#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA2	20	genome.wustl.edu	37	9	139912699	139912699	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr9:139912699C>T	ENST00000371605.3	-	13	2068	c.1921G>A	c.(1921-1923)Gcc>Acc	p.A641T	ABCA2_ENST00000492260.1_5'UTR|ABCA2_ENST00000341511.6_Missense_Mutation_p.A642T|ABCA2_ENST00000265662.5_Missense_Mutation_p.A642T			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	641					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGCCAGTAGGCGCGGCGGATC	0.637																																						dbGAP											0													57.0	64.0	62.0					9																	139912699		1937	4128	6065	-	-	-	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.1921G>A	9.37:g.139912699C>T	ENSP00000360666:p.Ala641Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A642T	ENST00000371605.3	37	c.1924		9	.	.	.	.	.	.	.	.	.	.	c	17.53	3.411534	0.62399	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.94232	-3.38;-3.38;-3.38	3.93	3.93	0.45458	.	0.077621	0.52532	U	0.000074	D	0.92153	0.7512	L	0.34521	1.04	0.58432	D	0.999999	D;P	0.69078	0.997;0.728	P;B	0.54026	0.74;0.169	D	0.90969	0.4818	10	0.29301	T	0.29	.	15.9559	0.79886	0.0:1.0:0.0:0.0	.	641;672	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	T	642;641;672;642	ENSP00000265662:A642T;ENSP00000360666:A641T;ENSP00000344155:A642T	ENSP00000265662:A642T	A	-	1	0	ABCA2	139032520	1.000000	0.71417	0.997000	0.53966	0.580000	0.36256	5.718000	0.68455	1.746000	0.51805	0.306000	0.20318	GCC	ABCA2	-	NULL	ENSG00000107331		0.637	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		56	0.00	0	C	NM_001606		139912699	139912699	-1	no_errors	ENST00000265662	ensembl	human	known	69_37n	missense	144	17.24	30	SNP	1.000	T
ALS2	57679	genome.wustl.edu	37	2	202645634	202645634	+	5'UTR	SNP	C	C	G	rs77327610	byFrequency	TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr2:202645634C>G	ENST00000264276.6	-	0	278				ALS2_ENST00000496244.1_5'UTR|ALS2_ENST00000467448.1_5'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)						behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						GCTCCGCATCCGGCGCGAGCT	0.667													C|||	175	0.0349441	0.1225	0.013	5008	,	,		12551	0.0		0.003	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.-95G>C	2.37:g.202645634C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	RNA	SNP	-	NULL	ENST00000264276.6	37	NULL	CCDS42800.1	2																																																																																			ALS2	-	-	ENSG00000003393		0.667	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3	8	0.00	0	C	NM_020919		202645634	202645634	-1	no_errors	ENST00000462747	ensembl	human	known	69_37n	rna	12	61.29	19	SNP	0.322	G
ANKRD20A4	728747	genome.wustl.edu	37	9	69390020	69390020	+	Missense_Mutation	SNP	T	T	A	rs200769647		TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr9:69390020T>A	ENST00000357336.3	+	4	855	c.574T>A	c.(574-576)Tca>Aca	p.S192T	RNU6-1193P_ENST00000459461.1_RNA	NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	192										breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						GAAAGCAAGTTCACATGCCGT	0.313																																						dbGAP											0													3.0	3.0	3.0					9																	69390020		1031	2307	3338	-	-	-	SO:0001583	missense	0				CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.574T>A	9.37:g.69390020T>A	ENSP00000349891:p.Ser192Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S192T	ENST00000357336.3	37	c.574	CCDS43828.1	9	.	.	.	.	.	.	.	.	.	.	T	1.745	-0.490649	0.04322	.	.	ENSG00000172014	ENST00000357336	T	0.52057	0.68	2.26	-0.246	0.13022	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.19805	0.0476	N	0.03268	-0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14117	-1.0484	9	0.46703	T	0.11	.	2.3964	0.04391	0.4743:0.0:0.3053:0.2205	.	192	Q4UJ75	A20A4_HUMAN	T	192	ENSP00000349891:S192T	ENSP00000349891:S192T	S	+	1	0	ANKRD20A4	68679840	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.285000	0.08410	-0.423000	0.07394	-3.249000	0.00050	TCA	ANKRD20A4	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000172014		0.313	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	HGNC	protein_coding	OTTHUMT00000143287.3	11	0.00	0	T	NM_001098805		69390020	69390020	+1	no_errors	ENST00000357336	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	0.002	A
ARHGAP29	9411	genome.wustl.edu	37	1	94668512	94668512	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr1:94668512C>A	ENST00000260526.6	-	10	1098	c.916G>T	c.(916-918)Gaa>Taa	p.E306*	ARHGAP29_ENST00000370217.3_Nonsense_Mutation_p.E306*	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	306					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)	p.E306K(1)		NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTTATTTCTTTCCTTTGT	0.299																																						dbGAP											1	Substitution - Missense(1)	lung(1)											105.0	117.0	113.0					1																	94668512		2202	4298	6500	-	-	-	SO:0001587	stop_gained	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.916G>T	1.37:g.94668512C>A	ENSP00000260526:p.Glu306*	Somatic		WXS	Illumina GAIIx	Phase_IV	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.E306*	ENST00000260526.6	37	c.916	CCDS748.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.891097	0.97074	.	.	ENSG00000137962	ENST00000260526;ENST00000370217	.	.	.	6.1	5.19	0.71726	.	0.186351	0.26334	N	0.024973	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.9981	15.3181	0.74099	0.0:0.9332:0.0:0.0668	.	.	.	.	X	306	.	ENSP00000260526:E306X	E	-	1	0	ARHGAP29	94441100	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.189000	0.65098	1.582000	0.49881	0.650000	0.86243	GAA	ARHGAP29	-	NULL	ENSG00000137962		0.299	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	52	0.00	0	C	NM_004815		94668512	94668512	-1	no_errors	ENST00000260526	ensembl	human	known	69_37n	nonsense	57	25.97	20	SNP	1.000	A
BTAF1	9044	genome.wustl.edu	37	10	93768598	93768598	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr10:93768598T>G	ENST00000265990.6	+	27	4134	c.3826T>G	c.(3826-3828)Tgg>Ggg	p.W1276G	BTAF1_ENST00000544642.1_Missense_Mutation_p.W104G	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1276					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TGGTGTGAACTGGTTAGCATT	0.303																																						dbGAP											0													81.0	82.0	82.0					10																	93768598		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.3826T>G	10.37:g.93768598T>G	ENSP00000265990:p.Trp1276Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0W6|O43578	Missense_Mutation	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.W1276G	ENST00000265990.6	37	c.3826	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	T	19.83	3.901044	0.72754	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	D;D	0.95554	-3.74;-3.74	5.43	5.43	0.79202	DEAD-like helicase (1);Armadillo-like helical (1);SNF2-related (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.98883	0.9622	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99026	1.0819	10	0.87932	D	0	-6.2337	14.3572	0.66745	0.0:0.0:0.0:1.0	.	1276	O14981	BTAF1_HUMAN	G	1276;104;126	ENSP00000265990:W1276G;ENSP00000439924:W104G	ENSP00000265990:W1276G	W	+	1	0	BTAF1	93758578	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.180000	0.69256	0.528000	0.53228	TGG	BTAF1	-	pfam_SNF2_N,superfamily_ARM-type_fold,smart_Helicase_ATP-bd	ENSG00000095564		0.303	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	39	0.00	0	T	NM_003972		93768598	93768598	+1	no_errors	ENST00000265990	ensembl	human	known	69_37n	missense	33	42.11	24	SNP	1.000	G
COL4A2	1284	genome.wustl.edu	37	13	111077189	111077189	+	Missense_Mutation	SNP	G	G	A	rs531542947		TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr13:111077189G>A	ENST00000360467.5	+	5	595	c.289G>A	c.(289-291)Gga>Aga	p.G97R		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	97					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGGAGCCCCCGGAGTAACGGG	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15771	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													92.0	101.0	98.0					13																	111077189		1949	4143	6092	-	-	-	SO:0001583	missense	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.289G>A	13.37:g.111077189G>A	ENSP00000353654:p.Gly97Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G97R	ENST00000360467.5	37	c.289	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769815	0.49680	.	.	ENSG00000134871	ENST00000400163;ENST00000360467;ENST00000257309	D;D	0.99637	-6.29;-6.29	5.08	5.08	0.68730	.	0.000000	0.49916	D	0.000121	D	0.99837	0.9926	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96464	0.9343	10	0.87932	D	0	.	18.5643	0.91112	0.0:0.0:1.0:0.0	.	97	P08572	CO4A2_HUMAN	R	97	ENSP00000383027:G97R;ENSP00000353654:G97R	ENSP00000257309:G97R	G	+	1	0	COL4A2	109875190	1.000000	0.71417	0.174000	0.22961	0.036000	0.12997	8.259000	0.89855	2.395000	0.81488	0.650000	0.86243	GGA	COL4A2	-	pfam_Collagen	ENSG00000134871		0.607	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2	31	0.00	0	G	NM_001846		111077189	111077189	+1	no_errors	ENST00000360467	ensembl	human	known	69_37n	missense	61	18.67	14	SNP	1.000	A
