#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADD2	119	genome.wustl.edu	37	2	70905837	70905837	+	Splice_Site	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:70905837G>A	ENST00000264436.4	-	11	1826	c.1382C>T	c.(1381-1383)aCg>aTg	p.T461M	ADD2_ENST00000407644.2_Splice_Site_p.T461M|ADD2_ENST00000413157.2_Splice_Site_p.T461M|ADD2_ENST00000430656.1_Splice_Site_p.T477M|ADD2_ENST00000355733.3_Splice_Site_p.T461M	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	461					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CCCCCTTACCGTGGTCTTGGG	0.602																																						dbGAP											0													151.0	165.0	160.0					2																	70905837		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1383+1C>T	2.37:g.70905837G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.T461M	ENST00000264436.4	37	c.1382	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972706	0.74246	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.37265	0.0997	L	0.38175	1.15	0.54753	D	0.999987	P;P;P;D	0.89917	0.949;0.868;0.897;1.0	B;B;B;D	0.91635	0.434;0.355;0.372;0.999	T	0.02813	-1.1107	10	0.48119	T	0.1	-14.7352	16.343	0.83101	0.0:0.0:1.0:0.0	.	477;461;461;461	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	M	461;461;461;461;461;477	ENSP00000264436:T461M;ENSP00000384677:T461M;ENSP00000347972:T461M;ENSP00000388072:T461M;ENSP00000398112:T477M	ENSP00000264436:T461M	T	-	2	0	ADD2	70759345	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	6.216000	0.72212	2.716000	0.92895	0.655000	0.94253	ACG	ADD2	-	NULL	ENSG00000075340		0.602	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	124	0.00	0	G	NM_001617	Missense_Mutation	70905837	70905837	-1	no_errors	ENST00000264436	ensembl	human	known	69_37n	missense	121	26.51	44	SNP	1.000	A
ADD2	119	genome.wustl.edu	37	2	70905837	70905837	+	Splice_Site	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:70905837G>A	ENST00000264436.4	-	11	1826	c.1382C>T	c.(1381-1383)aCg>aTg	p.T461M	ADD2_ENST00000407644.2_Splice_Site_p.T461M|ADD2_ENST00000413157.2_Splice_Site_p.T461M|ADD2_ENST00000430656.1_Splice_Site_p.T477M|ADD2_ENST00000355733.3_Splice_Site_p.T461M	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	461					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CCCCCTTACCGTGGTCTTGGG	0.602																																						dbGAP											0													151.0	165.0	160.0					2																	70905837		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1383+1C>T	2.37:g.70905837G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.T461M	ENST00000264436.4	37	c.1382	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972706	0.74246	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.37265	0.0997	L	0.38175	1.15	0.54753	D	0.999987	P;P;P;D	0.89917	0.949;0.868;0.897;1.0	B;B;B;D	0.91635	0.434;0.355;0.372;0.999	T	0.02813	-1.1107	10	0.48119	T	0.1	-14.7352	16.343	0.83101	0.0:0.0:1.0:0.0	.	477;461;461;461	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	M	461;461;461;461;461;477	ENSP00000264436:T461M;ENSP00000384677:T461M;ENSP00000347972:T461M;ENSP00000388072:T461M;ENSP00000398112:T477M	ENSP00000264436:T461M	T	-	2	0	ADD2	70759345	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	6.216000	0.72212	2.716000	0.92895	0.655000	0.94253	ACG	ADD2	-	NULL	ENSG00000075340		0.602	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	123	0.00	0	G	NM_001617	Missense_Mutation	70905837	70905837	-1	no_errors	ENST00000264436	ensembl	human	known	69_37n	missense	121	26.51	44	SNP	1.000	A
AKR1C1	1645	genome.wustl.edu	37	10	5010526	5010526	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr10:5010526A>T	ENST00000380872.4	+	4	587	c.395A>T	c.(394-396)gAt>gTt	p.D132V	AKR1C1_ENST00000434459.2_Missense_Mutation_p.D132V|AKR1C1_ENST00000380859.1_Missense_Mutation_p.D134V|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	132					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	ATCCCAAAAGATGAAAATGGA	0.428																																					Colon(130;2054 2316 13360 15380)	dbGAP											0													25.0	21.0	23.0					10																	5010526		2180	4247	6427	-	-	-	SO:0001583	missense	0			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.395A>T	10.37:g.5010526A>T	ENSP00000370254:p.Asp132Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.D132V	ENST00000380872.4	37	c.395	CCDS7061.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.77|14.77	2.633860|2.633860	0.47049|0.47049	.|.	.|.	ENSG00000187134|ENSG00000187134	ENST00000434459;ENST00000380872;ENST00000380859|ENST00000442997	T;T;T|.	0.53423|.	0.62;0.62;0.62|.	2.63|2.63	2.63|2.63	0.31362|0.31362	NADP-dependent oxidoreductase domain (3);|.	0.000000|.	0.64402|.	D|.	0.000008|.	T|T	0.55289|0.55289	0.1911|0.1911	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.58268|.	0.982|.	P|.	0.62813|.	0.907|.	T|T	0.50338|0.50338	-0.8840|-0.8840	10|5	0.87932|.	D|.	0|.	.|.	8.7325|8.7325	0.34507|0.34507	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	132|.	Q04828|.	AK1C1_HUMAN|.	V|L	132;132;134|99	ENSP00000412248:D132V;ENSP00000370254:D132V;ENSP00000370240:D134V|.	ENSP00000370240:D134V|.	D|M	+|+	2|1	0|0	AKR1C1|AKR1C1	5000526|5000526	1.000000|1.000000	0.71417|0.71417	0.080000|0.080000	0.20451|0.20451	0.057000|0.057000	0.15508|0.15508	4.068000|4.068000	0.57534|0.57534	1.209000|1.209000	0.43321|0.43321	0.254000|0.254000	0.18369|0.18369	GAT|ATG	AKR1C1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000187134		0.428	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C1	HGNC	protein_coding	OTTHUMT00000046523.2	30	0.00	0	A	NM_001353		5010526	5010526	+1	no_errors	ENST00000380872	ensembl	human	known	69_37n	missense	38	11.36	5	SNP	0.929	T
ALK	238	genome.wustl.edu	37	2	29462567	29462567	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:29462567C>G	ENST00000389048.3	-	13	3240	c.2334G>C	c.(2332-2334)caG>caC	p.Q778H	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	778					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CGTCCTCTCCCTGCTGCCCAA	0.602			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													90.0	79.0	83.0					2																	29462567		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2334G>C	2.37:g.29462567C>G	ENSP00000373700:p.Gln778His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q778H	ENST00000389048.3	37	c.2334	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606072	0.66445	.	.	ENSG00000171094	ENST00000389048	T	0.50001	0.76	5.16	1.2	0.21068	.	0.000000	0.45867	D	0.000326	T	0.65354	0.2683	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.63866	-0.6540	9	.	.	.	.	7.1389	0.25543	0.0:0.4359:0.0:0.5641	.	778	Q9UM73	ALK_HUMAN	H	778	ENSP00000373700:Q778H	.	Q	-	3	2	ALK	29316071	0.994000	0.37717	1.000000	0.80357	0.991000	0.79684	0.341000	0.19909	0.350000	0.24002	0.561000	0.74099	CAG	ALK	-	NULL	ENSG00000171094		0.602	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	69	0.00	0	C	NM_004304		29462567	29462567	-1	no_errors	ENST00000389048	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	1.000	G
ALK	238	genome.wustl.edu	37	2	29462567	29462567	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:29462567C>G	ENST00000389048.3	-	13	3240	c.2334G>C	c.(2332-2334)caG>caC	p.Q778H	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	778					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CGTCCTCTCCCTGCTGCCCAA	0.602			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													90.0	79.0	83.0					2																	29462567		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2334G>C	2.37:g.29462567C>G	ENSP00000373700:p.Gln778His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q778H	ENST00000389048.3	37	c.2334	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606072	0.66445	.	.	ENSG00000171094	ENST00000389048	T	0.50001	0.76	5.16	1.2	0.21068	.	0.000000	0.45867	D	0.000326	T	0.65354	0.2683	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.63866	-0.6540	9	.	.	.	.	7.1389	0.25543	0.0:0.4359:0.0:0.5641	.	778	Q9UM73	ALK_HUMAN	H	778	ENSP00000373700:Q778H	.	Q	-	3	2	ALK	29316071	0.994000	0.37717	1.000000	0.80357	0.991000	0.79684	0.341000	0.19909	0.350000	0.24002	0.561000	0.74099	CAG	ALK	-	NULL	ENSG00000171094		0.602	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	62	0.00	0	C	NM_004304		29462567	29462567	-1	no_errors	ENST00000389048	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	1.000	G
