTHUMT00000393844.1	42	0.00	0	C			59861502	59861502	+1	no_errors	ENST00000278888	ensembl	human	known	69_37n	silent	36	44.62	29	SNP	0.001	T
MS4A2	2206	genome.wustl.edu	37	11	59861502	59861502	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:59861502C>T	ENST00000278888.3	+	6	705	c.603C>T	c.(601-603)atC>atT	p.I201I		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	201					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	CACTCACAATCTGTGGAGCTG	0.388																																						dbGAP											0													117.0	104.0	109.0					11																	59861502		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.603C>T	11.37:g.59861502C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q54A81	Silent	SNP	pfam_CD20-like	p.I201	ENST00000278888.3	37	c.603	CCDS7980.1	11																																																																																			MS4A2	-	pfam_CD20-like	ENSG00000149534		0.388	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A2	HGNC	protein_coding	OTTHUMT00000393844.1	51	0.00	0	C			59861502	59861502	+1	no_errors	ENST00000278888	ensembl	human	known	69_37n	silent	76	34.48	40	SNP	0.001	T
MS4A2	2206	genome.wustl.edu	37	11	59861502	59861502	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:59861502C>T	ENST00000278888.3	+	6	705	c.603C>T	c.(601-603)atC>atT	p.I201I		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	201					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	CACTCACAATCTGTGGAGCTG	0.388																																						dbGAP											0													117.0	104.0	109.0					11																	59861502		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.603C>T	11.37:g.59861502C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q54A81	Silent	SNP	pfam_CD20-like	p.I201	ENST00000278888.3	37	c.603	CCDS7980.1	11																																																																																			MS4A2	-	pfam_CD20-like	ENSG00000149534		0.388	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A2	HGNC	protein_coding	OTTHUMT00000393844.1	51	0.00	0	C			59861502	59861502	+1	no_errors	ENST00000278888	ensembl	human	known	69_37n	silent	48	36.00	27	SNP	0.001	T
MSLNL	401827	genome.wustl.edu	37	16	820894	820894	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:820894G>T	ENST00000442466.1	-	12	1437	c.1438C>A	c.(1438-1440)Cat>Aat	p.H480N	MSLNL_ENST00000293892.3_Missense_Mutation_p.H831N|MIR662_ENST00000384847.1_RNA			Q96KJ4	MSLNL_HUMAN	mesothelin-like	480					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						AAGGTCTCATGGGCCTTGGTG	0.692																																						dbGAP											0													14.0	21.0	19.0					16																	820894		1952	4139	6091	-	-	-	SO:0001583	missense	0					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.1438C>A	16.37:g.820894G>T	ENSP00000415767:p.His480Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mesothelin	p.H831N	ENST00000442466.1	37	c.2491		16	.	.	.	.	.	.	.	.	.	.	G	3.008	-0.204628	0.06180	.	.	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	T;T;T	0.10860	2.83;2.83;2.83	4.84	3.75	0.43078	.	0.529892	0.18385	N	0.142841	T	0.09247	0.0228	.	.	.	0.09310	N	0.999991	B	0.25007	0.116	B	0.28011	0.085	T	0.19095	-1.0316	9	0.39692	T	0.17	-19.0369	11.4026	0.49878	0.0:0.0:0.7718:0.2282	.	480	Q96KJ4	MSLNL_HUMAN	N	530;480;831	ENSP00000441381:H530N;ENSP00000415767:H480N;ENSP00000293892:H831N	ENSP00000293892:H831N	H	-	1	0	MSLNL	760895	0.945000	0.32115	0.915000	0.36163	0.014000	0.08584	1.374000	0.34283	2.383000	0.81215	0.561000	0.74099	CAT	MSLNL	-	pfam_Mesothelin	ENSG00000162006		0.692	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	HGNC	protein_coding		27	0.00	0	G	NM_001025190		820894	820894	-1	no_errors	ENST00000293892	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	0.736	T
MTOR	2475	genome.wustl.edu	37	1	11303354	11303354	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:11303354G>T	ENST00000361445.4	-	9	1305	c.1229C>A	c.(1228-1230)aCc>aAc	p.T410N		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	410	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GAGATACTGGGTATCTGAGCA	0.453																																						dbGAP											0													93.0	86.0	88.0					1																	11303354		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1229C>A	1.37:g.11303354G>T	ENSP00000354558:p.Thr410Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.T410N	ENST00000361445.4	37	c.1229	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120121	0.37436	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.65178	-0.14	6.11	6.11	0.99139	Armadillo-like helical (1);Armadillo-type fold (2);	0.179399	0.48767	D	0.000177	T	0.45915	0.1366	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34925	-0.9809	10	0.17832	T	0.49	-3.3493	13.5702	0.61843	0.0:0.0:0.7467:0.2533	.	410	P42345	MTOR_HUMAN	N	410	ENSP00000354558:T410N	ENSP00000354558:T410N	T	-	2	0	MTOR	11225941	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	4.298000	0.59067	2.906000	0.99361	0.655000	0.94253	ACC	MTOR	-	superfamily_ARM-type_fold	ENSG00000198793		0.453	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	52	0.00	0	G	NM_004958		11303354	11303354	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	1.000	T
MUTYH	4595	genome.wustl.edu	37	1	45797933	45797933	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:45797933G>T	ENST00000372098.3	-	10	962	c.829C>A	c.(829-831)Caa>Aaa	p.Q277K	MUTYH_ENST00000528013.2_Missense_Mutation_p.Q266K|MUTYH_ENST00000456914.2_Missense_Mutation_p.Q252K|MUTYH_ENST00000531105.1_Intron|MUTYH_ENST00000372115.3_Missense_Mutation_p.Q266K|MUTYH_ENST00000488731.2_Intron|MUTYH_ENST00000372100.5_Missense_Mutation_p.Q263K|MUTYH_ENST00000450313.1_Missense_Mutation_p.Q280K|MUTYH_ENST00000372110.3_Missense_Mutation_p.Q267K|MUTYH_ENST00000355498.2_Missense_Mutation_p.Q252K|MUTYH_ENST00000354383.6_Missense_Mutation_p.Q253K|MUTYH_ENST00000372104.1_Missense_Mutation_p.Q252K|MUTYH_ENST00000448481.1_Missense_Mutation_p.Q263K|MUTYH_ENST00000529984.1_Intron|MUTYH_ENST00000528332.2_Intron			Q9UIF7	MUTYH_HUMAN	mutY homolog	277					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA repair (GO:0006281)|mismatch repair (GO:0006298)	mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|metal ion binding (GO:0046872)|MutSalpha complex binding (GO:0032407)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					ATGGCTGCTTGGTTGAAATCT	0.617			Mis			colorectal		Base excision repair (BER), DNA glycosylases	MUTYH-associated polyposis																													dbGAP	yes	Rec		Adenomatous polyposis coli	1	1p34.3-1p32.1	4595	mutY homolog (E. coli)		E	0													34.0	36.0	35.0					1																	45797933		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MAP, MYH-associated polyposis	U63329	CCDS520.1, CCDS41320.1, CCDS41321.1, CCDS41322.1, CCDS72776.1, CCDS72777.1	1p34.1	2014-09-17	2013-09-12		ENSG00000132781	ENSG00000132781			7527	protein-coding gene	gene with protein product		604933	"""mutY (E. coli) homolog"", ""mutY homolog (E. coli)"""			7823963, 10684930	Standard	NM_012222		Approved	MYH	uc009vxp.3	Q9UIF7	OTTHUMG00000007682	ENST00000372098.3:c.829C>A	1.37:g.45797933G>T	ENSP00000361170:p.Gln277Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPZ4|Q15830|Q9UBP2|Q9UBS7|Q9UIF4|Q9UIF5|Q9UIF6	Missense_Mutation	SNP	pfam_HhH-GPD_domain,superfamily_DNA_glycosylase,superfamily_NUDIX_hydrolase_dom-like,smart_HhH-GPD_domain,smart_Endouclease3_FeS-loop_motif	p.Q280K	ENST00000372098.3	37	c.838	CCDS520.1	1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791160	0.90367	.	.	ENSG00000132781	ENST00000372104;ENST00000448481;ENST00000456914;ENST00000354383;ENST00000355498;ENST00000372098;ENST00000372110;ENST00000372115;ENST00000450313;ENST00000372100;ENST00000525481;ENST00000412971;ENST00000435155	D;D;D;D;D;D;D;D;D;D;D;D	0.94793	-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52	5.64	5.64	0.86602	HhH-GPD domain (1);DNA glycosylase (1);Helix-turn-helix, base-excision DNA repair, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98720	0.9570	H	0.99090	4.425	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999;0.999	D	0.99383	1.0923	10	0.87932	D	0	-12.601	19.7037	0.96065	0.0:0.0:1.0:0.0	.	280;277;267;277;266;160;253	E5KP25;E5KP26;Q9UIF7-2;Q9UIF7;E5KP27;D3DPZ6;E5KP28	.;.;.;MUTYH_HUMAN;.;.;.	K	252;263;252;253;252;277;267;266;280;263;124;124;263	ENSP00000361176:Q252K;ENSP00000409718:Q263K;ENSP00000407590:Q252K;ENSP00000346354:Q253K;ENSP00000347685:Q252K;ENSP00000361170:Q277K;ENSP00000361182:Q267K;ENSP00000361187:Q266K;ENSP00000408176:Q280K;ENSP00000361172:Q263K;ENSP00000410263:Q124K;ENSP00000403655:Q263K	ENSP00000346354:Q253K	Q	-	1	0	MUTYH	45570520	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.655000	0.90218	0.655000	0.94253	CAA	MUTYH	-	superfamily_DNA_glycosylase,smart_HhH-GPD_domain	ENSG00000132781		0.617	MUTYH-002	KNOWN	basic|CCDS	protein_coding	MUTYH	HGNC	protein_coding	OTTHUMT00000020529.1	45	0.00	0	G	NM_012222		45797933	45797933	-1	no_errors	ENST00000450313	ensembl	human	known	69_37n	missense	21	15.38	4	SNP	1.000	T
MYH9	4627	genome.wustl.edu	37	22	36697603	36697603	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:36697603C>A	ENST00000216181.5	-	21	2838	c.2608G>T	c.(2608-2610)Gag>Tag	p.E870*		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	870					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GTCTCCATCTCCGTGAGCCTG	0.642			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated		OREG0026520	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													154.0	103.0	120.0					22																	36697603		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2608G>T	22.37:g.36697603C>A	ENSP00000216181:p.Glu870*	Somatic	864	WXS	Illumina GAIIx	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.E870*	ENST00000216181.5	37	c.2608	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	42	9.353795	0.99147	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	.	.	.	6.08	6.08	0.98989	.	0.117525	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	.	.	.	X	734;870	.	ENSP00000216181:E870X	E	-	1	0	MYH9	35027549	1.000000	0.71417	0.967000	0.41034	0.314000	0.28054	5.915000	0.69973	2.894000	0.99253	0.655000	0.94253	GAG	MYH9	-	NULL	ENSG00000100345		0.642	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	90	0.00	0	C	NM_002473		36697603	36697603	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	nonsense	32	11.11	4	SNP	1.000	A
MYO15B	80022	genome.wustl.edu	37	17	73586046	73586046	+	3'UTR	SNP	C	C	G			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:73586046C>G	ENST00000578382.2	+	0	1908					NR_003587.2		Q96JP2	MY15B_HUMAN	myosin XVB pseudogene							cytoplasm (GO:0005737)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)										CCCCGGTGCGCTGGGCGCAGG	0.711																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0					17q25.1	2014-07-16			ENSG00000266714	ENSG00000266714		"""Myosins / Myosin superfamily : Class XV"""	14083	pseudogene	pseudogene						11294886	Standard	NR_003587		Approved	MYO15BP	uc002jon.1	Q96JP2	OTTHUMG00000179794	ENST00000578382.2:c.*1905C>G	17.37:g.73586046C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000578382.2	37	NULL		17																																																																																			MYO15B	-	-	ENSG00000266714		0.711	MYO15B-001	KNOWN	sequence_error|basic	processed_transcript	MYO15B	Clone_based_vega_gene	protein_coding	OTTHUMT00000448172.2	18	0.00	0	C	NR_003587		73586046	73586046	+1	no_errors	ENST00000578382	ensembl	human	known	69_37n	rna	35	22.22	10	SNP	0.919	G
MYO15B	80022	genome.wustl.edu	37	17	73586046	73586046	+	3'UTR	SNP	C	C	G			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:73586046C>G	ENST00000578382.2	+	0	1908					NR_003587.2		Q96JP2	MY15B_HUMAN	myosin XVB pseudogene							cytoplasm (GO:0005737)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)										CCCCGGTGCGCTGGGCGCAGG	0.711																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0					17q25.1	2014-07-16			ENSG00000266714	ENSG00000266714		"""Myosins / Myosin superfamily : Class XV"""	14083	pseudogene	pseudogene						11294886	Standard	NR_003587		Approved	MYO15BP	uc002jon.1	Q96JP2	OTTHUMG00000179794	ENST00000578382.2:c.*1905C>G	17.37:g.73586046C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000578382.2	37	NULL		17																																																																																			MYO15B	-	-	ENSG00000266714		0.711	MYO15B-001	KNOWN	sequence_error|basic	processed_transcript	MYO15B	Clone_based_vega_gene	protein_coding	OTTHUMT00000448172.2	18	0.00	0	C	NR_003587		73586046	73586046	+1	no_errors	ENST00000578382	ensembl	human	known	69_37n	rna	5	37.50	3	SNP	0.919	G
NAV1	89796	genome.wustl.edu	37	1	201763306	201763306	+	Intron	DEL	T	T	-			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:201763306delT	ENST00000367296.4	+	15	3825				NAV1_ENST00000367300.3_Intron|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Intron|NAV1_ENST00000367297.4_Intron|NAV1_ENST00000469130.1_Intron|NAV1_ENST00000295624.6_Intron|NAV1_ENST00000367295.1_Intron	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1						microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						tgagatggagtttcgttcttg	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3406-288T>-	1.37:g.201763306delT		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	RNA	DEL	-	NULL	ENST00000367296.4	37	NULL	CCDS1414.2	1																																																																																			NAV1	-	-	ENSG00000134369		0.517	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	9	0.00	0	T	NM_020443		201763306	201763306	+1	no_errors	ENST00000490213	ensembl	human	known	69_37n	rna	12	14.29	2	DEL	0.020	-
NBPF1	55672	genome.wustl.edu	37	1	16892277	16892277	+	Missense_Mutation	SNP	G	G	A	rs368729374		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:16892277G>A	ENST00000430580.2	-	27	3802	c.2915C>T	c.(2914-2916)gCa>gTa	p.A972V		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	972	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AGGCTCTACTGCCTCCAGCAG	0.498																																						dbGAP											0													20.0	16.0	18.0					1																	16892277		1476	2583	4059	-	-	-	SO:0001583	missense	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2915C>T	1.37:g.16892277G>A	ENSP00000474456:p.Ala972Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.498	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	59	0.00	0	G	NM_017940		16892277	16892277	-1	no_errors	ENST00000430580	ensembl	human	known	69_37n	rna	22	32.35	11	SNP	0.000	A
NHS	4810	genome.wustl.edu	37	X	17744946	17744946	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:17744946C>A	ENST00000380060.3	+	6	2995	c.2657C>A	c.(2656-2658)cCc>cAc	p.P886H	NHS_ENST00000398097.3_Missense_Mutation_p.P730H	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	907					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					GCCAATCTTCCCACCAAGCAG	0.473																																						dbGAP											0													112.0	103.0	106.0					X																	17744946		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.2657C>A	X.37:g.17744946C>A	ENSP00000369400:p.Pro886His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.P886H	ENST00000380060.3	37	c.2657	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788830	0.31685	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.48836	0.8;0.82	5.93	5.93	0.95920	.	0.438111	0.26311	N	0.025104	T	0.49115	0.1538	L	0.54323	1.7	0.09310	N	1	B;B;B;P	0.40875	0.003;0.003;0.003;0.731	B;B;B;B	0.42555	0.004;0.004;0.004;0.391	T	0.53899	-0.8373	10	0.72032	D	0.01	-8.6509	14.1652	0.65473	0.1495:0.8505:0.0:0.0	.	907;728;730;886	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	H	886;730;728	ENSP00000369400:P886H;ENSP00000381170:P730H	ENSP00000369397:P728H	P	+	2	0	NHS	17654867	0.068000	0.21057	0.066000	0.19879	0.983000	0.72400	3.283000	0.51701	2.509000	0.84616	0.538000	0.68166	CCC	NHS	-	NULL	ENSG00000188158		0.473	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	HGNC	protein_coding	OTTHUMT00000059120.1	65	0.00	0	C	NM_198270		17744946	17744946	+1	no_errors	ENST00000380060	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.026	A
NLGN3	54413	genome.wustl.edu	37	X	70390008	70390009	+	3'UTR	DEL	CA	CA	-			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:70390008_70390009delCA	ENST00000358741.3	+	0	2911_2912				NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_3'UTR|NLGN3_ENST00000374051.3_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3						adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GGAacacatgcacacacacaca	0.55																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.*62CA>-	X.37:g.70390018_70390019delCA		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	RNA	DEL	-	NULL	ENST00000358741.3	37	NULL	CCDS55441.1	X																																																																																			NLGN3	-	-	ENSG00000196338		0.550	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	18	0.00	0	CA	NM_018977		70390008	70390009	+1	no_errors	ENST00000476589	ensembl	human	known	69_37n	rna	12	13.33	2	DEL	0.422:0.873	-
NOP14	8602	genome.wustl.edu	37	4	2939896	2939896	+	3'UTR	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr4:2939896C>A	ENST00000314262.6	-	0	2661				NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000507702.1_RNA|NOP14-AS1_ENST00000503709.1_RNA|NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000512712.2_RNA|NOP14_ENST00000502735.1_3'UTR|NOP14-AS1_ENST00000512802.1_RNA|NOP14_ENST00000507120.1_5'UTR|NOP14_ENST00000398071.4_3'UTR|NOP14-AS1_ENST00000507999.1_RNA|NOP14_ENST00000416614.2_3'UTR	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						AACAAAACCGCAGGCAGCGGG	0.458																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.*39G>T	4.37:g.2939896C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	RNA	SNP	-	NULL	ENST00000314262.6	37	NULL	CCDS33945.1	4																																																																																			NOP14	-	-	ENSG00000087269		0.458	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	HGNC	protein_coding	OTTHUMT00000358135.2	26	0.00	0	C	NM_003703		2939896	2939896	-1	no_errors	ENST00000507120	ensembl	human	known	69_37n	rna	32	11.11	4	SNP	0.000	A
NOTCH2	4853	genome.wustl.edu	37	1	120480616	120480616	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:120480616G>T	ENST00000256646.2	-	20	3420	c.3201C>A	c.(3199-3201)tgC>tgA	p.C1067*		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1067	EGF-like 28. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGACCGACTGCAGAGATTCA	0.423			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													92.0	88.0	89.0					1																	120480616		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.3201C>A	1.37:g.120480616G>T	ENSP00000256646:p.Cys1067*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Nonsense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.C1067*	ENST00000256646.2	37	c.3201	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.018869	0.99318	.	.	ENSG00000134250	ENST00000256646	.	.	.	5.73	0.738	0.18319	.	0.000000	0.41194	U	0.000934	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0301	0.58837	0.1855:0.0:0.8145:0.0	.	.	.	.	X	1067	.	ENSP00000256646:C1067X	C	-	3	2	NOTCH2	120282139	1.000000	0.71417	0.988000	0.46212	0.892000	0.51952	1.489000	0.35562	0.222000	0.20900	0.591000	0.81541	TGC	NOTCH2	-	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF_extracell,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000134250		0.423	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	44	0.00	0	G	NM_024408		120480616	120480616	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	nonsense	25	13.79	4	SNP	0.998	T
NOX5	79400	genome.wustl.edu	37	15	69347817	69347817	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:69347817C>A	ENST00000388866.3	+	15	2184	c.2143C>A	c.(2143-2145)Cct>Act	p.P715T	NOX5_ENST00000530406.2_Missense_Mutation_p.P687T|NOX5_ENST00000260364.5_Missense_Mutation_p.P697T|NOX5_ENST00000448182.3_Missense_Mutation_p.P669T|NOX5_ENST00000455873.3_Missense_Mutation_p.P680T	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	715					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						GCGCACCCAGCCTGGGCGGCC	0.607																																						dbGAP											0													40.0	42.0	41.0					15																	69347817		2200	4298	6498	-	-	-	SO:0001583	missense	0			AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.2143C>A	15.37:g.69347817C>A	ENSP00000373518:p.Pro715Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.P715T	ENST00000388866.3	37	c.2143	CCDS32276.2	15	.	.	.	.	.	.	.	.	.	.	C	10.78	1.445882	0.25987	.	.	ENSG00000255346	ENST00000455873;ENST00000448182;ENST00000388866;ENST00000530406	D;D;D;D	0.95377	-3.54;-3.69;-3.54;-3.54	3.94	3.01	0.34805	Ferric reductase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.94076	0.8101	L	0.43152	1.355	0.54753	D	0.999981	P;D;D	0.55172	0.882;0.97;0.963	P;P;P	0.52386	0.447;0.697;0.447	D	0.92844	0.6291	10	0.66056	D	0.02	-6.5111	9.3538	0.38153	0.0:0.8914:0.0:0.1086	.	680;715;687	Q96PH1-6;Q96PH1;Q96PH1-3	.;NOX5_HUMAN;.	T	680;697;715;687	ENSP00000416828:P680T;ENSP00000410887:P697T;ENSP00000373518:P715T;ENSP00000432440:P687T	ENSP00000373518:P715T	P	+	1	0	NOX5	67134871	1.000000	0.71417	0.916000	0.36221	0.388000	0.30384	3.233000	0.51311	0.851000	0.35264	0.511000	0.50034	CCT	NOX5	-	pfam_Fe_red_NAD-bd_6	ENSG00000255346		0.607	NOX5-003	KNOWN	basic|CCDS	protein_coding	NOX5	HGNC	protein_coding	OTTHUMT00000257124.2	22	0.00	0	C	NM_024505		69347817	69347817	+1	no_errors	ENST00000388866	ensembl	human	known	69_37n	missense	10	23.08	3	SNP	1.000	A