CRELD2	79174	genome.wustl.edu	37	22	50315537	50315537	+	Intron	SNP	A	A	G	rs12170220	byFrequency	TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr22:50315537A>G	ENST00000328268.4	+	5	666				CRELD2_ENST00000407217.3_Intron|CRELD2_ENST00000403427.3_Intron|CRELD2_ENST00000444954.1_Intron|CRELD2_ENST00000404488.3_Intron	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2							endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		GGAAGCTTCGAGGGCCCAGAA	0.557													G|||	402	0.0802716	0.2579	0.0245	5008	,	,		18611	0.0367		0.001	False		,,,				2504	0.0061					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.592+128A>G	22.37:g.50315537A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	RNA	SNP	-	NULL	ENST00000328268.4	37	NULL	CCDS14082.1	22																																																																																			CRELD2	-	-	ENSG00000184164		0.557	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CRELD2	HGNC	protein_coding	OTTHUMT00000317409.1	10	0.00	0	A	NM_024324		50315537	50315537	+1	no_errors	ENST00000498354	ensembl	human	known	69_37n	rna	1	92.31	12	SNP	0.002	G
CIITA	4261	genome.wustl.edu	37	16	11023406	11023406	+	3'UTR	SNP	G	G	T	rs60453756	byFrequency	TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr16:11023406G>T	ENST00000324288.8	+	0	9220				DEXI_ENST00000469379.1_5'UTR|DEXI_ENST00000331808.4_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator						aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						AAGCTTTTGAGGGGAGCAGGT	0.572			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """								G|||	52	0.0103834	0.034	0.0058	5008	,	,		17966	0.0		0.003	False		,,,				2504	0.0					dbGAP		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.*5694G>T	16.37:g.11023406G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	RNA	SNP	-	NULL	ENST00000324288.8	37	NULL	CCDS10544.1	16																																																																																			DEXI	-	-	ENSG00000182108		0.572	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEXI	HGNC	protein_coding	OTTHUMT00000251966.2	8	0.00	0	G	NM_000246		11023406	11023406	-1	no_errors	ENST00000469379	ensembl	human	known	69_37n	rna	1	80.00	4	SNP	0.114	T
DGCR5	26220	genome.wustl.edu	37	22	18978260	18978260	+	RNA	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr22:18978260G>A	ENST00000421572.1	+	0	432				DGCR5_ENST00000440005.2_RNA|DGCR5_ENST00000438934.1_RNA|DGCR5_ENST00000537283.1_RNA					DiGeorge syndrome critical region gene 5 (non-protein coding)																		CCAGCCAGCCGGAGGACCACC	0.657																																						dbGAP											0																																										-	-	-			0			X91348		22q11	2012-10-16	2008-08-13		ENSG00000237517	ENSG00000237517		"""Long non-coding RNAs"""	16757	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 37"", ""long intergenic non-protein coding RNA 37"""					8659529	Standard	NR_002733		Approved	NCRNA00037, LINC00037	uc021wku.1		OTTHUMG00000149977		22.37:g.18978260G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000421572.1	37	NULL		22																																																																																			DGCR5	-	-	ENSG00000237517		0.657	DGCR5-004	KNOWN	basic|exp_conf	antisense	DGCR5	HGNC	antisense	OTTHUMT00000316630.1	56	0.00	0	G	NR_002733		18978260	18978260	+1	no_errors	ENST00000438934	ensembl	human	known	69_37n	rna	124	14.48	21	SNP	0.350	A
DNAH2	146754	genome.wustl.edu	37	17	7646583	7646583	+	Intron	SNP	T	T	C	rs73248544	byFrequency	TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr17:7646583T>C	ENST00000572933.1	+	12	3364				DNAH2_ENST00000570791.1_Missense_Mutation_p.L758P|DNAH2_ENST00000082259.3_Missense_Mutation_p.L758P|DNAH2_ENST00000389173.2_Intron			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ATATGTTTGCTATCGTCATTT	0.353													T|||	84	0.0167732	0.062	0.0029	5008	,	,		19076	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1904+123T>C	17.37:g.7646583T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-1	p.L758P	ENST00000572933.1	37	c.2273	CCDS32551.1	17	31	0.014194139194139194	30	0.06097560975609756	1	0.0027624309392265192	0	0.0	0	0.0	T	11.94	1.789401	0.31685	.	.	ENSG00000183914	ENST00000082259	T	0.22945	1.93	3.67	-3.5	0.04710	.	.	.	.	.	T	0.01061	0.0035	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.30736	-0.9968	7	.	.	.	.	3.627	0.08117	0.3198:0.3794:0.0:0.3007	.	758	Q9P225-3	.	P	758	ENSP00000082259:L758P	.	L	+	2	0	DNAH2	7587308	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.018000	0.13422	-0.767000	0.04633	-0.367000	0.07326	CTA	DNAH2	-	NULL	ENSG00000183914		0.353	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	49	0.00	0	T	NM_020877		7646583	7646583	+1	no_errors	ENST00000082259	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.000	C
DPY19L3	147991	genome.wustl.edu	37	19	32959574	32959574	+	Intron	SNP	T	T	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr19:32959574T>A	ENST00000342179.5	+	16	1829				DPY19L3_ENST00000586987.1_Intron|DPY19L3_ENST00000392250.2_Intron|DPY19L3_ENST00000590651.1_Intron	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					TCATTTAATCTTAGTGATAGT	0.348																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1615-63T>A	19.37:g.32959574T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DC7|Q6ZTB7|Q6ZTS2	RNA	SNP	-	NULL	ENST00000342179.5	37	NULL	CCDS12422.1	19																																																																																			DPY19L3	-	-	ENSG00000178904		0.348	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	25	0.00	0	T	NM_207325		32959574	32959574	+1	no_errors	ENST00000592178	ensembl	human	known	69_37n	rna	16	36.00	9	SNP	0.060	A
ERCC6	2074	genome.wustl.edu	37	10	50732557	50732557	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr10:50732557G>C	ENST00000355832.5	-	5	997	c.919C>G	c.(919-921)Cca>Gca	p.P307A	PGBD3_ENST00000374127.3_5'Flank|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.P307A|PGBD3_ENST00000603152.1_Missense_Mutation_p.P307A|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.P307A	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	307					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTTTGCACTGGGGCTGGAGGC	0.428								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													194.0	190.0	191.0					10																	50732557		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.919C>G	10.37:g.50732557G>C	ENSP00000348089:p.Pro307Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P307A	ENST00000355832.5	37	c.919	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	G	9.849	1.193069	0.21954	.	.	ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000515869;ENST00000447839	D;T;T	0.81908	-1.55;3.41;3.41	6.03	-5.43	0.02632	.	.	.	.	.	T	0.55081	0.1898	N	0.08118	0	0.09310	N	0.999999	B;B	0.22683	0.073;0.0	B;B	0.17433	0.018;0.001	T	0.50988	-0.8762	9	0.08837	T	0.75	0.65	3.0593	0.06195	0.5358:0.2265:0.1245:0.1131	.	307;307	E7EV46;Q03468	.;ERCC6_HUMAN	A	307	ENSP00000348089:P307A;ENSP00000423550:P307A;ENSP00000387966:P307A	ENSP00000348089:P307A	P	-	1	0	ERCC6;RP11-123B3.6	50402563	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.309000	0.08145	-0.839000	0.04212	0.655000	0.94253	CCA	ERCC6	-	NULL	ENSG00000225830		0.428	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	58	0.00	0	G	NM_000124		50732557	50732557	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	missense	68	43.33	52	SNP	0.000	C
