#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AANAT	15	genome.wustl.edu	37	17	74464756	74464756	+	5'UTR	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr17:74464756G>T	ENST00000392492.3	+	0	162				AANAT_ENST00000250615.3_Silent_p.V21V	NM_001088.2	NP_001079.1	Q16613	SNAT_HUMAN	aralkylamine N-acetyltransferase						cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|N-terminal protein amino acid acetylation (GO:0006474)|response to calcium ion (GO:0051592)|response to copper ion (GO:0046688)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to insulin (GO:0032868)|response to light stimulus (GO:0009416)|response to prostaglandin E (GO:0034695)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	aralkylamine N-acetyltransferase activity (GO:0004059)|arylamine N-acetyltransferase activity (GO:0004060)			lung(1)	1						TCCAACAGGTGCTGGGAGGCC	0.607																																						dbGAP											0													28.0	36.0	33.0					17																	74464756		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			U40347	CCDS11745.1, CCDS54169.1	17q25.1	2013-10-15	2010-05-07		ENSG00000129673	ENSG00000129673	2.3.1.87		19	protein-coding gene	gene with protein product	"""serotonin N-acetyltransferase"""	600950	"""arylalkylamine N-acetyltransferase"""			8661026	Standard	NM_001088		Approved	SNAT	uc002jro.3	Q16613	OTTHUMG00000180179	ENST00000392492.3:c.-73G>T	17.37:g.74464756G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVF2|J3KMZ5|Q562F4	Silent	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.V21	ENST00000392492.3	37	c.63	CCDS11745.1	17																																																																																			AANAT	-	NULL	ENSG00000129673		0.607	AANAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AANAT	HGNC	protein_coding	OTTHUMT00000450130.1	35	0.00	0	G	NM_001088		74464756	74464756	+1	no_errors	ENST00000250615	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	0.228	T
ADPGK	83440	genome.wustl.edu	37	15	73044812	73044812	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr15:73044812C>T	ENST00000311669.8	-	7	1454	c.1361G>A	c.(1360-1362)tGg>tAg	p.W454*	ADPGK_ENST00000456471.2_Nonsense_Mutation_p.W180*	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	455	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						CTCTCTGTGCCATTCTACTAC	0.507																																						dbGAP											0													106.0	106.0	106.0					15																	73044812		1905	4115	6020	-	-	-	SO:0001587	stop_gained	0			AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.1361G>A	15.37:g.73044812C>T	ENSP00000312250:p.Trp454*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Nonsense_Mutation	SNP	pfam_ADP_PFK/GK	p.W454*	ENST00000311669.8	37	c.1361	CCDS42057.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.171583|5.171583	0.94807|0.94807	.|.	.|.	ENSG00000159322|ENSG00000159322	ENST00000331065|ENST00000311669;ENST00000443764;ENST00000456471	.|.	.|.	.|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.48926|.	0.1527|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36529|.	-0.9744|.	5|.	0.49607|0.02654	T|T	0.09|1	-12.4643|-12.4643	20.5407|20.5407	0.99260|0.99260	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	I|X	331|454;374;180	.|.	ENSP00000332964:M331I|ENSP00000312250:W454X	M|W	-|-	3|2	0|0	ADPGK|ADPGK	70831865|70831865	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.886000|0.886000	0.51366|0.51366	7.695000|7.695000	0.84257|0.84257	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	ATG|TGG	ADPGK	-	pfam_ADP_PFK/GK	ENSG00000159322		0.507	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPGK	HGNC	protein_coding	OTTHUMT00000420434.1	54	0.00	0	C	NM_031284		73044812	73044812	-1	no_errors	ENST00000311669	ensembl	human	known	69_37n	nonsense	33	10.81	4	SNP	1.000	T
APPL1	26060	genome.wustl.edu	37	3	57303610	57303610	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr3:57303610A>T	ENST00000288266.3	+	22	2172	c.2025A>T	c.(2023-2025)agA>agT	p.R675S	ASB14_ENST00000487349.1_3'UTR|ASB14_ENST00000389601.3_3'UTR	NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	675					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)			breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		CTTCCAGTAGACCAAACCAAG	0.428																																						dbGAP											0													136.0	128.0	130.0					3																	57303610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.2025A>T	3.37:g.57303610A>T	ENSP00000288266:p.Arg675Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2B9	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_Pleckstrin_homology,smart_PTyr_interaction_dom,pfscan_Pleckstrin_homology,pfscan_PTyr_interaction_dom	p.R675S	ENST00000288266.3	37	c.2025	CCDS2882.1	3	.	.	.	.	.	.	.	.	.	.	A	13.18	2.161214	0.38119	.	.	ENSG00000157500	ENST00000288266	T	0.09538	2.97	5.65	4.49	0.54785	.	0.100150	0.64402	D	0.000004	T	0.19685	0.0473	L	0.32530	0.975	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.01001	-1.1485	10	0.72032	D	0.01	-26.0858	8.971	0.35905	0.8571:0.0:0.1429:0.0	.	675	Q9UKG1	DP13A_HUMAN	S	675	ENSP00000288266:R675S	ENSP00000288266:R675S	R	+	3	2	APPL1	57278650	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.039000	0.41193	1.076000	0.40961	0.460000	0.39030	AGA	APPL1	-	NULL	ENSG00000157500		0.428	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPL1	HGNC	protein_coding	OTTHUMT00000258196.2	78	0.00	0	A	NM_012096		57303610	57303610	+1	no_errors	ENST00000288266	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	T
ALG1L	200810	genome.wustl.edu	37	3	125649445	125649445	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr3:125649445T>A	ENST00000340333.3	-	5	466	c.303A>T	c.(301-303)gaA>gaT	p.E101D	FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	101							transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CCAGGCCATTTTCTTCATGTT	0.582																																						dbGAP											0													56.0	59.0	58.0					3																	125649445		1374	2317	3691	-	-	-	SO:0001583	missense	0			BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.303A>T	3.37:g.125649445T>A	ENSP00000340009:p.Glu101Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNA5	Missense_Mutation	SNP	NULL	p.E101D	ENST00000340333.3	37	c.303	CCDS33840.1	3	.	.	.	.	.	.	.	.	.	.	.	15.04	2.715297	0.48622	.	.	ENSG00000189366	ENST00000340333	D	0.84370	-1.84	2.11	-2.77	0.05877	.	0.000000	0.85682	D	0.000000	D	0.89347	0.6689	M	0.85041	2.73	0.54753	D	0.999986	D	0.60160	0.987	D	0.67725	0.953	D	0.85175	0.1000	10	0.52906	T	0.07	-21.3226	6.6058	0.22724	0.0:0.3947:0.0:0.6053	.	101	Q6GMV1	ALG1L_HUMAN	D	101	ENSP00000340009:E101D	ENSP00000340009:E101D	E	-	3	2	ALG1L	127132135	0.448000	0.25681	0.928000	0.36995	0.087000	0.18053	-0.513000	0.06305	-0.822000	0.04306	0.136000	0.15936	GAA	ALG1L	-	NULL	ENSG00000189366		0.582	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1L	HGNC	protein_coding	OTTHUMT00000356347.1	162	0.00	0	T	NM_001015050		125649445	125649445	-1	no_errors	ENST00000340333	ensembl	human	known	69_37n	missense	62	27.06	23	SNP	0.999	A
ARPC1A	10552	genome.wustl.edu	37	7	98942098	98942098	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr7:98942098C>T	ENST00000262942.5	+	4	476	c.352C>T	c.(352-354)Cga>Tga	p.R118*	ARPC1A_ENST00000432884.2_Nonsense_Mutation_p.R71*	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	118					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			AAGTGGAGCACGACTCATTTC	0.428																																						dbGAP											0													95.0	89.0	91.0					7																	98942098		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.352C>T	7.37:g.98942098C>T	ENSP00000262942:p.Arg118*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R118*	ENST00000262942.5	37	c.352	CCDS5660.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.737675	0.96865	.	.	ENSG00000241685	ENST00000432884;ENST00000262942	.	.	.	5.55	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7513	0.62910	0.2799:0.7201:0.0:0.0	.	.	.	.	X	71;118	.	ENSP00000262942:R118X	R	+	1	2	ARPC1A	98780034	1.000000	0.71417	0.973000	0.42090	0.998000	0.95712	3.804000	0.55568	1.450000	0.47717	0.650000	0.86243	CGA	ARPC1A	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1	ENSG00000241685		0.428	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC1A	HGNC	protein_coding	OTTHUMT00000335908.1	37	0.00	0	C	NM_006409		98942098	98942098	+1	no_errors	ENST00000262942	ensembl	human	known	69_37n	nonsense	22	18.52	5	SNP	1.000	T