ARID4B	51742	genome.wustl.edu	37	1	235345440	235345440	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:235345440G>C	ENST00000264183.3	-	20	3291	c.2794C>G	c.(2794-2796)Cag>Gag	p.Q932E	ARID4B_ENST00000494543.1_5'Flank|ARID4B_ENST00000366603.2_Missense_Mutation_p.Q932E|ARID4B_ENST00000349213.3_Missense_Mutation_p.Q846E	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	932					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CACTGTCCCTGAATACTTGAC	0.458																																						dbGAP											0													68.0	73.0	71.0					1																	235345440		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2794C>G	1.37:g.235345440G>C	ENSP00000264183:p.Gln932Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Nonsense_Mutation	SNP	NULL	p.S245*	ENST00000264183.3	37	c.734	CCDS31061.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.01|14.01	2.407881|2.407881	0.42715|0.42715	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|T;T;T	.|0.26067	.|1.76;1.82;1.82	5.63|5.63	4.71|4.71	0.59529|0.59529	.|.	.|0.110784	.|0.64402	.|D	.|0.000005	T|T	0.34687|0.34687	0.0906|0.0906	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999993|0.999993	.|D;P;D;P	.|0.58268	.|0.982;0.917;0.979;0.865	.|D;P;P;P	.|0.70227	.|0.968;0.878;0.876;0.759	T|T	0.06917|0.06917	-1.0800|-1.0800	5|10	.|0.19590	.|T	.|0.45	-10.2656|-10.2656	15.8316|15.8316	0.78757|0.78757	0.0:0.0:0.8629:0.1371|0.0:0.0:0.8629:0.1371	.|.	.|613;932;846;932	.|Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39	.|.;.;.;ARI4B_HUMAN	L|E	331|932;846;932;932	.|ENSP00000264184:Q846E;ENSP00000355562:Q932E;ENSP00000264183:Q932E	.|ENSP00000264183:Q932E	F|Q	-|-	3|1	2|0	ARID4B|ARID4B	233412063|233412063	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	9.476000|9.476000	0.97823|0.97823	1.354000|1.354000	0.45846|0.45846	-0.302000|-0.302000	0.09304|0.09304	TTC|CAG	ARID4B	-	NULL	ENSG00000054267		0.458	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	45	0.00	0	G	NM_016374		235345440	235345440	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000474953	ensembl	human	known	69_37n	nonsense	120	10.45	14	SNP	1.000	C
ARID4B	51742	genome.wustl.edu	37	1	235345440	235345440	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:235345440G>C	ENST00000264183.3	-	20	3291	c.2794C>G	c.(2794-2796)Cag>Gag	p.Q932E	ARID4B_ENST00000494543.1_5'Flank|ARID4B_ENST00000366603.2_Missense_Mutation_p.Q932E|ARID4B_ENST00000349213.3_Missense_Mutation_p.Q846E	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	932					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CACTGTCCCTGAATACTTGAC	0.458																																						dbGAP											0													68.0	73.0	71.0					1																	235345440		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2794C>G	1.37:g.235345440G>C	ENSP00000264183:p.Gln932Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Nonsense_Mutation	SNP	NULL	p.S245*	ENST00000264183.3	37	c.734	CCDS31061.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.01|14.01	2.407881|2.407881	0.42715|0.42715	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|T;T;T	.|0.26067	.|1.76;1.82;1.82	5.63|5.63	4.71|4.71	0.59529|0.59529	.|.	.|0.110784	.|0.64402	.|D	.|0.000005	T|T	0.34687|0.34687	0.0906|0.0906	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999993|0.999993	.|D;P;D;P	.|0.58268	.|0.982;0.917;0.979;0.865	.|D;P;P;P	.|0.70227	.|0.968;0.878;0.876;0.759	T|T	0.06917|0.06917	-1.0800|-1.0800	5|10	.|0.19590	.|T	.|0.45	-10.2656|-10.2656	15.8316|15.8316	0.78757|0.78757	0.0:0.0:0.8629:0.1371|0.0:0.0:0.8629:0.1371	.|.	.|613;932;846;932	.|Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39	.|.;.;.;ARI4B_HUMAN	L|E	331|932;846;932;932	.|ENSP00000264184:Q846E;ENSP00000355562:Q932E;ENSP00000264183:Q932E	.|ENSP00000264183:Q932E	F|Q	-|-	3|1	2|0	ARID4B|ARID4B	233412063|233412063	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	9.476000|9.476000	0.97823|0.97823	1.354000|1.354000	0.45846|0.45846	-0.302000|-0.302000	0.09304|0.09304	TTC|CAG	ARID4B	-	NULL	ENSG00000054267		0.458	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	72	0.00	0	G	NM_016374		235345440	235345440	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000474953	ensembl	human	known	69_37n	nonsense	120	10.45	14	SNP	1.000	C
ARMC3	219681	genome.wustl.edu	37	10	23321928	23321928	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr10:23321928C>G	ENST00000298032.5	+	18	2469	c.2385C>G	c.(2383-2385)ttC>ttG	p.F795L	ARMC3_ENST00000409983.3_Missense_Mutation_p.F788L|ARMC3_ENST00000376528.4_Missense_Mutation_p.F532L	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	795						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAGGAATCTTCTACCATCGAG	0.368																																						dbGAP											0													123.0	116.0	118.0					10																	23321928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2385C>G	10.37:g.23321928C>G	ENSP00000298032:p.Phe795Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.F795L	ENST00000298032.5	37	c.2385	CCDS7142.1	10	.	.	.	.	.	.	.	.	.	.	C	16.80	3.221849	0.58560	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376528	T;T;T	0.38401	1.14;1.14;2.37	5.47	3.59	0.41128	.	0.308280	0.33670	N	0.004663	T	0.55577	0.1929	M	0.73598	2.24	0.45914	D	0.998758	D;D	0.71674	0.991;0.998	P;D	0.70227	0.883;0.968	T	0.56050	-0.8043	10	0.59425	D	0.04	-16.0662	9.7637	0.40548	0.0:0.7146:0.0:0.2854	.	788;795	Q5W041-4;Q5W041	.;ARMC3_HUMAN	L	795;788;532	ENSP00000298032:F795L;ENSP00000386943:F788L;ENSP00000365711:F532L	ENSP00000298032:F795L	F	+	3	2	ARMC3	23361934	1.000000	0.71417	0.993000	0.49108	0.705000	0.40729	1.038000	0.30254	0.759000	0.33084	0.555000	0.69702	TTC	ARMC3	-	NULL	ENSG00000165309		0.368	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	HGNC	protein_coding	OTTHUMT00000047197.2	70	0.00	0	C	NM_173081		23321928	23321928	+1	no_errors	ENST00000298032	ensembl	human	known	69_37n	missense	95	20.83	25	SNP	0.997	G
ARMC3	219681	genome.wustl.edu	37	10	23321928	23321928	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr10:23321928C>G	ENST00000298032.5	+	18	2469	c.2385C>G	c.(2383-2385)ttC>ttG	p.F795L	ARMC3_ENST00000409983.3_Missense_Mutation_p.F788L|ARMC3_ENST00000376528.4_Missense_Mutation_p.F532L	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	795						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAGGAATCTTCTACCATCGAG	0.368																																						dbGAP											0													123.0	116.0	118.0					10																	23321928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2385C>G	10.37:g.23321928C>G	ENSP00000298032:p.Phe795Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.F795L	ENST00000298032.5	37	c.2385	CCDS7142.1	10	.	.	.	.	.	.	.	.	.	.	C	16.80	3.221849	0.58560	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376528	T;T;T	0.38401	1.14;1.14;2.37	5.47	3.59	0.41128	.	0.308280	0.33670	N	0.004663	T	0.55577	0.1929	M	0.73598	2.24	0.45914	D	0.998758	D;D	0.71674	0.991;0.998	P;D	0.70227	0.883;0.968	T	0.56050	-0.8043	10	0.59425	D	0.04	-16.0662	9.7637	0.40548	0.0:0.7146:0.0:0.2854	.	788;795	Q5W041-4;Q5W041	.;ARMC3_HUMAN	L	795;788;532	ENSP00000298032:F795L;ENSP00000386943:F788L;ENSP00000365711:F532L	ENSP00000298032:F795L	F	+	3	2	ARMC3	23361934	1.000000	0.71417	0.993000	0.49108	0.705000	0.40729	1.038000	0.30254	0.759000	0.33084	0.555000	0.69702	TTC	ARMC3	-	NULL	ENSG00000165309		0.368	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	HGNC	protein_coding	OTTHUMT00000047197.2	96	0.00	0	C	NM_173081		23321928	23321928	+1	no_errors	ENST00000298032	ensembl	human	known	69_37n	missense	95	20.83	25	SNP	0.997	G
ATP2A1	487	genome.wustl.edu	37	16	28895954	28895954	+	Silent	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr16:28895954G>T	ENST00000357084.3	+	6	789	c.522G>T	c.(520-522)cgG>cgT	p.R174R	ATP2A1_ENST00000395503.4_Silent_p.R174R|ATP2A1_ENST00000536376.1_Silent_p.R49R	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	174					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CCACGCTGCGGGTTGACCAGT	0.592																																						dbGAP											0													54.0	47.0	50.0					16																	28895954		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.522G>T	16.37:g.28895954G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5J9|B3KY17|O14984	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.R174	ENST00000357084.3	37	c.522	CCDS10643.1	16																																																																																			ATP2A1	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000196296		0.592	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	58	0.00	0	G	NM_004320		28895954	28895954	+1	no_errors	ENST00000357084	ensembl	human	known	69_37n	silent	89	15.24	16	SNP	0.966	T
ATP2A1	487	genome.wustl.edu	37	16	28895954	28895954	+	Silent	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr16:28895954G>T	ENST00000357084.3	+	6	789	c.522G>T	c.(520-522)cgG>cgT	p.R174R	ATP2A1_ENST00000395503.4_Silent_p.R174R|ATP2A1_ENST00000536376.1_Silent_p.R49R	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	174					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CCACGCTGCGGGTTGACCAGT	0.592																																						dbGAP											0													54.0	47.0	50.0					16																	28895954		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.522G>T	16.37:g.28895954G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5J9|B3KY17|O14984	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.R174	ENST00000357084.3	37	c.522	CCDS10643.1	16																																																																																			ATP2A1	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000196296		0.592	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	57	0.00	0	G	NM_004320		28895954	28895954	+1	no_errors	ENST00000357084	ensembl	human	known	69_37n	silent	89	15.24	16	SNP	0.966	T