ERCC6	2074	genome.wustl.edu	37	10	50732756	50732756	+	Silent	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr10:50732756G>A	ENST00000355832.5	-	5	798	c.720C>T	c.(718-720)atC>atT	p.I240I	PGBD3_ENST00000374127.3_5'Flank|ERCC6-PGBD3_ENST00000515869.1_Silent_p.I240I|PGBD3_ENST00000603152.1_Silent_p.I240I|ERCC6-PGBD3_ENST00000447839.2_Silent_p.I240I	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	240					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GGCCAGTGCGGATGAGCTCTT	0.507								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													70.0	72.0	71.0					10																	50732756		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.720C>T	10.37:g.50732756G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I240	ENST00000355832.5	37	c.720	CCDS7229.1	10																																																																																			ERCC6	-	NULL	ENSG00000225830		0.507	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	45	0.00	0	G	NM_000124		50732756	50732756	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	silent	93	41.14	65	SNP	0.915	A
AMER3	205147	genome.wustl.edu	37	2	131519756	131519756	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr2:131519756G>T	ENST00000423981.1	+	2	221	c.111G>T	c.(109-111)tgG>tgT	p.W37C	AMER3_ENST00000321420.4_Missense_Mutation_p.W37C	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	37					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										CAGGCCCCTGGTCAGTCCTTC	0.632																																						dbGAP											0													19.0	27.0	24.0					2																	131519756		2200	4294	6494	-	-	-	SO:0001583	missense	0			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.111G>T	2.37:g.131519756G>T	ENSP00000392700:p.Trp37Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLH6	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.W37C	ENST00000423981.1	37	c.111	CCDS2164.1	2	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517021	0.44763	.	.	ENSG00000178171	ENST00000321420;ENST00000431758;ENST00000458606;ENST00000423981	T;T	0.47528	0.84;0.84	4.68	2.8	0.32819	.	1.186230	0.06157	N	0.675257	T	0.35128	0.0921	L	0.27053	0.805	0.19575	N	0.999969	B	0.15141	0.012	B	0.14023	0.01	T	0.26189	-1.0110	10	0.38643	T	0.18	.	6.2087	0.20617	0.104:0.1904:0.7056:0.0	.	37	Q8N944	F123C_HUMAN	C	37	ENSP00000314914:W37C;ENSP00000392700:W37C	ENSP00000314914:W37C	W	+	3	0	FAM123C	131236226	0.220000	0.23631	0.003000	0.11579	0.656000	0.38851	1.037000	0.30241	0.489000	0.27749	0.491000	0.48974	TGG	FAM123C	-	NULL	ENSG00000178171		0.632	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123C	HGNC	protein_coding	OTTHUMT00000254531.3	34	0.00	0	G	NM_152698		131519756	131519756	+1	no_errors	ENST00000321420	ensembl	human	known	69_37n	missense	45	23.73	14	SNP	0.010	T
FRMPD4	9758	genome.wustl.edu	37	X	12722603	12722603	+	Splice_Site	SNP	A	A	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chrX:12722603A>T	ENST00000380682.1	+	11	1702	c.1196A>T	c.(1195-1197)aAg>aTg	p.K399M		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	399	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CCGGGTAAAAAGGTATCACAT	0.338																																						dbGAP											0													75.0	73.0	74.0					X																	12722603		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.1197+1A>T	X.37:g.12722603A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X9|O15032	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.K399M	ENST00000380682.1	37	c.1196	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	A	22.5	4.299081	0.81025	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.08370	3.1	5.41	5.41	0.78517	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.054605	0.64402	D	0.000001	T	0.23133	0.0559	L	0.47016	1.485	0.80722	D	1	D;P	0.89917	1.0;0.858	D;P	0.97110	1.0;0.795	T	0.00496	-1.1705	10	0.87932	D	0	-11.44	14.5594	0.68126	1.0:0.0:0.0:0.0	.	391;399	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	M	399;390;388	ENSP00000370057:K399M	ENSP00000304583:K388M	K	+	2	0	FRMPD4	12632524	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.742000	0.91588	1.819000	0.53055	0.486000	0.48141	AAG	FRMPD4	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000169933		0.338	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	39	0.00	0	A	XM_045712	Missense_Mutation	12722603	12722603	+1	no_errors	ENST00000380682	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	1.000	T
GAS2	2620	genome.wustl.edu	37	11	22777476	22777476	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr11:22777476G>A	ENST00000454584.2	+	7	1005	c.700G>A	c.(700-702)Gga>Aga	p.G234R	GAS2_ENST00000278187.3_Missense_Mutation_p.G234R|GAS2_ENST00000433790.1_Missense_Mutation_p.G234R	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	234	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						ATACCGAGTGGGAGAAAAGAT	0.398																																						dbGAP											0													74.0	78.0	77.0					11																	22777476		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.700G>A	11.37:g.22777476G>A	ENSP00000401145:p.Gly234Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.G234R	ENST00000454584.2	37	c.700	CCDS7858.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.145564	0.94603	.	.	ENSG00000148935	ENST00000454584;ENST00000278187;ENST00000433790	T;T;T	0.57752	0.38;0.38;0.38	5.61	5.61	0.85477	Growth-arrest-specific protein 2 domain (5);	0.000000	0.85682	D	0.000000	T	0.78717	0.4327	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82345	-0.0503	10	0.87932	D	0	-14.0645	19.6299	0.95698	0.0:0.0:1.0:0.0	.	234	O43903	GAS2_HUMAN	R	234	ENSP00000401145:G234R;ENSP00000278187:G234R;ENSP00000396708:G234R	ENSP00000278187:G234R	G	+	1	0	GAS2	22734052	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.415000	0.97375	2.639000	0.89480	0.655000	0.94253	GGA	GAS2	-	pfam_GAS2_dom,superfamily_GAS2_dom,smart_GAS2_dom	ENSG00000148935		0.398	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2	HGNC	protein_coding	OTTHUMT00000387717.1	41	0.00	0	G	NM_177553		22777476	22777476	+1	no_errors	ENST00000278187	ensembl	human	known	69_37n	missense	83	25.00	28	SNP	1.000	A
HAS1	3036	genome.wustl.edu	37	19	52217306	52217306	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr19:52217306G>A	ENST00000222115.1	-	5	1145	c.1111C>T	c.(1111-1113)Cgg>Tgg	p.R371W	HAS1_ENST00000594621.1_Missense_Mutation_p.A200V|HAS1_ENST00000540069.2_Missense_Mutation_p.R370W|HAS1_ENST00000601714.1_Missense_Mutation_p.R378W	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	371					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CTCAGCCACCGCAGGAAGGAC	0.647																																					NSCLC(132;636 2450 45807 47979)	dbGAP											0													39.0	27.0	31.0					19																	52217306		2201	4300	6501	-	-	-	SO:0001583	missense	0			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1111C>T	19.37:g.52217306G>A	ENSP00000222115:p.Arg371Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14470|Q9NS49	Missense_Mutation	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.R371W	ENST00000222115.1	37	c.1111	CCDS12838.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.55|15.55	2.866389|2.866389	0.51588|0.51588	.|.	.|.	ENSG00000105509|ENSG00000105509	ENST00000376738|ENST00000540069;ENST00000222115	.|T;T	.|0.44881	.|0.91;0.91	2.98|2.98	2.98|2.98	0.34508|0.34508	.|.	.|0.085419	.|0.49916	.|U	.|0.000123	T|T	0.67767|0.67767	0.2928|0.2928	M|M	0.90369|0.90369	3.11|3.11	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.999	T|T	0.75291|0.75291	-0.3369|-0.3369	6|10	0.15499|0.87932	T|D	0.54|0	-33.7499|-33.7499	11.758|11.758	0.51886|0.51886	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|370;371;370	.|G3V1S7;Q92839;Q8IYH3	.|.;HAS1_HUMAN;.	V|W	200|370;371	.|ENSP00000445021:R370W;ENSP00000222115:R371W	ENSP00000365928:A200V|ENSP00000222115:R371W	A|R	-|-	2|1	0|2	HAS1|HAS1	56909118|56909118	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.046000|0.046000	0.14306|0.14306	5.469000|5.469000	0.66749|0.66749	1.693000|1.693000	0.51124|0.51124	0.174000|0.174000	0.16983|0.16983	GCG|CGG	HAS1	-	pfam_Chitin_synth_fng	ENSG00000105509		0.647	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HAS1	HGNC	protein_coding	OTTHUMT00000466953.1	37	0.00	0	G	NM_001523		52217306	52217306	-1	no_errors	ENST00000222115	ensembl	human	known	69_37n	missense	53	27.40	20	SNP	1.000	A