ATP2A1	487	genome.wustl.edu	37	16	28909621	28909621	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr16:28909621C>T	ENST00000357084.3	+	14	1880	c.1613C>T	c.(1612-1614)aCg>aTg	p.T538M	ATP2A1_ENST00000395503.4_Missense_Mutation_p.T538M|ATP2A1_ENST00000536376.1_Missense_Mutation_p.T413M	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	538					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GTGCCACTGACGGGGCCGGTG	0.652																																						dbGAP											0													66.0	72.0	70.0					16																	28909621		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1613C>T	16.37:g.28909621C>T	ENSP00000349595:p.Thr538Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.T538M	ENST00000357084.3	37	c.1613	CCDS10643.1	16	.	.	.	.	.	.	.	.	.	.	C	18.73	3.686725	0.68157	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.85258	-1.96;-1.96;-1.96	5.43	5.43	0.79202	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.048556	0.85682	D	0.000000	D	0.94016	0.8083	M	0.93978	3.48	0.80722	D	1	D;D;D	0.58620	0.97;0.957;0.983	B;D;P	0.63283	0.428;0.913;0.802	D	0.95325	0.8424	10	0.87932	D	0	.	17.9902	0.89166	0.0:1.0:0.0:0.0	.	413;538;538	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	M	538;538;575;413	ENSP00000349595:T538M;ENSP00000378879:T538M;ENSP00000443101:T413M	ENSP00000349595:T538M	T	+	2	0	ATP2A1	28817122	1.000000	0.71417	0.242000	0.24170	0.290000	0.27261	7.717000	0.84732	2.533000	0.85409	0.655000	0.94253	ACG	ATP2A1	-	superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Ca-transp	ENSG00000196296		0.652	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	70	0.00	0	C	NM_004320		28909621	28909621	+1	no_errors	ENST00000357084	ensembl	human	known	69_37n	missense	66	27.47	25	SNP	1.000	T
C10orf71	118461	genome.wustl.edu	37	10	50532913	50532913	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr10:50532913C>T	ENST00000374144.3	+	3	2611	c.2323C>T	c.(2323-2325)Cgg>Tgg	p.R775W	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	775										endometrium(1)	1						GAATGTGATGCGGAAGGATGA	0.517																																						dbGAP											0													86.0	78.0	81.0					10																	50532913		692	1591	2283	-	-	-	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.2323C>T	10.37:g.50532913C>T	ENSP00000363259:p.Arg775Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL8	Missense_Mutation	SNP	NULL	p.R775W	ENST00000374144.3	37	c.2323	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623670	0.66901	.	.	ENSG00000177354	ENST00000374144	T	0.05996	3.36	4.75	2.56	0.30785	.	.	.	.	.	T	0.04815	0.0130	N	0.14661	0.345	0.09310	N	0.999999	.	.	.	.	.	.	T	0.41052	-0.9530	7	0.62326	D	0.03	.	5.9257	0.19110	0.1544:0.3456:0.5:0.0	.	.	.	.	W	775	ENSP00000363259:R775W	ENSP00000363259:R775W	R	+	1	2	C10orf71	50202919	0.005000	0.15991	0.000000	0.03702	0.033000	0.12548	1.214000	0.32419	0.438000	0.26450	-0.352000	0.07741	CGG	C10orf71	-	NULL	ENSG00000177354		0.517	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	44	0.00	0	C	NM_199459		50532913	50532913	+1	no_errors	ENST00000374144	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.000	T
BMPR1A	657	genome.wustl.edu	37	10	88635786	88635786	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr10:88635786T>A	ENST00000372037.3	+	3	548	c.11T>A	c.(10-12)cTa>cAa	p.L4Q	BMPR1A_ENST00000480152.1_3'UTR	NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	4					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						ATGCCTCAGCTATACATTTAC	0.318			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												Ovarian(190;603 2086 22044 30335 47971)	dbGAP	yes	Rec		Juvenile polyposis	10	10q22.3	657	"""bone morphogenetic protein receptor, type IA"""		E	0													208.0	203.0	205.0					10																	88635786		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.11T>A	10.37:g.88635786T>A	ENSP00000361107:p.Leu4Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6U9|Q8NEN8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L4Q	ENST00000372037.3	37	c.11	CCDS7378.1	10	.	.	.	.	.	.	.	.	.	.	T	12.48	1.951903	0.34471	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	D	0.84370	-1.84	5.3	0.276	0.15663	.	0.689788	0.14348	N	0.325283	T	0.74160	0.3680	N	0.19112	0.55	0.24182	N	0.995586	B	0.28512	0.214	B	0.31751	0.135	T	0.65606	-0.6127	10	0.87932	D	0	.	9.0106	0.36139	0.0:0.3065:0.0:0.6935	.	4	P36894	BMR1A_HUMAN	Q	4	ENSP00000361107:L4Q	ENSP00000224764:L4Q	L	+	2	0	BMPR1A	88625766	0.736000	0.28164	0.311000	0.25182	0.820000	0.46376	1.066000	0.30604	0.090000	0.17273	0.455000	0.32223	CTA	BMPR1A	-	NULL	ENSG00000107779		0.318	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR1A	HGNC	protein_coding	OTTHUMT00000049170.3	135	0.00	0	T	NM_004329		88635786	88635786	+1	no_errors	ENST00000224764	ensembl	human	known	69_37n	missense	69	25.81	24	SNP	0.204	A
C2orf82	389084	genome.wustl.edu	37	2	233740391	233740391	+	Intron	SNP	A	A	G	rs778337	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr2:233740391A>G	ENST00000409230.1	+	3	320				C2orf82_ENST00000409533.1_Intron|C2orf82_ENST00000331342.2_Intron			Q6UX34	CB082_HUMAN	chromosome 2 open reading frame 82							cell periphery (GO:0071944)|integral component of membrane (GO:0016021)											CCAACCCTATAAGCAGAGAAG	0.592													G|||	4045	0.807708	0.9372	0.8184	5008	,	,		16108	0.7937		0.7783	False		,,,				2504	0.6697					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY358535, BC035093	CCDS2499.1	2q37.1	2013-10-11			ENSG00000182600	ENSG00000182600			33763	protein-coding gene	gene with protein product						12975309	Standard	NM_206895		Approved	UNQ830, ASCL830	uc002vtr.1	Q6UX34	OTTHUMG00000133273	ENST00000409230.1:c.74-259A>G	2.37:g.233740391A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000409230.1	37	NULL	CCDS2499.1	2																																																																																			C2orf82	-	-	ENSG00000182600		0.592	C2orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf82	HGNC	protein_coding	OTTHUMT00000257052.2	9	0.00	0	A	NM_206895		233740391	233740391	+1	no_errors	ENST00000476690	ensembl	human	putative	69_37n	rna	9	35.71	5	SNP	0.000	G
CDH1	999	genome.wustl.edu	37	16	68862095	68862095	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr16:68862095T>A	ENST00000261769.5	+	14	2374	c.2183T>A	c.(2182-2184)tTg>tAg	p.L728*	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Nonsense_Mutation_p.L667*	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	728					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTGCTGCTCTTGCTGTTTCTT	0.532			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													119.0	110.0	113.0					16																	68862095		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2183T>A	16.37:g.68862095T>A	ENSP00000261769:p.Leu728*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L728*	ENST00000261769.5	37	c.2183	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	T	40	8.173958	0.98691	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000422392	.	.	.	6.07	6.07	0.98685	.	0.000000	0.40554	N	0.001077	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3021	0.82825	0.0:0.0:0.0:1.0	.	.	.	.	X	728;746;667	.	ENSP00000261769:L728X	L	+	2	0	CDH1	67419596	0.914000	0.31030	0.972000	0.41901	0.983000	0.72400	5.906000	0.69900	2.326000	0.78906	0.533000	0.62120	TTG	CDH1	-	NULL	ENSG00000039068		0.532	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	164	0.00	0	T	NM_004360		68862095	68862095	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	64	27.27	24	SNP	0.983	A
CDHR1	92211	genome.wustl.edu	37	10	85974550	85974550	+	3'UTR	SNP	C	C	A	rs41291358	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr10:85974550C>A	ENST00000372117.3	+	0	2856				CDHR1_ENST00000440770.2_3'UTR|CDHR1_ENST00000332904.3_Intron	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1						cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CAAGAAGTTGCGCTCTGACAG	0.517											OREG0020334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1036	0.206869	0.0666	0.268	5008	,	,		16652	0.2907		0.2843	False		,,,				2504	0.1871					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.*173C>A	10.37:g.85974550C>A		Somatic	1240	WXS	Illumina GAIIx	Phase_IV	Q69YZ8|Q8IXY5	RNA	SNP	-	NULL	ENST00000372117.3	37	NULL	CCDS7372.1	10																																																																																			CDHR1	-	-	ENSG00000148600		0.517	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	HGNC	protein_coding	OTTHUMT00000049111.1	8	0.00	0	C	NM_033100		85974550	85974550	+1	no_errors	ENST00000459673	ensembl	human	known	69_37n	rna	5	44.44	4	SNP	0.001	A