BCHE	590	genome.wustl.edu	37	3	165547581	165547581	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr3:165547581C>T	ENST00000264381.3	-	2	1407	c.1241G>A	c.(1240-1242)cGt>cAt	p.R414H	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	414			R -> C (in BChE deficiency). {ECO:0000269|PubMed:12881446, ECO:0000269|PubMed:15563885}.		cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.R414H(1)|p.R414P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CAAGGCCTCACGGTAGTTTTC	0.408																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|lung(1)											78.0	84.0	82.0					3																	165547581		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1241G>A	3.37:g.165547581C>T	ENSP00000264381:p.Arg414His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.R414H	ENST00000264381.3	37	c.1241	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092070	0.55968	.	.	ENSG00000114200	ENST00000264381	D	0.95724	-3.79	5.46	5.46	0.80206	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.98251	0.9421	M	0.92268	3.29	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	D	0.99250	1.0887	10	0.87932	D	0	.	18.2829	0.90104	0.0:1.0:0.0:0.0	.	414	P06276	CHLE_HUMAN	H	414	ENSP00000264381:R414H	ENSP00000264381:R414H	R	-	2	0	BCHE	167030275	1.000000	0.71417	0.996000	0.52242	0.291000	0.27294	7.222000	0.78025	2.570000	0.86706	0.591000	0.81541	CGT	BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.408	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	22	0.00	0	C			165547581	165547581	-1	no_errors	ENST00000264381	ensembl	human	known	69_37n	missense	55	19.12	13	SNP	1.000	T
BCHE	590	genome.wustl.edu	37	3	165547581	165547581	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr3:165547581C>T	ENST00000264381.3	-	2	1407	c.1241G>A	c.(1240-1242)cGt>cAt	p.R414H	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	414			R -> C (in BChE deficiency). {ECO:0000269|PubMed:12881446, ECO:0000269|PubMed:15563885}.		cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.R414H(1)|p.R414P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CAAGGCCTCACGGTAGTTTTC	0.408																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|lung(1)											78.0	84.0	82.0					3																	165547581		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1241G>A	3.37:g.165547581C>T	ENSP00000264381:p.Arg414His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.R414H	ENST00000264381.3	37	c.1241	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092070	0.55968	.	.	ENSG00000114200	ENST00000264381	D	0.95724	-3.79	5.46	5.46	0.80206	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.98251	0.9421	M	0.92268	3.29	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	D	0.99250	1.0887	10	0.87932	D	0	.	18.2829	0.90104	0.0:1.0:0.0:0.0	.	414	P06276	CHLE_HUMAN	H	414	ENSP00000264381:R414H	ENSP00000264381:R414H	R	-	2	0	BCHE	167030275	1.000000	0.71417	0.996000	0.52242	0.291000	0.27294	7.222000	0.78025	2.570000	0.86706	0.591000	0.81541	CGT	BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.408	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	47	0.00	0	C			165547581	165547581	-1	no_errors	ENST00000264381	ensembl	human	known	69_37n	missense	55	19.12	13	SNP	1.000	T
BAIAP2L1	55971	genome.wustl.edu	37	7	97921989	97921989	+	3'UTR	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:97921989G>C	ENST00000005260.8	-	0	2595				BRI3_ENST00000539286.1_Missense_Mutation_p.R95T	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TATCCTTTGAGAGTCTGTACC	0.527																																						dbGAP											0													128.0	117.0	121.0					7																	97921989		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.*844C>G	7.37:g.97921989G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Missense_Mutation	SNP	pfam_Brain_I3	p.R95T	ENST00000005260.8	37	c.284	CCDS34687.1	7	.	.	.	.	.	.	.	.	.	.	G	4.133	0.022981	0.08006	.	.	ENSG00000164713	ENST00000539286	.	.	.	2.75	-2.08	0.07254	.	.	.	.	.	T	0.26557	0.0649	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.25117	-1.0141	7	0.87932	D	0	.	3.7519	0.08570	0.5117:0.2053:0.283:0.0	.	95	F5GXW6	.	T	95	.	ENSP00000440936:R95T	R	+	2	0	BRI3	97759925	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.226000	0.02953	-0.535000	0.06307	0.655000	0.94253	AGA	BRI3	-	NULL	ENSG00000164713		0.527	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRI3	HGNC	protein_coding	OTTHUMT00000334681.1	53	0.00	0	G	NM_018842		97921989	97921989	+1	no_errors	ENST00000539286	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	0.000	C
BAIAP2L1	55971	genome.wustl.edu	37	7	97921989	97921989	+	3'UTR	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:97921989G>C	ENST00000005260.8	-	0	2595				BRI3_ENST00000539286.1_Missense_Mutation_p.R95T	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TATCCTTTGAGAGTCTGTACC	0.527																																						dbGAP											0													128.0	117.0	121.0					7																	97921989		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.*844C>G	7.37:g.97921989G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Missense_Mutation	SNP	pfam_Brain_I3	p.R95T	ENST00000005260.8	37	c.284	CCDS34687.1	7	.	.	.	.	.	.	.	.	.	.	G	4.133	0.022981	0.08006	.	.	ENSG00000164713	ENST00000539286	.	.	.	2.75	-2.08	0.07254	.	.	.	.	.	T	0.26557	0.0649	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.25117	-1.0141	7	0.87932	D	0	.	3.7519	0.08570	0.5117:0.2053:0.283:0.0	.	95	F5GXW6	.	T	95	.	ENSP00000440936:R95T	R	+	2	0	BRI3	97759925	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.226000	0.02953	-0.535000	0.06307	0.655000	0.94253	AGA	BRI3	-	NULL	ENSG00000164713		0.527	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRI3	HGNC	protein_coding	OTTHUMT00000334681.1	71	0.00	0	G	NM_018842		97921989	97921989	+1	no_errors	ENST00000539286	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	0.000	C
BRWD3	254065	genome.wustl.edu	37	X	79989644	79989644	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chrX:79989644C>G	ENST00000373275.4	-	11	1275	c.1059G>C	c.(1057-1059)gaG>gaC	p.E353D		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	353					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CAGCAATTTTCTCAGGAACCT	0.328																																						dbGAP											0													117.0	109.0	112.0					X																	79989644		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1059G>C	X.37:g.79989644C>G	ENSP00000362372:p.Glu353Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.E353D	ENST00000373275.4	37	c.1059	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721154	0.68959	.	.	ENSG00000165288	ENST00000373275	T	0.19532	2.14	5.34	2.43	0.29744	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.167651	0.53938	D	0.000058	T	0.18215	0.0437	L	0.31294	0.92	0.32643	N	0.520483	P	0.40282	0.711	P	0.45343	0.477	T	0.17048	-1.0382	9	.	.	.	-8.1349	9.787	0.40681	0.0:0.6778:0.0:0.3222	.	353	Q6RI45	BRWD3_HUMAN	D	353	ENSP00000362372:E353D	.	E	-	3	2	BRWD3	79876300	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.693000	0.37742	0.629000	0.30376	0.544000	0.68410	GAG	BRWD3	-	superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000165288		0.328	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	122	0.00	0	C	NM_153252		79989644	79989644	-1	no_errors	ENST00000373275	ensembl	human	known	69_37n	missense	101	22.31	29	SNP	1.000	G
BRWD3	254065	genome.wustl.edu	37	X	79989644	79989644	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chrX:79989644C>G	ENST00000373275.4	-	11	1275	c.1059G>C	c.(1057-1059)gaG>gaC	p.E353D		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	353					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CAGCAATTTTCTCAGGAACCT	0.328																																						dbGAP											0													117.0	109.0	112.0					X																	79989644		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1059G>C	X.37:g.79989644C>G	ENSP00000362372:p.Glu353Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.E353D	ENST00000373275.4	37	c.1059	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721154	0.68959	.	.	ENSG00000165288	ENST00000373275	T	0.19532	2.14	5.34	2.43	0.29744	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.167651	0.53938	D	0.000058	T	0.18215	0.0437	L	0.31294	0.92	0.32643	N	0.520483	P	0.40282	0.711	P	0.45343	0.477	T	0.17048	-1.0382	9	.	.	.	-8.1349	9.787	0.40681	0.0:0.6778:0.0:0.3222	.	353	Q6RI45	BRWD3_HUMAN	D	353	ENSP00000362372:E353D	.	E	-	3	2	BRWD3	79876300	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.693000	0.37742	0.629000	0.30376	0.544000	0.68410	GAG	BRWD3	-	superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000165288		0.328	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	146	0.00	0	C	NM_153252		79989644	79989644	-1	no_errors	ENST00000373275	ensembl	human	known	69_37n	missense	101	22.31	29	SNP	1.000	G
C22orf34	348645	genome.wustl.edu	37	22	50018069	50018069	+	Missense_Mutation	SNP	A	A	G	rs2011097	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr22:50018069A>G	ENST00000405854.1	-	4	1351	c.392T>C	c.(391-393)cTc>cCc	p.L131P	C22orf34_ENST00000444628.1_Missense_Mutation_p.L131P|C22orf34_ENST00000400023.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	131										pancreas(1)	1						TTGTGGGGAGAGCACAGTGAT	0.632													.|||	3234	0.645767	0.6899	0.8184	5008	,	,		18900	0.4464		0.7237	False		,,,				2504	0.589					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000405854.1:c.392T>C	22.37:g.50018069A>G	ENSP00000385457:p.Leu131Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q147Y0|Q5R3D1|Q6ZTN8	Missense_Mutation	SNP	NULL	p.L131P	ENST00000405854.1	37	c.392		22	1432	0.6556776556776557	324	0.6585365853658537	290	0.8011049723756906	272	0.4755244755244755	546	0.7203166226912929	G	0.042	-1.281859	0.01398	.	.	ENSG00000188511	ENST00000405854;ENST00000444628	.	.	.	0.473	-0.945	0.10388	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.40217	P	0.022307999999999995	.	.	.	.	.	.	T	0.41413	-0.9510	3	.	.	.	.	3.0132	0.06051	0.3995:0.2335:0.367:0.0	rs2011097;rs5770593	.	.	.	P	131	.	.	L	-	2	0	C22orf34	48404073	0.006000	0.16342	0.001000	0.08648	0.000000	0.00434	-3.295000	0.00523	-2.882000	0.00318	-3.178000	0.00056	CTC	C22orf34	-	NULL	ENSG00000188511		0.632	C22orf34-003	PUTATIVE	basic|appris_candidate	protein_coding	C22orf34	HGNC	protein_coding	OTTHUMT00000317432.1	69	0.00	0	A	NR_026997		50018069	50018069	-1	no_errors	ENST00000444628	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	0.457	G