NR6A1	2649	genome.wustl.edu	37	9	127285049	127285049	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr9:127285049C>A	ENST00000487099.2	-	10	1535	c.1378G>T	c.(1378-1380)Gag>Tag	p.E460*	NR6A1_ENST00000344523.4_Nonsense_Mutation_p.E459*|NR6A1_ENST00000416460.2_Nonsense_Mutation_p.E455*|NR6A1_ENST00000373584.3_Nonsense_Mutation_p.E456*	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	460					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						GGCAGCTGCTCCAGGGGCACA	0.582																																					Esophageal Squamous(192;272 2884 6208 20560)	dbGAP											0													47.0	32.0	37.0					9																	127285049		2201	4300	6501	-	-	-	SO:0001587	stop_gained	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.1378G>T	9.37:g.127285049C>A	ENSP00000420267:p.Glu460*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.E460*	ENST00000487099.2	37	c.1378	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	C	37	6.243961	0.97408	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523	.	.	.	5.74	5.74	0.90152	.	0.050007	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.913	0.92493	0.0:1.0:0.0:0.0	.	.	.	.	X	460;456;455;459	.	ENSP00000341135:E459X	E	-	1	0	NR6A1	126324870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.581000	0.67471	2.683000	0.91414	0.655000	0.94253	GAG	NR6A1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000148200		0.582	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	29	0.00	0	C			127285049	127285049	-1	no_errors	ENST00000487099	ensembl	human	known	69_37n	nonsense	9	30.77	4	SNP	1.000	A
NR6A1	2649	genome.wustl.edu	37	9	127285049	127285049	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:127285049C>A	ENST00000487099.2	-	10	1535	c.1378G>T	c.(1378-1380)Gag>Tag	p.E460*	NR6A1_ENST00000344523.4_Nonsense_Mutation_p.E459*|NR6A1_ENST00000416460.2_Nonsense_Mutation_p.E455*|NR6A1_ENST00000373584.3_Nonsense_Mutation_p.E456*	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	460					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						GGCAGCTGCTCCAGGGGCACA	0.582																																					Esophageal Squamous(192;272 2884 6208 20560)	dbGAP											0													47.0	32.0	37.0					9																	127285049		2201	4300	6501	-	-	-	SO:0001587	stop_gained	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.1378G>T	9.37:g.127285049C>A	ENSP00000420267:p.Glu460*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.E460*	ENST00000487099.2	37	c.1378	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	C	37	6.243961	0.97408	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523	.	.	.	5.74	5.74	0.90152	.	0.050007	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.913	0.92493	0.0:1.0:0.0:0.0	.	.	.	.	X	460;456;455;459	.	ENSP00000341135:E459X	E	-	1	0	NR6A1	126324870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.581000	0.67471	2.683000	0.91414	0.655000	0.94253	GAG	NR6A1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000148200		0.582	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	49	0.00	0	C			127285049	127285049	-1	no_errors	ENST00000487099	ensembl	human	known	69_37n	nonsense	53	17.19	11	SNP	1.000	A
NR6A1	2649	genome.wustl.edu	37	9	127285049	127285049	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:127285049C>A	ENST00000487099.2	-	10	1535	c.1378G>T	c.(1378-1380)Gag>Tag	p.E460*	NR6A1_ENST00000344523.4_Nonsense_Mutation_p.E459*|NR6A1_ENST00000416460.2_Nonsense_Mutation_p.E455*|NR6A1_ENST00000373584.3_Nonsense_Mutation_p.E456*	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	460					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						GGCAGCTGCTCCAGGGGCACA	0.582																																					Esophageal Squamous(192;272 2884 6208 20560)	dbGAP											0													47.0	32.0	37.0					9																	127285049		2201	4300	6501	-	-	-	SO:0001587	stop_gained	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.1378G>T	9.37:g.127285049C>A	ENSP00000420267:p.Glu460*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.E460*	ENST00000487099.2	37	c.1378	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	C	37	6.243961	0.97408	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523	.	.	.	5.74	5.74	0.90152	.	0.050007	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.913	0.92493	0.0:1.0:0.0:0.0	.	.	.	.	X	460;456;455;459	.	ENSP00000341135:E459X	E	-	1	0	NR6A1	126324870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.581000	0.67471	2.683000	0.91414	0.655000	0.94253	GAG	NR6A1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000148200		0.582	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	49	0.00	0	C			127285049	127285049	-1	no_errors	ENST00000487099	ensembl	human	known	69_37n	nonsense	22	21.43	6	SNP	1.000	A
NSD1	64324	genome.wustl.edu	37	5	176637449	176637449	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr5:176637449G>T	ENST00000439151.2	+	5	2094	c.2049G>T	c.(2047-2049)aaG>aaT	p.K683N	NSD1_ENST00000347982.4_Missense_Mutation_p.K414N|NSD1_ENST00000354179.4_Missense_Mutation_p.K414N|NSD1_ENST00000361032.4_Missense_Mutation_p.K580N	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	683					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AAAATGAAAAGATAAAGTATT	0.378			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												dbGAP		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													62.0	65.0	64.0					5																	176637449		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2049G>T	5.37:g.176637449G>T	ENSP00000395929:p.Lys683Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.K683N	ENST00000439151.2	37	c.2049	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	8.409	0.843746	0.16963	.	.	ENSG00000165671	ENST00000354179;ENST00000355783;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93076	-3.05;-3.06;-3.05;-3.16	4.73	3.85	0.44370	.	0.255042	0.34460	N	0.003956	D	0.82453	0.5040	N	0.12182	0.205	0.24211	N	0.995474	B;B;B	0.15930	0.008;0.015;0.009	B;B;B	0.16722	0.011;0.016;0.007	T	0.66881	-0.5811	9	.	.	.	.	3.8013	0.08760	0.0886:0.1659:0.5734:0.1721	.	414;580;683	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	N	414;414;683;414;580	ENSP00000346111:K414N;ENSP00000395929:K683N;ENSP00000343209:K414N;ENSP00000354310:K580N	.	K	+	3	2	NSD1	176570055	0.990000	0.36364	0.983000	0.44433	0.999000	0.98932	0.459000	0.21908	1.326000	0.45319	0.655000	0.94253	AAG	NSD1	-	NULL	ENSG00000165671		0.378	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	29	0.00	0	G	NM_172349		176637449	176637449	+1	no_errors	ENST00000439151	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.872	T
NTN1	9423	genome.wustl.edu	37	17	8926002	8926002	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:8926002delG	ENST00000173229.2	+	2	419	c.312delG	c.(310-312)ccgfs	p.P105fs	NTN1_ENST00000546090.1_Frame_Shift_Del_p.P105fs|NTN1_ENST00000538852.1_Frame_Shift_Del_p.P105fs	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	105	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						AGGCGCACCCGCCCGCCTTCC	0.692																																						dbGAP											0													14.0	9.0	11.0					17																	8926002		2112	4155	6267	-	-	-	SO:0001589	frameshift_variant	0			U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.312delG	17.37:g.8926002delG	ENSP00000173229:p.Pro105fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL51	Frame_Shift_Del	DEL	pfam_Laminin_N,pfam_Netrin_module_non-TIMP,pfam_EGF_laminin,superfamily_TIMP-like_OB-fold,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_Netrin_module_non-TIMP,pfscan_EGF_laminin,pfscan_Laminin_N,pfscan_Netrin_domain	p.A106fs	ENST00000173229.2	37	c.312	CCDS11148.1	17																																																																																			NTN1	-	pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,pfscan_Laminin_N	ENSG00000065320		0.692	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN1	HGNC	protein_coding	OTTHUMT00000252583.1	29	0.00	0	G			8926002	8926002	+1	no_errors	ENST00000173229	ensembl	human	known	69_37n	frame_shift_del	6	25.00	2	DEL	1.000	-
OMA1	115209	genome.wustl.edu	37	1	58946709	58946709	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr1:58946709C>T	ENST00000371226.3	-	9	1616	c.1503G>A	c.(1501-1503)atG>atA	p.M501I	DAB1_ENST00000485760.1_Intron|OMA1_ENST00000358603.2_Intron	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	501					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					GAAGAGTATCCATTTTCTGTT	0.338																																						dbGAP											0													178.0	164.0	168.0					1																	58946709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.1503G>A	1.37:g.58946709C>T	ENSP00000360270:p.Met501Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	pfam_Peptidase_M48	p.M501I	ENST00000371226.3	37	c.1503	CCDS608.1	1	.	.	.	.	.	.	.	.	.	.	C	4.184	0.032803	0.08101	.	.	ENSG00000162600	ENST00000371226	T	0.13420	2.59	4.31	2.43	0.29744	.	0.861815	0.10099	N	0.716146	T	0.08044	0.0201	N	0.19112	0.55	0.25355	N	0.988831	B	0.19331	0.035	B	0.14578	0.011	T	0.42344	-0.9457	10	0.17832	T	0.49	-0.0322	6.5543	0.22452	0.0:0.7795:0.0:0.2205	.	501	Q96E52	OMA1_HUMAN	I	501	ENSP00000360270:M501I	ENSP00000360270:M501I	M	-	3	0	OMA1	58719297	0.433000	0.25562	0.296000	0.24974	0.587000	0.36485	1.794000	0.38774	0.578000	0.29487	0.460000	0.39030	ATG	OMA1	-	NULL	ENSG00000162600		0.338	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMA1	HGNC	protein_coding	OTTHUMT00000027819.1	155	0.00	0	C	NM_145243		58946709	58946709	-1	no_errors	ENST00000371226	ensembl	human	known	69_37n	missense	29	63.29	50	SNP	0.414	T
OMA1	115209	genome.wustl.edu	37	1	58946709	58946709	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:58946709C>T	ENST00000371226.3	-	9	1616	c.1503G>A	c.(1501-1503)atG>atA	p.M501I	DAB1_ENST00000485760.1_Intron|OMA1_ENST00000358603.2_Intron	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	501					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					GAAGAGTATCCATTTTCTGTT	0.338																																						dbGAP											0													178.0	164.0	168.0					1																	58946709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.1503G>A	1.37:g.58946709C>T	ENSP00000360270:p.Met501Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	pfam_Peptidase_M48	p.M501I	ENST00000371226.3	37	c.1503	CCDS608.1	1	.	.	.	.	.	.	.	.	.	.	C	4.184	0.032803	0.08101	.	.	ENSG00000162600	ENST00000371226	T	0.13420	2.59	4.31	2.43	0.29744	.	0.861815	0.10099	N	0.716146	T	0.08044	0.0201	N	0.19112	0.55	0.25355	N	0.988831	B	0.19331	0.035	B	0.14578	0.011	T	0.42344	-0.9457	10	0.17832	T	0.49	-0.0322	6.5543	0.22452	0.0:0.7795:0.0:0.2205	.	501	Q96E52	OMA1_HUMAN	I	501	ENSP00000360270:M501I	ENSP00000360270:M501I	M	-	3	0	OMA1	58719297	0.433000	0.25562	0.296000	0.24974	0.587000	0.36485	1.794000	0.38774	0.578000	0.29487	0.460000	0.39030	ATG	OMA1	-	NULL	ENSG00000162600		0.338	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMA1	HGNC	protein_coding	OTTHUMT00000027819.1	89	0.00	0	C	NM_145243		58946709	58946709	-1	no_errors	ENST00000371226	ensembl	human	known	69_37n	missense	43	59.43	63	SNP	0.414	T
OMA1	115209	genome.wustl.edu	37	1	58946709	58946709	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:58946709C>T	ENST00000371226.3	-	9	1616	c.1503G>A	c.(1501-1503)atG>atA	p.M501I	DAB1_ENST00000485760.1_Intron|OMA1_ENST00000358603.2_Intron	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	501					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					GAAGAGTATCCATTTTCTGTT	0.338																																						dbGAP											0													178.0	164.0	168.0					1																	58946709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.1503G>A	1.37:g.58946709C>T	ENSP00000360270:p.Met501Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	pfam_Peptidase_M48	p.M501I	ENST00000371226.3	37	c.1503	CCDS608.1	1	.	.	.	.	.	.	.	.	.	.	C	4.184	0.032803	0.08101	.	.	ENSG00000162600	ENST00000371226	T	0.13420	2.59	4.31	2.43	0.29744	.	0.861815	0.10099	N	0.716146	T	0.08044	0.0201	N	0.19112	0.55	0.25355	N	0.988831	B	0.19331	0.035	B	0.14578	0.011	T	0.42344	-0.9457	10	0.17832	T	0.49	-0.0322	6.5543	0.22452	0.0:0.7795:0.0:0.2205	.	501	Q96E52	OMA1_HUMAN	I	501	ENSP00000360270:M501I	ENSP00000360270:M501I	M	-	3	0	OMA1	58719297	0.433000	0.25562	0.296000	0.24974	0.587000	0.36485	1.794000	0.38774	0.578000	0.29487	0.460000	0.39030	ATG	OMA1	-	NULL	ENSG00000162600		0.338	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMA1	HGNC	protein_coding	OTTHUMT00000027819.1	89	0.00	0	C	NM_145243		58946709	58946709	-1	no_errors	ENST00000371226	ensembl	human	known	69_37n	missense	63	37.62	38	SNP	0.414	T
OPRK1	4986	genome.wustl.edu	37	8	54142021	54142021	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr8:54142021G>T	ENST00000265572.3	-	4	1276	c.979C>A	c.(979-981)Ccc>Acc	p.P327T	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000524278.1_Missense_Mutation_p.P238T|OPRK1_ENST00000520287.1_Missense_Mutation_p.P327T	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	327					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TAGAGAATGGGATTCAGGCTA	0.527																																						dbGAP											0													80.0	72.0	74.0					8																	54142021		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.979C>A	8.37:g.54142021G>T	ENSP00000265572:p.Pro327Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E5RHC9|Q499G4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Kappa_opi_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Neuropept_W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt,prints_P2_purnocptor	p.P327T	ENST00000265572.3	37	c.979	CCDS6152.1	8	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721337	0.89205	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	D;D;D	0.98807	-5.15;-5.15;-5.15	5.8	5.8	0.92144	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99533	0.9833	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98087	1.0407	10	0.87932	D	0	.	20.051	0.97627	0.0:0.0:1.0:0.0	.	327	P41145	OPRK_HUMAN	T	327;238;327;313	ENSP00000265572:P327T;ENSP00000430923:P238T;ENSP00000429706:P327T	ENSP00000265572:P327T	P	-	1	0	OPRK1	54304574	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.869000	0.99810	2.740000	0.93945	0.650000	0.86243	CCC	OPRK1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000082556		0.527	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	HGNC	protein_coding	OTTHUMT00000378048.1	46	0.00	0	G			54142021	54142021	-1	no_errors	ENST00000265572	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
OR1I1	126370	genome.wustl.edu	37	19	15198617	15198617	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:15198617delG	ENST00000209540.2	+	1	827	c.741delG	c.(739-741)gtgfs	p.V248fs		NM_001004713.1	NP_001004713.1	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I, member 1	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(3)|ovary(2)|stomach(2)	20						ACCTCACTGTGGTGTCACTGT	0.537																																						dbGAP											0													136.0	102.0	114.0					19																	15198617		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AC004794	CCDS32937.1	19p13.1	2012-08-09				ENSG00000094661		"""GPCR / Class A : Olfactory receptors"""	8207	protein-coding gene	gene with protein product							Standard	NM_001004713		Approved	OR1I1P, OR19-20, OR1I1Q	uc010xoe.2	O60431		ENST00000209540.2:c.741delG	19.37:g.15198617delG	ENSP00000209540:p.Val248fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96R92	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V248fs	ENST00000209540.2	37	c.741	CCDS32937.1	19																																																																																			OR1I1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000094661		0.537	OR1I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1I1	HGNC	protein_coding	OTTHUMT00000465665.1	61	0.00	0	G			15198617	15198617	+1	no_errors	ENST00000209540	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	1.000	-
PAX4	5078	genome.wustl.edu	37	7	127251642	127251642	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr7:127251642G>T	ENST00000341640.2	-	8	1041	c.836C>A	c.(835-837)cCa>cAa	p.P279Q	PAX4_ENST00000463946.1_Missense_Mutation_p.P277Q|PAX4_ENST00000378740.2_Missense_Mutation_p.P279Q|PAX4_ENST00000338516.3_Silent_p.T268T	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	287	Transcription repression.				cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						ACACCTTTCTGGTGCTGTTGC	0.582																																					Ovarian(113;737 1605 7858 27720 34092)	dbGAP											0													83.0	86.0	85.0					7																	127251642		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.836C>A	7.37:g.127251642G>T	ENSP00000339906:p.Pro279Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O95161|Q6B0H0	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Paired_dom,prints_Paired_dom	p.P279Q	ENST00000341640.2	37	c.836	CCDS5797.1	7	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689848	0.48097	.	.	ENSG00000106331	ENST00000341640;ENST00000378740;ENST00000463946	D;D	0.94000	-3.33;-3.2	5.34	3.5	0.40072	.	0.284388	0.25741	N	0.028605	D	0.92309	0.7560	L	0.50333	1.59	0.19300	N	0.999978	D;P;D	0.54397	0.958;0.838;0.966	P;B;P	0.53809	0.483;0.216;0.735	D	0.85161	0.0992	10	0.48119	T	0.1	.	6.9429	0.24502	0.0889:0.0:0.7389:0.1722	.	279;287;277	O43316-4;O43316;G3V4Q1	.;PAX4_HUMAN;.	Q	279;287;277	ENSP00000339906:P279Q;ENSP00000451923:P277Q	ENSP00000339906:P279Q	P	-	2	0	PAX4	127038878	0.290000	0.24343	0.365000	0.25901	0.584000	0.36387	2.678000	0.46900	0.728000	0.32382	-0.142000	0.14014	CCA	PAX4	-	NULL	ENSG00000106331		0.582	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1	67	0.00	0	G			127251642	127251642	-1	no_errors	ENST00000341640	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.109	T
PAX5	5079	genome.wustl.edu	37	9	36923447	36923447	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:36923447C>T	ENST00000358127.4	-	7	889	c.815G>A	c.(814-816)gGt>gAt	p.G272D	PAX5_ENST00000520281.1_Missense_Mutation_p.G229D|PAX5_ENST00000414447.1_Missense_Mutation_p.G229D|PAX5_ENST00000522003.1_Missense_Mutation_p.G164D|PAX5_ENST00000377853.2_Missense_Mutation_p.G272D|PAX5_ENST00000523145.1_Missense_Mutation_p.G164D|PAX5_ENST00000377852.2_Missense_Mutation_p.G272D|PAX5_ENST00000446742.1_Missense_Mutation_p.G206D|PAX5_ENST00000377847.2_Missense_Mutation_p.G272D|PAX5_ENST00000523241.1_Intron|PAX5_ENST00000520154.1_Intron	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	272					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(23)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		GTCCAGCCCACCAGCCAGCGA	0.577			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																	dbGAP		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	23	Unknown(23)	haematopoietic_and_lymphoid_tissue(23)											50.0	53.0	52.0					9																	36923447		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.815G>A	9.37:g.36923447C>T	ENSP00000350844:p.Gly272Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.G272D	ENST00000358127.4	37	c.815	CCDS6607.1	9	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966235	0.92855	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000520281;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000414447;ENST00000377847;ENST00000524340	D;D;D;D;D;D;D;D;D;T	0.97772	-4.02;-4.02;-4.03;-4.5;-3.72;-1.77;-2.38;-4.5;-4.53;1.14	5.93	5.93	0.95920	.	0.367890	0.29980	N	0.010701	D	0.98090	0.9370	L	0.44542	1.39	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.993;0.996;1.0;1.0;1.0;1.0;1.0	D;P;P;D;D;D;D;D	0.87578	0.992;0.796;0.791;0.992;0.998;0.992;0.992;0.992	D	0.98802	1.0740	10	0.56958	D	0.05	.	19.1082	0.93305	0.0:1.0:0.0:0.0	.	229;229;206;272;99;272;272;272	C0KTF8;C0KTF7;C0KTF9;C0KTF6;C0KTE2;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;.;PAX5_HUMAN	D	272;183;272;272;229;206;164;164;229;272;99	ENSP00000350844:G272D;ENSP00000367084:G272D;ENSP00000367083:G272D;ENSP00000430773:G229D;ENSP00000404687:G206D;ENSP00000429359:G164D;ENSP00000429197:G164D;ENSP00000412188:G229D;ENSP00000367078:G272D;ENSP00000429404:G99D	ENSP00000350844:G272D	G	-	2	0	PAX5	36913447	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.657000	0.74402	2.805000	0.96524	0.655000	0.94253	GGT	PAX5	-	NULL	ENSG00000196092		0.577	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX5	HGNC	protein_coding	OTTHUMT00000052433.1	30	0.00	0	C			36923447	36923447	-1	no_errors	ENST00000358127	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	1.000	T