CHD5	26038	genome.wustl.edu	37	1	6191719	6191719	+	Silent	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr1:6191719G>T	ENST00000262450.3	-	21	3333	c.3234C>A	c.(3232-3234)ctC>ctA	p.L1078L	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CCTCCTGCCGGAGGCCCCCGG	0.567																																						dbGAP											0													87.0	79.0	81.0					1																	6191719		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3234C>A	1.37:g.6191719G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_SNF2_N,pfam_DUF1086,pfam_DUF1087,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P461T	ENST00000262450.3	37	c.1381	CCDS57.1	1																																																																																			CHD5	-	pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,smart_Helicase_C,pfscan_Helicase_C	ENSG00000116254		0.567	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	66	0.00	0	G	NM_015557		6191719	6191719	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000462991	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.611	T
CIDECP	152302	genome.wustl.edu	37	3	10059658	10059658	+	RNA	SNP	G	G	T	rs9862221	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr3:10059658G>T	ENST00000432401.1	-	0	505									cell death-inducing DFFA-like effector c pseudogene																		GGGGATGCCCGTCCTCTGTGG	0.597													T|||	1145	0.228634	0.4932	0.1844	5008	,	,		20487	0.0665		0.1352	False		,,,				2504	0.1656					dbGAP											0																																										-	-	-			0			AF279614		3p25.3	2007-07-26			ENSG00000186162	ENSG00000186162			24230	pseudogene	pseudogene							Standard	NR_002786		Approved	CICE			OTTHUMG00000155323		3.37:g.10059658G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000432401.1	37	NULL		3																																																																																			CIDECP	-	-	ENSG00000186162		0.597	CIDECP-001	KNOWN	basic	processed_transcript	CIDECP	HGNC	pseudogene	OTTHUMT00000339463.1	53	0.00	0	G			10059658	10059658	-1	no_errors	ENST00000424471	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.000	T
CLDN4	1364	genome.wustl.edu	37	7	73245798	73245798	+	Silent	SNP	C	C	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr7:73245798C>A	ENST00000435050.1	+	2	2947	c.267C>A	c.(265-267)atC>atA	p.I89I	CLDN4_ENST00000431918.1_Silent_p.I89I|CLDN4_ENST00000340958.2_Silent_p.I89I			O14493	CLD4_HUMAN	claudin 4	89	Interaction with EPHA2.				calcium-independent cell-cell adhesion (GO:0016338)|establishment of skin barrier (GO:0061436)|female pregnancy (GO:0007565)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basal plasma membrane (GO:0009925)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)|transmembrane signaling receptor activity (GO:0004888)			kidney(2)|lung(4)|urinary_tract(1)	7		Lung NSC(55;0.159)				TCAGCATCATCGTGGCTGCTC	0.652																																						dbGAP											0													73.0	67.0	69.0					7																	73245798		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB000712	CCDS5560.1	7q11.23	2008-07-18			ENSG00000189143	ENSG00000189143		"""Claudins"""	2046	protein-coding gene	gene with protein product	"""Clostridium perfringens enterotoxin receptor 1"", ""Williams-Beuren syndrome chromosomal region 8 protein"""	602909		CPETR, CPETR1		9334247, 9892664	Standard	NM_001305		Approved	CPE-R, WBSCR8, hCPE-R	uc003tzi.4	O14493	OTTHUMG00000023425	ENST00000435050.1:c.267C>A	7.37:g.73245798C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin4	p.I89	ENST00000435050.1	37	c.267	CCDS5560.1	7																																																																																			CLDN4	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000189143		0.652	CLDN4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLDN4	HGNC	protein_coding	OTTHUMT00000348030.1	74	0.00	0	C	NM_001305		73245798	73245798	+1	no_errors	ENST00000340958	ensembl	human	known	69_37n	silent	36	16.28	7	SNP	0.998	A
COL6A1	1291	genome.wustl.edu	37	21	47423622	47423622	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr21:47423622C>T	ENST00000361866.3	+	35	2896	c.2782C>T	c.(2782-2784)Cgc>Tgc	p.R928C	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	928	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CCGCTTCTACCGCGAGGCCTC	0.642																																						dbGAP											0													32.0	27.0	29.0					21																	47423622		2202	4299	6501	-	-	-	SO:0001583	missense	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2782C>T	21.37:g.47423622C>T	ENSP00000355180:p.Arg928Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.R928C	ENST00000361866.3	37	c.2782	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	C	20.0	3.931284	0.73327	.	.	ENSG00000142156	ENST00000361866	T	0.78364	-1.17	4.74	3.85	0.44370	von Willebrand factor, type A (3);	0.477414	0.19994	N	0.101486	T	0.82139	0.4972	L	0.40543	1.245	0.51767	D	0.999932	D	0.89917	1.0	D	0.67103	0.949	T	0.81974	-0.0687	10	0.51188	T	0.08	-17.4301	14.3261	0.66521	0.1493:0.8507:0.0:0.0	.	928	P12109	CO6A1_HUMAN	C	928	ENSP00000355180:R928C	ENSP00000355180:R928C	R	+	1	0	COL6A1	46248050	0.028000	0.19301	0.899000	0.35326	0.824000	0.46624	1.053000	0.30442	0.980000	0.38523	0.530000	0.56133	CGC	COL6A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142156		0.642	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	107	0.00	0	C	NM_001848		47423622	47423622	+1	no_errors	ENST00000361866	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.892	T
CRYBB2P1	1416	genome.wustl.edu	37	22	25853368	25853368	+	RNA	SNP	T	T	C	rs6423498	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr22:25853368T>C	ENST00000609084.1	+	0	0									crystallin, beta B2 pseudogene 1																		CGGAGTGGCATGTAAGTGCAT	0.557													t|||	1297	0.258986	0.6369	0.1916	5008	,	,		22012	0.0933		0.0726	False		,,,				2504	0.1585					dbGAP											0																																										-	-	-			0			M18441		22q11.2-q12.1	2012-02-29			ENSG00000100058	ENSG00000100058			2399	pseudogene	pseudogene				CRYB2B			Standard	NR_033733		Approved		uc003abu.4		OTTHUMG00000150874		22.37:g.25853368T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000609084.1	37	NULL		22																																																																																			CRYBB2P1	-	-	ENSG00000100058		0.557	CRYBB2P1-006	KNOWN	basic	processed_transcript	CRYBB2P1	HGNC	pseudogene	OTTHUMT00000472347.1	88	0.00	0	T			25853368	25853368	+1	no_errors	ENST00000354451	ensembl	human	known	69_37n	rna	39	13.33	6	SNP	1.000	C
CSRP2	1466	genome.wustl.edu	37	12	77253422	77253422	+	Splice_Site	SNP	T	T	C			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr12:77253422T>C	ENST00000311083.5	-	5	535		c.e5-2		CSRP2_ENST00000552330.1_Splice_Site|CSRP2_ENST00000546966.1_Splice_Site|CSRP2_ENST00000547435.1_Splice_Site	NM_001321.1	NP_001312.1	Q16527	CSRP2_HUMAN	cysteine and glycine-rich protein 2						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)	8						GTGCCAGGGCTGGAAGAGATG	0.413																																						dbGAP											0													63.0	55.0	58.0					12																	77253422		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC000992	CCDS9015.1	12q21.1	2005-10-30				ENSG00000175183			2470	protein-coding gene	gene with protein product		601871				7499425, 9286703	Standard	XM_006719258		Approved	SmLIM, CRP2, LMO5	uc001syl.1	Q16527		ENST00000311083.5:c.412-2A>G	12.37:g.77253422T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q93030	Splice_Site	SNP	-	e4-2	ENST00000311083.5	37	c.412-2	CCDS9015.1	12	.	.	.	.	.	.	.	.	.	.	T	16.16	3.045275	0.55110	.	.	ENSG00000175183	ENST00000311083;ENST00000552330;ENST00000546966;ENST00000547435	.	.	.	5.64	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.946	0.58373	0.0:0.0:0.1353:0.8647	.	.	.	.	.	-1	.	.	.	-	.	.	CSRP2	75777553	1.000000	0.71417	0.805000	0.32314	0.691000	0.40173	6.294000	0.72738	0.955000	0.37878	0.533000	0.62120	.	CSRP2	-	-	ENSG00000175183		0.413	CSRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRP2	HGNC	protein_coding	OTTHUMT00000406572.1	66	0.00	0	T	NM_001321	Intron	77253422	77253422	-1	no_errors	ENST00000311083	ensembl	human	known	69_37n	splice_site	35	18.60	8	SNP	0.998	C
DCDC1	341019	genome.wustl.edu	37	11	31263112	31263112	+	Missense_Mutation	SNP	A	A	G	rs2616812	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr11:31263112A>G	ENST00000597505.1	-	7	1105	c.1106T>C	c.(1105-1107)cTa>cCa	p.L369P				P59894	DCDC1_HUMAN	doublecortin domain containing 1	234					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GACCCAAAGTAGTCCTCGCAA	0.438													G|||	3827	0.764177	0.857	0.6945	5008	,	,		16091	0.9484		0.5736	False		,,,				2504	0.6943					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1106T>C	11.37:g.31263112A>G	ENSP00000472625:p.Leu369Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVL6|B7WNX6|Q6ZU04	RNA	SNP	-	NULL	ENST00000597505.1	37	NULL		11																																																																																			DCDC1	-	-	ENSG00000188682		0.438	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	37	0.00	0	A	NM_181807		31263112	31263112	-1	no_errors	ENST00000534722	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.998	G