C4orf26	152816	genome.wustl.edu	37	4	76481299	76481299	+	Missense_Mutation	SNP	C	C	G	rs370018477		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr4:76481299C>G	ENST00000311623.4	+	1	42	c.7C>G	c.(7-9)Cgc>Ggc	p.R3G	C4orf26_ENST00000514064.1_3'UTR|C4orf26_ENST00000435974.2_Missense_Mutation_p.R3G	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	3						extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AGCCATGGCTCGCAGACACTG	0.478																																						dbGAP											0													141.0	126.0	131.0					4																	76481299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.7C>G	4.37:g.76481299C>G	ENSP00000311307:p.Arg3Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	NULL	p.R3G	ENST00000311623.4	37	c.7	CCDS3569.1	4	.	.	.	.	.	.	.	.	.	.	C	4.621	0.115436	0.08831	.	.	ENSG00000174792	ENST00000311623;ENST00000435974	T;T	0.59502	1.61;0.26	4.87	-6.26	0.02033	.	3.266680	0.00919	N	0.002574	T	0.33177	0.0854	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.17868	-1.0355	10	0.21540	T	0.41	.	8.4398	0.32808	0.0:0.1991:0.5086:0.2923	.	3;3	E7ETQ0;Q17RF5	.;CD026_HUMAN	G	3	ENSP00000311307:R3G;ENSP00000406925:R3G	ENSP00000311307:R3G	R	+	1	0	C4orf26	76700323	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.693000	0.05121	-1.217000	0.02604	-1.297000	0.01338	CGC	C4orf26	-	NULL	ENSG00000174792		0.478	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf26	HGNC	protein_coding	OTTHUMT00000252410.1	104	0.00	0	C	NM_178497		76481299	76481299	+1	no_errors	ENST00000311623	ensembl	human	known	69_37n	missense	152	16.39	30	SNP	0.000	G
C4orf26	152816	genome.wustl.edu	37	4	76481299	76481299	+	Missense_Mutation	SNP	C	C	G	rs370018477		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr4:76481299C>G	ENST00000311623.4	+	1	42	c.7C>G	c.(7-9)Cgc>Ggc	p.R3G	C4orf26_ENST00000514064.1_3'UTR|C4orf26_ENST00000435974.2_Missense_Mutation_p.R3G	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	3						extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AGCCATGGCTCGCAGACACTG	0.478																																						dbGAP											0													141.0	126.0	131.0					4																	76481299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.7C>G	4.37:g.76481299C>G	ENSP00000311307:p.Arg3Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	NULL	p.R3G	ENST00000311623.4	37	c.7	CCDS3569.1	4	.	.	.	.	.	.	.	.	.	.	C	4.621	0.115436	0.08831	.	.	ENSG00000174792	ENST00000311623;ENST00000435974	T;T	0.59502	1.61;0.26	4.87	-6.26	0.02033	.	3.266680	0.00919	N	0.002574	T	0.33177	0.0854	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.17868	-1.0355	10	0.21540	T	0.41	.	8.4398	0.32808	0.0:0.1991:0.5086:0.2923	.	3;3	E7ETQ0;Q17RF5	.;CD026_HUMAN	G	3	ENSP00000311307:R3G;ENSP00000406925:R3G	ENSP00000311307:R3G	R	+	1	0	C4orf26	76700323	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.693000	0.05121	-1.217000	0.02604	-1.297000	0.01338	CGC	C4orf26	-	NULL	ENSG00000174792		0.478	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf26	HGNC	protein_coding	OTTHUMT00000252410.1	138	0.00	0	C	NM_178497		76481299	76481299	+1	no_errors	ENST00000311623	ensembl	human	known	69_37n	missense	152	16.39	30	SNP	0.000	G
C7orf57	136288	genome.wustl.edu	37	7	48094195	48094195	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:48094195C>A	ENST00000348904.3	+	8	1045	c.833C>A	c.(832-834)tCt>tAt	p.S278Y	C7orf57_ENST00000430738.1_Missense_Mutation_p.S323Y|C7orf57_ENST00000539619.1_Intron|C7orf57_ENST00000435376.1_Intron|C7orf57_ENST00000420324.1_Missense_Mutation_p.S307Y	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	278										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						ATTACAGAGTCTTCTCAAAGT	0.308																																						dbGAP											0													51.0	46.0	48.0					7																	48094195		1768	3962	5730	-	-	-	SO:0001583	missense	0			BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.833C>A	7.37:g.48094195C>A	ENSP00000335500:p.Ser278Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JBJ8	Missense_Mutation	SNP	NULL	p.S278Y	ENST00000348904.3	37	c.833	CCDS47583.1	7	.	.	.	.	.	.	.	.	.	.	C	6.047	0.376988	0.11466	.	.	ENSG00000164746	ENST00000420324;ENST00000430738;ENST00000348904	T;T;T	0.48201	0.82;0.82;0.87	2.17	2.17	0.27698	.	3.796950	0.00687	N	0.000719	T	0.52709	0.1751	L	0.44542	1.39	0.80722	D	1	P	0.48694	0.914	P	0.50708	0.648	T	0.54853	-0.8231	10	0.49607	T	0.09	4.9615	7.9621	0.30076	0.0:1.0:0.0:0.0	.	278	Q8NEG2	CG057_HUMAN	Y	307;323;278	ENSP00000394648:S307Y;ENSP00000410944:S323Y;ENSP00000335500:S278Y	ENSP00000335500:S278Y	S	+	2	0	C7orf57	48060720	0.397000	0.25270	0.989000	0.46669	0.327000	0.28475	2.069000	0.41481	1.517000	0.48917	0.549000	0.68633	TCT	C7orf57	-	NULL	ENSG00000164746		0.308	C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf57	HGNC	protein_coding	OTTHUMT00000341745.1	54	0.00	0	C	NM_001100159		48094195	48094195	+1	no_errors	ENST00000348904	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.994	A
C7orf57	136288	genome.wustl.edu	37	7	48094195	48094195	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:48094195C>A	ENST00000348904.3	+	8	1045	c.833C>A	c.(832-834)tCt>tAt	p.S278Y	C7orf57_ENST00000430738.1_Missense_Mutation_p.S323Y|C7orf57_ENST00000539619.1_Intron|C7orf57_ENST00000435376.1_Intron|C7orf57_ENST00000420324.1_Missense_Mutation_p.S307Y	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	278										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						ATTACAGAGTCTTCTCAAAGT	0.308																																						dbGAP											0													51.0	46.0	48.0					7																	48094195		1768	3962	5730	-	-	-	SO:0001583	missense	0			BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.833C>A	7.37:g.48094195C>A	ENSP00000335500:p.Ser278Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JBJ8	Missense_Mutation	SNP	NULL	p.S278Y	ENST00000348904.3	37	c.833	CCDS47583.1	7	.	.	.	.	.	.	.	.	.	.	C	6.047	0.376988	0.11466	.	.	ENSG00000164746	ENST00000420324;ENST00000430738;ENST00000348904	T;T;T	0.48201	0.82;0.82;0.87	2.17	2.17	0.27698	.	3.796950	0.00687	N	0.000719	T	0.52709	0.1751	L	0.44542	1.39	0.80722	D	1	P	0.48694	0.914	P	0.50708	0.648	T	0.54853	-0.8231	10	0.49607	T	0.09	4.9615	7.9621	0.30076	0.0:1.0:0.0:0.0	.	278	Q8NEG2	CG057_HUMAN	Y	307;323;278	ENSP00000394648:S307Y;ENSP00000410944:S323Y;ENSP00000335500:S278Y	ENSP00000335500:S278Y	S	+	2	0	C7orf57	48060720	0.397000	0.25270	0.989000	0.46669	0.327000	0.28475	2.069000	0.41481	1.517000	0.48917	0.549000	0.68633	TCT	C7orf57	-	NULL	ENSG00000164746		0.308	C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf57	HGNC	protein_coding	OTTHUMT00000341745.1	55	0.00	0	C	NM_001100159		48094195	48094195	+1	no_errors	ENST00000348904	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.994	A
C7orf33	202865	genome.wustl.edu	37	7	148311310	148311310	+	Silent	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:148311310C>A	ENST00000307003.2	+	2	742	c.381C>A	c.(379-381)ggC>ggA	p.G127G		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	127										central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAGTTGTCGGCACCTTGTCTT	0.522																																						dbGAP											0													140.0	108.0	119.0					7																	148311310		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.381C>A	7.37:g.148311310C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.G127	ENST00000307003.2	37	c.381	CCDS5890.1	7																																																																																			C7orf33	-	NULL	ENSG00000170279		0.522	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf33	HGNC	protein_coding	OTTHUMT00000327684.1	47	0.00	0	C	NM_145304		148311310	148311310	+1	no_errors	ENST00000307003	ensembl	human	known	69_37n	silent	95	10.38	11	SNP	0.001	A
C7orf33	202865	genome.wustl.edu	37	7	148311310	148311310	+	Silent	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:148311310C>A	ENST00000307003.2	+	2	742	c.381C>A	c.(379-381)ggC>ggA	p.G127G		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	127										central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAGTTGTCGGCACCTTGTCTT	0.522																																						dbGAP											0													140.0	108.0	119.0					7																	148311310		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.381C>A	7.37:g.148311310C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.G127	ENST00000307003.2	37	c.381	CCDS5890.1	7																																																																																			C7orf33	-	NULL	ENSG00000170279		0.522	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf33	HGNC	protein_coding	OTTHUMT00000327684.1	59	0.00	0	C	NM_145304		148311310	148311310	+1	no_errors	ENST00000307003	ensembl	human	known	69_37n	silent	95	10.38	11	SNP	0.001	A