PC	5091	genome.wustl.edu	37	11	66631291	66631291	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:66631291G>T	ENST00000393958.2	-	11	1415	c.1322C>A	c.(1321-1323)aCc>aAc	p.T441N	PC_ENST00000355677.3_Missense_Mutation_p.T441N|PC_ENST00000524491.1_Missense_Mutation_p.T401N|PC_ENST00000393960.1_Missense_Mutation_p.T441N|PC_ENST00000393955.2_Missense_Mutation_p.T441N	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	441	Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GCTCATCTTGGTGGCGGCCGT	0.652																																						dbGAP											0													126.0	116.0	119.0					11																	66631291		2200	4295	6495	-	-	-	SO:0001583	missense	0			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1322C>A	11.37:g.66631291G>T	ENSP00000377530:p.Thr441Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DN00|Q16705	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Carboxylase_cons_dom,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_PYR_CT,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pirsf_Pyruv_COase,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_PYR_CT,pfscan_Biotin_lipoyl,tigrfam_Pyruv_COase	p.T441N	ENST00000393958.2	37	c.1322	CCDS8152.1	11	.	.	.	.	.	.	.	.	.	.	G	12.36	1.915954	0.33815	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	5.54	5.54	0.83059	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.142779	0.49305	D	0.000147	T	0.67655	0.2916	N	0.12471	0.22	0.53005	D	0.999965	B	0.14805	0.011	B	0.17433	0.018	T	0.61922	-0.6963	10	0.27785	T	0.31	-40.1775	16.9528	0.86250	0.0:0.0:1.0:0.0	.	441	P11498	PYC_HUMAN	N	441;441;441;401;441	ENSP00000377527:T441N;ENSP00000377530:T441N;ENSP00000377532:T441N;ENSP00000434192:T401N;ENSP00000347900:T441N	ENSP00000347900:T441N	T	-	2	0	PC	66387867	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	8.849000	0.92178	2.603000	0.88011	0.555000	0.69702	ACC	PC	-	pfam_Biotin_COase_C,superfamily_Rudment_hybrid_motif,smart_Biotin_COase_C,pirsf_Pyruv_COase,pfscan_Biotin_carboxylation_dom,tigrfam_Pyruv_COase	ENSG00000173599		0.652	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	HGNC	protein_coding	OTTHUMT00000393115.1	102	0.97	1	G	NM_001040716		66631291	66631291	-1	no_errors	ENST00000393958	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
PCSK1	5122	genome.wustl.edu	37	5	95735803	95735803	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr5:95735803C>A	ENST00000311106.3	-	10	1521	c.1284G>T	c.(1282-1284)aaG>aaT	p.K428N	CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_5'UTR|PCSK1_ENST00000508626.1_Missense_Mutation_p.K381N	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	428	Peptidase S8.				cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.K428N(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTGCTCCATTCTTTTTCCATC	0.527																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											120.0	117.0	118.0					5																	95735803		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.1284G>T	5.37:g.95735803C>A	ENSP00000308024:p.Lys428Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,pfam_Proho_convert,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.K428N	ENST00000311106.3	37	c.1284	CCDS4081.1	5	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453288	0.63290	.	.	ENSG00000175426	ENST00000311106;ENST00000508626	D;D	0.88124	-2.34;-2.34	5.35	4.49	0.54785	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.043838	0.85682	D	0.000000	D	0.88691	0.6505	L	0.52573	1.65	0.47476	D	0.999431	P;D	0.56287	0.627;0.975	P;P	0.60886	0.449;0.88	D	0.86025	0.1509	10	0.27785	T	0.31	-18.9402	10.076	0.42360	0.0:0.8451:0.0:0.1549	.	381;428	E9PHA1;P29120	.;NEC1_HUMAN	N	428;381	ENSP00000308024:K428N;ENSP00000421600:K381N	ENSP00000308024:K428N	K	-	3	2	PCSK1	95761559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.125000	0.31332	1.392000	0.46585	0.557000	0.71058	AAG	PCSK1	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000175426		0.527	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK1	HGNC	protein_coding	OTTHUMT00000242851.1	36	0.00	0	C	NM_000439		95735803	95735803	-1	no_errors	ENST00000311106	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	A
PCDHAC1	56135	genome.wustl.edu	37	5	140306879	140306879	+	Silent	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr5:140306879C>A	ENST00000253807.2	+	1	402	c.402C>A	c.(400-402)ccC>ccA	p.P134P	PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.P134P	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	134	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCACATCCCCGAGTTCCTGA	0.587																																						dbGAP											0													64.0	62.0	63.0					5																	140306879		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.402C>A	5.37:g.140306879C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5F5|Q9Y5I5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P134	ENST00000253807.2	37	c.402	CCDS4241.1	5																																																																																			PCDHAC1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000248383		0.587	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	35	0.00	0	C	NM_018898		140306879	140306879	+1	no_errors	ENST00000253807	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	0.049	A
PCDH1	5097	genome.wustl.edu	37	5	141244045	141244045	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr5:141244045G>T	ENST00000394536.3	-	3	1990	c.1851C>A	c.(1849-1851)taC>taA	p.Y617*	PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000287008.3_Nonsense_Mutation_p.Y617*|PCDH1_ENST00000536585.1_Nonsense_Mutation_p.Y595*|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Nonsense_Mutation_p.Y605*	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	617	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CTGAGAAGTTGTAGCCACTCA	0.547																																					Ovarian(132;1609 1739 4190 14731 45037)	dbGAP											0													83.0	78.0	80.0					5																	141244045		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1851C>A	5.37:g.141244045G>T	ENSP00000378043:p.Tyr617*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUP2	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Y617*	ENST00000394536.3	37	c.1851	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	g	31	5.102658	0.94245	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	.	.	.	5.76	3.98	0.46160	.	0.000000	0.47093	D	0.000259	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7082	0.62653	0.1364:0.0:0.8636:0.0	.	.	.	.	X	617;617;605;628;595	.	ENSP00000287008:Y617X	Y	-	3	2	PCDH1	141224229	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	3.471000	0.53107	0.386000	0.24997	-2.101000	0.00361	TAC	PCDH1	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000156453		0.547	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	47	0.00	0	G	NM_032420		141244045	141244045	-1	no_errors	ENST00000287008	ensembl	human	known	69_37n	nonsense	30	16.67	6	SNP	1.000	T
PIGZ	80235	genome.wustl.edu	37	3	196675479	196675479	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:196675479G>T	ENST00000412723.1	-	3	435	c.289C>A	c.(289-291)Ctg>Atg	p.L97M	PIGZ_ENST00000443835.1_Intron	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	97					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		GAGATCAGCAGGGGGAAGAGC	0.677																																						dbGAP											0													9.0	8.0	9.0					3																	196675479		2166	4239	6405	-	-	-	SO:0001583	missense	0			BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.289C>A	3.37:g.196675479G>T	ENSP00000413405:p.Leu97Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9G6	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.L97M	ENST00000412723.1	37	c.289	CCDS3324.1	3	.	.	.	.	.	.	.	.	.	.	g	13.43	2.233539	0.39498	.	.	ENSG00000119227	ENST00000412723	T	0.66995	-0.24	5.25	4.38	0.52667	.	0.358212	0.20170	N	0.097747	T	0.80859	0.4704	M	0.87097	2.86	0.80722	D	1	D	0.65815	0.995	D	0.65323	0.934	T	0.81568	-0.0873	10	0.51188	T	0.08	-2.1552	9.6441	0.39857	0.1777:0.0:0.8223:0.0	.	97	Q86VD9	PIGZ_HUMAN	M	97	ENSP00000413405:L97M	ENSP00000413405:L97M	L	-	1	2	PIGZ	198159876	0.701000	0.27806	0.926000	0.36857	0.212000	0.24457	0.921000	0.28718	1.380000	0.46344	0.538000	0.68166	CTG	PIGZ	-	pfam_GPI_mannosylTrfase	ENSG00000119227		0.677	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGZ	HGNC	protein_coding	OTTHUMT00000340486.2	61	0.00	0	G	NM_025163		196675479	196675479	-1	no_errors	ENST00000412723	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.932	T
PIK3CD	5293	genome.wustl.edu	37	1	9776655	9776655	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:9776655G>T	ENST00000377346.4	+	6	953	c.758G>T	c.(757-759)aGc>aTc	p.S253I	PIK3CD_ENST00000543390.1_5'Flank|PIK3CD_ENST00000536656.1_Missense_Mutation_p.S253I|PIK3CD_ENST00000361110.2_Missense_Mutation_p.S253I	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	253	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.			S -> N (in Ref. 3; AAC25677). {ECO:0000305}.	adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	CTGTATGGCAGCTACCCGCTC	0.657																																						dbGAP											0													29.0	25.0	27.0					1																	9776655		2182	4257	6439	-	-	-	SO:0001583	missense	0				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.758G>T	1.37:g.9776655G>T	ENSP00000366563:p.Ser253Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.S253I	ENST00000377346.4	37	c.758	CCDS104.1	1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486456	0.63962	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.45668	0.89;0.89;0.89	5.59	2.63	0.31362	Phosphoinositide 3-kinase, ras-binding (2);	0.185046	0.56097	D	0.000026	T	0.26484	0.0647	N	0.14661	0.345	0.80722	D	1	B;B;B	0.24258	0.027;0.1;0.1	B;B;B	0.33568	0.051;0.166;0.166	T	0.11891	-1.0569	10	0.66056	D	0.02	-35.3288	6.3221	0.21223	0.4149:0.0:0.5851:0.0	.	253;253;253	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	I	253	ENSP00000446444:S253I;ENSP00000366563:S253I;ENSP00000354410:S253I	ENSP00000353766:S253I	S	+	2	0	PIK3CD	9699242	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	1.692000	0.37731	1.337000	0.45525	0.655000	0.94253	AGC	PIK3CD	-	pfam_PI3K_Ras-bd_dom,smart_PI3K_Ras-bd_dom	ENSG00000171608		0.657	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CD	HGNC	protein_coding	OTTHUMT00000004235.1	107	0.00	0	G	NM_005026		9776655	9776655	+1	no_errors	ENST00000536656	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
PKNOX1	5316	genome.wustl.edu	37	21	44433349	44433349	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr21:44433349G>T	ENST00000291547.5	+	5	733		c.e5+1		PKNOX1_ENST00000432907.2_Splice_Site	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1						angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						GCAGTCCCAGGTACTTACATT	0.473																																						dbGAP											0													75.0	77.0	77.0					21																	44433349		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.522+1G>T	21.37:g.44433349G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00528|Q8IWT7	Splice_Site	SNP	-	e4+1	ENST00000291547.5	37	c.522+1	CCDS13692.1	21	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695294	0.68386	.	.	ENSG00000160199	ENST00000291547;ENST00000432907	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8683	0.57951	0.0744:0.0:0.9256:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKNOX1	43306418	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	8.044000	0.89434	2.636000	0.89361	0.561000	0.74099	.	PKNOX1	-	-	ENSG00000160199		0.473	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX1	HGNC	protein_coding	OTTHUMT00000195520.3	50	0.00	0	G		Intron	44433349	44433349	+1	no_errors	ENST00000291547	ensembl	human	known	69_37n	splice_site	35	10.26	4	SNP	1.000	T
PPP3CB	5532	genome.wustl.edu	37	10	75204367	75204367	+	Intron	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:75204367G>T	ENST00000360663.5	-	12	1478				PPP3CB_ENST00000394829.2_Intron|PPP3CB_ENST00000545874.1_Silent_p.L409L|PPP3CB_ENST00000342558.3_Silent_p.L494L|PPP3CB_ENST00000544628.1_Intron|PPP3CB_ENST00000394822.2_Silent_p.L512L|PPP3CB_ENST00000394828.2_Intron			P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta isozyme						axon extension (GO:0048675)|calcium ion-dependent exocytosis (GO:0017156)|cellular response to drug (GO:0035690)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|learning (GO:0007612)|locomotion involved in locomotory behavior (GO:0031987)|memory (GO:0007613)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein dephosphorylation (GO:0006470)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)|social behavior (GO:0035176)|T cell activation (GO:0042110)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein phosphatase 2B binding (GO:0030346)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(7)|skin(1)|urinary_tract(1)	22	Prostate(51;0.0119)					GTCAGCTGCTGAGACAGGAAC	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M29551	CCDS7328.1, CCDS44436.1, CCDS44437.1	10q22.2	2010-03-17	2010-03-05		ENSG00000107758	ENSG00000107758	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9315	protein-coding gene	gene with protein product	"""calcineurin A beta"", ""protein phosphatase 2B, catalytic subunit, beta isoform"""	114106	"""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform"""	CALNB		1659808, 2558868	Standard	XM_005269944		Approved	CALNA2, CNA2, PP2Bbeta	uc001juf.3	P16298	OTTHUMG00000018472	ENST00000360663.5:c.1366+115C>A	10.37:g.75204367G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P16299|Q5F2F9|Q8N1F0|Q8N3W4	Silent	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.L512	ENST00000360663.5	37	c.1536	CCDS7328.1	10																																																																																			PPP3CB	-	NULL	ENSG00000107758		0.418	PPP3CB-001	KNOWN	basic|CCDS	protein_coding	PPP3CB	HGNC	protein_coding	OTTHUMT00000048669.1	41	0.00	0	G	NM_021132		75204367	75204367	-1	no_errors	ENST00000394822	ensembl	human	known	69_37n	silent	22	12.00	3	SNP	0.997	T
PRAMEF4	400735	genome.wustl.edu	37	1	12939782	12939782	+	Silent	SNP	A	A	G	rs200129543		TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr1:12939782A>G	ENST00000235349.5	-	4	1090	c.1020T>C	c.(1018-1020)ctT>ctC	p.L340L		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	340					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGAGAGGCACAAGACTGTAAT	0.473																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1020T>C	1.37:g.12939782A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Silent	SNP	NULL	p.L340	ENST00000235349.5	37	c.1020	CCDS30592.1	1																																																																																			PRAMEF4	-	NULL	ENSG00000243073		0.473	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	36	0.00	0	A	NM_001009611		12939782	12939782	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	silent	39	23.53	12	SNP	0.000	G
PRKCQ	5588	genome.wustl.edu	37	10	6528089	6528089	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr10:6528089G>T	ENST00000263125.5	-	9	907	c.808C>A	c.(808-810)Cat>Aat	p.H270N	PRKCQ_ENST00000539722.1_Missense_Mutation_p.H145N|PRKCQ_ENST00000397176.2_Missense_Mutation_p.H270N	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	270					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CATCTATGATGCACATTCATG	0.507																																					Ovarian(50;572 1126 10530 25349 30594)	dbGAP											0													101.0	79.0	86.0					10																	6528089		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.808C>A	10.37:g.6528089G>T	ENSP00000263125:p.His270Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C42*	ENST00000263125.5	37	c.126	CCDS7079.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	26.6|26.6	4.752819|4.752819	0.89753|0.89753	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|D;D;D	.|0.99557	.|-6.16;-6.16;-6.16	5.52|5.52	5.52|5.52	0.82312|0.82312	.|Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	.|0.045379	.|0.85682	.|D	.|0.000000	.|D	.|0.99871	.|0.9939	H|H	0.99806|0.99806	4.795|4.795	0.80722|0.80722	D|D	1|1	.|D;D;D;P	.|0.76494	.|0.999;0.999;0.991;0.87	.|D;D;D;P	.|0.77557	.|0.99;0.973;0.941;0.771	.|D	.|0.96183	.|0.9132	.|10	.|0.87932	.|D	.|0	.|.	19.474|19.474	0.94979|0.94979	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|145;42;270;270	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	X|N	42|270;270;145	.|ENSP00000263125:H270N;ENSP00000380361:H270N;ENSP00000441752:H145N	.|ENSP00000263125:H270N	C|H	-|-	3|1	2|0	PRKCQ|PRKCQ	6568095|6568095	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.952000|0.952000	0.60782|0.60782	9.731000|9.731000	0.98807|0.98807	2.601000|2.601000	0.87937|0.87937	0.650000|0.650000	0.86243|0.86243	TGC|CAT	PRKCQ	-	NULL	ENSG00000065675		0.507	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1	45	0.00	0	G	NM_006257		6528089	6528089	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000397178	ensembl	human	known	69_37n	nonsense	8	42.86	6	SNP	1.000	T
PRKCQ	5588	genome.wustl.edu	37	10	6528089	6528089	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:6528089G>T	ENST00000263125.5	-	9	907	c.808C>A	c.(808-810)Cat>Aat	p.H270N	PRKCQ_ENST00000539722.1_Missense_Mutation_p.H145N|PRKCQ_ENST00000397176.2_Missense_Mutation_p.H270N	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	270					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CATCTATGATGCACATTCATG	0.507																																					Ovarian(50;572 1126 10530 25349 30594)	dbGAP											0													101.0	79.0	86.0					10																	6528089		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.808C>A	10.37:g.6528089G>T	ENSP00000263125:p.His270Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C42*	ENST00000263125.5	37	c.126	CCDS7079.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	26.6|26.6	4.752819|4.752819	0.89753|0.89753	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|D;D;D	.|0.99557	.|-6.16;-6.16;-6.16	5.52|5.52	5.52|5.52	0.82312|0.82312	.|Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	.|0.045379	.|0.85682	.|D	.|0.000000	.|D	.|0.99871	.|0.9939	H|H	0.99806|0.99806	4.795|4.795	0.80722|0.80722	D|D	1|1	.|D;D;D;P	.|0.76494	.|0.999;0.999;0.991;0.87	.|D;D;D;P	.|0.77557	.|0.99;0.973;0.941;0.771	.|D	.|0.96183	.|0.9132	.|10	.|0.87932	.|D	.|0	.|.	19.474|19.474	0.94979|0.94979	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|145;42;270;270	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	X|N	42|270;270;145	.|ENSP00000263125:H270N;ENSP00000380361:H270N;ENSP00000441752:H145N	.|ENSP00000263125:H270N	C|H	-|-	3|1	2|0	PRKCQ|PRKCQ	6568095|6568095	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.952000|0.952000	0.60782|0.60782	9.731000|9.731000	0.98807|0.98807	2.601000|2.601000	0.87937|0.87937	0.650000|0.650000	0.86243|0.86243	TGC|CAT	PRKCQ	-	NULL	ENSG00000065675		0.507	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1	47	0.00	0	G	NM_006257		6528089	6528089	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000397178	ensembl	human	known	69_37n	nonsense	68	26.09	24	SNP	1.000	T
ZNF512B	57473	genome.wustl.edu	37	20	62642835	62642835	+	Intron	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:62642835C>A	ENST00000450537.1	-	1	56				PRPF6_ENST00000535781.1_Silent_p.I501I|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GTGTGGAGATCAACCGTGAGC	0.612																																						dbGAP											0													54.0	46.0	49.0					20																	62642835		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+37222G>T	20.37:g.62642835C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK9|Q9ULM4	Silent	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.I501	ENST00000450537.1	37	c.1503	CCDS13548.1	20																																																																																			PRPF6	-	NULL	ENSG00000101161		0.612	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	39	0.00	0	C	NM_020713		62642835	62642835	+1	no_errors	ENST00000266079	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	1.000	A
PTCH2	8643	genome.wustl.edu	37	1	45294693	45294693	+	Silent	SNP	C	C	A	rs35851686	byFrequency	TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:45294693C>A	ENST00000372192.3	-	11	1555	c.1425G>T	c.(1423-1425)gcG>gcT	p.A475A	PTCH2_ENST00000447098.2_Silent_p.A475A	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	475	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					TGAAGGCATGCGCCAGCAGGA	0.632									Basal Cell Nevus syndrome																													dbGAP											0													34.0	28.0	30.0					1																	45294693		2195	4291	6486	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.1425G>T	1.37:g.45294693C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Silent	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.A475	ENST00000372192.3	37	c.1425	CCDS516.1	1																																																																																			PTCH2	-	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	ENSG00000117425		0.632	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	HGNC	protein_coding	OTTHUMT00000023428.4	54	0.00	0	C	NM_003738		45294693	45294693	-1	no_errors	ENST00000372192	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.865	A