FAM208B	54906	genome.wustl.edu	37	10	5754852	5754852	+	5'UTR	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr10:5754852G>T	ENST00000328090.5	+	0	405				RP11-336A10.2_ENST00000596567.1_RNA|FAM208B_ENST00000463468.1_3'UTR|RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B																		AGACACTTACGGGTTTCTTCT	0.328																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.-221G>T	10.37:g.5754852G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	RNA	SNP	-	NULL	ENST00000328090.5	37	NULL	CCDS41485.1	10																																																																																			FAM208B	-	-	ENSG00000108021		0.328	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	42	0.00	0	G	NM_017782		5754852	5754852	+1	no_errors	ENST00000463468	ensembl	human	known	69_37n	rna	42	14.00	7	SNP	0.993	T
FAM65A	79567	genome.wustl.edu	37	16	67579729	67579729	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr16:67579729G>A	ENST00000379312.3	+	19	3486	c.3365G>A	c.(3364-3366)cGg>cAg	p.R1122Q	FAM65A_ENST00000540839.3_Missense_Mutation_p.R1137Q|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000422602.2_Missense_Mutation_p.R1138Q|FAM65A_ENST00000042381.4_Missense_Mutation_p.R1118Q|FAM65A_ENST00000428437.2_Missense_Mutation_p.R1132Q	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	1122						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		ACCCAGCTCCGGAGCCTGTCA	0.672																																						dbGAP											0													46.0	53.0	50.0					16																	67579729		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.3365G>A	16.37:g.67579729G>A	ENSP00000368614:p.Arg1122Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.R1138Q	ENST00000379312.3	37	c.3413	CCDS54028.1	16	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951185	0.92660	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	T;T;T	0.76186	-1.0;-1.0;-1.0	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85279	0.5660	M	0.62723	1.935	0.42367	D	0.992433	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.84915	0.0850	10	0.49607	T	0.09	-20.0195	19.5799	0.95461	0.0:0.0:1.0:0.0	.	1132;1138;1122	B4DIM2;E9PBS3;Q6ZS17	.;.;FA65A_HUMAN	Q	1122;1118;1138;1132	ENSP00000368614:R1122Q;ENSP00000042381:R1118Q;ENSP00000400099:R1138Q	ENSP00000042381:R1118Q	R	+	2	0	FAM65A	66137230	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.208000	0.65203	2.642000	0.89623	0.655000	0.94253	CGG	FAM65A	-	superfamily_ARM-type_fold	ENSG00000039523		0.672	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3	57	0.00	0	G	NM_024519		67579729	67579729	+1	no_errors	ENST00000422602	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	A
GCDH	2639	genome.wustl.edu	37	19	13010643	13010643	+	3'UTR	SNP	G	G	T	rs9384	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr19:13010643G>T	ENST00000222214.5	+	0	1816				GCDH_ENST00000588242.2_3'UTR|GCDH_ENST00000457854.1_3'UTR|SYCE2_ENST00000293695.7_Intron|GCDH_ENST00000422947.2_3'UTR|GCDH_ENST00000591470.1_3'UTR			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase						cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	AGAGTGACATGGAAGCAACTC	0.527													T|||	1392	0.277955	0.261	0.4424	5008	,	,		14969	0.1518		0.3241	False		,,,				2504	0.2669				GBM(123;875 1636 7726 16444 26754)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.*288G>T	19.37:g.13010643G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Z2|O14719	RNA	SNP	-	NULL	ENST00000222214.5	37	NULL	CCDS12286.1	19																																																																																			GCDH	-	-	ENSG00000105607		0.527	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCDH	HGNC	protein_coding	OTTHUMT00000451897.1	38	0.00	0	G			13010643	13010643	+1	no_errors	ENST00000588242	ensembl	human	known	69_37n	rna	16	15.79	3	SNP	0.000	T
GTPBP2	54676	genome.wustl.edu	37	6	43593284	43593284	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr6:43593284C>A	ENST00000307126.5	-	5	520	c.521G>T	c.(520-522)cGt>cTt	p.R174L	GTPBP2_ENST00000476510.1_5'UTR|GTPBP2_ENST00000307114.7_Missense_Mutation_p.R86L	NM_019096.3	NP_061969.3			GTP binding protein 2											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GACGGCCACACGGAGGTCTAG	0.582																																					GBM(116;405 1620 28302 32150 44768)	dbGAP											0													46.0	47.0	46.0					6																	43593284		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.521G>T	6.37:g.43593284C>A	ENSP00000303997:p.Arg174Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel	p.R174L	ENST00000307126.5	37	c.521	CCDS4903.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.2|27.2	4.809006|4.809006	0.90707|0.90707	.|.	.|.	ENSG00000172432|ENSG00000172432	ENST00000307126;ENST00000307114;ENST00000452781|ENST00000442748	T;T;T|.	0.70516|.	-0.49;-0.49;0.48|.	4.65|4.65	4.65|4.65	0.58169|0.58169	Protein synthesis factor, GTP-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69070|0.69070	0.3070|0.3070	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.996;0.997|.	P;D|.	0.64042|.	0.899;0.921|.	T|T	0.69491|0.69491	-0.5131|-0.5131	10|5	0.87932|.	D|.	0|.	-6.8149|-6.8149	17.7131|17.7131	0.88327|0.88327	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	166;174|.	Q9BX10-4;Q9BX10|.	.;GTPB2_HUMAN|.	L|L	174;86;166|140	ENSP00000303997:R174L;ENSP00000304893:R86L;ENSP00000410676:R166L|.	ENSP00000304893:R86L|.	R|V	-|-	2|1	0|0	GTPBP2|GTPBP2	43701262|43701262	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.651000|7.651000	0.83577|0.83577	2.410000|2.410000	0.81850|0.81850	0.462000|0.462000	0.41574|0.41574	CGT|GTG	GTPBP2	-	pfam_ProtSyn_GTP-bd	ENSG00000172432		0.582	GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP2	HGNC	protein_coding	OTTHUMT00000040679.1	62	0.00	0	C			43593284	43593284	-1	no_errors	ENST00000307126	ensembl	human	known	69_37n	missense	29	11.76	4	SNP	1.000	A
GJE1	100126572	genome.wustl.edu	37	6	142455130	142455130	+	Silent	SNP	C	C	T	rs225607	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr6:142455130C>T	ENST00000450456.2	+	2	252	c.183C>T	c.(181-183)aaC>aaT	p.N61N				Q8NFK1	CXG3_HUMAN	gap junction protein, epsilon 1, 23kDa	61					cell communication (GO:0007154)|myelination (GO:0042552)|sensory perception of sound (GO:0007605)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)											GAGAAGTAAACCTCTTCTGTT	0.398													T|||	1696	0.338658	0.3253	0.268	5008	,	,		16989	0.1815		0.4324	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					6q24.1	2013-01-16			ENSG00000203733	ENSG00000203733		"""Ion channels / Gap junction proteins (connexins)"""	33251	other	unknown						18849090	Standard	NG_033968		Approved	CX23		A6NN92	OTTHUMG00000015706	ENST00000450456.2:c.183C>T	6.37:g.142455130C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D296|Q86XI9	Silent	SNP	pfam_Connexin_CCC,pfam_Connexin_N	p.N61	ENST00000450456.2	37	c.183		6																																																																																			GJE1	-	pfam_Connexin_N	ENSG00000203733		0.398	GJE1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	GJE1	HGNC	protein_coding	OTTHUMT00000042482.2	121	0.00	0	C			142455130	142455130	+1	no_errors	ENST00000450456	ensembl	human	known	69_37n	silent	53	13.11	8	SNP	0.987	T