CCDC158	339965	genome.wustl.edu	37	4	77317569	77317569	+	Silent	SNP	A	A	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr4:77317569A>T	ENST00000388914.3	-	3	293	c.141T>A	c.(139-141)acT>acA	p.T47T	CCDC158_ENST00000434846.2_Silent_p.T47T|CCDC158_ENST00000504868.1_5'UTR	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	47										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						CCTGTGTCAAAGTCCCAGCTG	0.338																																						dbGAP											0													76.0	74.0	75.0					4																	77317569		1816	4081	5897	-	-	-	SO:0001819	synonymous_variant	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.141T>A	4.37:g.77317569A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYQ1|Q8N7D4|Q8N7E3	Silent	SNP	superfamily_Prefoldin	p.T47	ENST00000388914.3	37	c.141	CCDS43242.1	4																																																																																			CCDC158	-	NULL	ENSG00000163749		0.338	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	HGNC	protein_coding	OTTHUMT00000362694.2	59	0.00	0	A	NM_001042784		77317569	77317569	-1	no_errors	ENST00000388914	ensembl	human	known	69_37n	silent	71	15.48	13	SNP	0.994	T
CCDC158	339965	genome.wustl.edu	37	4	77317569	77317569	+	Silent	SNP	A	A	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr4:77317569A>T	ENST00000388914.3	-	3	293	c.141T>A	c.(139-141)acT>acA	p.T47T	CCDC158_ENST00000434846.2_Silent_p.T47T|CCDC158_ENST00000504868.1_5'UTR	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	47										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						CCTGTGTCAAAGTCCCAGCTG	0.338																																						dbGAP											0													76.0	74.0	75.0					4																	77317569		1816	4081	5897	-	-	-	SO:0001819	synonymous_variant	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.141T>A	4.37:g.77317569A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYQ1|Q8N7D4|Q8N7E3	Silent	SNP	superfamily_Prefoldin	p.T47	ENST00000388914.3	37	c.141	CCDS43242.1	4																																																																																			CCDC158	-	NULL	ENSG00000163749		0.338	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	HGNC	protein_coding	OTTHUMT00000362694.2	60	0.00	0	A	NM_001042784		77317569	77317569	-1	no_errors	ENST00000388914	ensembl	human	known	69_37n	silent	71	15.48	13	SNP	0.994	T
CD244	51744	genome.wustl.edu	37	1	160808754	160808754	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:160808754C>G	ENST00000368033.3	-	4	838	c.756G>C	c.(754-756)agG>agC	p.R252S	CD244_ENST00000481677.1_5'UTR|CD244_ENST00000368032.2_Missense_Mutation_p.R247S|CD244_ENST00000322302.7_Missense_Mutation_p.R155S|CD244_ENST00000368034.4_Missense_Mutation_p.R247S			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	252					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TCCTCTTTCTCCTCCACACAC	0.522																																						dbGAP											0													159.0	110.0	127.0					1																	160808754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.756G>C	1.37:g.160808754C>G	ENSP00000357012:p.Arg252Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like	p.R252S	ENST00000368033.3	37	c.756	CCDS53399.1	1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.925286	0.34002	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000322302;ENST00000368032	T;T;T;T	0.48522	0.81;0.81;1.48;0.81	4.23	2.28	0.28536	.	0.931196	0.08924	N	0.874007	T	0.22936	0.0554	L	0.29908	0.895	0.24222	N	0.995435	P;P;P	0.49307	0.793;0.873;0.922	B;P;P	0.48840	0.422;0.467;0.592	T	0.09796	-1.0658	10	0.49607	T	0.09	-27.1758	4.9582	0.14052	0.2171:0.672:0.0:0.1109	.	155;252;247	Q9BZW8-4;Q9BZW8;Q9BZW8-2	.;CD244_HUMAN;.	S	247;252;155;247	ENSP00000357013:R247S;ENSP00000357012:R252S;ENSP00000313619:R155S;ENSP00000357011:R247S	ENSP00000313619:R155S	R	-	3	2	CD244	159075378	0.425000	0.25498	0.664000	0.29753	0.186000	0.23388	1.727000	0.38095	0.494000	0.27859	0.561000	0.74099	AGG	CD244	-	NULL	ENSG00000122223		0.522	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	60	0.00	0	C	NM_016382		160808754	160808754	-1	no_errors	ENST00000368033	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	0.757	G
CD244	51744	genome.wustl.edu	37	1	160808754	160808754	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:160808754C>G	ENST00000368033.3	-	4	838	c.756G>C	c.(754-756)agG>agC	p.R252S	CD244_ENST00000481677.1_5'UTR|CD244_ENST00000368032.2_Missense_Mutation_p.R247S|CD244_ENST00000322302.7_Missense_Mutation_p.R155S|CD244_ENST00000368034.4_Missense_Mutation_p.R247S			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	252					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TCCTCTTTCTCCTCCACACAC	0.522																																						dbGAP											0													159.0	110.0	127.0					1																	160808754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.756G>C	1.37:g.160808754C>G	ENSP00000357012:p.Arg252Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like	p.R252S	ENST00000368033.3	37	c.756	CCDS53399.1	1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.925286	0.34002	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000322302;ENST00000368032	T;T;T;T	0.48522	0.81;0.81;1.48;0.81	4.23	2.28	0.28536	.	0.931196	0.08924	N	0.874007	T	0.22936	0.0554	L	0.29908	0.895	0.24222	N	0.995435	P;P;P	0.49307	0.793;0.873;0.922	B;P;P	0.48840	0.422;0.467;0.592	T	0.09796	-1.0658	10	0.49607	T	0.09	-27.1758	4.9582	0.14052	0.2171:0.672:0.0:0.1109	.	155;252;247	Q9BZW8-4;Q9BZW8;Q9BZW8-2	.;CD244_HUMAN;.	S	247;252;155;247	ENSP00000357013:R247S;ENSP00000357012:R252S;ENSP00000313619:R155S;ENSP00000357011:R247S	ENSP00000313619:R155S	R	-	3	2	CD244	159075378	0.425000	0.25498	0.664000	0.29753	0.186000	0.23388	1.727000	0.38095	0.494000	0.27859	0.561000	0.74099	AGG	CD244	-	NULL	ENSG00000122223		0.522	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	65	0.00	0	C	NM_016382		160808754	160808754	-1	no_errors	ENST00000368033	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	0.757	G
CDK5RAP1	51654	genome.wustl.edu	37	20	31980029	31980029	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr20:31980029T>C	ENST00000357886.4	-	5	616	c.463A>G	c.(463-465)Atc>Gtc	p.I155V	CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.I155V|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.I155V|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.I65V|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.I155V|CDK5RAP1_ENST00000477105.1_5'UTR			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	155	CDK5 activation inhibition.|MTTase N-terminal.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						CGGTTCCAGATGGTCTGCTCA	0.473																																						dbGAP											0													75.0	76.0	76.0					20																	31980029		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.463A>G	20.37:g.31980029T>C	ENSP00000350558:p.Ile155Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	pfam_rSAM,pfam_Methylthiotransferase_N,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	p.I155V	ENST00000357886.4	37	c.463		20	.	.	.	.	.	.	.	.	.	.	T	14.36	2.512410	0.44660	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000375351;ENST00000544843	.	.	.	5.19	5.19	0.71726	Methylthiotransferase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.46464	0.1394	N	0.05487	-0.04	0.80722	D	1	P;D;B;B;B;B;B	0.62365	0.517;0.991;0.276;0.276;0.276;0.234;0.023	B;D;B;B;B;B;B	0.72625	0.371;0.978;0.13;0.13;0.315;0.08;0.048	T	0.43163	-0.9408	9	0.02654	T	1	-23.9248	13.0306	0.58840	0.0:0.0:0.0:1.0	.	155;155;155;155;155;155;65	Q675N4;Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2	.;.;CK5P1_HUMAN;.;.;.;.	V	155;155;155;65;45;155	.	ENSP00000341840:I155V	I	-	1	0	CDK5RAP1	31443690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.619000	0.67729	2.182000	0.69389	0.482000	0.46254	ATC	CDK5RAP1	-	pfam_Methylthiotransferase_N,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	ENSG00000101391		0.473	CDK5RAP1-011	KNOWN	basic	protein_coding	CDK5RAP1	HGNC	protein_coding	OTTHUMT00000078697.1	72	0.00	0	T	NM_016408		31980029	31980029	-1	no_errors	ENST00000357886	ensembl	human	known	69_37n	missense	133	16.35	26	SNP	1.000	C