PTGIS	5740	genome.wustl.edu	37	20	48124536	48124536	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr20:48124536T>G	ENST00000244043.4	-	10	1453	c.1424A>C	c.(1423-1425)gAg>gCg	p.E475A	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	475					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GAGGTCAAACTCAGGGATCTC	0.567																																						dbGAP											0													128.0	83.0	98.0					20																	48124536		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1424A>C	20.37:g.48124536T>G	ENSP00000244043:p.Glu475Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.E475A	ENST00000244043.4	37	c.1424	CCDS13419.1	20	.	.	.	.	.	.	.	.	.	.	T	5.165	0.216016	0.09810	.	.	ENSG00000124212	ENST00000244043	T	0.68331	-0.32	4.9	2.21	0.28008	.	1.038830	0.07565	N	0.917589	T	0.51329	0.1668	L	0.32530	0.975	0.09310	N	1	B	0.16396	0.017	B	0.17979	0.02	T	0.34551	-0.9824	10	0.11485	T	0.65	-19.031	6.8015	0.23754	0.1402:0.0897:0.0:0.77	.	475	Q16647	PTGIS_HUMAN	A	475	ENSP00000244043:E475A	ENSP00000244043:E475A	E	-	2	0	PTGIS	47557943	0.000000	0.05858	0.531000	0.27976	0.536000	0.34869	-0.366000	0.07563	0.711000	0.32018	0.379000	0.24179	GAG	PTGIS	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000124212		0.567	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIS	HGNC	protein_coding	OTTHUMT00000080496.2	51	0.00	0	T			48124536	48124536	-1	no_errors	ENST00000244043	ensembl	human	known	69_37n	missense	6	66.67	12	SNP	0.015	G
PTGIS	5740	genome.wustl.edu	37	20	48124536	48124536	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:48124536T>G	ENST00000244043.4	-	10	1453	c.1424A>C	c.(1423-1425)gAg>gCg	p.E475A	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	475					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GAGGTCAAACTCAGGGATCTC	0.567																																						dbGAP											0													128.0	83.0	98.0					20																	48124536		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1424A>C	20.37:g.48124536T>G	ENSP00000244043:p.Glu475Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.E475A	ENST00000244043.4	37	c.1424	CCDS13419.1	20	.	.	.	.	.	.	.	.	.	.	T	5.165	0.216016	0.09810	.	.	ENSG00000124212	ENST00000244043	T	0.68331	-0.32	4.9	2.21	0.28008	.	1.038830	0.07565	N	0.917589	T	0.51329	0.1668	L	0.32530	0.975	0.09310	N	1	B	0.16396	0.017	B	0.17979	0.02	T	0.34551	-0.9824	10	0.11485	T	0.65	-19.031	6.8015	0.23754	0.1402:0.0897:0.0:0.77	.	475	Q16647	PTGIS_HUMAN	A	475	ENSP00000244043:E475A	ENSP00000244043:E475A	E	-	2	0	PTGIS	47557943	0.000000	0.05858	0.531000	0.27976	0.536000	0.34869	-0.366000	0.07563	0.711000	0.32018	0.379000	0.24179	GAG	PTGIS	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000124212		0.567	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIS	HGNC	protein_coding	OTTHUMT00000080496.2	87	0.00	0	T			48124536	48124536	-1	no_errors	ENST00000244043	ensembl	human	known	69_37n	missense	85	48.48	80	SNP	0.015	G
PTGIS	5740	genome.wustl.edu	37	20	48124536	48124536	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:48124536T>G	ENST00000244043.4	-	10	1453	c.1424A>C	c.(1423-1425)gAg>gCg	p.E475A	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	475					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GAGGTCAAACTCAGGGATCTC	0.567																																						dbGAP											0													128.0	83.0	98.0					20																	48124536		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1424A>C	20.37:g.48124536T>G	ENSP00000244043:p.Glu475Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.E475A	ENST00000244043.4	37	c.1424	CCDS13419.1	20	.	.	.	.	.	.	.	.	.	.	T	5.165	0.216016	0.09810	.	.	ENSG00000124212	ENST00000244043	T	0.68331	-0.32	4.9	2.21	0.28008	.	1.038830	0.07565	N	0.917589	T	0.51329	0.1668	L	0.32530	0.975	0.09310	N	1	B	0.16396	0.017	B	0.17979	0.02	T	0.34551	-0.9824	10	0.11485	T	0.65	-19.031	6.8015	0.23754	0.1402:0.0897:0.0:0.77	.	475	Q16647	PTGIS_HUMAN	A	475	ENSP00000244043:E475A	ENSP00000244043:E475A	E	-	2	0	PTGIS	47557943	0.000000	0.05858	0.531000	0.27976	0.536000	0.34869	-0.366000	0.07563	0.711000	0.32018	0.379000	0.24179	GAG	PTGIS	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000124212		0.567	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIS	HGNC	protein_coding	OTTHUMT00000080496.2	87	0.00	0	T			48124536	48124536	-1	no_errors	ENST00000244043	ensembl	human	known	69_37n	missense	35	39.66	23	SNP	0.015	G
PTPRE	5791	genome.wustl.edu	37	10	129845722	129845722	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr10:129845722C>T	ENST00000254667.3	+	4	457	c.178C>T	c.(178-180)Ctc>Ttc	p.L60F	PTPRE_ENST00000430713.2_Missense_Mutation_p.L60F|PTPRE_ENST00000471218.1_Missense_Mutation_p.L60F|PTPRE_ENST00000419012.2_Missense_Mutation_p.L60F|PTPRE_ENST00000306042.5_5'Flank	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	60					negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GCTCCTCCTCCTCGTGCTCCT	0.642																																					Colon(52;977 1184 20575 41685)	dbGAP											0													25.0	29.0	28.0					10																	129845722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.178C>T	10.37:g.129845722C>T	ENSP00000254667:p.Leu60Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L60F	ENST00000254667.3	37	c.178	CCDS7657.1	10	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639296	0.29157	.	.	ENSG00000132334	ENST00000254667;ENST00000442830;ENST00000419012;ENST00000430713;ENST00000455661	T;T	0.03468	3.92;3.92	4.88	3.96	0.45880	.	0.343688	0.25511	N	0.030177	T	0.02533	0.0077	N	0.22421	0.69	0.09310	N	0.999996	B;B	0.29085	0.232;0.232	B;B	0.30179	0.112;0.112	T	0.43669	-0.9377	10	0.07030	T	0.85	.	8.6478	0.34016	0.1997:0.5369:0.2634:0.0	.	60;60	Q5VWH4;P23469	.;PTPRE_HUMAN	F	60	ENSP00000254667:L60F;ENSP00000402337:L60F	ENSP00000254667:L60F	L	+	1	0	PTPRE	129735712	0.036000	0.19791	0.032000	0.17829	0.063000	0.16089	0.764000	0.26532	1.163000	0.42636	0.650000	0.86243	CTC	PTPRE	-	pirsf_Tyr_Pase_rcpt_a/e-type	ENSG00000132334		0.642	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRE	HGNC	protein_coding	OTTHUMT00000050990.1	28	0.00	0	C			129845722	129845722	+1	no_errors	ENST00000254667	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.226	T
PTPRE	5791	genome.wustl.edu	37	10	129845722	129845722	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:129845722C>T	ENST00000254667.3	+	4	457	c.178C>T	c.(178-180)Ctc>Ttc	p.L60F	PTPRE_ENST00000430713.2_Missense_Mutation_p.L60F|PTPRE_ENST00000471218.1_Missense_Mutation_p.L60F|PTPRE_ENST00000419012.2_Missense_Mutation_p.L60F|PTPRE_ENST00000306042.5_5'Flank	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	60					negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GCTCCTCCTCCTCGTGCTCCT	0.642																																					Colon(52;977 1184 20575 41685)	dbGAP											0													25.0	29.0	28.0					10																	129845722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.178C>T	10.37:g.129845722C>T	ENSP00000254667:p.Leu60Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L60F	ENST00000254667.3	37	c.178	CCDS7657.1	10	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639296	0.29157	.	.	ENSG00000132334	ENST00000254667;ENST00000442830;ENST00000419012;ENST00000430713;ENST00000455661	T;T	0.03468	3.92;3.92	4.88	3.96	0.45880	.	0.343688	0.25511	N	0.030177	T	0.02533	0.0077	N	0.22421	0.69	0.09310	N	0.999996	B;B	0.29085	0.232;0.232	B;B	0.30179	0.112;0.112	T	0.43669	-0.9377	10	0.07030	T	0.85	.	8.6478	0.34016	0.1997:0.5369:0.2634:0.0	.	60;60	Q5VWH4;P23469	.;PTPRE_HUMAN	F	60	ENSP00000254667:L60F;ENSP00000402337:L60F	ENSP00000254667:L60F	L	+	1	0	PTPRE	129735712	0.036000	0.19791	0.032000	0.17829	0.063000	0.16089	0.764000	0.26532	1.163000	0.42636	0.650000	0.86243	CTC	PTPRE	-	pirsf_Tyr_Pase_rcpt_a/e-type	ENSG00000132334		0.642	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRE	HGNC	protein_coding	OTTHUMT00000050990.1	126	0.00	0	C			129845722	129845722	+1	no_errors	ENST00000254667	ensembl	human	known	69_37n	missense	109	38.42	68	SNP	0.226	T
PTPRE	5791	genome.wustl.edu	37	10	129845722	129845722	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:129845722C>T	ENST00000254667.3	+	4	457	c.178C>T	c.(178-180)Ctc>Ttc	p.L60F	PTPRE_ENST00000430713.2_Missense_Mutation_p.L60F|PTPRE_ENST00000471218.1_Missense_Mutation_p.L60F|PTPRE_ENST00000419012.2_Missense_Mutation_p.L60F|PTPRE_ENST00000306042.5_5'Flank	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	60					negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GCTCCTCCTCCTCGTGCTCCT	0.642																																					Colon(52;977 1184 20575 41685)	dbGAP											0													25.0	29.0	28.0					10																	129845722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.178C>T	10.37:g.129845722C>T	ENSP00000254667:p.Leu60Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L60F	ENST00000254667.3	37	c.178	CCDS7657.1	10	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639296	0.29157	.	.	ENSG00000132334	ENST00000254667;ENST00000442830;ENST00000419012;ENST00000430713;ENST00000455661	T;T	0.03468	3.92;3.92	4.88	3.96	0.45880	.	0.343688	0.25511	N	0.030177	T	0.02533	0.0077	N	0.22421	0.69	0.09310	N	0.999996	B;B	0.29085	0.232;0.232	B;B	0.30179	0.112;0.112	T	0.43669	-0.9377	10	0.07030	T	0.85	.	8.6478	0.34016	0.1997:0.5369:0.2634:0.0	.	60;60	Q5VWH4;P23469	.;PTPRE_HUMAN	F	60	ENSP00000254667:L60F;ENSP00000402337:L60F	ENSP00000254667:L60F	L	+	1	0	PTPRE	129735712	0.036000	0.19791	0.032000	0.17829	0.063000	0.16089	0.764000	0.26532	1.163000	0.42636	0.650000	0.86243	CTC	PTPRE	-	pirsf_Tyr_Pase_rcpt_a/e-type	ENSG00000132334		0.642	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRE	HGNC	protein_coding	OTTHUMT00000050990.1	126	0.00	0	C			129845722	129845722	+1	no_errors	ENST00000254667	ensembl	human	known	69_37n	missense	53	27.40	20	SNP	0.226	T
PTRH1	138428	genome.wustl.edu	37	9	130476544	130476544	+	Silent	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr9:130476544C>A	ENST00000419060.1	-	6	1936	c.480G>T	c.(478-480)cgG>cgT	p.R160R	C9orf117_ENST00000464092.1_3'UTR|PTRH1_ENST00000543175.1_Silent_p.R160R|TTC16_ENST00000393748.4_5'Flank|C9orf117_ENST00000373293.5_Intron|PTRH1_ENST00000423807.1_Missense_Mutation_p.G145V|PTRH1_ENST00000429848.1_5'Flank|TTC16_ENST00000373289.3_5'Flank			Q86Y79	PTH_HUMAN	peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)	160						mitochondrion (GO:0005739)	aminoacyl-tRNA hydrolase activity (GO:0004045)|poly(A) RNA binding (GO:0044822)			NS(1)	1						CGATACCCACCCGCAGCCTTG	0.667																																						dbGAP											0													39.0	47.0	45.0					9																	130476544		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK090922	CCDS35147.1	9q34.11	2006-02-13	2006-02-13	2006-02-13	ENSG00000187024	ENSG00000187024			27039	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 115"""	C9orf115			Standard	NM_001002913		Approved	PTH1	uc004bro.3	Q86Y79	OTTHUMG00000020710	ENST00000419060.1:c.480G>T	9.37:g.130476544C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Pept_tRNA_hydro,superfamily_Pept_tRNA_hydro	p.G145V	ENST00000419060.1	37	c.434	CCDS35147.1	9	.	.	.	.	.	.	.	.	.	.	C	10.27	1.303238	0.23736	.	.	ENSG00000187024	ENST00000423807	.	.	.	4.76	0.775	0.18527	.	.	.	.	.	T	0.54663	0.1872	.	.	.	0.80722	D	1	P	0.42518	0.782	P	0.44623	0.455	T	0.54748	-0.8247	7	0.87932	D	0	-3.1241	8.4537	0.32886	0.0:0.5907:0.0:0.4093	.	145	C9J7Z1	.	V	145	.	ENSP00000418219:G145V	G	-	2	0	PTRH1	129516365	0.951000	0.32395	0.992000	0.48379	0.486000	0.33341	-0.051000	0.11885	0.114000	0.18032	-0.448000	0.05591	GGG	PTRH1	-	NULL	ENSG00000187024		0.667	PTRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRH1	HGNC	protein_coding	OTTHUMT00000054219.4	59	0.00	0	C	NM_001002913		130476544	130476544	-1	no_errors	ENST00000423807	ensembl	human	novel	69_37n	missense	36	10.00	4	SNP	0.984	A
RAD54L2	23132	genome.wustl.edu	37	3	51690009	51690009	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:51690009G>T	ENST00000409535.2	+	19	3174	c.3049G>T	c.(3049-3051)Gaa>Taa	p.E1017*	RAD54L2_ENST00000296477.3_Nonsense_Mutation_p.E711*	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1017						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GAAGGGTGATGAAAAGCCTGT	0.517																																						dbGAP											0													144.0	136.0	139.0					3																	51690009		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.3049G>T	3.37:g.51690009G>T	ENSP00000386520:p.Glu1017*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB57|Q9BV54	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1017*	ENST00000409535.2	37	c.3049	CCDS33765.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.130202|10.130202	0.99343|0.99343	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000409535;ENST00000296477|ENST00000432863	.|.	.|.	.|.	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	0.245369|.	0.47852|.	D|.	0.000207|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.18276|.	T|.	0.48|.	-10.0162|-10.0162	19.583|19.583	0.95478|0.95478	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1017;711|845	.|.	ENSP00000296477:E711X|.	E|X	+|+	1|2	0|2	RAD54L2|RAD54L2	51665049|51665049	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.476000|9.476000	0.97823|0.97823	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	GAA|TGA	RAD54L2	-	NULL	ENSG00000164080		0.517	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	19	0.00	0	G	NM_015106		51690009	51690009	+1	no_errors	ENST00000409535	ensembl	human	known	69_37n	nonsense	6	40.00	4	SNP	1.000	T
RASA4CP	401331	genome.wustl.edu	37	7	44068698	44068698	+	RNA	DEL	G	G	-			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr7:44068698delG	ENST00000446874.1	-	0	1044									RAS p21 protein activator 4C, pseudogene																		AGGCAGTGATGGCTACAGCGG	0.632																																						dbGAP											0																																										-	-	-			0					7p13	2012-07-04			ENSG00000228903	ENSG00000228903			44185	pseudogene	pseudogene							Standard	NR_024116		Approved		uc011kbk.1		OTTHUMG00000155354		7.37:g.44068698delG		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000446874.1	37	NULL		7																																																																																			RASA4CP	-	-	ENSG00000228903		0.632	RASA4CP-003	KNOWN	basic	processed_transcript	RASA4CP	HGNC	pseudogene	OTTHUMT00000339613.1	9	0.00	0	G	NR_024116		44068698	44068698	-1	no_errors	ENST00000446874	ensembl	human	known	69_37n	rna	19	29.63	8	DEL	0.537	-
REV3L	5980	genome.wustl.edu	37	6	111695680	111695680	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:111695680G>T	ENST00000358835.3	-	14	4332	c.3878C>A	c.(3877-3879)tCt>tAt	p.S1293Y	REV3L_ENST00000435970.1_Missense_Mutation_p.S1215Y|REV3L_ENST00000368802.3_Missense_Mutation_p.S1293Y|REV3L_ENST00000368805.1_Missense_Mutation_p.S1293Y			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1293					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AAAGCAGCCAGATAACTTCTG	0.403								DNA polymerases (catalytic subunits)																														dbGAP											0													68.0	69.0	69.0					6																	111695680		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3878C>A	6.37:g.111695680G>T	ENSP00000351697:p.Ser1293Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.S1293Y	ENST00000358835.3	37	c.3878	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845643	0.32606	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01705	4.77;4.77;4.77;4.68	5.69	5.69	0.88448	Ribonuclease H-like (1);	0.771991	0.12376	N	0.474301	T	0.01387	0.0045	L	0.47716	1.5	0.30075	N	0.809719	P	0.44195	0.828	B	0.40782	0.34	T	0.46484	-0.9188	10	0.72032	D	0.01	.	14.3626	0.66782	0.0706:0.0:0.9294:0.0	.	1293	O60673	DPOLZ_HUMAN	Y	1293;1293;1293;1215	ENSP00000357792:S1293Y;ENSP00000357795:S1293Y;ENSP00000351697:S1293Y;ENSP00000402003:S1215Y	ENSP00000351697:S1293Y	S	-	2	0	REV3L	111802373	0.650000	0.27331	0.997000	0.53966	0.994000	0.84299	3.052000	0.49893	2.840000	0.97914	0.655000	0.94253	TCT	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.403	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	43	0.00	0	G	NM_002912		111695680	111695680	-1	no_errors	ENST00000358835	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.832	T
RHOBTB2	23221	genome.wustl.edu	37	8	22852085	22852085	+	5'UTR	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr8:22852085G>A	ENST00000519685.1	+	0	272				RP11-875O11.1_ENST00000523884.1_RNA|RHOBTB2_ENST00000522948.1_5'Flank	NM_001160036.1	NP_001153508.1	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		AGCCTGGAGGGAACACAGAGC	0.582																																						dbGAP											0													101.0	109.0	107.0					8																	22852085		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000519685.1:c.-12G>A	8.37:g.22852085G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	RNA	SNP	-	NULL	ENST00000519685.1	37	NULL	CCDS55210.1	8																																																																																			RHOBTB2	-	-	ENSG00000008853		0.582	RHOBTB2-002	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	RHOBTB2	HGNC	protein_coding	OTTHUMT00000375197.2	43	0.00	0	G			22852085	22852085	+1	no_errors	ENST00000518534	ensembl	human	known	69_37n	rna	16	15.79	3	SNP	0.000	A
RNF213	57674	genome.wustl.edu	37	17	78307961	78307961	+	Silent	SNP	C	C	G			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:78307961C>G	ENST00000582970.1	+	22	4343	c.4200C>G	c.(4198-4200)ctC>ctG	p.L1400L	RNF213_ENST00000508628.2_Silent_p.L1449L|RNF213_ENST00000456466.1_Silent_p.L1400L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1400					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACCAGGAGCTCATCCAGGCCA	0.547																																						dbGAP											0													92.0	80.0	84.0					17																	78307961		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.4200C>G	17.37:g.78307961C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L1400	ENST00000582970.1	37	c.4200	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.547	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	82	0.00	0	C	NM_020914		78307961	78307961	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	silent	135	15.09	24	SNP	0.771	G
ROBO2	6092	genome.wustl.edu	37	3	77611806	77611806	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr3:77611806C>T	ENST00000461745.1	+	10	2342	c.1442C>T	c.(1441-1443)tCt>tTt	p.S481F	ROBO2_ENST00000487694.3_Missense_Mutation_p.S497F|ROBO2_ENST00000332191.8_Missense_Mutation_p.S481F	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	481	Ig-like C2-type 5.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CACTAGATTTCTGATACTGGC	0.388																																						dbGAP											0													102.0	98.0	99.0					3																	77611806		1891	4131	6022	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1442C>T	3.37:g.77611806C>T	ENSP00000417164:p.Ser481Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S481F	ENST00000461745.1	37	c.1442	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289676	0.59976	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.32753	1.44;1.44;1.44	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.45606	D	0.000342	T	0.66548	0.2800	H	0.94345	3.525	0.49582	D	0.999801	P;P;P	0.52842	0.956;0.904;0.84	P;P;P	0.59948	0.866;0.789;0.866	T	0.74785	-0.3547	9	0.66056	D	0.02	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	497;481;481	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	F	497;497;501;481;481;202	ENSP00000417335:S497F;ENSP00000417164:S481F;ENSP00000327536:S481F	ENSP00000327536:S481F	S	+	2	0	ROBO2	77694496	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	6.027000	0.70881	2.885000	0.99019	0.655000	0.94253	TCT	ROBO2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000185008		0.388	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	109	0.00	0	C	XM_031246		77611806	77611806	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	37	42.19	27	SNP	1.000	T