HECW1	23072	genome.wustl.edu	37	7	43482155	43482155	+	Silent	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr7:43482155C>T	ENST00000395891.2	+	10	1577	c.972C>T	c.(970-972)ggC>ggT	p.G324G	HECW1_ENST00000453890.1_Silent_p.G324G	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	324					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ACACACTTGGCCGCAGGCTTC	0.468																																						dbGAP											0													134.0	135.0	135.0					7																	43482155		2042	4191	6233	-	-	-	SO:0001819	synonymous_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.972C>T	7.37:g.43482155C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.G324	ENST00000395891.2	37	c.972	CCDS5469.2	7																																																																																			HECW1	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000002746		0.468	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	33	0.00	0	C	NM_015052		43482155	43482155	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	silent	83	19.42	20	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186057750	186057750	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr1:186057750C>T	ENST00000271588.4	+	63	9819	c.9590C>T	c.(9589-9591)tCa>tTa	p.S3197L	HMCN1_ENST00000367492.2_Missense_Mutation_p.S3197L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3197	Ig-like C2-type 30.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AATTCTGACTCACTGGAAGTT	0.338																																						dbGAP											0													41.0	45.0	43.0					1																	186057750		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9590C>T	1.37:g.186057750C>T	ENSP00000271588:p.Ser3197Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.S3197L	ENST00000271588.4	37	c.9590	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.371684	0.95923	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68025	-0.3;-0.3	5.51	5.51	0.81932	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.056826	0.64402	D	0.000001	T	0.67183	0.2866	M	0.66939	2.045	0.80722	D	1	P	0.37781	0.608	B	0.37198	0.243	T	0.65742	-0.6094	10	0.27785	T	0.31	.	19.4309	0.94765	0.0:1.0:0.0:0.0	.	3197	Q96RW7	HMCN1_HUMAN	L	3197	ENSP00000271588:S3197L;ENSP00000356462:S3197L	ENSP00000271588:S3197L	S	+	2	0	HMCN1	184324373	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.663000	0.61532	2.592000	0.87571	0.650000	0.86243	TCA	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.338	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	26	0.00	0	C	NM_031935		186057750	186057750	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	58	24.68	19	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186092173	186092173	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr1:186092173C>T	ENST00000271588.4	+	81	12549	c.12320C>T	c.(12319-12321)cCg>cTg	p.P4107L	HMCN1_ENST00000367492.2_Missense_Mutation_p.P4107L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4107	Ig-like C2-type 40.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGCCTCCCTCCGCCTGACATT	0.483																																						dbGAP											0													111.0	89.0	97.0					1																	186092173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12320C>T	1.37:g.186092173C>T	ENSP00000271588:p.Pro4107Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.P4107L	ENST00000271588.4	37	c.12320	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	8.177	0.792891	0.16327	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67171	-0.25;-0.25	5.85	2.89	0.33648	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.648886	0.16551	N	0.209493	T	0.43875	0.1267	N	0.16066	0.365	0.09310	N	1	P	0.42757	0.789	B	0.40864	0.342	T	0.20107	-1.0285	10	0.26408	T	0.33	.	4.1527	0.10245	0.1165:0.5006:0.2493:0.1337	.	4107	Q96RW7	HMCN1_HUMAN	L	4107	ENSP00000271588:P4107L;ENSP00000356462:P4107L	ENSP00000271588:P4107L	P	+	2	0	HMCN1	184358796	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	1.433000	0.34947	0.347000	0.23924	-0.126000	0.14955	CCG	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.483	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	39	0.00	0	C	NM_031935		186092173	186092173	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	73	27.00	27	SNP	0.001	T
HSD17B11	51170	genome.wustl.edu	37	4	88258484	88258484	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr4:88258484G>A	ENST00000358290.4	-	7	1162	c.847C>T	c.(847-849)Caa>Taa	p.Q283*	HSD17B11_ENST00000507518.1_5'UTR|RP11-529H2.2_ENST00000508163.1_RNA|HSD17B11_ENST00000507286.1_Nonsense_Mutation_p.Q239*	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	283				Q -> R (in Ref. 1; AAF06939, 2; AAM44459, 3; AAQ88917, 4; BAC11560 and 6; AAH08650/ AAH14327/AAH16367/AAH21673/AAH36001). {ECO:0000305}.	androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		CTGATTTTTTGTTTTAAAACT	0.313																																						dbGAP											0													103.0	103.0	103.0					4																	88258484		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.847C>T	4.37:g.88258484G>A	ENSP00000351035:p.Gln283*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96HF6|Q9UKU4	Nonsense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.Q283*	ENST00000358290.4	37	c.847	CCDS3619.1	4	.	.	.	.	.	.	.	.	.	.	G	6.268	0.417505	0.11870	.	.	ENSG00000198189	ENST00000358290;ENST00000507286	.	.	.	5.49	0.281	0.15687	.	0.933214	0.08812	N	0.890113	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	9.5207	0.39133	0.0712:0.0:0.3961:0.5327	.	.	.	.	X	283;239	.	ENSP00000351035:Q283X	Q	-	1	0	HSD17B11	88477508	0.008000	0.16893	0.002000	0.10522	0.023000	0.10783	0.277000	0.18734	-0.214000	0.10078	-1.357000	0.01221	CAA	HSD17B11	-	NULL	ENSG00000198189		0.313	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B11	HGNC	protein_coding	OTTHUMT00000253041.1	44	0.00	0	G	NM_016245		88258484	88258484	-1	no_errors	ENST00000358290	ensembl	human	known	69_37n	nonsense	66	10.81	8	SNP	0.000	A
KIAA0100	9703	genome.wustl.edu	37	17	26965606	26965606	+	Silent	SNP	G	G	C			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr17:26965606G>C	ENST00000528896.2	-	12	1358	c.1284C>G	c.(1282-1284)gtC>gtG	p.V428V	KIAA0100_ENST00000389003.3_Silent_p.V285V|KIAA0100_ENST00000544884.1_Silent_p.V285V|RP11-192H23.7_ENST00000577814.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	428						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TGGAAATGTTGACATTGGAGA	0.433																																						dbGAP											0													163.0	155.0	158.0					17																	26965606		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1284C>G	17.37:g.26965606G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.V428	ENST00000528896.2	37	c.1284	CCDS32595.1	17																																																																																			KIAA0100	-	pfam_FMP27_N	ENSG00000007202		0.433	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	36	0.00	0	G	NM_014680		26965606	26965606	-1	no_errors	ENST00000005905	ensembl	human	known	69_37n	silent	71	19.32	17	SNP	1.000	C
LBR	3930	genome.wustl.edu	37	1	225599097	225599097	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr1:225599097C>T	ENST00000338179.2	-	9	1255	c.1130G>A	c.(1129-1131)cGa>cAa	p.R377Q	LBR_ENST00000272163.4_Missense_Mutation_p.R377Q|AC092811.1_ENST00000366845.2_5'Flank	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	377					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AGTACCAATTCGAGGGTTTAA	0.388																																						dbGAP											0													114.0	121.0	119.0					1																	225599097		2203	4300	6503	-	-	-	SO:0001583	missense	0			L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1130G>A	1.37:g.225599097C>T	ENSP00000339883:p.Arg377Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	pfam_Ergosterol_biosynth_ERG4_ERG24,pfam_Lamin-B_rcpt_of_tudor,pfam_DUF1295,smart_Tudor	p.R377Q	ENST00000338179.2	37	c.1130	CCDS1545.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.082017	0.97267	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000424022	D;D;D	0.99226	-5.59;-5.59;-5.59	6.16	6.16	0.99307	Sterol reductase, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99566	0.9844	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98619	1.0666	10	0.87932	D	0	-18.7579	20.8598	0.99761	0.0:1.0:0.0:0.0	.	377	Q14739	LBR_HUMAN	Q	377;377;8	ENSP00000272163:R377Q;ENSP00000339883:R377Q;ENSP00000397817:R8Q	ENSP00000272163:R377Q	R	-	2	0	LBR	223665720	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.746000	0.85057	2.937000	0.99478	0.650000	0.86243	CGA	LBR	-	pfam_Ergosterol_biosynth_ERG4_ERG24	ENSG00000143815		0.388	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LBR	HGNC	protein_coding	OTTHUMT00000091398.1	22	0.00	0	C	NM_002296		225599097	225599097	-1	no_errors	ENST00000272163	ensembl	human	known	69_37n	missense	53	27.40	20	SNP	1.000	T