CDK5RAP1	51654	genome.wustl.edu	37	20	31980029	31980029	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr20:31980029T>C	ENST00000357886.4	-	5	616	c.463A>G	c.(463-465)Atc>Gtc	p.I155V	CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.I155V|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.I155V|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.I65V|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.I155V|CDK5RAP1_ENST00000477105.1_5'UTR			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	155	CDK5 activation inhibition.|MTTase N-terminal.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						CGGTTCCAGATGGTCTGCTCA	0.473																																						dbGAP											0													75.0	76.0	76.0					20																	31980029		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.463A>G	20.37:g.31980029T>C	ENSP00000350558:p.Ile155Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	pfam_rSAM,pfam_Methylthiotransferase_N,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	p.I155V	ENST00000357886.4	37	c.463		20	.	.	.	.	.	.	.	.	.	.	T	14.36	2.512410	0.44660	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000375351;ENST00000544843	.	.	.	5.19	5.19	0.71726	Methylthiotransferase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.46464	0.1394	N	0.05487	-0.04	0.80722	D	1	P;D;B;B;B;B;B	0.62365	0.517;0.991;0.276;0.276;0.276;0.234;0.023	B;D;B;B;B;B;B	0.72625	0.371;0.978;0.13;0.13;0.315;0.08;0.048	T	0.43163	-0.9408	9	0.02654	T	1	-23.9248	13.0306	0.58840	0.0:0.0:0.0:1.0	.	155;155;155;155;155;155;65	Q675N4;Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2	.;.;CK5P1_HUMAN;.;.;.;.	V	155;155;155;65;45;155	.	ENSP00000341840:I155V	I	-	1	0	CDK5RAP1	31443690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.619000	0.67729	2.182000	0.69389	0.482000	0.46254	ATC	CDK5RAP1	-	pfam_Methylthiotransferase_N,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	ENSG00000101391		0.473	CDK5RAP1-011	KNOWN	basic	protein_coding	CDK5RAP1	HGNC	protein_coding	OTTHUMT00000078697.1	61	0.00	0	T	NM_016408		31980029	31980029	-1	no_errors	ENST00000357886	ensembl	human	known	69_37n	missense	133	16.35	26	SNP	1.000	C
CEP350	9857	genome.wustl.edu	37	1	180065244	180065244	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:180065244C>G	ENST00000367607.3	+	36	9409	c.8991C>G	c.(8989-8991)gtC>gtG	p.V2997V	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2997					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ATCAACCTGTCTGGATGAAGC	0.333																																						dbGAP											0													40.0	39.0	39.0					1																	180065244		2191	4287	6478	-	-	-	SO:0001819	synonymous_variant	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.8991C>G	1.37:g.180065244C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.L1172V	ENST00000367607.3	37	c.3514	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	6.791	0.514971	0.12944	.	.	ENSG00000135837	ENST00000429851	.	.	.	6.07	0.832	0.18867	.	.	.	.	.	T	0.51517	0.1679	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35251	-0.9796	4	.	.	.	.	5.6082	0.17391	0.0:0.3081:0.3952:0.2967	.	.	.	.	V	1172	.	.	L	+	1	2	CEP350	178331867	0.998000	0.40836	0.970000	0.41538	0.952000	0.60782	0.414000	0.21164	-0.078000	0.12730	-0.291000	0.09656	CTG	CEP350	-	NULL	ENSG00000135837		0.333	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	55	0.00	0	C	NM_014810		180065244	180065244	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429851	ensembl	human	novel	69_37n	missense	116	11.45	15	SNP	0.969	G
CEP350	9857	genome.wustl.edu	37	1	180065244	180065244	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:180065244C>G	ENST00000367607.3	+	36	9409	c.8991C>G	c.(8989-8991)gtC>gtG	p.V2997V	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2997					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ATCAACCTGTCTGGATGAAGC	0.333																																						dbGAP											0													40.0	39.0	39.0					1																	180065244		2191	4287	6478	-	-	-	SO:0001819	synonymous_variant	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.8991C>G	1.37:g.180065244C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.L1172V	ENST00000367607.3	37	c.3514	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	6.791	0.514971	0.12944	.	.	ENSG00000135837	ENST00000429851	.	.	.	6.07	0.832	0.18867	.	.	.	.	.	T	0.51517	0.1679	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35251	-0.9796	4	.	.	.	.	5.6082	0.17391	0.0:0.3081:0.3952:0.2967	.	.	.	.	V	1172	.	.	L	+	1	2	CEP350	178331867	0.998000	0.40836	0.970000	0.41538	0.952000	0.60782	0.414000	0.21164	-0.078000	0.12730	-0.291000	0.09656	CTG	CEP350	-	NULL	ENSG00000135837		0.333	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	64	0.00	0	C	NM_014810		180065244	180065244	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429851	ensembl	human	novel	69_37n	missense	116	11.45	15	SNP	0.969	G
CEP41	95681	genome.wustl.edu	37	7	130066545	130066545	+	Intron	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:130066545G>C	ENST00000223208.5	-	2	368				CEP41_ENST00000489512.1_Intron|CEP41_ENST00000495702.1_Intron|CEP41_ENST00000541543.1_Intron|CEP41_ENST00000343969.5_Intron	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa						cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)											TGAAAGAGCTGAGGGTTTTTG	0.443																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.97+1250C>G	7.37:g.130066545G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Silent	SNP	NULL	p.L51	ENST00000223208.5	37	c.153	CCDS5821.1	7																																																																																			CEP41	-	NULL	ENSG00000106477		0.443	CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP41	HGNC	protein_coding	OTTHUMT00000349702.2	28	0.00	0	G	NM_018718		130066545	130066545	-1	no_errors	ENST00000471201	ensembl	human	known	69_37n	silent	63	16.00	12	SNP	0.000	C
CEP41	95681	genome.wustl.edu	37	7	130066545	130066545	+	Intron	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:130066545G>C	ENST00000223208.5	-	2	368				CEP41_ENST00000489512.1_Intron|CEP41_ENST00000495702.1_Intron|CEP41_ENST00000541543.1_Intron|CEP41_ENST00000343969.5_Intron	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa						cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)											TGAAAGAGCTGAGGGTTTTTG	0.443																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.97+1250C>G	7.37:g.130066545G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Silent	SNP	NULL	p.L51	ENST00000223208.5	37	c.153	CCDS5821.1	7																																																																																			CEP41	-	NULL	ENSG00000106477		0.443	CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP41	HGNC	protein_coding	OTTHUMT00000349702.2	33	0.00	0	G	NM_018718		130066545	130066545	-1	no_errors	ENST00000471201	ensembl	human	known	69_37n	silent	63	16.00	12	SNP	0.000	C
COBLL1	22837	genome.wustl.edu	37	2	165550995	165550995	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:165550995C>G	ENST00000392717.2	-	13	3139	c.3135G>C	c.(3133-3135)aaG>aaC	p.K1045N	COBLL1_ENST00000194871.6_Missense_Mutation_p.K1074N|COBLL1_ENST00000342193.4_Missense_Mutation_p.K1007N|COBLL1_ENST00000375458.2_Missense_Mutation_p.K969N|COBLL1_ENST00000409184.3_Missense_Mutation_p.K1007N			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1045						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TTTTCAAAGTCTTCAGATTTT	0.478																																						dbGAP											0													109.0	107.0	108.0					2																	165550995		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3135G>C	2.37:g.165550995C>G	ENSP00000376478:p.Lys1045Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_domain,pfscan_WH2_dom	p.K1074N	ENST00000392717.2	37	c.3222		2	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171870	0.57584	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.75	3.73	0.42828	.	0.076327	0.56097	D	0.000032	T	0.54791	0.1880	M	0.62723	1.935	0.26362	N	0.977021	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.74348	0.961;0.972;0.983	T	0.43294	-0.9400	9	0.49607	T	0.09	-18.9972	6.5931	0.22658	0.0:0.6471:0.0:0.3528	.	1045;1074;1007	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	N	969;1007;1007;1045;1074	.	ENSP00000194871:K1074N	K	-	3	2	COBLL1	165259241	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	1.557000	0.36299	1.444000	0.47605	0.655000	0.94253	AAG	COBLL1	-	NULL	ENSG00000082438		0.478	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		26	0.00	0	C	NM_014900		165550995	165550995	-1	no_errors	ENST00000194871	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	1.000	G
COBLL1	22837	genome.wustl.edu	37	2	165550995	165550995	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:165550995C>G	ENST00000392717.2	-	13	3139	c.3135G>C	c.(3133-3135)aaG>aaC	p.K1045N	COBLL1_ENST00000194871.6_Missense_Mutation_p.K1074N|COBLL1_ENST00000342193.4_Missense_Mutation_p.K1007N|COBLL1_ENST00000375458.2_Missense_Mutation_p.K969N|COBLL1_ENST00000409184.3_Missense_Mutation_p.K1007N			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1045						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TTTTCAAAGTCTTCAGATTTT	0.478																																						dbGAP											0													109.0	107.0	108.0					2																	165550995		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3135G>C	2.37:g.165550995C>G	ENSP00000376478:p.Lys1045Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_domain,pfscan_WH2_dom	p.K1074N	ENST00000392717.2	37	c.3222		2	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171870	0.57584	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.75	3.73	0.42828	.	0.076327	0.56097	D	0.000032	T	0.54791	0.1880	M	0.62723	1.935	0.26362	N	0.977021	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.74348	0.961;0.972;0.983	T	0.43294	-0.9400	9	0.49607	T	0.09	-18.9972	6.5931	0.22658	0.0:0.6471:0.0:0.3528	.	1045;1074;1007	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	N	969;1007;1007;1045;1074	.	ENSP00000194871:K1074N	K	-	3	2	COBLL1	165259241	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	1.557000	0.36299	1.444000	0.47605	0.655000	0.94253	AAG	COBLL1	-	NULL	ENSG00000082438		0.478	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		46	0.00	0	C	NM_014900		165550995	165550995	-1	no_errors	ENST00000194871	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	1.000	G