ROBO2	6092	genome.wustl.edu	37	3	77611806	77611806	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:77611806C>T	ENST00000461745.1	+	10	2342	c.1442C>T	c.(1441-1443)tCt>tTt	p.S481F	ROBO2_ENST00000487694.3_Missense_Mutation_p.S497F|ROBO2_ENST00000332191.8_Missense_Mutation_p.S481F	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	481	Ig-like C2-type 5.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CACTAGATTTCTGATACTGGC	0.388																																						dbGAP											0													102.0	98.0	99.0					3																	77611806		1891	4131	6022	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1442C>T	3.37:g.77611806C>T	ENSP00000417164:p.Ser481Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S481F	ENST00000461745.1	37	c.1442	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289676	0.59976	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.32753	1.44;1.44;1.44	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.45606	D	0.000342	T	0.66548	0.2800	H	0.94345	3.525	0.49582	D	0.999801	P;P;P	0.52842	0.956;0.904;0.84	P;P;P	0.59948	0.866;0.789;0.866	T	0.74785	-0.3547	9	0.66056	D	0.02	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	497;481;481	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	F	497;497;501;481;481;202	ENSP00000417335:S497F;ENSP00000417164:S481F;ENSP00000327536:S481F	ENSP00000327536:S481F	S	+	2	0	ROBO2	77694496	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	6.027000	0.70881	2.885000	0.99019	0.655000	0.94253	TCT	ROBO2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000185008		0.388	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	83	0.00	0	C	XM_031246		77611806	77611806	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	102	40.70	70	SNP	1.000	T
ROBO2	6092	genome.wustl.edu	37	3	77611806	77611806	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr3:77611806C>T	ENST00000461745.1	+	10	2342	c.1442C>T	c.(1441-1443)tCt>tTt	p.S481F	ROBO2_ENST00000487694.3_Missense_Mutation_p.S497F|ROBO2_ENST00000332191.8_Missense_Mutation_p.S481F	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	481	Ig-like C2-type 5.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CACTAGATTTCTGATACTGGC	0.388																																						dbGAP											0													102.0	98.0	99.0					3																	77611806		1891	4131	6022	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1442C>T	3.37:g.77611806C>T	ENSP00000417164:p.Ser481Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S481F	ENST00000461745.1	37	c.1442	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289676	0.59976	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.32753	1.44;1.44;1.44	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.45606	D	0.000342	T	0.66548	0.2800	H	0.94345	3.525	0.49582	D	0.999801	P;P;P	0.52842	0.956;0.904;0.84	P;P;P	0.59948	0.866;0.789;0.866	T	0.74785	-0.3547	9	0.66056	D	0.02	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	497;481;481	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	F	497;497;501;481;481;202	ENSP00000417335:S497F;ENSP00000417164:S481F;ENSP00000327536:S481F	ENSP00000327536:S481F	S	+	2	0	ROBO2	77694496	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	6.027000	0.70881	2.885000	0.99019	0.655000	0.94253	TCT	ROBO2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000185008		0.388	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	83	0.00	0	C	XM_031246		77611806	77611806	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	82	15.31	15	SNP	1.000	T
RPS6KL1	83694	genome.wustl.edu	37	14	75378070	75378070	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr14:75378070C>A	ENST00000555647.1	-	7	832	c.545G>T	c.(544-546)tGc>tTc	p.C182F	RPS6KL1_ENST00000554900.1_5'UTR|RPS6KL1_ENST00000354625.2_Missense_Mutation_p.C151F|RPS6KL1_ENST00000557413.1_Missense_Mutation_p.C182F|RPS6KL1_ENST00000358328.4_Missense_Mutation_p.C182F			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	182	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		CACCATGTGGCACCTGGGTAG	0.622																																						dbGAP											0													88.0	77.0	81.0					14																	75378070		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.545G>T	14.37:g.75378070C>A	ENSP00000452027:p.Cys182Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_MIT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_MIT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C182F	ENST00000555647.1	37	c.545	CCDS9834.2	14	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600627	0.87055	.	.	ENSG00000198208	ENST00000555647;ENST00000354625;ENST00000557413;ENST00000358328	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	5.72	5.72	0.89469	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.056332	0.64402	D	0.000001	T	0.23766	0.0575	L	0.56769	1.78	0.43430	D	0.995599	D;D;D	0.71674	0.995;0.991;0.998	P;P;D	0.67548	0.862;0.771;0.952	T	0.00047	-1.2208	10	0.66056	D	0.02	-19.4331	13.7013	0.62611	0.0:0.8001:0.1999:0.0	.	182;182;151	Q9Y6S9;Q9Y6S9-4;Q9Y6S9-2	RPKL1_HUMAN;.;.	F	182;151;182;182	ENSP00000452027:C182F;ENSP00000346644:C151F;ENSP00000450567:C182F;ENSP00000351086:C182F	ENSP00000346644:C151F	C	-	2	0	RPS6KL1	74447823	1.000000	0.71417	0.993000	0.49108	0.932000	0.56968	6.380000	0.73158	2.692000	0.91855	0.561000	0.74099	TGC	RPS6KL1	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198208		0.622	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPS6KL1	HGNC	protein_coding	OTTHUMT00000413732.1	52	0.00	0	C			75378070	75378070	-1	no_errors	ENST00000358328	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	A
RTEL1	51750	genome.wustl.edu	37	20	62319311	62319311	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:62319311G>T	ENST00000360203.5	+	18	1828	c.1503G>T	c.(1501-1503)gaG>gaT	p.E501D	RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.E501D|RTEL1_ENST00000370018.3_Missense_Mutation_p.E501D|RTEL1_ENST00000318100.4_Missense_Mutation_p.E501D|RTEL1_ENST00000508582.2_Missense_Mutation_p.E525D|RTEL1_ENST00000370003.1_5'Flank					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			TCTGCCTGGAGAACCCACACA	0.647																																						dbGAP											0													35.0	34.0	35.0					20																	62319311		2199	4292	6491	-	-	-	SO:0001583	missense	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1503G>T	20.37:g.62319311G>T	ENSP00000353332:p.Glu501Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.E501D	ENST00000360203.5	37	c.1503		20	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544357	0.86022	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203	D;D;D;D	0.84873	-1.89;-1.91;-1.86;-1.89	5.48	3.54	0.40534	.	0.053634	0.64402	D	0.000001	D	0.93716	0.7992	H	0.95402	3.665	0.50171	D	0.999852	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.996;0.998;0.986	D	0.93302	0.6677	10	0.87932	D	0	-38.1209	9.7509	0.40475	0.2254:0.0:0.7746:0.0	.	525;501;501	Q9NZ71-7;Q9NZ71;Q9NZ71-6	.;RTEL1_HUMAN;.	D	501;501;525;501	ENSP00000359035:E501D;ENSP00000322287:E501D;ENSP00000424307:E525D;ENSP00000353332:E501D	ENSP00000353332:E501D	E	+	3	2	AL353715.1	61789755	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	1.867000	0.39499	0.695000	0.31675	0.561000	0.74099	GAG	RTEL1	-	tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000258366		0.647	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	46	0.00	0	G	NM_032957		62319311	62319311	+1	no_errors	ENST00000318100	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
SAG	6295	genome.wustl.edu	37	2	234235771	234235771	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:234235771G>T	ENST00000409110.1	+	7	670	c.440G>T	c.(439-441)tGt>tTt	p.C147F	SAG_ENST00000449594.2_Missense_Mutation_p.C13F	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	147					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		CAACAGTCCTGTGGGGTTGAC	0.577																																						dbGAP											0													99.0	100.0	99.0					2																	234235771		2049	4204	6253	-	-	-	SO:0001583	missense	0				CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.440G>T	2.37:g.234235771G>T	ENSP00000386444:p.Cys147Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.C147F	ENST00000409110.1	37	c.440	CCDS46545.1	2	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804757	0.50315	.	.	ENSG00000130561	ENST00000252857;ENST00000447536;ENST00000409110;ENST00000449594	T;T;T	0.20598	2.06;2.06;2.06	3.96	3.96	0.45880	Arrestin, N-terminal (1);Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.78314	0.898;0.991	T	0.66779	-0.5837	10	0.87932	D	0	-4.9448	14.7721	0.69688	0.0:0.0:1.0:0.0	.	13;147	B7Z7L5;P10523	.;ARRS_HUMAN	F	147;147;147;13	ENSP00000408937:C147F;ENSP00000386444:C147F;ENSP00000392889:C13F	ENSP00000252857:C147F	C	+	2	0	SAG	233900510	1.000000	0.71417	0.997000	0.53966	0.128000	0.20619	8.524000	0.90579	2.204000	0.70986	0.555000	0.69702	TGT	SAG	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000130561		0.577	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAG	HGNC	protein_coding	OTTHUMT00000330126.1	48	0.00	0	G	NM_000541		234235771	234235771	+1	no_errors	ENST00000409110	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	1.000	T
SAMD4B	55095	genome.wustl.edu	37	19	39869181	39869181	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:39869181G>T	ENST00000314471.6	+	11	2517	c.1482G>T	c.(1480-1482)gaG>gaT	p.E494D	SAMD4B_ENST00000598913.1_Missense_Mutation_p.E494D|SAMD4B_ENST00000596368.1_Intron	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CAGACGAGGAGAACATCACCA	0.567																																						dbGAP											0													164.0	120.0	135.0					19																	39869181		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.1482G>T	19.37:g.39869181G>T	ENSP00000317224:p.Glu494Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z0M6|Q6P194	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.E494D	ENST00000314471.6	37	c.1482	CCDS33020.1	19	.	.	.	.	.	.	.	.	.	.	G	12.71	2.019799	0.35606	.	.	ENSG00000179134	ENST00000314471;ENST00000429637	.	.	.	4.66	2.42	0.29668	Smaug, pseudo-HEAT analogous topology (1);	0.256814	0.35262	N	0.003322	T	0.24967	0.0606	N	0.17278	0.47	0.33146	D	0.545009	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.12243	-1.0555	9	0.32370	T	0.25	.	3.78	0.08677	0.2296:0.206:0.5645:0.0	.	494;494	Q5PRF9;A5Z0M6	SMAG2_HUMAN;.	D	494	.	ENSP00000317224:E494D	E	+	3	2	SAMD4B	44561021	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.432000	0.34936	1.175000	0.42826	0.467000	0.42956	GAG	SAMD4B	-	NULL	ENSG00000179134		0.567	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4B	HGNC	protein_coding	OTTHUMT00000464467.1	48	0.00	0	G	NM_018028		39869181	39869181	+1	no_errors	ENST00000314471	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	T
SIAE	54414	genome.wustl.edu	37	11	124506876	124506876	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:124506876G>T	ENST00000263593.3	-	10	1715	c.1543C>A	c.(1543-1545)Cct>Act	p.P515T	RNA5SP352_ENST00000363408.1_RNA|SIAE_ENST00000545756.1_Missense_Mutation_p.P480T			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	515					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		TGATGTCCAGGACCCTGGTCT	0.453																																						dbGAP											0													100.0	103.0	102.0					11																	124506876		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.1543C>A	11.37:g.124506876G>T	ENSP00000263593:p.Pro515Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Missense_Mutation	SNP	pfam_DUF303_acetylest,superfamily_Esterase_SGNH_hydro-type	p.P515T	ENST00000263593.3	37	c.1543	CCDS8449.1	11	.	.	.	.	.	.	.	.	.	.	G	10.21	1.288473	0.23478	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	D;D	0.85411	-1.98;-1.93	5.15	-4.38	0.03622	.	1.566460	0.03194	N	0.173739	T	0.80160	0.4572	L	0.60455	1.87	0.09310	N	1	B	0.24186	0.099	B	0.21917	0.037	T	0.61836	-0.6981	10	0.62326	D	0.03	-12.0253	3.9639	0.09423	0.3832:0.0982:0.4236:0.095	.	515	Q9HAT2	SIAE_HUMAN	T	515;480	ENSP00000263593:P515T;ENSP00000437877:P480T	ENSP00000263593:P515T	P	-	1	0	SIAE	124012086	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-0.102000	0.10956	-1.611000	0.01581	-2.048000	0.00412	CCT	SIAE	-	NULL	ENSG00000110013		0.453	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAE	HGNC	protein_coding	OTTHUMT00000387070.1	31	0.00	0	G	NM_170601		124506876	124506876	-1	no_errors	ENST00000263593	ensembl	human	known	69_37n	missense	18	14.29	3	SNP	0.000	T
SLC16A11	162515	genome.wustl.edu	37	17	6945433	6945433	+	Silent	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:6945433G>A	ENST00000308009.1	-	3	1405	c.1068C>T	c.(1066-1068)taC>taT	p.Y356Y	SLC16A11_ENST00000447225.1_Silent_p.Y324Y	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	356					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						CCAGCGGGGCGTAACTCCCCG	0.711																																						dbGAP											0													16.0	21.0	19.0					17																	6945433		2195	4291	6486	-	-	-	SO:0001819	synonymous_variant	0			AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.1068C>T	17.37:g.6945433G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.Y356	ENST00000308009.1	37	c.1068	CCDS11086.1	17																																																																																			SLC16A11	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000174326		0.711	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC16A11	HGNC	protein_coding	OTTHUMT00000219921.1	55	0.00	0	G	NM_153357		6945433	6945433	-1	no_errors	ENST00000308009	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.080	A
SLC13A2	9058	genome.wustl.edu	37	17	26817890	26817890	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:26817890G>T	ENST00000314669.5	+	4	960	c.540G>T	c.(538-540)caG>caT	p.Q180H	SLC13A2_ENST00000444914.3_Missense_Mutation_p.Q229H|SLC13A2_ENST00000537681.1_Missense_Mutation_p.Q109H|SLC13A2_ENST00000545060.1_Missense_Mutation_p.Q137H	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	180					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	TCGAGCTCCAGGAACCAAGTC	0.587																																						dbGAP											0													57.0	51.0	53.0					17																	26817890		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.540G>T	17.37:g.26817890G>T	ENSP00000316202:p.Gln180His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.Q229H	ENST00000314669.5	37	c.687	CCDS11231.1	17	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055180	0.36277	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000541739;ENST00000537681	T;T;T;T	0.03181	4.02;4.02;4.02;4.02	5.31	4.34	0.51931	.	0.597438	0.18956	N	0.126542	T	0.12178	0.0296	M	0.68593	2.085	0.46437	D	0.999044	D;B;D;D;B	0.62365	0.991;0.142;0.973;0.967;0.107	P;B;P;P;B	0.61722	0.893;0.216;0.852;0.77;0.081	T	0.04115	-1.0976	10	0.32370	T	0.25	-24.3066	10.6389	0.45582	0.1546:0.0:0.8454:0.0	.	137;229;136;109;180	F5GWV6;E7ETH5;B4E1M6;G3V1L2;Q13183	.;.;.;.;S13A2_HUMAN	H	180;229;137;136;109	ENSP00000316202:Q180H;ENSP00000392411:Q229H;ENSP00000441935:Q137H;ENSP00000440802:Q109H	ENSP00000316202:Q180H	Q	+	3	2	SLC13A2	23842017	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.197000	0.51028	1.240000	0.43803	0.650000	0.86243	CAG	SLC13A2	-	pfam_Na/sul_symport	ENSG00000007216		0.587	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A2	HGNC	protein_coding	OTTHUMT00000255722.1	68	0.00	0	G	NM_003984		26817890	26817890	+1	no_errors	ENST00000444914	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
SLC22A24	283238	genome.wustl.edu	37	11	62850756	62850756	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:62850756G>T	ENST00000417740.1	-	7	1685	c.1244C>A	c.(1243-1245)cCg>cAg	p.P415Q		NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	0					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						AAGTCCCACCGGGAACGTGAA	0.463																																						dbGAP											0													125.0	100.0	108.0					11																	62850756		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.1244C>A	11.37:g.62850756G>T	ENSP00000396586:p.Pro415Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P415Q	ENST00000417740.1	37	c.1244		11	.	.	.	.	.	.	.	.	.	.	G	9.499	1.102803	0.20632	.	.	ENSG00000197658	ENST00000417740	T	0.74421	-0.84	3.72	-5.49	0.02584	.	.	.	.	.	T	0.47322	0.1439	N	0.04508	-0.205	0.09310	N	1	B	0.30605	0.287	B	0.21360	0.034	T	0.34775	-0.9815	9	0.87932	D	0	.	11.5887	0.50933	0.4471:0.0:0.5529:0.0	.	415	C9JC66	.	Q	415	ENSP00000396586:P415Q	ENSP00000396586:P415Q	P	-	2	0	SLC22A24	62607332	0.012000	0.17670	0.000000	0.03702	0.020000	0.10135	0.744000	0.26245	-0.989000	0.03485	-0.952000	0.02654	CCG	SLC22A24	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197658		0.463	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383747.1	45	0.00	0	G	NM_173586		62850756	62850756	-1	no_errors	ENST00000417740	ensembl	human	putative	69_37n	missense	31	11.43	4	SNP	0.000	T
SLK	9748	genome.wustl.edu	37	10	105778547	105778547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:105778547G>T	ENST00000369755.3	+	15	3558	c.3013G>T	c.(3013-3015)Gaa>Taa	p.E1005*	SLK_ENST00000474260.1_3'UTR|SLK_ENST00000335753.4_Nonsense_Mutation_p.E974*	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	1005					apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TCTAGCTCGAGAAGCTGCAAT	0.353																																					NSCLC(111;540 1651 1927 4474 17706)	dbGAP											0													89.0	92.0	91.0					10																	105778547		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.3013G>T	10.37:g.105778547G>T	ENSP00000358770:p.Glu1005*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Nonsense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UVR_dom,pfscan_Prot_kinase_cat_dom	p.E1005*	ENST00000369755.3	37	c.3013	CCDS7553.1	10	.	.	.	.	.	.	.	.	.	.	G	45	11.920041	0.99617	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	19.3297	0.94281	0.0:0.0:1.0:0.0	.	.	.	.	X	974;1005	.	ENSP00000336824:E974X	E	+	1	0	SLK	105768537	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.818000	0.99354	2.571000	0.86741	0.462000	0.41574	GAA	SLK	-	superfamily_Kinase-like_dom	ENSG00000065613		0.353	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLK	HGNC	protein_coding	OTTHUMT00000050188.1	41	0.00	0	G	NM_014720		105778547	105778547	+1	no_errors	ENST00000369755	ensembl	human	known	69_37n	nonsense	21	12.50	3	SNP	1.000	T
SLTM	79811	genome.wustl.edu	37	15	59209183	59209183	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:59209183G>T	ENST00000380516.2	-	3	353	c.266C>A	c.(265-267)gCa>gAa	p.A89E	SLTM_ENST00000557950.1_5'UTR|SLTM_ENST00000536328.1_5'UTR	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	89					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CAACTCATCTGCTTCATGTTT	0.333																																						dbGAP											0													112.0	101.0	104.0					15																	59209183		2192	4292	6484	-	-	-	SO:0001583	missense	0			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.266C>A	15.37:g.59209183G>T	ENSP00000369887:p.Ala89Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.A89E	ENST00000380516.2	37	c.266	CCDS10168.2	15	.	.	.	.	.	.	.	.	.	.	G	12.40	1.925166	0.34002	.	.	ENSG00000137776	ENST00000380516;ENST00000249736	T;T	0.11169	2.81;2.8	6.03	6.03	0.97812	.	0.252471	0.27951	N	0.017190	T	0.12390	0.0301	L	0.54323	1.7	0.80722	D	1	P;B	0.34522	0.455;0.141	B;B	0.28139	0.086;0.053	T	0.10613	-1.0622	10	0.19147	T	0.46	.	18.0507	0.89347	0.0:0.0:1.0:0.0	.	89;89	C9IZZ3;Q9NWH9	.;SLTM_HUMAN	E	89	ENSP00000369887:A89E;ENSP00000249736:A89E	ENSP00000249736:A89E	A	-	2	0	SLTM	56996475	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.928000	0.70088	2.861000	0.98227	0.655000	0.94253	GCA	SLTM	-	NULL	ENSG00000137776		0.333	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	HGNC	protein_coding	OTTHUMT00000157124.1	45	0.00	0	G	NM_024755		59209183	59209183	-1	no_errors	ENST00000380516	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	T
SMEK1	55671	genome.wustl.edu	37	14	91931754	91931754	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr14:91931754C>T	ENST00000554943.1	-	11	1785	c.1670G>A	c.(1669-1671)cGt>cAt	p.R557H	SMEK1_ENST00000555718.1_5'UTR|SMEK1_ENST00000555462.1_Missense_Mutation_p.R318H|SMEK1_ENST00000337238.4_Missense_Mutation_p.R544H|SMEK1_ENST00000428424.2_Missense_Mutation_p.R318H|SMEK1_ENST00000554684.1_Missense_Mutation_p.R544H			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	557					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		TCTTTTAAAACGAAGGGCACC	0.318																																						dbGAP											0													81.0	80.0	81.0					14																	91931754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.1670G>A	14.37:g.91931754C>T	ENSP00000450883:p.Arg557His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.R557H	ENST00000554943.1	37	c.1670		14	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111886	0.77210	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390	D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	6.15	6.15	0.99193	Armadillo-type fold (1);	0.094899	0.64402	D	0.000001	D	0.98245	0.9419	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	0.979;1.0;1.0	P;D;D	0.87578	0.584;0.996;0.998	D	0.98287	1.0511	10	0.87932	D	0	-9.6184	20.8387	0.99724	0.0:1.0:0.0:0.0	.	318;557;544	Q6IN85-4;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	H	544;544;318;557;318;544	ENSP00000450864:R544H;ENSP00000337125:R544H;ENSP00000392704:R318H;ENSP00000450883:R557H;ENSP00000450891:R318H;ENSP00000452596:R544H	ENSP00000337125:R544H	R	-	2	0	SMEK1	91001507	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	7.811000	0.86092	2.932000	0.99384	0.643000	0.83706	CGT	SMEK1	-	superfamily_ARM-type_fold	ENSG00000100796		0.318	SMEK1-007	KNOWN	basic	protein_coding	SMEK1	HGNC	protein_coding	OTTHUMT00000411665.1	43	0.00	0	C	NM_032560		91931754	91931754	-1	no_errors	ENST00000554943	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	1.000	T