LINC00523	283601	genome.wustl.edu	37	14	101138230	101138230	+	lincRNA	SNP	A	A	C	rs8011237	byFrequency	TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr14:101138230A>C	ENST00000556697.1	+	0	1189							Q86TU6	CN070_HUMAN	long intergenic non-protein coding RNA 523																		ctctcctagaactttctgtcg	0.473													C|||	3827	0.764177	0.7534	0.6844	5008	,	,		22019	0.4812		0.9602	False		,,,				2504	0.9254					dbGAP											0																																										-	-	-			0					14q32.2	2012-10-12	2011-11-30	2011-11-30	ENSG00000196273	ENSG00000196273		"""Long non-coding RNAs"""	20117	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 70"""	C14orf70			Standard	NR_024096		Approved		uc001yhr.1	Q86TU6	OTTHUMG00000171592		14.37:g.101138230A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUP4	RNA	SNP	-	NULL	ENST00000556697.1	37	NULL		14																																																																																			LINC00523	-	-	ENSG00000196273		0.473	LINC00523-001	KNOWN	basic	lincRNA	LINC00523	HGNC	lincRNA	OTTHUMT00000414340.1	25	0.00	0	A	NR_024096		101138230	101138230	+1	no_errors	ENST00000360899	ensembl	human	known	69_37n	rna	43	10.42	5	SNP	0.000	C
LUZP1	7798	genome.wustl.edu	37	1	23418607	23418607	+	Silent	SNP	T	T	C			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr1:23418607T>C	ENST00000302291.4	-	4	2949	c.2148A>G	c.(2146-2148)gaA>gaG	p.E716E	LUZP1_ENST00000374623.3_Silent_p.E716E|LUZP1_ENST00000314174.5_Silent_p.E716E|LUZP1_ENST00000418342.1_Silent_p.E716E			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	716					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		ATTTCACAGATTCATTCTCCA	0.493																																						dbGAP											0													228.0	244.0	239.0					1																	23418607		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2148A>G	1.37:g.23418607T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TH93|Q8N4X3|Q8TEH1	Silent	SNP	NULL	p.E716	ENST00000302291.4	37	c.2148	CCDS30628.1	1																																																																																			LUZP1	-	NULL	ENSG00000169641		0.493	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP1	HGNC	protein_coding	OTTHUMT00000008900.3	47	0.00	0	T	NM_033631		23418607	23418607	-1	no_errors	ENST00000302291	ensembl	human	known	69_37n	silent	55	24.66	18	SNP	0.050	C
MRPL45	84311	genome.wustl.edu	37	17	36478436	36478436	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr17:36478436T>A	ENST00000312513.5	+	8	1040	c.879T>A	c.(877-879)taT>taA	p.Y293*	GPR179_ENST00000584976.1_5'Flank	NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	293						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				AAGAAGAATATGAAGAGGCAC	0.537											OREG0024353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													71.0	71.0	71.0					17																	36478436		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.879T>A	17.37:g.36478436T>A	ENSP00000308901:p.Tyr293*	Somatic	863	WXS	Illumina GAIIx	Phase_IV	A1L436|Q6ZMJ5	Nonsense_Mutation	SNP	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45	p.Y293*	ENST00000312513.5	37	c.879	CCDS11326.1	17	.	.	.	.	.	.	.	.	.	.	T	13.16	2.154971	0.38021	.	.	ENSG00000174100	ENST00000312513	.	.	.	5.23	4.15	0.48705	.	0.684704	0.14774	N	0.299194	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0346	8.1398	0.31076	0.0:0.0936:0.0:0.9064	.	.	.	.	X	293	.	ENSP00000308901:Y293X	Y	+	3	2	MRPL45	33731963	0.165000	0.22948	0.890000	0.34922	0.051000	0.14879	0.456000	0.21859	1.043000	0.40175	0.514000	0.50259	TAT	MRPL45	-	NULL	ENSG00000174100		0.537	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	MRPL45	HGNC	protein_coding	OTTHUMT00000256792.3	25	0.00	0	T	NM_032351		36478436	36478436	+1	no_errors	ENST00000312513	ensembl	human	known	69_37n	nonsense	570	19.35	137	SNP	0.998	A
MSX1	4487	genome.wustl.edu	37	4	4864485	4864485	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr4:4864485G>A	ENST00000382723.4	+	2	761	c.527G>A	c.(526-528)cGg>cAg	p.R176Q	MSX1_ENST00000468421.1_3'UTR	NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	176					activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CGTAAGCCGCGGACGCCCTTC	0.632																																						dbGAP											0													57.0	71.0	66.0					4																	4864485		2199	4292	6491	-	-	-	SO:0001583	missense	0			M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.527G>A	4.37:g.4864485G>A	ENSP00000372170:p.Arg176Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.R176Q	ENST00000382723.4	37	c.527	CCDS3378.2	4	.	.	.	.	.	.	.	.	.	.	G	36	5.655199	0.96724	.	.	ENSG00000163132	ENST00000382723	D	0.99150	-5.49	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99542	0.9836	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97938	1.0324	10	0.87932	D	0	-4.631	18.3263	0.90255	0.0:0.0:1.0:0.0	.	170	P28360	MSX1_HUMAN	Q	176	ENSP00000372170:R176Q	ENSP00000372170:R176Q	R	+	2	0	MSX1	4915386	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	9.634000	0.98435	2.391000	0.81399	0.462000	0.41574	CGG	MSX1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000163132		0.632	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSX1	HGNC	protein_coding	OTTHUMT00000206700.3	24	0.00	0	G			4864485	4864485	+1	no_errors	ENST00000382723	ensembl	human	known	69_37n	missense	63	16.00	12	SNP	1.000	A
MUC5AC	4586	genome.wustl.edu	37	11	1156604	1156604	+	Splice_Site	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr11:1156604C>T	ENST00000356191.2	+	10	613	c.613C>T	c.(613-615)Ctg>Ttg	p.L205L				P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming	207	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		CCAACAAGACCTGTGGGCTCT	0.617																																						dbGAP											0													139.0	132.0	134.0					11																	1156604		875	1990	2865	-	-	-	SO:0001630	splice_region_variant	0			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000356191.2:c.613-1C>T	11.37:g.1156604C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out	p.T207	ENST00000356191.2	37	c.621		11																																																																																			MUC5AC	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000215182		0.617	MUC5AC-201	KNOWN	basic|appris_candidate	protein_coding	MUC5AC	HGNC	protein_coding		27	0.00	0	C	XM_001130382	Silent	1156604	1156604	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000534821	ensembl	human	known	69_37n	silent	42	12.50	6	SNP	0.989	T
OR4C15	81309	genome.wustl.edu	37	11	55322053	55322054	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr11:55322053_55322054insT	ENST00000314644.2	+	1	271_272	c.271_272insT	c.(271-273)gttfs	p.V91fs		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						CATTGCAACTGTTGGGGGCAAC	0.436										HNSCC(20;0.049)																												dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.273dupT	11.37:g.55322055_55322055dupT	ENSP00000324958:p.Val91fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFE2	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G92fs	ENST00000314644.2	37	c.271_272	CCDS31501.1	11																																																																																			OR4C15	-	prints_7TM_GPCR_Rhodpsn	ENSG00000181939		0.436	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	98	0.00	0	-	NM_001001920		55322053	55322054	+1	no_errors	ENST00000314644	ensembl	human	known	69_37n	frame_shift_ins	148	12.94	22	INS	0.000:0.008	T
POLRMT	5442	genome.wustl.edu	37	19	629640	629640	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr19:629640A>T	ENST00000588649.2	-	3	806	c.722T>A	c.(721-723)cTc>cAc	p.L241H		NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	241					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGTGGGCGAGGGGCAGCTG	0.677																																						dbGAP											0													29.0	32.0	31.0					19																	629640		2200	4296	6496	-	-	-	SO:0001583	missense	0				CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.722T>A	19.37:g.629640A>T	ENSP00000465759:p.Leu241His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60370	Missense_Mutation	SNP	pfam_DNA-dir_Rpol_phage-type	p.L256H	ENST00000588649.2	37	c.767	CCDS12036.1	19	.	.	.	.	.	.	.	.	.	.	A	9.204	1.029327	0.19512	.	.	ENSG00000099821	ENST00000215591	T	0.44881	0.91	4.23	3.07	0.35406	.	0.244039	0.34314	N	0.004072	T	0.50548	0.1622	M	0.62723	1.935	0.09310	N	1	D	0.76494	0.999	D	0.64042	0.921	T	0.35151	-0.9800	10	0.45353	T	0.12	-28.44	3.9522	0.09374	0.5306:0.1541:0.0:0.3153	.	241	O00411	RPOM_HUMAN	H	241	ENSP00000215591:L241H	ENSP00000215591:L241H	L	-	2	0	POLRMT	580640	0.006000	0.16342	0.081000	0.20488	0.022000	0.10575	1.147000	0.31602	1.686000	0.51046	0.459000	0.35465	CTC	POLRMT	-	NULL	ENSG00000099821		0.677	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	POLRMT	HGNC	protein_coding	OTTHUMT00000452172.3	36	0.00	0	A	NM_005035		629640	629640	-1	no_errors	ENST00000588649	ensembl	human	known	69_37n	missense	40	28.57	16	SNP	0.007	T