HAL	3034	genome.wustl.edu	37	12	96389632	96389632	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr12:96389632G>T	ENST00000261208.3	-	2	425	c.57C>A	c.(55-57)gaC>gaA	p.D19E	HAL_ENST00000541929.1_5'UTR|RP11-256L6.3_ENST00000551849.1_RNA|HAL_ENST00000538703.1_Missense_Mutation_p.D19E	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	19					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	TGAGCTGCGCGTCCTGGCAGG	0.642																																					NSCLC(169;943 2815 23563 30031)	dbGAP											0													34.0	29.0	31.0					12																	96389632		2202	4296	6498	-	-	-	SO:0001583	missense	0				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.57C>A	12.37:g.96389632G>T	ENSP00000261208:p.Asp19Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Missense_Mutation	SNP	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	p.D19E	ENST00000261208.3	37	c.57	CCDS9058.1	12	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894634	0.33442	.	.	ENSG00000084110	ENST00000261208;ENST00000538703;ENST00000552509	T;T;D	0.87491	-1.24;-1.22;-2.26	5.2	-4.0	0.04057	.	0.086699	0.85682	D	0.000000	T	0.74831	0.3768	L	0.31294	0.92	0.53005	D	0.999962	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.52786	-0.8529	10	0.51188	T	0.08	-28.2779	8.9214	0.35615	0.5157:0.0997:0.3846:0.0	.	19;19	F5GXF2;P42357	.;HUTH_HUMAN	E	19	ENSP00000261208:D19E;ENSP00000440861:D19E;ENSP00000450372:D19E	ENSP00000261208:D19E	D	-	3	2	HAL	94913763	0.000000	0.05858	0.652000	0.29579	0.648000	0.38561	-0.693000	0.05121	-0.572000	0.06006	-0.440000	0.05779	GAC	HAL	-	NULL	ENSG00000084110		0.642	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	HGNC	protein_coding	OTTHUMT00000408644.1	55	0.00	0	G			96389632	96389632	-1	no_errors	ENST00000261208	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.003	T
ITGA9	3680	genome.wustl.edu	37	3	37544783	37544783	+	Frame_Shift_Del	DEL	C	C	-	rs368067046		TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr3:37544783delC	ENST00000264741.5	+	6	983	c.727delC	c.(727-729)cggfs	p.R243fs	ITGA9_ENST00000422441.1_Frame_Shift_Del_p.R243fs	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	243					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		CATGAACAGGCGGTACACCTA	0.463																																						dbGAP											0													93.0	82.0	86.0					3																	37544783		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.727delC	3.37:g.37544783delC	ENSP00000264741:p.Arg243fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14638	Frame_Shift_Del	DEL	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.R243fs	ENST00000264741.5	37	c.727	CCDS2669.1	3																																																																																			ITGA9	-	smart_Int_alpha_beta-p	ENSG00000144668		0.463	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA9	HGNC	protein_coding	OTTHUMT00000253361.1	35	0.00	0	C	NM_002207		37544783	37544783	+1	no_errors	ENST00000264741	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	1.000	-
MAP2	4133	genome.wustl.edu	37	2	210570443	210570443	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr2:210570443G>A	ENST00000360351.4	+	11	5230	c.4724G>A	c.(4723-4725)cGg>cAg	p.R1575Q	MAP2_ENST00000392194.1_Missense_Mutation_p.R219Q|MAP2_ENST00000199940.6_Missense_Mutation_p.R276Q|MAP2_ENST00000447185.1_Missense_Mutation_p.R1571Q|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000361559.4_Missense_Mutation_p.R219Q	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1575					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCAGCACGGCGGACCACCAGT	0.383																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													135.0	138.0	137.0					2																	210570443		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4724G>A	2.37:g.210570443G>A	ENSP00000353508:p.Arg1575Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.R1575Q	ENST00000360351.4	37	c.4724	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.219252	0.95139	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	T;T;T;T;T	0.28454	1.61;2.96;2.18;2.18;2.96	5.44	5.44	0.79542	.	0.000000	0.48767	D	0.000167	T	0.45637	0.1352	L	0.34521	1.04	0.54753	D	0.999988	D;D;D;D;D	0.89917	1.0;0.998;0.998;1.0;0.998	D;D;D;D;D	0.85130	0.997;0.986;0.945;0.995;0.99	T	0.14755	-1.0461	10	0.22109	T	0.4	-8.7394	19.2527	0.93932	0.0:0.0:1.0:0.0	.	1571;219;220;1575;276	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	Q	276;1575;219;219;1571	ENSP00000199940:R276Q;ENSP00000353508:R1575Q;ENSP00000355290:R219Q;ENSP00000376032:R219Q;ENSP00000392164:R1571Q	ENSP00000199940:R276Q	R	+	2	0	MAP2	210278688	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	8.518000	0.90559	2.552000	0.86080	0.591000	0.81541	CGG	MAP2	-	NULL	ENSG00000078018		0.383	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	49	0.00	0	G	NM_001039538		210570443	210570443	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	A
NCOA2	10499	genome.wustl.edu	37	8	71087081	71087081	+	Silent	SNP	A	A	C			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr8:71087081A>C	ENST00000452400.2	-	5	454	c.273T>G	c.(271-273)gcT>gcG	p.A91A		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	91					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CTATGTTGGCAGCTGCTGCTT	0.428			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																	dbGAP		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													157.0	151.0	153.0					8																	71087081		1978	4174	6152	-	-	-	SO:0001819	synonymous_variant	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.273T>G	8.37:g.71087081A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CD2	Silent	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.A91	ENST00000452400.2	37	c.273	CCDS47872.1	8																																																																																			NCOA2	-	superfamily_HLH_DNA-bd,pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.428	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	75	0.00	0	A			71087081	71087081	-1	no_errors	ENST00000452400	ensembl	human	known	69_37n	silent	43	20.37	11	SNP	0.992	C
NCOR1	9611	genome.wustl.edu	37	17	16075275	16075275	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr17:16075275G>A	ENST00000268712.3	-	4	534	c.277C>T	c.(277-279)Cat>Tat	p.H93Y	NCOR1_ENST00000395851.1_Missense_Mutation_p.H93Y|NCOR1_ENST00000395848.1_Intron	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	93	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGGCCTGGATGAAACGGTTCA	0.433																																						dbGAP											0													103.0	87.0	92.0					17																	16075275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.277C>T	17.37:g.16075275G>A	ENSP00000268712:p.His93Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.H93Y	ENST00000268712.3	37	c.277	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012746	0.54468	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000458113;ENST00000411510;ENST00000436828;ENST00000430577	T;T	0.43294	0.95;1.55	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.48677	0.1513	L	0.27053	0.805	0.80722	D	1	B;D;D;D;B;P	0.69078	0.001;0.959;0.997;0.959;0.15;0.857	B;P;D;P;B;P	0.77557	0.001;0.625;0.99;0.625;0.031;0.623	T	0.22034	-1.0228	10	0.02654	T	1	-10.445	19.0666	0.93114	0.0:0.0:1.0:0.0	.	93;93;93;93;93;93	E7EU93;E7EV02;Q3B773;E7EW50;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	Y	93	ENSP00000268712:H93Y;ENSP00000379192:H93Y	ENSP00000268712:H93Y	H	-	1	0	NCOR1	16016000	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.135000	0.71696	2.736000	0.93811	0.655000	0.94253	CAT	NCOR1	-	NULL	ENSG00000141027		0.433	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	89	0.00	0	G	NM_006311		16075275	16075275	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	A
RASGRP3	25780	genome.wustl.edu	37	2	33752360	33752360	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr2:33752360G>A	ENST00000403687.3	+	10	1704	c.964G>A	c.(964-966)Gag>Aag	p.E322K	RASGRP3_ENST00000402538.3_Missense_Mutation_p.E322K|RASGRP3_ENST00000407811.1_Missense_Mutation_p.E322K	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	322	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					CTGGACAGAGGAGAACAAAGT	0.483																																						dbGAP											0													100.0	96.0	97.0					2																	33752360		1943	4139	6082	-	-	-	SO:0001583	missense	0			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.964G>A	2.37:g.33752360G>A	ENSP00000384192:p.Glu322Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W583|O94931|Q53SD7	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.E322K	ENST00000403687.3	37	c.964	CCDS46256.1	2	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372033	0.61624	.	.	ENSG00000152689	ENST00000402538;ENST00000403687;ENST00000407811	T;T;T	0.29397	1.57;1.57;1.57	5.74	5.74	0.90152	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.194137	0.45606	D	0.000359	T	0.25121	0.0610	N	0.20357	0.565	0.58432	D	0.999992	B;B	0.10296	0.003;0.003	B;B	0.12156	0.007;0.007	T	0.02829	-1.1105	10	0.34782	T	0.22	-12.4549	19.9403	0.97159	0.0:0.0:1.0:0.0	.	322;322	D6W583;Q8IV61	.;GRP3_HUMAN	K	322	ENSP00000385886:E322K;ENSP00000384192:E322K;ENSP00000383917:E322K	ENSP00000385886:E322K	E	+	1	0	RASGRP3	33605864	1.000000	0.71417	0.999000	0.59377	0.805000	0.45488	9.869000	0.99810	2.712000	0.92718	0.650000	0.86243	GAG	RASGRP3	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000152689		0.483	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	RASGRP3	HGNC	protein_coding	OTTHUMT00000325462.2	61	0.00	0	G	NM_015376		33752360	33752360	+1	no_errors	ENST00000402538	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	A