SMEK1	55671	genome.wustl.edu	37	14	91931754	91931754	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr14:91931754C>T	ENST00000554943.1	-	11	1785	c.1670G>A	c.(1669-1671)cGt>cAt	p.R557H	SMEK1_ENST00000555718.1_5'UTR|SMEK1_ENST00000555462.1_Missense_Mutation_p.R318H|SMEK1_ENST00000337238.4_Missense_Mutation_p.R544H|SMEK1_ENST00000428424.2_Missense_Mutation_p.R318H|SMEK1_ENST00000554684.1_Missense_Mutation_p.R544H			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	557					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		TCTTTTAAAACGAAGGGCACC	0.318																																						dbGAP											0													81.0	80.0	81.0					14																	91931754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.1670G>A	14.37:g.91931754C>T	ENSP00000450883:p.Arg557His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.R557H	ENST00000554943.1	37	c.1670		14	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111886	0.77210	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390	D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	6.15	6.15	0.99193	Armadillo-type fold (1);	0.094899	0.64402	D	0.000001	D	0.98245	0.9419	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	0.979;1.0;1.0	P;D;D	0.87578	0.584;0.996;0.998	D	0.98287	1.0511	10	0.87932	D	0	-9.6184	20.8387	0.99724	0.0:1.0:0.0:0.0	.	318;557;544	Q6IN85-4;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	H	544;544;318;557;318;544	ENSP00000450864:R544H;ENSP00000337125:R544H;ENSP00000392704:R318H;ENSP00000450883:R557H;ENSP00000450891:R318H;ENSP00000452596:R544H	ENSP00000337125:R544H	R	-	2	0	SMEK1	91001507	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	7.811000	0.86092	2.932000	0.99384	0.643000	0.83706	CGT	SMEK1	-	superfamily_ARM-type_fold	ENSG00000100796		0.318	SMEK1-007	KNOWN	basic	protein_coding	SMEK1	HGNC	protein_coding	OTTHUMT00000411665.1	43	0.00	0	C	NM_032560		91931754	91931754	-1	no_errors	ENST00000554943	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	1.000	T
SPATA8	145946	genome.wustl.edu	37	15	97328341	97328341	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:97328341G>A	ENST00000328504.3	+	3	579	c.312G>A	c.(310-312)tgG>tgA	p.W104*	SPATA8_ENST00000558553.1_Missense_Mutation_p.V64I|SPATA8-AS1_ENST00000558722.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	104								p.W104*(1)		large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			CATATTGCTGGTCCTGATTTT	0.478																																						dbGAP											1	Substitution - Nonsense(1)	skin(1)											158.0	148.0	152.0					15																	97328341		2197	4298	6495	-	-	-	SO:0001587	stop_gained	0			AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.312G>A	15.37:g.97328341G>A	ENSP00000328149:p.Trp104*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KJ07	Nonsense_Mutation	SNP	NULL	p.W104*	ENST00000328504.3	37	c.312	CCDS10376.1	15	.	.	.	.	.	.	.	.	.	.	G	11.65	1.700968	0.30142	.	.	ENSG00000185594	ENST00000328504	.	.	.	3.52	-7.05	0.01573	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.2247	0.06728	0.2797:0.4611:0.107:0.1521	.	.	.	.	X	104	.	ENSP00000328149:W104X	W	+	3	0	SPATA8	95129345	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.766000	0.04725	-2.599000	0.00452	-1.615000	0.00797	TGG	SPATA8	-	NULL	ENSG00000185594		0.478	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA8	HGNC	protein_coding	OTTHUMT00000313533.1	48	0.00	0	G	NM_173499		97328341	97328341	+1	no_errors	ENST00000328504	ensembl	human	known	69_37n	nonsense	35	10.26	4	SNP	0.000	A
SRRM2	23524	genome.wustl.edu	37	16	2810336	2810336	+	Missense_Mutation	SNP	G	G	T	rs190081047		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:2810336G>T	ENST00000301740.8	+	10	1417	c.868G>T	c.(868-870)Gcc>Tcc	p.A290S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	290	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TCATACAACTGCCTTGGCTGG	0.552																																						dbGAP											0													70.0	56.0	61.0					16																	2810336		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.868G>T	16.37:g.2810336G>T	ENSP00000301740:p.Ala290Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.A290S	ENST00000301740.8	37	c.868	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.788579	0.00623	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000396975;ENST00000426305	T	0.23754	1.89	5.15	-3.68	0.04463	.	0.498890	0.18306	N	0.145243	T	0.10766	0.0263	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18366	-1.0339	10	0.30854	T	0.27	2.317	8.3074	0.32051	0.1867:0.0:0.707:0.1063	.	290	Q9UQ35	SRRM2_HUMAN	S	290;290;194;255	ENSP00000301740:A290S	ENSP00000301740:A290S	A	+	1	0	SRRM2	2750337	0.003000	0.15002	0.008000	0.14137	0.506000	0.33950	-0.478000	0.06575	-0.650000	0.05423	0.563000	0.77884	GCC	SRRM2	-	NULL	ENSG00000167978		0.552	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	48	0.00	0	G			2810336	2810336	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.011	T
ST3GAL2	6483	genome.wustl.edu	37	16	70422296	70422296	+	Missense_Mutation	SNP	G	G	T	rs139403154		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:70422296G>T	ENST00000393640.4	-	3	2794	c.687C>A	c.(685-687)agC>agA	p.S229R	ST3GAL2_ENST00000342907.2_Missense_Mutation_p.S229R|RP11-529K1.4_ENST00000566960.1_RNA			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	229					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				TGGACAAGGCGCTGGCGATCC	0.577																																						dbGAP											0													133.0	124.0	127.0					16																	70422296		2198	4300	6498	-	-	-	SO:0001583	missense	0			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.687C>A	16.37:g.70422296G>T	ENSP00000377257:p.Ser229Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O00654	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.S229R	ENST00000393640.4	37	c.687	CCDS10890.1	16	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074092	0.76415	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.33865	1.39;1.39	5.79	-8.87	0.00792	.	0.000000	0.85682	D	0.000000	T	0.54029	0.1833	M	0.77820	2.39	0.50813	D	0.99989	D	0.89917	1.0	D	0.97110	1.0	T	0.73588	-0.3935	10	0.56958	D	0.05	-9.7799	18.4351	0.90643	0.7856:0.0:0.2144:0.0	.	229	Q16842	SIA4B_HUMAN	R	229	ENSP00000345477:S229R;ENSP00000377257:S229R	ENSP00000345477:S229R	S	-	3	2	ST3GAL2	68979797	0.026000	0.19158	0.699000	0.30290	0.783000	0.44284	-0.393000	0.07305	-1.596000	0.01611	-1.191000	0.01696	AGC	ST3GAL2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000157350		0.577	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL2	HGNC	protein_coding	OTTHUMT00000268968.1	80	0.00	0	G	NM_006927		70422296	70422296	-1	no_errors	ENST00000342907	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.609	T
STARD10	10809	genome.wustl.edu	37	11	72466789	72466789	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:72466789G>T	ENST00000334805.6	-	6	1506	c.587C>A	c.(586-588)cCc>cAc	p.P196H	STARD10_ENST00000538536.1_Missense_Mutation_p.P150H|STARD10_ENST00000543304.1_Missense_Mutation_p.P196H|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000545082.1_Missense_Mutation_p.P167H|STARD10_ENST00000538437.1_5'UTR	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	196	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			CACCCACTTGGGTAAGGAGCC	0.592																																						dbGAP											0													53.0	57.0	56.0					11																	72466789		1914	4119	6033	-	-	-	SO:0001583	missense	0			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.587C>A	11.37:g.72466789G>T	ENSP00000335247:p.Pro196His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60532	Missense_Mutation	SNP	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.P196H	ENST00000334805.6	37	c.587	CCDS41688.1	11	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700633	0.88924	.	.	ENSG00000214530	ENST00000537351;ENST00000543304;ENST00000334805;ENST00000538536;ENST00000545082;ENST00000544767;ENST00000537947	T;T;T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69	5.19	5.19	0.71726	Lipid-binding START (3);START-like domain (1);	0.000000	0.85682	U	0.000000	D	0.88340	0.6410	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91414	0.5153	10	0.87932	D	0	-20.7385	17.313	0.87214	0.0:0.0:1.0:0.0	.	150;196	F5GY11;Q9Y365	.;PCTL_HUMAN	H	103;196;196;150;167;127;196	ENSP00000445708:P103H;ENSP00000438792:P196H;ENSP00000335247:P196H;ENSP00000440016:P150H;ENSP00000443548:P167H;ENSP00000438357:P127H;ENSP00000445657:P196H	ENSP00000335247:P196H	P	-	2	0	STARD10	72144437	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.864000	0.99589	2.417000	0.82017	0.491000	0.48974	CCC	STARD10	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	ENSG00000214530		0.592	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STARD10	HGNC	protein_coding	OTTHUMT00000397254.1	43	0.00	0	G			72466789	72466789	-1	no_errors	ENST00000334805	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	1.000	T
STMN1	3925	genome.wustl.edu	37	1	26227357	26227357	+	3'UTR	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:26227357C>A	ENST00000399728.1	-	0	963				STMN1_ENST00000374291.1_3'UTR|STMN1_ENST00000426559.2_Intron|STMN1_ENST00000357865.2_3'UTR|STMN1_ENST00000455785.2_3'UTR|STMN1_ENST00000465604.1_5'UTR	NM_203401.1	NP_981946.1	P16949	STMN1_HUMAN	stathmin 1						axonogenesis (GO:0007409)|intracellular signal transduction (GO:0035556)|microtubule depolymerization (GO:0007019)|mitotic spindle organization (GO:0007052)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of cellular component movement (GO:0051272)|response to virus (GO:0009615)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|microtubule (GO:0005874)	signal transducer activity (GO:0004871)|tubulin binding (GO:0015631)			breast(2)|large_intestine(2)|skin(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000163)|all_lung(284;0.000234)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.013)|READ - Rectum adenocarcinoma(331;0.0649)		CCTAAAACAACATCTTACAGT	0.358																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			J04991	CCDS269.1, CCDS44090.1	1p36.11	2011-02-09	2009-04-28	2001-07-13	ENSG00000117632	ENSG00000117632			6510	protein-coding gene	gene with protein product	"""oncoprotein 18"""	151442	"""chromosome 1 open reading frame 215"", ""stathmin 1/oncoprotein 18"""	LAP18, C1orf215		2917975	Standard	NM_005563		Approved	SMN, OP18, PR22, PP19, PP17, Lag, FLJ32206	uc010oev.2	P16949	OTTHUMG00000007389	ENST00000399728.1:c.*150G>T	1.37:g.26227357C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2D1|B2R4E7|B7Z8N4|D3DPJ5	RNA	SNP	-	NULL	ENST00000399728.1	37	NULL	CCDS269.1	1																																																																																			STMN1	-	-	ENSG00000117632		0.358	STMN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STMN1	HGNC	protein_coding	OTTHUMT00000019359.1	20	0.00	0	C	NM_005563		26227357	26227357	-1	no_errors	ENST00000465604	ensembl	human	known	69_37n	rna	16	20.00	4	SNP	1.000	A
SVIL	6840	genome.wustl.edu	37	10	29760118	29760118	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:29760118C>A	ENST00000355867.4	-	31	6336	c.5584G>T	c.(5584-5586)Ggg>Tgg	p.G1862W	SVIL_ENST00000375398.2_Missense_Mutation_p.G1862W|PTCHD3P1_ENST00000413405.1_RNA|SVIL_ENST00000375400.3_Missense_Mutation_p.G1436W|PTCHD3P1_ENST00000414457.1_RNA|PTCHD3P1_ENST00000446807.1_RNA|SVIL_ENST00000535393.1_Missense_Mutation_p.G776W|PTCHD3P1_ENST00000455774.1_RNA|PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000460007.1_5'Flank	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1862					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				ACCACCATCCCCCCCTGGAAA	0.532																																						dbGAP											0													74.0	62.0	66.0					10																	29760118		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.5584G>T	10.37:g.29760118C>A	ENSP00000348128:p.Gly1862Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.G1862W	ENST00000355867.4	37	c.5584	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.209116	0.95069	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	6.03	6.03	0.97812	.	0.046981	0.85682	D	0.000000	T	0.49236	0.1545	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	1.0;0.989;0.991	D;D;D	0.83275	0.996;0.941;0.913	T	0.55114	-0.8191	10	0.87932	D	0	-26.919	20.5568	0.99304	0.0:1.0:0.0:0.0	.	776;1436;1862	F5H2Q5;O95425-2;O95425	.;.;SVIL_HUMAN	W	1436;1862;1862;776	ENSP00000364549:G1436W;ENSP00000364547:G1862W;ENSP00000348128:G1862W;ENSP00000445472:G776W	ENSP00000348128:G1862W	G	-	1	0	SVIL	29800124	1.000000	0.71417	0.992000	0.48379	0.941000	0.58515	7.683000	0.84093	2.861000	0.98227	0.655000	0.94253	GGG	SVIL	-	smart_Gelsolin	ENSG00000197321		0.532	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	52	0.00	0	C			29760118	29760118	-1	no_errors	ENST00000355867	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	A
SVOPL	136306	genome.wustl.edu	37	7	138305870	138305870	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr7:138305870G>T	ENST00000419765.3	-	13	1307	c.1274C>A	c.(1273-1275)aCc>aAc	p.T425N	SVOPL_ENST00000463557.1_Intron|SVOPL_ENST00000436657.1_Missense_Mutation_p.T273N|SVOPL_ENST00000288513.5_Missense_Mutation_p.T273N|SVOPL_ENST00000421622.1_Missense_Mutation_p.T305N	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	425						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						GCGCATCGTGGTGGGGTAGAC	0.592																																						dbGAP											0													58.0	45.0	50.0					7																	138305870		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.1274C>A	7.37:g.138305870G>T	ENSP00000405482:p.Thr425Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T425N	ENST00000419765.3	37	c.1274	CCDS47721.1	7	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369655	0.82573	.	.	ENSG00000157703	ENST00000288513;ENST00000421622;ENST00000436657;ENST00000419765	T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84	5.32	5.32	0.75619	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.101621	0.64402	D	0.000003	D	0.88239	0.6383	M	0.90019	3.08	0.52501	D	0.999956	D;P	0.52996	0.957;0.947	P;P	0.61201	0.885;0.74	D	0.90542	0.4503	10	0.87932	D	0	-24.8232	18.9961	0.92813	0.0:0.0:1.0:0.0	.	425;273	Q8N434;Q8N434-2	SVOPL_HUMAN;.	N	273;305;273;425	ENSP00000288513:T273N;ENSP00000412830:T305N;ENSP00000417018:T273N;ENSP00000405482:T425N	ENSP00000288513:T273N	T	-	2	0	SVOPL	137956410	1.000000	0.71417	0.941000	0.38009	0.783000	0.44284	7.177000	0.77650	2.484000	0.83849	0.650000	0.86243	ACC	SVOPL	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000157703		0.592	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SVOPL	HGNC	protein_coding	OTTHUMT00000342092.4	69	0.00	0	G	NM_174959		138305870	138305870	-1	no_errors	ENST00000419765	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.995	T
TAAR5	9038	genome.wustl.edu	37	6	132910744	132910744	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:132910744C>T	ENST00000258034.2	-	1	133	c.82G>A	c.(82-84)Gta>Ata	p.V28I		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	28					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		AGAGTATGTACTGTCCTGGGG	0.502																																						dbGAP											0													112.0	106.0	108.0					6																	132910744		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.82G>A	6.37:g.132910744C>T	ENSP00000258034:p.Val28Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Trace_amine_rcpt	p.V28I	ENST00000258034.2	37	c.82	CCDS5156.1	6	.	.	.	.	.	.	.	.	.	.	C	10.99	1.508756	0.27036	.	.	ENSG00000135569	ENST00000258034	T	0.37235	1.21	5.43	-3.49	0.04724	.	0.594657	0.14363	N	0.324283	T	0.05640	0.0148	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34054	-0.9844	10	0.35671	T	0.21	-8.8224	5.1356	0.14934	0.0965:0.179:0.5137:0.2109	.	28	O14804	TAAR5_HUMAN	I	28	ENSP00000258034:V28I	ENSP00000258034:V28I	V	-	1	0	TAAR5	132952437	0.000000	0.05858	0.000000	0.03702	0.904000	0.53231	-1.492000	0.02300	-0.323000	0.08602	0.655000	0.94253	GTA	TAAR5	-	NULL	ENSG00000135569		0.502	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR5	HGNC	protein_coding	OTTHUMT00000042257.1	58	0.00	0	C	NM_003967		132910744	132910744	-1	no_errors	ENST00000258034	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.000	T
TBCB	1155	genome.wustl.edu	37	19	36611663	36611663	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:36611663G>T	ENST00000221855.3	+	3	885	c.310G>T	c.(310-312)Gtg>Ttg	p.V104L	TBCB_ENST00000392178.4_3'UTR|TBCB_ENST00000589996.1_Missense_Mutation_p.V104L|TBCB_ENST00000585746.1_Missense_Mutation_p.V53L|TBCB_ENST00000586868.1_Intron	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B	104					'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGTGTCCCGGGTGGAGAAGTA	0.647																																						dbGAP											0													92.0	72.0	79.0					19																	36611663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.310G>T	19.37:g.36611663G>T	ENSP00000221855:p.Val104Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00111|O00674|O14728|Q6FGY5	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.V104L	ENST00000221855.3	37	c.310	CCDS12488.1	19	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650349	0.47362	.	.	ENSG00000105254	ENST00000221855;ENST00000392178	D	0.93019	-3.15	5.22	4.18	0.49190	Cytoskeleton-associated protein, Gly-rich domain (1);	0.124480	0.53938	D	0.000055	D	0.95614	0.8574	M	0.93763	3.455	0.80722	D	1	P;P	0.42827	0.791;0.717	B;P	0.48089	0.25;0.566	D	0.95314	0.8414	10	0.72032	D	0.01	-15.4806	9.5186	0.39120	0.0981:0.0:0.9019:0.0	.	53;104	Q6FGY5;Q99426	.;TBCB_HUMAN	L	104	ENSP00000221855:V104L	ENSP00000221855:V104L	V	+	1	0	TBCB	41303503	1.000000	0.71417	0.998000	0.56505	0.142000	0.21351	6.639000	0.74314	1.203000	0.43233	0.448000	0.29417	GTG	TBCB	-	superfamily_CAP-Gly_domain	ENSG00000105254		0.647	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCB	HGNC	protein_coding	OTTHUMT00000156291.2	47	0.00	0	G	NM_001281		36611663	36611663	+1	no_errors	ENST00000221855	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
TBC1D17	79735	genome.wustl.edu	37	19	50391058	50391058	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:50391058G>T	ENST00000221543.5	+	15	1925	c.1626G>T	c.(1624-1626)atG>atT	p.M542I	MIR4750_ENST00000584564.1_RNA|TBC1D17_ENST00000535102.2_Missense_Mutation_p.M509I	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	542					autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)			NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		ACACCCTCATGCTGTCCGGCT	0.692																																						dbGAP											0													34.0	28.0	30.0					19																	50391058		2201	4300	6501	-	-	-	SO:0001583	missense	0			AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.1626G>T	19.37:g.50391058G>T	ENSP00000221543:p.Met542Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DT12|B9A6L8|F5H1W7	Missense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.M542I	ENST00000221543.5	37	c.1626	CCDS12785.1	19	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968336	0.34754	.	.	ENSG00000104946	ENST00000221543;ENST00000535102	T;T	0.20881	2.04;2.04	4.8	4.8	0.61643	Rab-GAP/TBC domain (3);	0.103001	0.64402	D	0.000003	T	0.12774	0.0310	N	0.04768	-0.165	0.47621	D	0.99947	B;B	0.26195	0.144;0.032	B;B	0.36186	0.219;0.124	T	0.13045	-1.0524	10	0.09084	T	0.74	-32.1597	15.3813	0.74658	0.0:0.0:1.0:0.0	.	509;542	F5H1W7;Q9HA65	.;TBC17_HUMAN	I	542;509	ENSP00000221543:M542I;ENSP00000446323:M509I	ENSP00000221543:M542I	M	+	3	0	TBC1D17	55082870	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.050000	0.57404	2.479000	0.83701	0.511000	0.50034	ATG	TBC1D17	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom	ENSG00000104946		0.692	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D17	HGNC	protein_coding	OTTHUMT00000466404.1	32	0.00	0	G	NM_024682		50391058	50391058	+1	no_errors	ENST00000221543	ensembl	human	known	69_37n	missense	10	23.08	3	SNP	1.000	T
TCF12	6938	genome.wustl.edu	37	15	57578647	57578647	+	3'UTR	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:57578647C>A	ENST00000267811.5	+	0	2657				TCF12_ENST00000557843.1_3'UTR|TCF12_ENST00000559710.1_3'UTR|TCF12_ENST00000559703.1_3'UTR|TCF12_ENST00000438423.2_3'UTR|TCF12_ENST00000333725.5_3'UTR|TCF12_ENST00000452095.2_3'UTR|TCF12_ENST00000343827.3_3'UTR	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12						immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GATCTCTCCACTCACCGTGGA	0.388			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.*304C>A	15.37:g.57578647C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3D9|Q86TC1|Q86VM2	RNA	SNP	-	NULL	ENST00000267811.5	37	NULL	CCDS10159.1	15																																																																																			TCF12	-	-	ENSG00000140262		0.388	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	38	0.00	0	C	NM_003205		57578647	57578647	+1	no_errors	ENST00000560190	ensembl	human	known	69_37n	rna	31	11.43	4	SNP	1.000	A