RPRD2	23248	genome.wustl.edu	37	1	150444409	150444409	+	Silent	SNP	A	A	G			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr1:150444409A>G	ENST00000369068.4	+	11	2989	c.2985A>G	c.(2983-2985)aaA>aaG	p.K995K	RPRD2_ENST00000539519.1_Missense_Mutation_p.S923G|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Silent_p.K969K	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	995						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						GCGTGGAGAAAGTCCTGGCCT	0.542																																						dbGAP											0													231.0	234.0	233.0					1																	150444409		1975	4166	6141	-	-	-	SO:0001819	synonymous_variant	0			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2985A>G	1.37:g.150444409A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.S923G	ENST00000369068.4	37	c.2767	CCDS44216.1	1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.605462	0.28623	.	.	ENSG00000163125	ENST00000539519	T	0.46063	0.88	5.32	0.337	0.15966	.	.	.	.	.	T	0.13841	0.0335	.	.	.	0.09310	N	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.34925	-0.9809	8	0.49607	T	0.09	-11.77	10.1416	0.42738	0.6335:0.0:0.3665:0.0	.	923	B4E2Q6	.	G	923	ENSP00000445482:S923G	ENSP00000445482:S923G	S	+	1	0	RPRD2	148711033	0.572000	0.26668	1.000000	0.80357	0.997000	0.91878	0.196000	0.17176	0.128000	0.18479	0.528000	0.53228	AGT	RPRD2	-	NULL	ENSG00000163125		0.542	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	HGNC	protein_coding	OTTHUMT00000035844.1	23	0.00	0	A	NM_015203		150444409	150444409	+1	no_errors	ENST00000539519	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	0.994	G
RUNX1T1	862	genome.wustl.edu	37	8	92998437	92998437	+	Silent	SNP	G	G	A	rs201685328		TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr8:92998437G>A	ENST00000523629.1	-	9	1648	c.1194C>T	c.(1192-1194)gaC>gaT	p.D398D	RUNX1T1_ENST00000396218.1_Silent_p.D371D|RUNX1T1_ENST00000265814.3_Silent_p.D398D|RUNX1T1_ENST00000520724.1_Silent_p.D361D|RUNX1T1_ENST00000436581.2_Silent_p.D409D|RUNX1T1_ENST00000518844.1_Silent_p.D371D|RUNX1T1_ENST00000422361.2_Silent_p.D361D|RUNX1T1_ENST00000360348.2_Silent_p.D361D	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	398					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			AGTCCTCGGCGTCACTGTACC	0.517													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13578	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													110.0	113.0	112.0					8																	92998437		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1194C>T	8.37:g.92998437G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2	p.T98M	ENST00000523629.1	37	c.293	CCDS6256.1	8																																																																																			RUNX1T1	-	pfam_NHR2	ENSG00000079102		0.517	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	42	0.00	0	G	NM_004349, NM_175635		92998437	92998437	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000521751	ensembl	human	known	69_37n	missense	122	16.44	24	SNP	0.034	A
RYR3	6263	genome.wustl.edu	37	15	34151848	34151848	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr15:34151848G>A	ENST00000389232.4	+	100	14285	c.14215G>A	c.(14215-14217)Ggt>Agt	p.G4739S	RP11-3D4.3_ENST00000560404.1_RNA|RYR3_ENST00000415757.3_Missense_Mutation_p.G4734S|RP11-3D4.2_ENST00000560268.1_RNA	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4739					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGACCCTGCTGGTGATCCTTA	0.418																																						dbGAP											0													297.0	293.0	295.0					15																	34151848		2024	4186	6210	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.14215G>A	15.37:g.34151848G>A	ENSP00000373884:p.Gly4739Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.G4739S	ENST00000389232.4	37	c.14215	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.594638	0.96602	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.96856	-4.15	5.13	5.13	0.70059	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97698	0.9245	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	0.96;1.0	D;D	0.97110	0.933;1.0	D	0.97807	1.0248	10	0.56958	D	0.05	.	19.1276	0.93391	0.0:0.0:1.0:0.0	.	4734;4739	Q15413-2;Q15413	.;RYR3_HUMAN	S	4739;4735	ENSP00000373884:G4739S	ENSP00000354735:G4735S	G	+	1	0	RYR3	31939140	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.499000	0.97975	2.813000	0.96785	0.655000	0.94253	GGT	RYR3	-	pfam_Ion_trans_dom	ENSG00000198838		0.418	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	106	0.00	0	G			34151848	34151848	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	147	17.88	32	SNP	1.000	A
SDHAP1	255812	genome.wustl.edu	37	3	195686739	195686739	+	RNA	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr3:195686739C>T	ENST00000427841.1	-	0	2491					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		tgccagtctgcagggaaccac	0.493																																					Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195686739C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.493	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	20	0.00	0	C			195686739	195686739	-1	no_errors	ENST00000427149	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.653	T
SLC44A5	204962	genome.wustl.edu	37	1	75685020	75685020	+	Silent	SNP	C	C	T	rs531608712		TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr1:75685020C>T	ENST00000370855.5	-	16	1301	c.1188G>A	c.(1186-1188)gcG>gcA	p.A396A	SLC44A5_ENST00000535611.1_Silent_p.A266A|SLC44A5_ENST00000370859.3_Silent_p.A396A	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	396					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A396A(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CCCCCGATGTCGCCAAGAAAC	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		17200	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											89.0	83.0	85.0					1																	75685020		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1188G>A	1.37:g.75685020C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	pfam_Choline_transptr-like	p.A396	ENST00000370855.5	37	c.1188	CCDS667.1	1																																																																																			SLC44A5	-	pfam_Choline_transptr-like	ENSG00000137968		0.393	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1	37	0.00	0	C	NM_152697		75685020	75685020	-1	no_errors	ENST00000370855	ensembl	human	known	69_37n	silent	76	12.64	11	SNP	0.993	T
SOCS6	9306	genome.wustl.edu	37	18	67993118	67993118	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr18:67993118C>T	ENST00000397942.3	+	2	1530	c.1214C>T	c.(1213-1215)tCt>tTt	p.S405F	SOCS6_ENST00000582322.1_Missense_Mutation_p.S405F	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	405	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CCAGATGGTTCTTTTCTTGTT	0.468																																					Melanoma(84;1024 1361 24382 36583 42651)	dbGAP											0													180.0	167.0	171.0					18																	67993118		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1214C>T	18.37:g.67993118C>T	ENSP00000381034:p.Ser405Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUM3	Missense_Mutation	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.S405F	ENST00000397942.3	37	c.1214	CCDS11998.1	18	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990680	0.54041	.	.	ENSG00000170677	ENST00000397942	D	0.89681	-2.55	5.7	4.83	0.62350	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.94212	0.8142	M	0.78223	2.4	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.94872	0.8031	10	0.87932	D	0	-11.4683	16.0697	0.80914	0.1352:0.8648:0.0:0.0	.	405	O14544	SOCS6_HUMAN	F	405	ENSP00000381034:S405F	ENSP00000381034:S405F	S	+	2	0	SOCS6	66144098	1.000000	0.71417	0.612000	0.29024	0.498000	0.33706	7.697000	0.84279	1.386000	0.46466	-0.314000	0.08810	TCT	SOCS6	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000170677		0.468	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS6	HGNC	protein_coding	OTTHUMT00000256270.2	20	0.00	0	C			67993118	67993118	+1	no_errors	ENST00000397942	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	1.000	T