RCN3	57333	genome.wustl.edu	37	19	50045943	50045943	+	Silent	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr19:50045943G>T	ENST00000270645.3	+	6	1260	c.813G>T	c.(811-813)ctG>ctT	p.L271L		NM_020650.2	NP_065701.2	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	271	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		ACTGGGTGCTGCCCCCTGCCC	0.677																																						dbGAP											0													30.0	29.0	30.0					19																	50045943		2198	4296	6494	-	-	-	SO:0001819	synonymous_variant	0			AY195859	CCDS12771.1	19q13.33	2013-01-10				ENSG00000142552		"""EF-hand domain containing"""	21145	protein-coding gene	gene with protein product							Standard	NM_020650		Approved	RLP49	uc002poj.3	Q96D15		ENST00000270645.3:c.813G>T	19.37:g.50045943G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HBZ8	Silent	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.L271	ENST00000270645.3	37	c.813	CCDS12771.1	19																																																																																			RCN3	-	NULL	ENSG00000142552		0.677	RCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN3	HGNC	protein_coding	OTTHUMT00000465261.1	60	0.00	0	G	NM_020650		50045943	50045943	+1	no_errors	ENST00000270645	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	1.000	T
CSF2RA	1438	genome.wustl.edu	37	X	1419249	1419249	+	Intron	SNP	A	A	G			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chrX:1419249A>G	ENST00000381524.3	+	10	996				RNA5SP498_ENST00000411342.1_RNA|CSF2RA_ENST00000355805.2_Intron|CSF2RA_ENST00000501036.2_Intron|CSF2RA_ENST00000355432.3_Intron|CSF2RA_ENST00000381500.1_Intron|CSF2RA_ENST00000381509.3_Intron|CSF2RA_ENST00000498153.1_Intron|CSF2RA_ENST00000417535.2_Intron|CSF2RA_ENST00000432318.2_Intron|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000361536.3_Intron|CSF2RA_ENST00000381529.3_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)						response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	aagtgcattcagagtggtaGa	0.388													a|||	1763	0.352037	0.5098	0.3674	5008	,	,		14469	0.3819		0.2316	False		,,,				2504	0.2209				Esophageal Squamous(131;723 1707 25334 40494 41806)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.811-135A>G	X.37:g.1419249A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	RNA	SNP	-	NULL	ENST00000381524.3	37	NULL	CCDS35191.1	X																																																																																			RNA5SP498	-	-	ENSG00000223274		0.388	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNA5SP498	HGNC	protein_coding	OTTHUMT00000035013.2	29	0.00	0	A			1419249	1419249	-1	no_errors	ENST00000411342	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.236	G
SELP	6403	genome.wustl.edu	37	1	169578896	169578896	+	Silent	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr1:169578896G>A	ENST00000263686.6	-	8	1216	c.1179C>T	c.(1177-1179)gtC>gtT	p.V393V	SELP_ENST00000367792.2_Silent_p.V331V|SELP_ENST00000458599.2_Silent_p.V331V|SELP_ENST00000367788.2_Silent_p.V331V|SELP_ENST00000367791.2_Intron|SELP_ENST00000367793.2_Silent_p.V331V|SELP_ENST00000367794.2_Silent_p.V331V|SELP_ENST00000367786.2_Silent_p.V331V	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	393	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TGCTTCCGTGGACAGGACTCT	0.493																																						dbGAP											0													85.0	73.0	77.0					1																	169578896		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1179C>T	1.37:g.169578896G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R344|Q8IVD1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.P331S	ENST00000263686.6	37	c.991	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918386	0.33908	.	.	ENSG00000174175	ENST00000446728	.	.	.	5.74	-2.5	0.06384	.	.	.	.	.	T	0.06005	0.0156	.	.	.	0.23101	N	0.998292	.	.	.	.	.	.	T	0.35847	-0.9772	4	.	.	.	-7.0E-4	0.6905	0.00890	0.2929:0.1191:0.3437:0.2443	.	.	.	.	S	331	.	.	P	-	1	0	SELP	167845520	0.000000	0.05858	0.000000	0.03702	0.857000	0.48899	-0.266000	0.08631	-0.822000	0.04306	0.650000	0.86243	CCA	SELP	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000174175		0.493	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4	67	0.00	0	G	NM_003005		169578896	169578896	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000446728	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.007	A
SEMA6A	57556	genome.wustl.edu	37	5	115818155	115818156	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr5:115818155_115818156insG	ENST00000343348.6	-	11	1865_1866	c.1078_1079insC	c.(1078-1080)cgafs	p.R360fs	CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000257414.8_Frame_Shift_Ins_p.R360fs|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000510263.1_Frame_Shift_Ins_p.R360fs	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	360	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CTTAGGAACTCGTTCATCAGGA	0.426																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.1079dupC	5.37:g.115818156_115818156dupG	ENSP00000345512:p.Arg360fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2H9	Frame_Shift_Ins	INS	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.R360fs	ENST00000343348.6	37	c.1079_1078	CCDS47256.1	5																																																																																			SEMA6A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000092421		0.426	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	26	0.00	0	-	NM_020796		115818155	115818156	-1	no_errors	ENST00000257414	ensembl	human	known	69_37n	frame_shift_ins	16	15.79	3	INS	0.994:0.966	G
SLC24A4	123041	genome.wustl.edu	37	14	92959216	92959216	+	Intron	SNP	G	G	A	rs11623883	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr14:92959216G>A	ENST00000532405.1	+	17	1942				SLC24A4_ENST00000531433.1_Intron|SLC24A4_ENST00000351924.5_Intron|SLC24A4_ENST00000298877.1_Intron|SLC24A4_ENST00000393265.2_Intron			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4						amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		AGCCTTGATCGAGGGACAAGG	0.502													G|||	1927	0.384784	0.295	0.4467	5008	,	,		18629	0.3085		0.5278	False		,,,				2504	0.3937				NSCLC(10;315 435 10383 28450 38798)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1717-604G>A	14.37:g.92959216G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.R453Q	ENST00000532405.1	37	c.1358	CCDS9903.2	14	927	0.42445054945054944	168	0.34146341463414637	152	0.4198895027624309	204	0.35664335664335667	403	0.5316622691292876	G	6.308	0.424887	0.11987	.	.	ENSG00000140090	ENST00000525557	.	.	.	3.24	0.436	0.16549	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.45702	-0.9243	3	.	.	.	.	1.8379	0.03143	0.2052:0.4634:0.21:0.1215	rs11623883;rs60279133;rs11623883	.	.	.	Q	453	.	.	R	+	2	0	SLC24A4	92028969	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.094000	0.11094	0.088000	0.17205	-1.510000	0.00946	CGA	SLC24A4	-	NULL	ENSG00000140090		0.502	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	HGNC	protein_coding	OTTHUMT00000395240.1	53	0.00	0	G	NM_153646		92959216	92959216	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525557	ensembl	human	putative	69_37n	missense	33	13.16	5	SNP	0.000	A
SLC28A2	9153	genome.wustl.edu	37	15	45558340	45558340	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr15:45558340G>C	ENST00000347644.3	+	10	988	c.923G>C	c.(922-924)gGa>gCa	p.G308A	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	308					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)			NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	GCTGTGGCAGGAAACATCTTT	0.443																																					NSCLC(92;493 1501 26361 28917 47116)	dbGAP											0													126.0	110.0	115.0					15																	45558340		2198	4298	6496	-	-	-	SO:0001583	missense	0			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.923G>C	15.37:g.45558340G>C	ENSP00000315006:p.Gly308Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.G308A	ENST00000347644.3	37	c.923	CCDS10121.1	15	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808133	0.90707	.	.	ENSG00000137860	ENST00000347644	T	0.27256	1.68	5.93	5.93	0.95920	Nucleoside recognition (1);	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	N	0.21282	0.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08868	-1.0701	10	0.44086	T	0.13	-11.5282	17.8334	0.88689	0.0:0.0:1.0:0.0	.	308	O43868	S28A2_HUMAN	A	308	ENSP00000315006:G308A	ENSP00000315006:G308A	G	+	2	0	SLC28A2	43345632	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.463000	0.97652	2.812000	0.96745	0.555000	0.69702	GGA	SLC28A2	-	pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	ENSG00000137860		0.443	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A2	HGNC	protein_coding	OTTHUMT00000254219.2	72	0.00	0	G	NM_004212		45558340	45558340	+1	no_errors	ENST00000347644	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	C