DNASE2	1777	genome.wustl.edu	37	19	12987168	12987168	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr19:12987168G>C	ENST00000222219.3	-	6	811	c.719C>G	c.(718-720)tCc>tGc	p.S240C	DNASE2_ENST00000538460.1_Missense_Mutation_p.S185C	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	240					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						CAACCAGCCGGAGTACAGGTC	0.572																																						dbGAP											0													39.0	36.0	37.0					19																	12987168		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.719C>G	19.37:g.12987168G>C	ENSP00000222219:p.Ser240Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	pfam_DNase_II	p.S240C	ENST00000222219.3	37	c.719	CCDS12284.1	19	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788745	0.31685	.	.	ENSG00000105612	ENST00000222219;ENST00000538460	T;T	0.15603	2.41;2.41	4.74	4.74	0.60224	.	0.265223	0.38326	N	0.001731	T	0.46229	0.1382	M	0.87827	2.91	0.27166	N	0.96104	D;D	0.76494	0.999;0.986	D;P	0.68943	0.961;0.895	T	0.48068	-0.9067	10	0.62326	D	0.03	-16.1559	15.214	0.73250	0.0:0.0:1.0:0.0	.	185;240	B7Z4K6;O00115	.;DNS2A_HUMAN	C	240;185	ENSP00000222219:S240C;ENSP00000445988:S185C	ENSP00000222219:S240C	S	-	2	0	DNASE2	12848168	0.996000	0.38824	0.967000	0.41034	0.235000	0.25334	2.696000	0.47052	2.201000	0.70794	0.462000	0.41574	TCC	DNASE2	-	pfam_DNase_II	ENSG00000105612		0.572	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE2	HGNC	protein_coding	OTTHUMT00000451790.1	40	0.00	0	G			12987168	12987168	-1	no_errors	ENST00000222219	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	0.468	C
DNASE2	1777	genome.wustl.edu	37	19	12987168	12987168	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr19:12987168G>C	ENST00000222219.3	-	6	811	c.719C>G	c.(718-720)tCc>tGc	p.S240C	DNASE2_ENST00000538460.1_Missense_Mutation_p.S185C	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	240					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						CAACCAGCCGGAGTACAGGTC	0.572																																						dbGAP											0													39.0	36.0	37.0					19																	12987168		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.719C>G	19.37:g.12987168G>C	ENSP00000222219:p.Ser240Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	pfam_DNase_II	p.S240C	ENST00000222219.3	37	c.719	CCDS12284.1	19	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788745	0.31685	.	.	ENSG00000105612	ENST00000222219;ENST00000538460	T;T	0.15603	2.41;2.41	4.74	4.74	0.60224	.	0.265223	0.38326	N	0.001731	T	0.46229	0.1382	M	0.87827	2.91	0.27166	N	0.96104	D;D	0.76494	0.999;0.986	D;P	0.68943	0.961;0.895	T	0.48068	-0.9067	10	0.62326	D	0.03	-16.1559	15.214	0.73250	0.0:0.0:1.0:0.0	.	185;240	B7Z4K6;O00115	.;DNS2A_HUMAN	C	240;185	ENSP00000222219:S240C;ENSP00000445988:S185C	ENSP00000222219:S240C	S	-	2	0	DNASE2	12848168	0.996000	0.38824	0.967000	0.41034	0.235000	0.25334	2.696000	0.47052	2.201000	0.70794	0.462000	0.41574	TCC	DNASE2	-	pfam_DNase_II	ENSG00000105612		0.572	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE2	HGNC	protein_coding	OTTHUMT00000451790.1	57	0.00	0	G			12987168	12987168	-1	no_errors	ENST00000222219	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	0.468	C
EP300	2033	genome.wustl.edu	37	22	41572386	41572386	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr22:41572386C>T	ENST00000263253.7	+	30	6134	c.4915C>T	c.(4915-4917)Ctg>Ttg	p.L1639L	RP1-85F18.5_ENST00000420537.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1639	Binding region for E1A adenovirus.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GGACAAGCACCTGGAGTTCTC	0.572			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													dbGAP		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													105.0	86.0	93.0					22																	41572386		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4915C>T	22.37:g.41572386C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKC2	Silent	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.L1639	ENST00000263253.7	37	c.4915	CCDS14010.1	22																																																																																			EP300	-	NULL	ENSG00000100393		0.572	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	62	0.00	0	C	NM_001429		41572386	41572386	+1	no_errors	ENST00000263253	ensembl	human	known	69_37n	silent	82	18.81	19	SNP	1.000	T
EP300	2033	genome.wustl.edu	37	22	41572386	41572386	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr22:41572386C>T	ENST00000263253.7	+	30	6134	c.4915C>T	c.(4915-4917)Ctg>Ttg	p.L1639L	RP1-85F18.5_ENST00000420537.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1639	Binding region for E1A adenovirus.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GGACAAGCACCTGGAGTTCTC	0.572			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													dbGAP		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													105.0	86.0	93.0					22																	41572386		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4915C>T	22.37:g.41572386C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKC2	Silent	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.L1639	ENST00000263253.7	37	c.4915	CCDS14010.1	22																																																																																			EP300	-	NULL	ENSG00000100393		0.572	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	74	0.00	0	C	NM_001429		41572386	41572386	+1	no_errors	ENST00000263253	ensembl	human	known	69_37n	silent	82	18.81	19	SNP	1.000	T
ERP29	10961	genome.wustl.edu	37	12	112460145	112460145	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr12:112460145delC	ENST00000261735.3	+	3	625	c.475delC	c.(475-477)cctfs	p.P159fs	ERP29_ENST00000455836.1_3'UTR|ERP29_ENST00000546477.1_Frame_Shift_Del_p.P58fs	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	159					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						TGGTTGCCTGCCTGTATACGA	0.597																																						dbGAP											0													49.0	47.0	48.0					12																	112460145		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.475delC	12.37:g.112460145delC	ENSP00000261735:p.Pro159fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J183|Q3MJC3|Q6FHT4	Frame_Shift_Del	DEL	pfam_ERp29_N,pfam_ER_p29_C,superfamily_ER_p29_C,superfamily_Thioredoxin-like_fold,pirsf_ER_p29	p.P159fs	ENST00000261735.3	37	c.475	CCDS9158.1	12																																																																																			ERP29	-	pfam_ER_p29_C,superfamily_ER_p29_C,pirsf_ER_p29	ENSG00000089248		0.597	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERP29	HGNC	protein_coding	OTTHUMT00000405200.1	57	0.00	0	C			112460145	112460145	+1	no_errors	ENST00000261735	ensembl	human	known	69_37n	frame_shift_del	70	17.24	15	DEL	0.971	-
ERP29	10961	genome.wustl.edu	37	12	112460145	112460145	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr12:112460145delC	ENST00000261735.3	+	3	625	c.475delC	c.(475-477)cctfs	p.P159fs	ERP29_ENST00000455836.1_3'UTR|ERP29_ENST00000546477.1_Frame_Shift_Del_p.P58fs	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	159					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						TGGTTGCCTGCCTGTATACGA	0.597																																						dbGAP											0													49.0	47.0	48.0					12																	112460145		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.475delC	12.37:g.112460145delC	ENSP00000261735:p.Pro159fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J183|Q3MJC3|Q6FHT4	Frame_Shift_Del	DEL	pfam_ERp29_N,pfam_ER_p29_C,superfamily_ER_p29_C,superfamily_Thioredoxin-like_fold,pirsf_ER_p29	p.P159fs	ENST00000261735.3	37	c.475	CCDS9158.1	12																																																																																			ERP29	-	pfam_ER_p29_C,superfamily_ER_p29_C,pirsf_ER_p29	ENSG00000089248		0.597	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERP29	HGNC	protein_coding	OTTHUMT00000405200.1	99	0.00	0	C			112460145	112460145	+1	no_errors	ENST00000261735	ensembl	human	known	69_37n	frame_shift_del	70	17.24	15	DEL	0.971	-
ETNK2	55224	genome.wustl.edu	37	1	204116010	204116010	+	Intron	SNP	A	A	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:204116010A>C	ENST00000367202.4	-	3	669				ETNK2_ENST00000367198.2_5'UTR|ETNK2_ENST00000367201.3_Intron|ETNK2_ENST00000367199.2_Intron	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2						glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGAGGGCCAAGGATGGGATG	0.557																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.519-118T>G	1.37:g.204116010A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	pfam_Choline/ethanolamine_kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.L27V	ENST00000367202.4	37	c.79	CCDS1442.2	1	.	.	.	.	.	.	.	.	.	.	A	10.10	1.256392	0.22965	.	.	ENSG00000143845	ENST00000452983	T	0.67345	-0.26	4.62	-8.05	0.01106	.	.	.	.	.	T	0.52805	0.1757	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53968	-0.8363	6	0.34782	T	0.22	.	2.9941	0.05993	0.2073:0.4336:0.2459:0.1132	.	.	.	.	V	27	ENSP00000398091:L27V	ENSP00000398091:L27V	L	-	1	2	ETNK2	202382633	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.060000	0.01392	-1.601000	0.01601	-2.351000	0.00242	TTG	ETNK2	-	NULL	ENSG00000143845		0.557	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK2	HGNC	protein_coding	OTTHUMT00000087893.1	35	0.00	0	A	NM_018208		204116010	204116010	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000452983	ensembl	human	putative	69_37n	missense	81	18.18	18	SNP	0.000	C