SOCS6	9306	genome.wustl.edu	37	18	67993262	67993262	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr18:67993262C>T	ENST00000397942.3	+	2	1674	c.1358C>T	c.(1357-1359)tCc>tTc	p.S453F	SOCS6_ENST00000582322.1_Missense_Mutation_p.S453F	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	453	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GGACATACGTCCATAGTTGAT	0.433																																					Melanoma(84;1024 1361 24382 36583 42651)	dbGAP											0													115.0	112.0	113.0					18																	67993262		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1358C>T	18.37:g.67993262C>T	ENSP00000381034:p.Ser453Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUM3	Missense_Mutation	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.S453F	ENST00000397942.3	37	c.1358	CCDS11998.1	18	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286871	0.80803	.	.	ENSG00000170677	ENST00000397942	D	0.90732	-2.72	5.7	5.7	0.88788	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.96846	0.8970	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97349	0.9962	10	0.87932	D	0	-11.3435	19.8418	0.96692	0.0:1.0:0.0:0.0	.	453	O14544	SOCS6_HUMAN	F	453	ENSP00000381034:S453F	ENSP00000381034:S453F	S	+	2	0	SOCS6	66144242	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	7.666000	0.83877	2.685000	0.91497	0.561000	0.74099	TCC	SOCS6	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000170677		0.433	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS6	HGNC	protein_coding	OTTHUMT00000256270.2	27	0.00	0	C			67993262	67993262	+1	no_errors	ENST00000397942	ensembl	human	known	69_37n	missense	67	10.67	8	SNP	1.000	T
TBC1D3P2	440452	genome.wustl.edu	37	17	60342145	60342145	+	RNA	SNP	T	T	C			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr17:60342145T>C	ENST00000581291.1	-	0	2008									TBC1 domain family, member 3 pseudogene 2											breast(2)|kidney(1)|lung(2)	5						AGGCTCACGGTGTCGTCAGAA	0.473																																						dbGAP											0																																										-	-	-			0					17q23.2	2009-05-14				ENSG00000188755			27783	pseudogene	pseudogene							Standard	NR_027486		Approved		uc002izq.2				17.37:g.60342145T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581291.1	37	NULL		17																																																																																			TBC1D3P2	-	-	ENSG00000188755		0.473	TBC1D3P2-002	KNOWN	basic	processed_transcript	TBC1D3P2	HGNC	pseudogene	OTTHUMT00000445021.1	15	0.00	0	T	NR_027486		60342145	60342145	-1	no_errors	ENST00000581291	ensembl	human	known	69_37n	rna	6	57.14	8	SNP	0.054	C
TCF25	22980	genome.wustl.edu	37	16	89952461	89952461	+	Intron	SNP	T	T	C	rs111321912		TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr16:89952461T>C	ENST00000263346.8	+	4	604				TCF25_ENST00000263347.7_Intron	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)						heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		cccttctctgTGGCTGCCACA	0.522																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.548+87T>C	16.37:g.89952461T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2MK75|Q9UPV3	Missense_Mutation	SNP	NULL	p.W134R	ENST00000263346.8	37	c.400	CCDS10987.1	16																																																																																			TCF25	-	NULL	ENSG00000141002		0.522	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF25	HGNC	protein_coding	OTTHUMT00000272875.2	36	0.00	0	T	NM_014972		89952461	89952461	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000565404	ensembl	human	putative	69_37n	missense	41	22.22	12	SNP	0.000	C
THBS1	7057	genome.wustl.edu	37	15	39874437	39874437	+	Silent	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr15:39874437C>T	ENST00000260356.5	+	3	276	c.111C>T	c.(109-111)acC>acT	p.T37T		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	37					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TTGAACTCACCGGGGCCGCCC	0.612																																						dbGAP											0													38.0	42.0	41.0					15																	39874437		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.111C>T	15.37:g.39874437C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.T37	ENST00000260356.5	37	c.111	CCDS32194.1	15																																																																																			THBS1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000137801		0.612	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	HGNC	protein_coding	OTTHUMT00000257831.2	23	0.00	0	C	NM_003246		39874437	39874437	+1	no_errors	ENST00000260356	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.057	T
TMCC1	23023	genome.wustl.edu	37	3	129389467	129389467	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr3:129389467C>T	ENST00000393238.3	-	4	1557	c.1217G>A	c.(1216-1218)gGa>gAa	p.G406E	TMCC1_ENST00000426664.2_Missense_Mutation_p.G292E|TMCC1_ENST00000329333.5_Missense_Mutation_p.G227E|TMCC1_ENST00000432054.2_Missense_Mutation_p.G82E	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	406						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TGAAATCACTCCCAAAGCCTT	0.502																																						dbGAP											0													101.0	95.0	97.0					3																	129389467		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1217G>A	3.37:g.129389467C>T	ENSP00000376930:p.Gly406Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.G406E	ENST00000393238.3	37	c.1217	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167081	0.78339	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.21	5.21	0.72293	.	0.047620	0.85682	D	0.000000	T	0.62441	0.2428	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.974;1.0	T	0.60672	-0.7217	10	0.02654	T	1	-4.399	19.1112	0.93317	0.0:1.0:0.0:0.0	.	227;406	B4DE04;O94876	.;TMCC1_HUMAN	E	82;406;292;227	ENSP00000404711:G82E;ENSP00000376930:G406E;ENSP00000389892:G292E;ENSP00000327349:G227E	ENSP00000327349:G227E	G	-	2	0	TMCC1	130872157	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.607000	0.54102	2.581000	0.87130	0.591000	0.81541	GGA	TMCC1	-	pfam_Predicted_TM_coiled-coil_2	ENSG00000172765		0.502	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	HGNC	protein_coding	OTTHUMT00000356418.2	35	0.00	0	C	NM_015008		129389467	129389467	-1	no_errors	ENST00000393238	ensembl	human	known	69_37n	missense	61	18.67	14	SNP	1.000	T
TMEM14B	81853	genome.wustl.edu	37	6	10750060	10750060	+	Intron	SNP	G	G	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr6:10750060G>A	ENST00000379542.5	+	3	267				RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000491103.1_Intron|TMEM14B_ENST00000475942.1_Intron|RNA5SP203_ENST00000410451.1_RNA|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000461342.1_Intron|TMEM14B_ENST00000481240.1_Intron|RP11-421M1.8_ENST00000606522.1_lincRNA|TMEM14B_ENST00000379530.3_Intron|TMEM14B_ENST00000473276.1_Intron|TMEM14B_ENST00000467317.1_Intron	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TGGAGTGCAGGCTTCCTTGTC	0.483																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.100+129G>A	6.37:g.10750060G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	SNP	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			TMEM14B	-	-	ENSG00000137210		0.483	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	38	0.00	0	G	NM_030969		10750060	10750060	+1	no_errors	ENST00000492297	ensembl	human	known	69_37n	rna	30	42.31	22	SNP	0.017	A
TNK2	10188	genome.wustl.edu	37	3	195603552	195603552	+	Intron	SNP	G	G	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr3:195603552G>T	ENST00000333602.6	-	9	1874				TNK2_ENST00000428187.1_Intron|TNK2_ENST00000316664.3_Intron|TNK2_ENST00000381916.2_Intron|TNK2_ENST00000392400.1_Intron|TNK2_ENST00000468819.1_5'Flank	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2						cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CCAGGGGGAAGGAGCCCCCAG	0.711																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1256+1571C>A	3.37:g.195603552G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	pfam_GTPase_binding,superfamily_SH3_domain	p.P19H	ENST00000333602.6	37	c.56	CCDS33928.1	3	.	.	.	.	.	.	.	.	.	.	G	9.620	1.133483	0.21041	.	.	ENSG00000061938	ENST00000411741	T	0.53857	0.6	4.16	2.21	0.28008	.	.	.	.	.	T	0.48132	0.1483	.	.	.	0.19300	N	0.999979	.	.	.	.	.	.	T	0.45585	-0.9251	6	0.87932	D	0	.	4.9088	0.13811	0.122:0.0:0.656:0.222	.	.	.	.	H	19	ENSP00000415126:P19H	ENSP00000415126:P19H	P	-	2	0	TNK2	197087949	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.262000	0.08682	0.426000	0.26116	0.561000	0.74099	CCT	TNK2	-	NULL	ENSG00000061938		0.711	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	HGNC	protein_coding	OTTHUMT00000341437.3	18	0.00	0	G	NM_005781		195603552	195603552	-1	no_start_codon:no_stop_codon	ENST00000411741	ensembl	human	novel	69_37n	missense	20	45.95	17	SNP	0.002	T