TCIRG1	10312	genome.wustl.edu	37	11	67811701	67811701	+	Silent	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr11:67811701C>T	ENST00000265686.3	+	9	1018	c.910C>T	c.(910-912)Ctg>Ttg	p.L304L	TCIRG1_ENST00000532635.1_Silent_p.L88L	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	304					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						GGCCGTGTACCTGGCCCTGAA	0.677																																						dbGAP											0													34.0	32.0	33.0					11																	67811701		2193	4285	6478	-	-	-	SO:0001819	synonymous_variant	0			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.910C>T	11.37:g.67811701C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75877|Q8WVC5	Missense_Mutation	SNP	pfam_ATPase_V0/A0_a	p.P137L	ENST00000265686.3	37	c.410	CCDS8177.1	11	.	.	.	.	.	.	.	.	.	.	C	9.762	1.170378	0.21621	.	.	ENSG00000110719	ENST00000529364	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	T	0.73806	0.3634	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72626	-0.4236	4	.	.	.	-21.6558	17.5931	0.88003	0.0:1.0:0.0:0.0	.	.	.	.	L	137	.	.	P	+	2	0	TCIRG1	67568277	0.032000	0.19561	1.000000	0.80357	0.722000	0.41435	0.695000	0.25527	2.498000	0.84270	0.462000	0.41574	CCT	TCIRG1	-	pfam_ATPase_V0/A0_a	ENSG00000110719		0.677	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCIRG1	HGNC	protein_coding	OTTHUMT00000394305.1	24	0.00	0	C	NM_006019		67811701	67811701	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000529364	ensembl	human	novel	69_37n	missense	27	12.90	4	SNP	0.988	T
THNSL2	55258	genome.wustl.edu	37	2	88485624	88485624	+	Silent	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:88485624C>A	ENST00000324166.5	+	8	3128	c.1437C>A	c.(1435-1437)gcC>gcA	p.A479A	THNSL2_ENST00000377254.3_3'UTR|THNSL2_ENST00000449349.1_3'UTR|THNSL2_ENST00000343544.4_3'UTR|THNSL2_ENST00000496844.1_3'UTR|THNSL2_ENST00000358591.2_Silent_p.A479A	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	479					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						GGAGTCATGCCCTCAACACCT	0.562																																						dbGAP											0													47.0	54.0	52.0					2																	88485624		2153	4247	6400	-	-	-	SO:0001819	synonymous_variant	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.1437C>A	2.37:g.88485624C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Silent	SNP	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	p.A479	ENST00000324166.5	37	c.1437	CCDS2002.2	2																																																																																			THNSL2	-	NULL	ENSG00000144115		0.562	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1	57	0.00	0	C	NM_018271		88485624	88485624	+1	no_errors	ENST00000324166	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.000	A
TMEM132D	121256	genome.wustl.edu	37	12	129566436	129566436	+	Silent	SNP	C	C	A			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr12:129566436C>A	ENST00000422113.2	-	7	2117	c.1791G>T	c.(1789-1791)ctG>ctT	p.L597L	TMEM132D_ENST00000389441.4_Silent_p.L135L	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	597					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTGAGCCCAGCAGGTGGGCCA	0.652																																						dbGAP											0													47.0	48.0	48.0					12																	129566436		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1791G>T	12.37:g.129566436C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.L597	ENST00000422113.2	37	c.1791	CCDS9266.1	12																																																																																			TMEM132D	-	NULL	ENSG00000151952		0.652	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	81	0.00	0	C	NM_133448		129566436	129566436	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	silent	95	54.55	114	SNP	1.000	A
TMEM132D	121256	genome.wustl.edu	37	12	129566436	129566436	+	Silent	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr12:129566436C>A	ENST00000422113.2	-	7	2117	c.1791G>T	c.(1789-1791)ctG>ctT	p.L597L	TMEM132D_ENST00000389441.4_Silent_p.L135L	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	597					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTGAGCCCAGCAGGTGGGCCA	0.652																																						dbGAP											0													47.0	48.0	48.0					12																	129566436		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1791G>T	12.37:g.129566436C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.L597	ENST00000422113.2	37	c.1791	CCDS9266.1	12																																																																																			TMEM132D	-	NULL	ENSG00000151952		0.652	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	81	0.00	0	C	NM_133448		129566436	129566436	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	silent	56	42.27	41	SNP	1.000	A
TMEM184A	202915	genome.wustl.edu	37	7	1589215	1589215	+	Intron	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr7:1589215C>T	ENST00000297477.5	-	6	961					NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A						germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		AGGTCCAGGCCCCCGGCCTTG	0.687																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.644+274G>A	7.37:g.1589215C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBQ6	Missense_Mutation	SNP	pfam_Ost-alpha	p.G224S	ENST00000297477.5	37	c.670	CCDS43537.1	7	.	.	.	.	.	.	.	.	.	.	C	7.375	0.627614	0.14257	.	.	ENSG00000164855	ENST00000319010	T	0.52295	0.67	1.05	-2.09	0.07232	.	.	.	.	.	T	0.28300	0.0699	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20338	-1.0278	6	0.27082	T	0.32	.	2.717	0.05190	0.0:0.3283:0.2574:0.4142	.	.	.	.	S	224	ENSP00000325945:G224S	ENSP00000325945:G224S	G	-	1	0	TMEM184A	1555741	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.295000	0.02764	-1.100000	0.03030	-0.379000	0.06801	GGC	TMEM184A	-	NULL	ENSG00000164855		0.687	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM184A	HGNC	protein_coding	OTTHUMT00000239229.4	21	0.00	0	C	NM_152689		1589215	1589215	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000319010	ensembl	human	novel	69_37n	missense	6	40.00	4	SNP	0.000	T
TMEM201	199953	genome.wustl.edu	37	1	9670593	9670593	+	Missense_Mutation	SNP	C	C	T	rs188241941	byFrequency	TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr1:9670593C>T	ENST00000340381.6	+	9	1504	c.1495C>T	c.(1495-1497)Ccc>Tcc	p.P499S	TMEM201_ENST00000377376.4_Missense_Mutation_p.P475S	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	499	Ser-rich.				fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GGGGAGCTGCCCCTCCTCCCC	0.637																																						dbGAP											0													20.0	18.0	19.0					1																	9670593		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.1495C>T	1.37:g.9670593C>T	ENSP00000344503:p.Pro499Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH90|Q5SNT3	Missense_Mutation	SNP	pfam_DUF2448,pfam_DUF2349	p.P499S	ENST00000340381.6	37	c.1495	CCDS44055.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.88|16.88	3.245654|3.245654	0.59103|0.59103	.|.	.|.	ENSG00000188807|ENSG00000188807	ENST00000416541|ENST00000377376;ENST00000340381	.|.	.|.	.|.	5.19|5.19	4.25|4.25	0.50352|0.50352	.|.	0.214594|0.214594	0.40385|0.40385	N|N	0.001108|0.001108	T|T	0.38161|0.38161	0.1030|0.1030	L|L	0.27053|0.27053	0.805|0.805	0.30589|0.30589	N|N	0.761716|0.761716	.|B	.|0.33964	.|0.434	.|B	.|0.37091	.|0.241	T|T	0.51076|0.51076	-0.8751|-0.8751	6|9	.|0.66056	.|D	.|0.02	-20.1602|-20.1602	13.5078|13.5078	0.61493|0.61493	0.0:0.7645:0.2355:0.0|0.0:0.7645:0.2355:0.0	.|.	.|475	.|E9PBR6	.|.	L|S	384|475;499	.|.	.|ENSP00000344503:P499S	P|P	+|+	2|1	0|0	TMEM201|TMEM201	9593180|9593180	0.017000|0.017000	0.18338|0.18338	0.785000|0.785000	0.31869|0.31869	0.744000|0.744000	0.42396|0.42396	1.840000|1.840000	0.39230|0.39230	2.423000|2.423000	0.82170|0.82170	0.561000|0.561000	0.74099|0.74099	CCC|CCC	TMEM201	-	NULL	ENSG00000188807		0.637	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM201	HGNC	protein_coding	OTTHUMT00000127672.1	50	0.00	0	C	NM_001010866		9670593	9670593	+1	no_errors	ENST00000340381	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.971	T
TMEM242	729515	genome.wustl.edu	37	6	157739762	157739762	+	Intron	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:157739762C>A	ENST00000400788.4	-	3	429				TMEM242_ENST00000367144.4_Missense_Mutation_p.V127L	NM_018452.4	NP_060922.2	Q9NWH2	TM242_HUMAN	transmembrane protein 242							integral component of membrane (GO:0016021)											ATTTAGAACACAGTAAGCAGA	0.373																																						dbGAP											0													141.0	149.0	147.0					6																	157739762		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AF217510	CCDS43519.1	6q25.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000215712	ENSG00000215712			17206	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 35"""	C6orf35			Standard	NM_018452		Approved	BM033	uc003sih.4	Q9NWH2	OTTHUMG00000015893	ENST00000400788.4:c.327+51G>T	6.37:g.157739762C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJD0|Q9NZ88|Q9P094	Missense_Mutation	SNP	pfam_DUF1358	p.V127L	ENST00000400788.4	37	c.379	CCDS43519.1	6	.	.	.	.	.	.	.	.	.	.	C	6.581	0.475575	0.12521	.	.	ENSG00000215712	ENST00000367144	.	.	.	4.0	2.08	0.27032	.	.	.	.	.	T	0.19446	0.0467	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31779	-0.9931	5	0.87932	D	0	.	3.557	0.07867	0.1749:0.4434:0.2922:0.0895	.	.	.	.	L	127	.	ENSP00000356112:V127L	V	-	1	0	C6orf35	157659750	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.482000	0.22276	-0.087000	0.12528	-0.415000	0.06103	GTG	TMEM242	-	NULL	ENSG00000215712		0.373	TMEM242-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM242	HGNC	protein_coding	OTTHUMT00000042837.2	18	0.00	0	C			157739762	157739762	-1	no_errors	ENST00000367144	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	0.000	A
TOX2	84969	genome.wustl.edu	37	20	42683025	42683025	+	Silent	SNP	G	G	A	rs563538915	byFrequency	TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chr20:42683025G>A	ENST00000358131.5	+	5	973	c.765G>A	c.(763-765)ccG>ccA	p.P255P	TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000423191.2_Silent_p.P204P|TOX2_ENST00000341197.4_Silent_p.P246P|TOX2_ENST00000372999.1_Silent_p.P204P	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	255					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCAATGAGCCGCAGAAGCCTG	0.547													G|||	3	0.000599042	0.0	0.0	5008	,	,		18155	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													48.0	47.0	47.0					20																	42683025		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.765G>A	20.37:g.42683025G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	NULL	p.R12H	ENST00000358131.5	37	c.35	CCDS42875.1	20	.	.	.	.	.	.	.	.	.	.	G	12.41	1.931142	0.34096	.	.	ENSG00000124191	ENST00000372992;ENST00000413823	.	.	.	5.44	-8.16	0.01061	.	.	.	.	.	T	0.49525	0.1562	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59773	-0.7391	5	0.87932	D	0	.	2.531	0.04703	0.2962:0.4024:0.1001:0.2013	.	.	.	.	H	12	.	ENSP00000362083:R12H	R	+	2	0	TOX2	42116439	0.000000	0.05858	0.453000	0.27007	0.770000	0.43624	-5.579000	0.00112	-2.112000	0.00835	-0.355000	0.07637	CGC	TOX2	-	NULL	ENSG00000124191		0.547	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2	42	0.00	0	G			42683025	42683025	+1	no_start_codon	ENST00000413823	ensembl	human	known	69_37n	missense	29	36.96	17	SNP	0.649	A
TOX2	84969	genome.wustl.edu	37	20	42683025	42683025	+	Silent	SNP	G	G	A	rs563538915	byFrequency	TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:42683025G>A	ENST00000358131.5	+	5	973	c.765G>A	c.(763-765)ccG>ccA	p.P255P	TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000423191.2_Silent_p.P204P|TOX2_ENST00000341197.4_Silent_p.P246P|TOX2_ENST00000372999.1_Silent_p.P204P	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	255					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCAATGAGCCGCAGAAGCCTG	0.547													G|||	3	0.000599042	0.0	0.0	5008	,	,		18155	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													48.0	47.0	47.0					20																	42683025		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.765G>A	20.37:g.42683025G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	NULL	p.R12H	ENST00000358131.5	37	c.35	CCDS42875.1	20	.	.	.	.	.	.	.	.	.	.	G	12.41	1.931142	0.34096	.	.	ENSG00000124191	ENST00000372992;ENST00000413823	.	.	.	5.44	-8.16	0.01061	.	.	.	.	.	T	0.49525	0.1562	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59773	-0.7391	5	0.87932	D	0	.	2.531	0.04703	0.2962:0.4024:0.1001:0.2013	.	.	.	.	H	12	.	ENSP00000362083:R12H	R	+	2	0	TOX2	42116439	0.000000	0.05858	0.453000	0.27007	0.770000	0.43624	-5.579000	0.00112	-2.112000	0.00835	-0.355000	0.07637	CGC	TOX2	-	NULL	ENSG00000124191		0.547	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2	69	0.00	0	G			42683025	42683025	+1	no_start_codon	ENST00000413823	ensembl	human	known	69_37n	missense	123	27.91	48	SNP	0.649	A
TOX2	84969	genome.wustl.edu	37	20	42683025	42683025	+	Silent	SNP	G	G	A	rs563538915	byFrequency	TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr20:42683025G>A	ENST00000358131.5	+	5	973	c.765G>A	c.(763-765)ccG>ccA	p.P255P	TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000423191.2_Silent_p.P204P|TOX2_ENST00000341197.4_Silent_p.P246P|TOX2_ENST00000372999.1_Silent_p.P204P	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	255					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCAATGAGCCGCAGAAGCCTG	0.547													G|||	3	0.000599042	0.0	0.0	5008	,	,		18155	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													48.0	47.0	47.0					20																	42683025		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.765G>A	20.37:g.42683025G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	NULL	p.R12H	ENST00000358131.5	37	c.35	CCDS42875.1	20	.	.	.	.	.	.	.	.	.	.	G	12.41	1.931142	0.34096	.	.	ENSG00000124191	ENST00000372992;ENST00000413823	.	.	.	5.44	-8.16	0.01061	.	.	.	.	.	T	0.49525	0.1562	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59773	-0.7391	5	0.87932	D	0	.	2.531	0.04703	0.2962:0.4024:0.1001:0.2013	.	.	.	.	H	12	.	ENSP00000362083:R12H	R	+	2	0	TOX2	42116439	0.000000	0.05858	0.453000	0.27007	0.770000	0.43624	-5.579000	0.00112	-2.112000	0.00835	-0.355000	0.07637	CGC	TOX2	-	NULL	ENSG00000124191		0.547	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2	69	0.00	0	G			42683025	42683025	+1	no_start_codon	ENST00000413823	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	0.649	A
TPT1-AS1	100190939	genome.wustl.edu	37	13	45953414	45953414	+	RNA	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr13:45953414C>T	ENST00000521336.1	+	0	1518				TPT1-AS1_ENST00000520585.1_RNA|TPT1-AS1_ENST00000520622.1_RNA|TPT1-AS1_ENST00000523445.1_RNA|TPT1-AS1_ENST00000522845.2_RNA|TPT1-AS1_ENST00000520590.1_RNA|TPT1-AS1_ENST00000522673.1_RNA|TPT1-AS1_ENST00000517509.1_RNA|TPT1-AS1_ENST00000521507.1_RNA|TPT1-AS1_ENST00000519454.1_RNA|TPT1-AS1_ENST00000523506.1_RNA|TPT1-AS1_ENST00000520310.1_RNA					TPT1 antisense RNA 1																		agtaaggtacctgccgttggc	0.527																																						dbGAP											0																																										-	-	-			0			AF318337		13q14.13	2012-10-12	2012-08-15		ENSG00000170919	ENSG00000170919		"""Long non-coding RNAs"""	43686	non-coding RNA	RNA, long non-coding			"""TPT1 antisense RNA 1 (non-protein coding)"""				Standard	NR_024458		Approved		uc021rjh.1		OTTHUMG00000016851		13.37:g.45953414C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000521336.1	37	NULL		13																																																																																			TPT1-AS1	-	-	ENSG00000170919		0.527	TPT1-AS1-019	KNOWN	basic|exp_conf	antisense	TPT1-AS1	HGNC	antisense	OTTHUMT00000374924.1	38	0.00	0	C	NR_024458		45953414	45953414	+1	no_errors	ENST00000405697	ensembl	human	known	69_37n	rna	26	13.33	4	SNP	0.002	T
CENPT	80152	genome.wustl.edu	37	16	67861192	67861192	+	IGR	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr16:67861192C>A	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Missense_Mutation_p.Q515K|TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.Q500K|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.Q569K	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GACAGAAGAGCAAATCCAGGA	0.577																																						dbGAP											0													80.0	72.0	75.0					16																	67861192		2198	4300	6498	-	-	-	SO:0001628	intergenic_variant	0			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			16.37:g.67861192C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	NULL	p.Q515K	ENST00000562787.1	37	c.1543	CCDS42182.1	16	.	.	.	.	.	.	.	.	.	.	C	3.891	-0.024079	0.07634	.	.	ENSG00000102904	ENST00000415766;ENST00000388833;ENST00000431934	.	.	.	6.06	2.86	0.33363	.	0.845310	0.10698	N	0.644428	T	0.16300	0.0392	N	0.11560	0.145	0.09310	N	1	B;B;B;B;B;B	0.09022	0.0;0.001;0.001;0.002;0.001;0.002	B;B;B;B;B;B	0.09377	0.001;0.003;0.002;0.004;0.002;0.002	T	0.30966	-0.9960	9	0.05525	T	0.97	0.2936	7.4409	0.27183	0.4325:0.345:0.2225:0.0	.	500;569;305;223;515;500	E7ENJ7;B4DXD0;B4DY78;Q2TAA8-2;Q2TAA8;B4E1H3	.;.;.;.;TXIP1_HUMAN;.	K	500;515;305	.	ENSP00000373485:Q515K	Q	+	1	0	TSNAXIP1	66418693	0.993000	0.37304	0.246000	0.24233	0.975000	0.68041	1.463000	0.35277	0.293000	0.22520	-0.274000	0.10170	CAA	TSNAXIP1	-	NULL	ENSG00000102904		0.577	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSNAXIP1	HGNC	protein_coding	OTTHUMT00000422020.1	36	0.00	0	C	NM_025082		67861192	67861192	+1	no_errors	ENST00000388833	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	0.046	A
TTN	7273	genome.wustl.edu	37	2	179411627	179411627	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr2:179411627G>A	ENST00000591111.1	-	291	89829	c.89605C>T	c.(89605-89607)Cca>Tca	p.P29869S	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P22637S|TTN_ENST00000589042.1_Missense_Mutation_p.P31510S|TTN-AS1_ENST00000590807.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P22570S|TTN_ENST00000460472.2_Missense_Mutation_p.P22445S|TTN_ENST00000342992.6_Missense_Mutation_p.P28942S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29869	Fibronectin type-III 118. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTCTGCCTGGTGCATCTGGA	0.413																																						dbGAP											0													41.0	41.0	41.0					2																	179411627		1971	4153	6124	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89605C>T	2.37:g.179411627G>A	ENSP00000465570:p.Pro29869Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P28942S	ENST00000591111.1	37	c.86824		2	.	.	.	.	.	.	.	.	.	.	G	18.94	3.728815	0.69074	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3	5.97	5.97	0.96955	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.94315	0.8173	H	0.98218	4.175	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.95612	0.8673	9	0.87932	D	0	.	20.4214	0.99039	0.0:0.0:1.0:0.0	.	22445;22570;22637;29869	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	28942;22445;22637;22570;22442	ENSP00000343764:P28942S;ENSP00000434586:P22445S;ENSP00000340554:P22637S;ENSP00000352154:P22570S	ENSP00000340554:P22637S	P	-	1	0	TTN	179119873	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.869000	0.99810	2.820000	0.97059	0.655000	0.94253	CCA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	41	0.00	0	G	NM_133378		179411627	179411627	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	17	15.00	3	SNP	1.000	A
TULP1	7287	genome.wustl.edu	37	6	35480610	35480610	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:35480610C>A	ENST00000229771.6	-	1	105	c.26G>T	c.(25-27)cGa>cTa	p.R9L	TULP1_ENST00000322263.4_Missense_Mutation_p.R9L	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	9					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						CCACACCTCTCGGAGGGTTTC	0.632																																					GBM(55;1027 1091 11115 23439)	dbGAP											0													59.0	54.0	56.0					6																	35480610		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.26G>T	6.37:g.35480610C>A	ENSP00000229771:p.Arg9Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C	p.R9L	ENST00000229771.6	37	c.26	CCDS4807.1	6	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822017	0.71028	.	.	ENSG00000112041	ENST00000229771;ENST00000322263;ENST00000545327;ENST00000428978	D;D;T	0.86297	-1.69;-2.1;0.21	4.1	3.2	0.36748	.	0.389781	0.24007	N	0.042412	D	0.87767	0.6260	L	0.53249	1.67	0.36924	D	0.891529	B;D	0.89917	0.057;1.0	B;D	0.81914	0.019;0.995	D	0.88206	0.2887	10	0.66056	D	0.02	.	10.3651	0.44019	0.1965:0.8035:0.0:0.0	.	9;9	O00294-2;O00294	.;TULP1_HUMAN	L	9	ENSP00000229771:R9L;ENSP00000319414:R9L;ENSP00000406765:R9L	ENSP00000229771:R9L	R	-	2	0	TULP1	35588588	0.877000	0.30153	0.997000	0.53966	0.976000	0.68499	1.442000	0.35046	0.878000	0.35920	0.558000	0.71614	CGA	TULP1	-	NULL	ENSG00000112041		0.632	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP1	HGNC	protein_coding	OTTHUMT00000040307.2	41	0.00	0	C			35480610	35480610	-1	no_errors	ENST00000229771	ensembl	human	known	69_37n	missense	23	11.54	3	SNP	0.999	A