SLC30A9	10463	genome.wustl.edu	37	4	42051496	42051496	+	Splice_Site	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr4:42051496G>T	ENST00000264451.7	+	9	1020	c.840G>T	c.(838-840)caG>caT	p.Q280H		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	280					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CTTGTAATCAGGTGAGGACTA	0.303																																						dbGAP											0													101.0	101.0	101.0					4																	42051496		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.840+1G>T	4.37:g.42051496G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.Q280H	ENST00000264451.7	37	c.840	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499978	0.85176	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.63096	-0.02	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.85004	0.5598	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88336	0.2971	10	0.87932	D	0	-7.505	14.6223	0.68594	0.0696:0.0:0.9304:0.0	.	280	Q6PML9	ZNT9_HUMAN	H	280;108	ENSP00000264451:Q280H	ENSP00000264451:Q280H	Q	+	3	2	SLC30A9	41746253	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.073000	0.76784	2.941000	0.99782	0.655000	0.94253	CAG	SLC30A9	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000014824		0.303	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	HGNC	protein_coding	OTTHUMT00000216842.3	51	0.00	0	G		Missense_Mutation	42051496	42051496	+1	no_errors	ENST00000264451	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
SORBS2	8470	genome.wustl.edu	37	4	186528172	186528172	+	Intron	SNP	G	G	A	rs13117637	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr4:186528172G>A	ENST00000284776.7	-	18	3594				SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000431808.1_Intron|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000418609.1_Intron|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000355634.5_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2						actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GGCTGCAGCCGAGGCCACACC	0.557													G|||	2610	0.521166	0.6089	0.5303	5008	,	,		18410	0.5813		0.4672	False		,,,				2504	0.3896				Esophageal Squamous(153;41 2433 9491 36028)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.3084+4761C>T	4.37:g.186528172G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	RNA	SNP	-	NULL	ENST00000284776.7	37	NULL	CCDS3845.1	4																																																																																			SORBS2	-	-	ENSG00000154556		0.557	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	37	0.00	0	G	NM_003603		186528172	186528172	-1	no_errors	ENST00000498125	ensembl	human	known	69_37n	rna	25	13.79	4	SNP	0.026	A
SPRY4	81848	genome.wustl.edu	37	5	141694224	141694224	+	Silent	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr5:141694224G>A	ENST00000434127.2	-	2	693	c.450C>T	c.(448-450)ccC>ccT	p.P150P	SPRY4_ENST00000344120.4_Silent_p.P173P|SPRY4_ENST00000503582.1_5'Flank	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	150					multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCCAGCTCGGGTGGGACCG	0.652									Testicular Cancer, Familial Clustering of																													dbGAP											0													48.0	53.0	52.0					5																	141694224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.450C>T	5.37:g.141694224G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVB2|A4FVB3|Q6QIX2|Q9C003	Silent	SNP	pfam_Sprouty	p.P173	ENST00000434127.2	37	c.519	CCDS47296.1	5																																																																																			SPRY4	-	NULL	ENSG00000187678		0.652	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY4	HGNC	protein_coding	OTTHUMT00000370652.1	53	0.00	0	G			141694224	141694224	-1	no_errors	ENST00000344120	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	0.003	A
TARSL2	123283	genome.wustl.edu	37	15	102241331	102241331	+	Silent	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr15:102241331G>A	ENST00000335968.3	-	10	1494	c.1278C>T	c.(1276-1278)ccC>ccT	p.P426P		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	426					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGGCTCCTCTGGGAAGGAAAA	0.308																																						dbGAP											0													47.0	50.0	49.0					15																	102241331		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1278C>T	15.37:g.102241331G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-synth_IIa	p.P426	ENST00000335968.3	37	c.1278	CCDS10394.1	15																																																																																			TARSL2	-	tigrfam_Thr-tRNA-synth_IIa	ENSG00000185418		0.308	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARSL2	HGNC	protein_coding	OTTHUMT00000313619.3	45	0.00	0	G	NM_152334		102241331	102241331	-1	no_errors	ENST00000335968	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	0.848	A
TMEM120B	144404	genome.wustl.edu	37	12	122199620	122199620	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr12:122199620G>T	ENST00000449592.2	+	6	628	c.527G>T	c.(526-528)aGc>aTc	p.S176I	TMEM120B_ENST00000540377.1_5'UTR	NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	176						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		ATTCGGGAGAGCATTCTCATC	0.582																																						dbGAP											0													108.0	103.0	104.0					12																	122199620		2041	4186	6227	-	-	-	SO:0001583	missense	0			BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.527G>T	12.37:g.122199620G>T	ENSP00000404991:p.Ser176Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK01|B3KX33	Missense_Mutation	SNP	pfam_TMPIT	p.S176I	ENST00000449592.2	37	c.527	CCDS41852.1	12	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889409	0.91889	.	.	ENSG00000188735	ENST00000449592;ENST00000541467	T;T	0.38560	1.13;1.13	5.62	5.62	0.85841	.	0.120203	0.85682	D	0.000000	T	0.72914	0.3520	M	0.92880	3.355	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	T	0.79794	-0.1653	10	0.87932	D	0	-13.8652	17.1968	0.86894	0.0:0.0:1.0:0.0	.	176	A0PK00	T120B_HUMAN	I	176;155	ENSP00000404991:S176I;ENSP00000442105:S155I	ENSP00000345152:S176I	S	+	2	0	TMEM120B	120684003	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.463000	0.97652	2.655000	0.90218	0.650000	0.86243	AGC	TMEM120B	-	pfam_TMPIT	ENSG00000188735		0.582	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM120B	HGNC	protein_coding	OTTHUMT00000402158.1	52	0.00	0	G	NM_001080825		122199620	122199620	+1	no_errors	ENST00000342607	ensembl	human	known	69_37n	missense	11	21.43	3	SNP	1.000	T
TPCN2	219931	genome.wustl.edu	37	11	68845965	68845965	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr11:68845965G>A	ENST00000294309.3	+	14	1347	c.1246G>A	c.(1246-1248)Gag>Aag	p.E416K	TPCN2_ENST00000542467.1_Missense_Mutation_p.E416K|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	416					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GCCGAGGCCCGAGTACCAGTC	0.587																																						dbGAP											0													95.0	77.0	83.0					11																	68845965		2200	4294	6494	-	-	-	SO:0001583	missense	0			AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.1246G>A	11.37:g.68845965G>A	ENSP00000294309:p.Glu416Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NT82	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.E416K	ENST00000294309.3	37	c.1246	CCDS8189.1	11	.	.	.	.	.	.	.	.	.	.	G	7.296	0.612094	0.14066	.	.	ENSG00000162341	ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.97066	-4.22;-4.23	4.72	0.762	0.18454	.	1.300280	0.05280	N	0.519166	D	0.93884	0.8043	M	0.65975	2.015	0.21675	N	0.999595	P;P;P	0.43973	0.729;0.591;0.823	B;B;B	0.33890	0.083;0.037;0.172	D	0.85406	0.1134	10	0.39692	T	0.17	-1.7369	1.5726	0.02618	0.1643:0.1965:0.4166:0.2227	.	416;416;331	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	K	416;331;416	ENSP00000294309:E416K;ENSP00000445551:E416K	ENSP00000294309:E416K	E	+	1	0	TPCN2	68602541	1.000000	0.71417	0.191000	0.23289	0.282000	0.26991	1.052000	0.30429	-0.150000	0.11195	-0.244000	0.11960	GAG	TPCN2	-	NULL	ENSG00000162341		0.587	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	HGNC	protein_coding	OTTHUMT00000396878.2	106	0.00	0	G	NM_139075		68845965	68845965	+1	no_errors	ENST00000294309	ensembl	human	known	69_37n	missense	45	23.73	14	SNP	0.411	A