TP53	7157	genome.wustl.edu	37	17	7579409	7579410	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr17:7579409_7579410delAG	ENST00000269305.4	-	4	466_467	c.277_278delCT	c.(277-279)ctgfs	p.L93fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.L93fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.L93fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.L93fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Del_p.L93fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.L93fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	93	Interaction with WWOX.		L -> M (in a sporadic cancer; somatic mutation).|L -> P (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L93fs*30(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.A88fs*52(1)|p.L93M(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAAGATGACAGGGGCCAGGAG	0.629		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	22	Deletion - Frameshift(13)|Whole gene deletion(8)|Substitution - Missense(1)	breast(6)|lung(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.277_278delCT	17.37:g.7579409_7579410delAG	ENSP00000269305:p.Leu93fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L93fs	ENST00000269305.4	37	c.278_277	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.629	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	43	0.00	0	AG	NM_000546		7579409	7579410	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	7	55.56	10	DEL	1.000:1.000	-
TRIM51HP	440041	genome.wustl.edu	37	11	55065032	55065032	+	RNA	DEL	T	T	-			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr11:55065032delT	ENST00000526016.1	-	0	393					NR_038174.2				tripartite motif-containing 51H, pseudogene																		AAAGACTGCATTTTTTTTTAG	0.398																																						dbGAP											0																																										-	-	-			0					11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55065032delT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000526016.1	37	NULL		11																																																																																			TRIM51HP	-	-	ENSG00000166007		0.398	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	TRIM51HP	HGNC	pseudogene	OTTHUMT00000391438.1	117	0.00	0	T			55065032	55065032	-1	no_errors	ENST00000526016	ensembl	human	putative	69_37n	rna	122	43.58	95	DEL	0.010	-
WAS	7454	genome.wustl.edu	37	X	48547822	48547822	+	Splice_Site	SNP	C	C	T			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chrX:48547822C>T	ENST00000376701.4	+	11	1527	c.1452C>T	c.(1450-1452)tcC>tcT	p.S484S		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	484					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				TCCACTCCTCCGGTGAGCTGA	0.607			"""Mis, N, F, S"""			lymphoma																																dbGAP		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	0													26.0	27.0	26.0					X																	48547822		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1453+1C>T	X.37:g.48547822C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BU11|Q9UNJ9	Silent	SNP	pfam_EVH1,pfam_PAK_box_Rho-bd,pfam_WH2_dom,superfamily_WASP_C,smart_EVH1,smart_PAK_box_Rho-bd,smart_WH2_dom,pfscan_PAK_box_Rho-bd,pfscan_EVH1,pfscan_WH2_dom	p.S484	ENST00000376701.4	37	c.1452	CCDS14303.1	X																																																																																			WAS	-	superfamily_WASP_C	ENSG00000015285		0.607	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	WAS	HGNC	protein_coding	OTTHUMT00000083379.1	52	0.00	0	C	NM_000377	Silent	48547822	48547822	+1	no_errors	ENST00000376701	ensembl	human	known	69_37n	silent	55	32.93	27	SNP	0.951	T
ZFP91	80829	genome.wustl.edu	37	11	58384773	58384773	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr11:58384773G>C	ENST00000316059.6	+	11	1478	c.1307G>C	c.(1306-1308)gGc>gCc	p.G436A	ZFP91-CNTF_ENST00000389919.4_Missense_Mutation_p.G436A	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	436					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AATATCTGTGGCAAAAAATTT	0.468																																						dbGAP											0													66.0	62.0	63.0					11																	58384773		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.1307G>C	11.37:g.58384773G>C	ENSP00000339030:p.Gly436Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G436A	ENST00000316059.6	37	c.1307	CCDS31553.1	11	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998685	0.74818	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	T	0.59772	0.24	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.060875	0.64402	D	0.000004	T	0.61009	0.2313	M	0.70275	2.135	0.80722	D	1	P;P	0.46784	0.884;0.476	B;B	0.39419	0.203;0.299	T	0.67325	-0.5699	10	0.87932	D	0	-12.5467	19.6313	0.95704	0.0:0.0:1.0:0.0	.	436;436	Q96JP5-2;Q96JP5	.;ZFP91_HUMAN	A	436	ENSP00000339030:G436A	ENSP00000374569:G436A	G	+	2	0	ZFP91	58141349	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGC	ZFP91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186660		0.468	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP91	HGNC	protein_coding	OTTHUMT00000268674.1	27	0.00	0	G	NM_053023		58384773	58384773	+1	no_errors	ENST00000316059	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	C
ZNF208	7757	genome.wustl.edu	37	19	22155166	22155166	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr19:22155166T>G	ENST00000397126.4	-	4	2818	c.2670A>C	c.(2668-2670)aaA>aaC	p.K890N	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	890					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTCTTCACATTTGTAGGGTT	0.383																																						dbGAP											0													44.0	47.0	46.0					19																	22155166		2077	4227	6304	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2670A>C	19.37:g.22155166T>G	ENSP00000380315:p.Lys890Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K890N	ENST00000397126.4	37	c.2670	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	12.06	1.826053	0.32237	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.20200	2.09	2.58	-1.79	0.07932	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34337	0.0894	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.18241	-1.0343	8	0.56958	D	0.05	.	3.3468	0.07139	0.0:0.2784:0.2102:0.5114	.	790	O43345	ZN208_HUMAN	N	890;790	ENSP00000380315:K890N	ENSP00000380315:K890N	K	-	3	2	ZNF208	21947006	0.000000	0.05858	0.001000	0.08648	0.108000	0.19459	-4.381000	0.00243	-0.000000	0.14550	0.240000	0.17902	AAA	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	32	0.00	0	T	NM_007153		22155166	22155166	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	0.001	G
ZNF703	80139	genome.wustl.edu	37	8	37556061	37556061	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A2KD-01A-31D-A21Q-09	TCGA-A7-A2KD-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f8d373ee-1874-4d50-93ce-baea3d91bcf3	534d0ac4-dc2f-427f-911f-1b7b2a003306	g.chr8:37556061T>A	ENST00000331569.4	+	2	1871	c.1642T>A	c.(1642-1644)Tat>Aat	p.Y548N		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	548					adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)		FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			GTACCACCCCTATGGCAAGAG	0.672																																						dbGAP											0													19.0	19.0	19.0					8																	37556061		2201	4294	6495	-	-	-	SO:0001583	missense	0			AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.1642T>A	8.37:g.37556061T>A	ENSP00000332325:p.Tyr548Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XG76	Missense_Mutation	SNP	pfam_Tscrpt_rep_NocA-like,pfscan_Znf_C2H2	p.Y548N	ENST00000331569.4	37	c.1642	CCDS6094.1	8	.	.	.	.	.	.	.	.	.	.	T	20.2	3.941884	0.73557	.	.	ENSG00000183779	ENST00000331569;ENST00000397235	T	0.74526	-0.85	3.7	3.7	0.42460	.	0.000000	0.85682	D	0.000000	D	0.83050	0.5170	M	0.70595	2.14	0.58432	D	0.999999	D	0.65815	0.995	D	0.66084	0.941	D	0.84918	0.0852	10	0.66056	D	0.02	-6.9334	12.5507	0.56225	0.0:0.0:0.0:1.0	.	548	Q9H7S9	ZN703_HUMAN	N	548;121	ENSP00000332325:Y548N	ENSP00000332325:Y548N	Y	+	1	0	ZNF703	37675219	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.862000	0.69560	1.540000	0.49301	0.260000	0.18958	TAT	ZNF703	-	NULL	ENSG00000183779		0.672	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF703	HGNC	protein_coding	OTTHUMT00000376683.2	29	0.00	0	T	NM_025069		37556061	37556061	+1	no_errors	ENST00000331569	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	1.000	A