TULP4	56995	genome.wustl.edu	37	6	158925110	158925110	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr6:158925110C>A	ENST00000367097.3	+	13	5772	c.4415C>A	c.(4414-4416)cCg>cAg	p.P1472Q	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1472	TUB.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AACAAGCAGCCGCTGTGGAAC	0.667																																						dbGAP											0													16.0	20.0	19.0					6																	158925110		2199	4297	6496	-	-	-	SO:0001583	missense	0				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.4415C>A	6.37:g.158925110C>A	ENSP00000356064:p.Pro1472Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P1472Q	ENST00000367097.3	37	c.4415	CCDS34561.1	6	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546699	0.86022	.	.	ENSG00000130338	ENST00000367097	D	0.95885	-3.84	6.04	6.04	0.98038	Tubby, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98372	0.9459	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98548	1.0635	10	0.87932	D	0	-19.0324	20.5792	0.99380	0.0:1.0:0.0:0.0	.	1472	Q9NRJ4	TULP4_HUMAN	Q	1472	ENSP00000356064:P1472Q	ENSP00000356064:P1472Q	P	+	2	0	TULP4	158845098	1.000000	0.71417	0.007000	0.13788	0.953000	0.61014	7.324000	0.79115	2.873000	0.98535	0.561000	0.74099	CCG	TULP4	-	pfam_Tubby_C,superfamily_Tubby_C-like	ENSG00000130338		0.667	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	35	0.00	0	C	NM_020245		158925110	158925110	+1	no_errors	ENST00000367097	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.000	A
UNC45A	55898	genome.wustl.edu	37	15	91493412	91493412	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr15:91493412C>T	ENST00000418476.2	+	16	2142	c.2102C>T	c.(2101-2103)aCg>aTg	p.T701M	AC068831.6_ENST00000553321.1_RNA|UNC45A_ENST00000394275.2_Missense_Mutation_p.T686M	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	701					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CTGGAAGGCACGGACGTGGGG	0.652																																						dbGAP											0													66.0	58.0	61.0					15																	91493412		1985	3749	5734	-	-	-	SO:0001583	missense	0				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.2102C>T	15.37:g.91493412C>T	ENSP00000407487:p.Thr701Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T701M	ENST00000418476.2	37	c.2102	CCDS10367.1	15	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375225	0.82682	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.50277	0.75;0.75	4.94	4.94	0.65067	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.72953	0.3525	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.77864	-0.2429	9	0.72032	D	0.01	-19.6571	18.048	0.89338	0.0:1.0:0.0:0.0	.	701;686	Q9H3U1;A8K6F7	UN45A_HUMAN;.	M	686;701	ENSP00000377816:T686M;ENSP00000407487:T701M	ENSP00000377816:T686M	T	+	2	0	UNC45A	89294416	0.994000	0.37717	0.918000	0.36340	0.751000	0.42716	3.196000	0.51020	2.579000	0.87056	0.558000	0.71614	ACG	UNC45A	-	superfamily_ARM-type_fold	ENSG00000140553		0.652	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45A	HGNC	protein_coding	OTTHUMT00000280406.2	61	0.00	0	C	NM_018671		91493412	91493412	+1	no_errors	ENST00000418476	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	T
UNC45B	146862	genome.wustl.edu	37	17	33486463	33486463	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr17:33486463G>T	ENST00000268876.5	+	8	975	c.878G>T	c.(877-879)gGc>gTc	p.G293V	UNC45B_ENST00000394570.2_Missense_Mutation_p.G293V|UNC45B_ENST00000591048.1_Missense_Mutation_p.G293V|UNC45B_ENST00000378449.1_Missense_Mutation_p.G293V|UNC45B_ENST00000433649.1_Missense_Mutation_p.G293V	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	293					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				AAGGTGTCTGGCCAGGGCAGG	0.507																																						dbGAP											0													162.0	157.0	158.0					17																	33486463		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.878G>T	17.37:g.33486463G>T	ENSP00000268876:p.Gly293Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495Q8|Q495Q9	Missense_Mutation	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,smart_Armadillo,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G293V	ENST00000268876.5	37	c.878	CCDS11292.1	17	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535964	0.85812	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.49720	0.77;3.64;0.77;3.23	5.87	5.87	0.94306	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69160	0.3080	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.989;0.976;0.986	T	0.68945	-0.5275	10	0.72032	D	0.01	-34.6621	19.5705	0.95413	0.0:0.0:1.0:0.0	.	293;293;293	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	V	293	ENSP00000378071:G293V;ENSP00000268876:G293V;ENSP00000412840:G293V;ENSP00000367710:G293V	ENSP00000268876:G293V	G	+	2	0	UNC45B	30510576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.583000	0.82559	2.941000	0.99782	0.655000	0.94253	GGC	UNC45B	-	pfam_UNC-45/Ring3,superfamily_ARM-type_fold	ENSG00000141161		0.507	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45B	HGNC	protein_coding	OTTHUMT00000256458.2	47	0.00	0	G	NM_173167		33486463	33486463	+1	no_errors	ENST00000268876	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	1.000	T
USP9X	8239	genome.wustl.edu	37	X	41082490	41082490	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A26J-01A-11D-A167-09	TCGA-A7-A26J-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	be2ca34f-5c15-4b38-a207-52df296a98ee	7e2e9858-0372-46bf-b46d-0f83d9ea87f6	g.chrX:41082490C>G	ENST00000324545.8	+	39	7219	c.6586C>G	c.(6586-6588)Ctt>Gtt	p.L2196V	USP9X_ENST00000378308.2_Missense_Mutation_p.L2196V	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2196					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GAAGACACAGCTTCTGAAATT	0.398																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													130.0	118.0	122.0					X																	41082490		2196	4300	6496	-	-	-	SO:0001583	missense	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.6586C>G	X.37:g.41082490C>G	ENSP00000316357:p.Leu2196Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.L2196V	ENST00000324545.8	37	c.6586	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670817	0.88348	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.29655	1.56;1.56	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64097	-0.6487	10	0.56958	D	0.05	.	18.483	0.90819	0.0:1.0:0.0:0.0	.	2196;2196	Q93008-1;Q93008	.;USP9X_HUMAN	V	2196	ENSP00000367558:L2196V;ENSP00000316357:L2196V	ENSP00000316357:L2196V	L	+	1	0	USP9X	40967434	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.629000	0.61290	2.307000	0.77673	0.594000	0.82650	CTT	USP9X	-	NULL	ENSG00000124486		0.398	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	98	0.00	0	C	NM_004652		41082490	41082490	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	missense	57	19.72	14	SNP	1.000	G
USP9X	8239	genome.wustl.edu	37	X	41082490	41082490	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A26J-01A-11D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6f2b1732-2f2d-46a9-8665-9f5373768a5e	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:41082490C>G	ENST00000324545.8	+	39	7219	c.6586C>G	c.(6586-6588)Ctt>Gtt	p.L2196V	USP9X_ENST00000378308.2_Missense_Mutation_p.L2196V	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2196					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GAAGACACAGCTTCTGAAATT	0.398																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													130.0	118.0	122.0					X																	41082490		2196	4300	6496	-	-	-	SO:0001583	missense	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.6586C>G	X.37:g.41082490C>G	ENSP00000316357:p.Leu2196Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.L2196V	ENST00000324545.8	37	c.6586	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670817	0.88348	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.29655	1.56;1.56	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64097	-0.6487	10	0.56958	D	0.05	.	18.483	0.90819	0.0:1.0:0.0:0.0	.	2196;2196	Q93008-1;Q93008	.;USP9X_HUMAN	V	2196	ENSP00000367558:L2196V;ENSP00000316357:L2196V	ENSP00000316357:L2196V	L	+	1	0	USP9X	40967434	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.629000	0.61290	2.307000	0.77673	0.594000	0.82650	CTT	USP9X	-	NULL	ENSG00000124486		0.398	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	106	0.00	0	C	NM_004652		41082490	41082490	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	missense	104	23.36	32	SNP	1.000	G
USP9X	8239	genome.wustl.edu	37	X	41082490	41082490	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chrX:41082490C>G	ENST00000324545.8	+	39	7219	c.6586C>G	c.(6586-6588)Ctt>Gtt	p.L2196V	USP9X_ENST00000378308.2_Missense_Mutation_p.L2196V	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2196					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GAAGACACAGCTTCTGAAATT	0.398																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													130.0	118.0	122.0					X																	41082490		2196	4300	6496	-	-	-	SO:0001583	missense	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.6586C>G	X.37:g.41082490C>G	ENSP00000316357:p.Leu2196Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.L2196V	ENST00000324545.8	37	c.6586	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670817	0.88348	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.29655	1.56;1.56	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64097	-0.6487	10	0.56958	D	0.05	.	18.483	0.90819	0.0:1.0:0.0:0.0	.	2196;2196	Q93008-1;Q93008	.;USP9X_HUMAN	V	2196	ENSP00000367558:L2196V;ENSP00000316357:L2196V	ENSP00000316357:L2196V	L	+	1	0	USP9X	40967434	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.629000	0.61290	2.307000	0.77673	0.594000	0.82650	CTT	USP9X	-	NULL	ENSG00000124486		0.398	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	106	0.00	0	C	NM_004652		41082490	41082490	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	missense	87	12.75	13	SNP	1.000	G
XPNPEP1	7511	genome.wustl.edu	37	10	111630594	111630594	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr10:111630594C>A	ENST00000502935.1	-	18	1710	c.1591G>T	c.(1591-1593)Gga>Tga	p.G531*	U4_ENST00000607255.1_RNA|XPNPEP1_ENST00000322238.8_Nonsense_Mutation_p.G507*|XPNPEP1_ENST00000369680.4_Nonsense_Mutation_p.G488*|XPNPEP1_ENST00000369683.1_Nonsense_Mutation_p.G417*					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		ACACCATGTCCAGTCCCGTGC	0.463																																						dbGAP											0													135.0	123.0	127.0					10																	111630594		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1591G>T	10.37:g.111630594C>A	ENSP00000421566:p.Gly531*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.G531*	ENST00000502935.1	37	c.1591	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	C	41	8.533032	0.98852	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.5006	17.9059	0.88918	0.0:1.0:0.0:0.0	.	.	.	.	X	531;417;507;488	.	ENSP00000324011:G507X	G	-	1	0	XPNPEP1	111620584	1.000000	0.71417	0.933000	0.37362	0.771000	0.43674	7.330000	0.79181	2.673000	0.90976	0.585000	0.79938	GGA	XPNPEP1	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain	ENSG00000108039		0.463	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2	49	0.00	0	C			111630594	111630594	-1	no_errors	ENST00000502935	ensembl	human	known	69_37n	nonsense	27	12.90	4	SNP	1.000	A
ZC3H7B	23264	genome.wustl.edu	37	22	41751857	41751857	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr22:41751857G>T	ENST00000352645.4	+	19	2522	c.2265G>T	c.(2263-2265)caG>caT	p.Q755H	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.Q755H	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	771					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						ACTTCCCACAGCAATACGATG	0.627																																						dbGAP											0													46.0	42.0	43.0					22																	41751857		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2265G>T	22.37:g.41751857G>T	ENSP00000345793:p.Gln755His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_TPR-1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q755H	ENST00000352645.4	37	c.2265	CCDS14013.1	22	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141130	0.56936	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.12774	2.65;2.65	5.14	3.04	0.35103	.	0.000000	0.85682	D	0.000000	T	0.22589	0.0545	L	0.48642	1.525	0.53005	D	0.999962	D	0.57571	0.98	P	0.58721	0.844	T	0.00615	-1.1643	10	0.35671	T	0.21	-13.2278	11.9909	0.53173	0.1286:0.0:0.8714:0.0	.	755	Q9UGR2-2	.	H	755	ENSP00000345793:Q755H;ENSP00000263243:Q755H	ENSP00000263243:Q755H	Q	+	3	2	ZC3H7B	40081803	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.024000	0.49674	2.406000	0.81754	0.555000	0.69702	CAG	ZC3H7B	-	NULL	ENSG00000100403		0.627	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1	51	0.00	0	G	NM_017590		41751857	41751857	+1	no_errors	ENST00000351589	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	1.000	T
ZFAND2A	90637	genome.wustl.edu	37	7	1197836	1197836	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr7:1197836C>A	ENST00000316495.3	-	2	272	c.13G>T	c.(13-15)Gat>Tat	p.D5Y	ZFAND2A_ENST00000478137.1_5'Flank|AC091729.9_ENST00000413706.1_RNA|AC091729.9_ENST00000423008.1_RNA|ZFAND2A_ENST00000401903.1_Missense_Mutation_p.D5Y|AC091729.9_ENST00000422230.1_RNA	NM_182491.2	NP_872297.2	Q8N6M9	ZFN2A_HUMAN	zinc finger, AN1-type domain 2A	5					cellular response to arsenic-containing substance (GO:0071243)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	zinc ion binding (GO:0008270)			lung(2)|ovary(1)	3		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.82e-15)		TTCCCCAAATCAGGAAACTCC	0.433																																						dbGAP											0													223.0	238.0	233.0					7																	1197836		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029558	CCDS5323.1	7p22.3	2010-04-23			ENSG00000178381	ENSG00000178381		"""Zinc fingers, AN1-type domain containing"""	28073	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein"""	610699				20185824	Standard	NM_182491		Approved	AIRAP	uc003skc.3	Q8N6M9	OTTHUMG00000119019	ENST00000316495.3:c.13G>T	7.37:g.1197836C>A	ENSP00000314619:p.Asp5Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D220	Missense_Mutation	SNP	pfam_Znf_AN1,smart_Znf_AN1	p.D5Y	ENST00000316495.3	37	c.13	CCDS5323.1	7	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459366	0.84317	.	.	ENSG00000178381	ENST00000401903;ENST00000397083;ENST00000316495	T;T;T	0.51817	0.72;0.69;0.98	5.21	5.21	0.72293	Zinc finger, AN1-type (1);	0.109437	0.64402	D	0.000006	T	0.71821	0.3385	M	0.91354	3.2	0.80722	D	1	D;D	0.58268	0.982;0.968	P;P	0.58331	0.837;0.474	T	0.79453	-0.1797	10	0.72032	D	0.01	-22.8298	16.2663	0.82581	0.0:1.0:0.0:0.0	.	5;5	A8MYA3;Q8N6M9	.;ZFN2A_HUMAN	Y	5	ENSP00000386031:D5Y;ENSP00000380273:D5Y;ENSP00000314619:D5Y	ENSP00000314619:D5Y	D	-	1	0	ZFAND2A	1164362	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.775000	0.47702	2.436000	0.82500	0.655000	0.94253	GAT	ZFAND2A	-	NULL	ENSG00000178381		0.433	ZFAND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND2A	HGNC	protein_coding	OTTHUMT00000239220.2	31	0.00	0	C	NM_182491		1197836	1197836	-1	no_errors	ENST00000316495	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	1.000	A
ZHX2	22882	genome.wustl.edu	37	8	123965170	123965170	+	Nonsense_Mutation	SNP	G	G	T	rs374724083		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr8:123965170G>T	ENST00000314393.4	+	3	2255	c.1420G>T	c.(1420-1422)Gag>Tag	p.E474*		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	474	Required for interaction with NFYA.				mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CCGGCTCATCGAGGTGACTGG	0.557																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	dbGAP											0													87.0	86.0	87.0					8																	123965170		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1420G>T	8.37:g.123965170G>T	ENSP00000314709:p.Glu474*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E474*	ENST00000314393.4	37	c.1420	CCDS6336.1	8	.	.	.	.	.	.	.	.	.	.	G	43	9.869578	0.99284	.	.	ENSG00000178764	ENST00000314393	.	.	.	5.94	5.07	0.68467	.	0.102570	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-24.8951	15.4187	0.74995	0.0667:0.0:0.9333:0.0	.	.	.	.	X	474	.	ENSP00000314709:E474X	E	+	1	0	ZHX2	124034351	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	7.641000	0.83368	1.531000	0.49152	0.561000	0.74099	GAG	ZHX2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000178764		0.557	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZHX2	HGNC	protein_coding	OTTHUMT00000381709.1	54	0.00	0	G	NM_014943		123965170	123965170	+1	no_errors	ENST00000314393	ensembl	human	known	69_37n	nonsense	27	12.90	4	SNP	1.000	T
ZNF507	22847	genome.wustl.edu	37	19	32838203	32838203	+	5'UTR	SNP	G	G	A			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:32838203G>A	ENST00000355898.5	+	0	118				ZNF507_ENST00000544431.1_5'UTR|ZNF507_ENST00000311921.4_Intron			Q8TCN5	ZN507_HUMAN	zinc finger protein 507						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					gaattgatttgaaagacactg	0.378																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000355898.5:c.-44G>A	19.37:g.32838203G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	RNA	SNP	-	NULL	ENST00000355898.5	37	NULL	CCDS32985.1	19																																																																																			ZNF507	-	-	ENSG00000168813		0.378	ZNF507-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF507	HGNC	protein_coding	OTTHUMT00000451294.1	24	0.00	0	G	NM_014910		32838203	32838203	+1	no_errors	ENST00000588686	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	1.000	A
ZNF285	26974	genome.wustl.edu	37	19	44891003	44891003	+	Silent	SNP	G	G	A	rs201302972		TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:44891003G>A	ENST00000330997.4	-	4	1468	c.1404C>T	c.(1402-1404)agC>agT	p.S468S	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Silent_p.S468S|ZNF285_ENST00000591679.1_Silent_p.S475S	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GAAGAACAGAGCTATACGCAA	0.418																																						dbGAP											0													86.0	87.0	87.0					19																	44891003		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1404C>T	19.37:g.44891003G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S468	ENST00000330997.4	37	c.1404	CCDS12638.1	19																																																																																			ZNF285	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267508		0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	83	0.00	0	G	NM_152354		44891003	44891003	-1	no_errors	ENST00000330997	ensembl	human	known	69_37n	silent	74	10.84	9	SNP	0.000	A
ZNF837	116412	genome.wustl.edu	37	19	58879909	58879909	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A26J-01B-02D-A272-09	TCGA-A7-A26J-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f204456d-40aa-4a38-81b0-1dce6409d881	14e32cc8-ff98-4842-9ab9-022358584e94	g.chr19:58879909T>G	ENST00000427624.2	-	3	1113	c.791A>C	c.(790-792)gAc>gCc	p.D264A	ZNF837_ENST00000597582.1_Missense_Mutation_p.D264A|CTD-2619J13.3_ENST00000599889.1_RNA			Q96EG3	ZN837_HUMAN	zinc finger protein 837	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						GGCCGGGGGGTCGGGGACAAT	0.697																																						dbGAP											0													9.0	12.0	11.0					19																	58879909		688	1578	2266	-	-	-	SO:0001583	missense	0			BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.791A>C	19.37:g.58879909T>G	ENSP00000405699:p.Asp264Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D264A	ENST00000427624.2	37	c.791	CCDS46216.1	19	.	.	.	.	.	.	.	.	.	.	T	0.049	-1.257720	0.01457	.	.	ENSG00000152475	ENST00000427624	T	0.06068	3.35	0.796	-0.454	0.12197	.	.	.	.	.	T	0.02571	0.0078	N	0.02830	-0.485	0.09310	N	1	B	0.15141	0.012	B	0.14578	0.011	T	0.42882	-0.9425	9	0.66056	D	0.02	.	4.5445	0.12074	0.0:0.0:0.3368:0.6632	.	264	Q96EG3	ZN837_HUMAN	A	264	ENSP00000405699:D264A	ENSP00000405699:D264A	D	-	2	0	ZNF837	63571721	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.610000	0.02064	-0.246000	0.09611	-0.460000	0.05396	GAC	ZNF837	-	NULL	ENSG00000152475		0.697	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF837	HGNC	protein_coding	OTTHUMT00000466962.1	26	0.00	0	T	NM_138466		58879909	58879909	-1	no_errors	ENST00000427624	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.002	G