TRIM16L	147166	genome.wustl.edu	37	17	18602476	18602476	+	5'UTR	SNP	A	A	G	rs1969051	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr17:18602476A>G	ENST00000449552.2	+	0	1154				TRIM16L_ENST00000449697.3_3'UTR|TRIM16L_ENST00000395902.3_5'UTR|TRIM16L_ENST00000572555.1_5'UTR|TRIM16L_ENST00000571708.1_5'Flank			Q309B1	TR16L_HUMAN	tripartite motif containing 16-like							cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	9						GTTTTTGGCAAAATGCTGGCA	0.428													N|||	3298	0.658546	0.6959	0.7781	5008	,	,		20740	0.5427		0.8082	False		,,,				2504	0.4888					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			DQ232882	CCDS32588.1	17p11.2	2011-02-10	2011-01-25		ENSG00000108448	ENSG00000108448			32670	protein-coding gene	gene with protein product			"""tripartite motif-containing 16-like"""				Standard	XM_005256479		Approved	TRIM70	uc002gui.1	Q309B1	OTTHUMG00000059050	ENST00000449552.2:c.-331A>G	17.37:g.18602476A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK10|B2RUW6|B4DQK2|B4DWQ8	RNA	SNP	-	NULL	ENST00000449552.2	37	NULL	CCDS32588.1	17																																																																																			TRIM16L	-	-	ENSG00000108448		0.428	TRIM16L-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM16L	HGNC	protein_coding	OTTHUMT00000130670.3	39	0.00	0	A	NM_001037330		18602476	18602476	+1	no_errors	ENST00000449697	ensembl	human	known	69_37n	rna	32	13.51	5	SNP	0.726	G
TSPAN5	10098	genome.wustl.edu	37	4	99399888	99399888	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr4:99399888G>T	ENST00000305798.3	-	5	926	c.524C>A	c.(523-525)gCa>gAa	p.A175E	TSPAN5_ENST00000505184.1_Missense_Mutation_p.A104E|TSPAN5_ENST00000509168.1_5'UTR	NM_005723.3	NP_005714.2	P62079	TSN5_HUMAN	tetraspanin 5	175					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)			kidney(2)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		CTCTCGACTTGCATTGGAATC	0.463																																						dbGAP											0													122.0	109.0	113.0					4																	99399888		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3646.1	4q22.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000168785	ENSG00000168785		"""Tetraspanins"""	17753	protein-coding gene	gene with protein product		613136	"""transmembrane 4 superfamily member 9"""	TM4SF9			Standard	NM_005723		Approved	Tspan-5, NET-4	uc003hub.3	P62079	OTTHUMG00000131008	ENST00000305798.3:c.524C>A	4.37:g.99399888G>T	ENSP00000307701:p.Ala175Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDY2|O60628|O60746|Q6FHE5|Q9JLY1	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.A175E	ENST00000305798.3	37	c.524	CCDS3646.1	4	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146901	0.57151	.	.	ENSG00000168785	ENST00000305798;ENST00000505184;ENST00000515287	T;T;T	0.79247	-1.25;-1.25;3.7	5.13	5.13	0.70059	Tetraspanin, EC2 domain (1);	0.050885	0.85682	D	0.000000	T	0.66237	0.2769	L	0.27053	0.805	0.58432	D	0.999997	B	0.16802	0.019	B	0.25759	0.063	T	0.61869	-0.6974	10	0.02654	T	1	.	18.6095	0.91279	0.0:0.0:1.0:0.0	.	175	P62079	TSN5_HUMAN	E	175;104;104	ENSP00000307701:A175E;ENSP00000423916:A104E;ENSP00000423504:A104E	ENSP00000307701:A175E	A	-	2	0	TSPAN5	99618911	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.666000	0.98612	2.387000	0.81309	0.555000	0.69702	GCA	TSPAN5	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000168785		0.463	TSPAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN5	HGNC	protein_coding	OTTHUMT00000253641.2	56	0.00	0	G	NM_005723		99399888	99399888	-1	no_errors	ENST00000305798	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	T
ZFHX2	85446	genome.wustl.edu	37	14	23996935	23996935	+	Missense_Mutation	SNP	C	C	T	rs58400374	byFrequency	TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr14:23996935C>T	ENST00000419474.3	-	7	3368	c.3013G>A	c.(3013-3015)Gtg>Atg	p.V1005M	RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1005					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						TTGGGCTGCACTGCATGCTGG	0.597													C|||	232	0.0463259	0.1558	0.0187	5008	,	,		18793	0.0		0.0109	False		,,,				2504	0.002					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.3013G>A	14.37:g.23996935C>T	ENSP00000413418:p.Val1005Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UPU6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.V1005M	ENST00000419474.3	37	c.3013	CCDS55907.1	14	90	0.04120879120879121	81	0.16463414634146342	5	0.013812154696132596	0	0.0	4	0.005277044854881266	C	14.41	2.528066	0.44969	.	.	ENSG00000136367	ENST00000419474	T	0.81247	-1.47	4.79	4.79	0.61399	.	.	.	.	.	T	0.01124	0.0037	L	0.47716	1.5	0.38458	P	0.05284599999999995	.	.	.	.	.	.	T	0.41538	-0.9503	6	0.42905	T	0.14	.	11.9322	0.52853	0.174:0.8259:0.0:0.0	rs58400374	.	.	.	M	1005	ENSP00000413418:V1005M	ENSP00000413418:V1005M	V	-	1	0	ZFHX2	23066775	0.005000	0.15991	0.998000	0.56505	0.911000	0.54048	0.113000	0.15499	2.470000	0.83445	0.557000	0.71058	GTG	ZFHX2	-	NULL	ENSG00000136367		0.597	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	31	0.00	0	C	NM_014894		23996935	23996935	-1	no_errors	ENST00000419474	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	T
ZNF676	163223	genome.wustl.edu	37	19	22364026	22364026	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr19:22364026T>C	ENST00000397121.2	-	3	810	c.493A>G	c.(493-495)Aga>Gga	p.R165G		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GAATTCTCTCTAGTATAAATT	0.338																																						dbGAP											0													63.0	63.0	63.0					19																	22364026		1976	4194	6170	-	-	-	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.493A>G	19.37:g.22364026T>C	ENSP00000380310:p.Arg165Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R165G	ENST00000397121.2	37	c.493	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.318176	0.00235	.	.	ENSG00000196109	ENST00000397121	T	0.10288	2.89	1.03	-0.366	0.12545	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02807	0.0084	N	0.02181	-0.65	0.23657	N	0.997183	B	0.02656	0.0	B	0.01281	0.0	T	0.43130	-0.9410	9	0.02654	T	1	.	5.7604	0.18196	0.0:0.6043:0.0:0.3957	.	165	Q8N7Q3	ZN676_HUMAN	G	165	ENSP00000380310:R165G	ENSP00000380310:R165G	R	-	1	2	ZNF676	22155866	0.856000	0.29760	0.003000	0.11579	0.039000	0.13416	0.674000	0.25218	-0.745000	0.04772	-1.273000	0.01405	AGA	ZNF676	-	NULL	ENSG00000196109		0.338	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	82	0.00	0	T	NM_001001411		22364026	22364026	-1	no_errors	ENST00000397121	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	0.900	C
ZSWIM3	140831	genome.wustl.edu	37	20	44506742	44506742	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A426-01A-22D-A243-09	TCGA-A7-A426-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73635f25-2d34-4846-ae87-eae8daa6150b	d22300e2-883a-46e2-9b64-7c19d28483bd	g.chr20:44506742G>T	ENST00000255152.2	+	2	1754	c.1545G>T	c.(1543-1545)gaG>gaT	p.E515D	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.E509D	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	515							zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				ATGAGTGGGAGGTGGTACAGA	0.567																																						dbGAP											0													88.0	73.0	78.0					20																	44506742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1545G>T	20.37:g.44506742G>T	ENSP00000255152:p.Glu515Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BR13	Missense_Mutation	SNP	pfam_Znf_SWIM,pfam_MULE_transposase_dom,pfam_Transposase,smart_Znf_PMZ,pfscan_Znf_SWIM	p.E515D	ENST00000255152.2	37	c.1545	CCDS13381.1	20	.	.	.	.	.	.	.	.	.	.	G	12.31	1.898296	0.33535	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.25912	1.8;1.77	5.51	4.57	0.56435	.	0.266470	0.34652	N	0.003790	T	0.15522	0.0374	L	0.29908	0.895	0.29336	N	0.866364	B;B	0.24576	0.106;0.015	B;B	0.20767	0.031;0.021	T	0.15578	-1.0432	10	0.15952	T	0.53	-19.5683	7.6267	0.28216	0.1491:0.1383:0.7126:0.0	.	509;515	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	D	515;509	ENSP00000255152:E515D;ENSP00000406313:E509D	ENSP00000255152:E515D	E	+	3	2	ZSWIM3	43940149	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.678000	0.25277	1.575000	0.49775	0.561000	0.74099	GAG	ZSWIM3	-	NULL	ENSG00000132801		0.567	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM3	HGNC	protein_coding	OTTHUMT00000079540.1	41	0.00	0	G	NM_080752		44506742	44506742	+1	no_errors	ENST00000255152	ensembl	human	known	69_37n	missense	18	14.29	3	SNP	1.000	T