ETNK2	55224	genome.wustl.edu	37	1	204116010	204116010	+	Intron	SNP	A	A	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:204116010A>C	ENST00000367202.4	-	3	669				ETNK2_ENST00000367198.2_5'UTR|ETNK2_ENST00000367201.3_Intron|ETNK2_ENST00000367199.2_Intron	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2						glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGAGGGCCAAGGATGGGATG	0.557																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.519-118T>G	1.37:g.204116010A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	pfam_Choline/ethanolamine_kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.L27V	ENST00000367202.4	37	c.79	CCDS1442.2	1	.	.	.	.	.	.	.	.	.	.	A	10.10	1.256392	0.22965	.	.	ENSG00000143845	ENST00000452983	T	0.67345	-0.26	4.62	-8.05	0.01106	.	.	.	.	.	T	0.52805	0.1757	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53968	-0.8363	6	0.34782	T	0.22	.	2.9941	0.05993	0.2073:0.4336:0.2459:0.1132	.	.	.	.	V	27	ENSP00000398091:L27V	ENSP00000398091:L27V	L	-	1	2	ETNK2	202382633	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.060000	0.01392	-1.601000	0.01601	-2.351000	0.00242	TTG	ETNK2	-	NULL	ENSG00000143845		0.557	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK2	HGNC	protein_coding	OTTHUMT00000087893.1	74	0.00	0	A	NM_018208		204116010	204116010	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000452983	ensembl	human	putative	69_37n	missense	81	18.18	18	SNP	0.000	C
FAM184B	27146	genome.wustl.edu	37	4	17710554	17710554	+	Silent	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr4:17710554G>A	ENST00000265018.3	-	2	1067	c.855C>T	c.(853-855)gaC>gaT	p.D285D		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	285										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						ACTTCTTCAGGTCACTTATCT	0.542																																						dbGAP											0													59.0	51.0	54.0					4																	17710554		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.855C>T	4.37:g.17710554G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.D285	ENST00000265018.3	37	c.855	CCDS47033.1	4																																																																																			FAM184B	-	NULL	ENSG00000047662		0.542	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184B	HGNC	protein_coding	OTTHUMT00000360137.1	52	0.00	0	G	NM_015688		17710554	17710554	-1	no_errors	ENST00000265018	ensembl	human	known	69_37n	silent	64	22.89	19	SNP	1.000	A
FAM184B	27146	genome.wustl.edu	37	4	17710554	17710554	+	Silent	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr4:17710554G>A	ENST00000265018.3	-	2	1067	c.855C>T	c.(853-855)gaC>gaT	p.D285D		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	285										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						ACTTCTTCAGGTCACTTATCT	0.542																																						dbGAP											0													59.0	51.0	54.0					4																	17710554		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.855C>T	4.37:g.17710554G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.D285	ENST00000265018.3	37	c.855	CCDS47033.1	4																																																																																			FAM184B	-	NULL	ENSG00000047662		0.542	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184B	HGNC	protein_coding	OTTHUMT00000360137.1	63	0.00	0	G	NM_015688		17710554	17710554	-1	no_errors	ENST00000265018	ensembl	human	known	69_37n	silent	64	22.89	19	SNP	1.000	A
FAM45A	404636	genome.wustl.edu	37	10	120896927	120896927	+	IGR	SNP	G	G	A	rs61874337	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr10:120896927G>A	ENST00000361432.2	+	0	1648				FAM45A_ENST00000489988.1_3'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A											breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		ATAAAAGTGTGTAGGACTGAA	0.378													G|||	2898	0.578674	0.4788	0.6196	5008	,	,		14145	0.5615		0.5666	False		,,,				2504	0.7147					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143		10.37:g.120896927G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	RNA	SNP	-	NULL	ENST00000361432.2	37	NULL	CCDS7609.1	10																																																																																			FAM45A	-	-	ENSG00000119979		0.378	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM45A	HGNC	protein_coding	OTTHUMT00000050623.1	34	0.00	0	G	NM_207009		120896927	120896927	+1	no_errors	ENST00000489988	ensembl	human	known	69_37n	rna	30	16.67	6	SNP	0.001	A
FCGR3A	2214	genome.wustl.edu	37	1	161599571	161599571	+	Intron	SNP	T	T	C	rs2290834	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:161599571T>C	ENST00000540048.1	-	2	94				FCGR3B_ENST00000531221.1_Missense_Mutation_p.I142V|FCGR3B_ENST00000367964.2_Missense_Mutation_p.I106V|FCGR3B_ENST00000294800.3_Missense_Mutation_p.I106V|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000403078.3_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AACTCACCGATATGGACTTCT	0.478																																						dbGAP											0													24.0	26.0	25.0					1																	161599571		2124	4279	6403	-	-	-	SO:0001627	intron_variant	0			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+586A>G	1.37:g.161599571T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.I106V	ENST00000540048.1	37	c.316		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	1.794|1.794	-0.478839|-0.478839	0.04414|0.04414	.|.	.|.	ENSG00000162747|ENSG00000162747	ENST00000367964;ENST00000294800;ENST00000531221;ENST00000534776|ENST00000421702	T;T;T;T|.	0.02787|.	4.91;4.91;5.01;4.16|.	2.79|2.79	-5.57|-5.57	0.02521|0.02521	.|.	4.037030|.	0.00559|.	N|.	0.000262|.	T|T	0.02727|0.02727	0.0082|0.0082	N|N	0.04508|0.04508	-0.205|-0.205	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.16660|0.16660	-1.0395|-1.0395	9|4	0.20046|.	T|.	0.44|.	.|.	3.2984|3.2984	0.06974|0.06974	0.1208:0.478:0.2427:0.1584|0.1208:0.478:0.2427:0.1584	.|.	106|.	O75015|.	FCG3B_HUMAN|.	V|C	106;106;142;89|126	ENSP00000356941:I106V;ENSP00000294800:I106V;ENSP00000433642:I142V;ENSP00000437084:I89V|.	ENSP00000294800:I106V|.	I|Y	-|-	1|2	0|0	FCGR3B|FCGR3B	159866195|159866195	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	-7.325000|-7.325000	0.00039|0.00039	-3.260000|-3.260000	0.00202|0.00202	0.319000|0.319000	0.21371|0.21371	ATC|TAT	FCGR3B	-	NULL	ENSG00000162747		0.478	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	FCGR3B	HGNC	protein_coding		38	0.00	0	T	NM_000569		161599571	161599571	-1	no_errors	ENST00000294800	ensembl	human	known	69_37n	missense	62	13.70	10	SNP	0.000	C
GARNL3	84253	genome.wustl.edu	37	9	130005533	130005533	+	IGR	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr9:130005533G>C								RALGPS1 (20090 upstream) : GARNL3 (20407 downstream)																							CAACCTGTAAGTAAGTAAAAG	0.428																																						dbGAP											0													55.0	51.0	52.0					9																	130005533		876	1991	2867	-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.130005533G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e1+1		37	c.147+1		9																																																																																			GARNL3	-	-	ENSG00000136895	0	0.428					GARNL3	HGNC			78	0.00	0	G			130005533	130005533	+1	no_errors	ENST00000441134	ensembl	human	known	69_37n	splice_site	87	12.00	12	SNP	1.000	C
GARNL3	84253	genome.wustl.edu	37	9	130005533	130005533	+	IGR	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr9:130005533G>C								RALGPS1 (20090 upstream) : GARNL3 (20407 downstream)																							CAACCTGTAAGTAAGTAAAAG	0.428																																						dbGAP											0													55.0	51.0	52.0					9																	130005533		876	1991	2867	-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.130005533G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e1+1		37	c.147+1		9																																																																																			GARNL3	-	-	ENSG00000136895	0	0.428					GARNL3	HGNC			102	0.00	0	G			130005533	130005533	+1	no_errors	ENST00000441134	ensembl	human	known	69_37n	splice_site	87	12.00	12	SNP	1.000	C
GIT1	28964	genome.wustl.edu	37	17	27902412	27902412	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr17:27902412G>T	ENST00000225394.3	-	18	2151	c.1903C>A	c.(1903-1905)Cta>Ata	p.L635I	RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000579937.1_Missense_Mutation_p.L635I|GIT1_ENST00000581348.1_Missense_Mutation_p.L621I|GIT1_ENST00000394869.3_Missense_Mutation_p.L644I	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	635					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		CCAGGATCTAGGTCTCCATCC	0.547																																					Colon(81;41 1719 20078 35068)	dbGAP											0													117.0	124.0	122.0					17																	27902412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1903C>A	17.37:g.27902412G>T	ENSP00000225394:p.Leu635Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Missense_Mutation	SNP	pfam_GIT1_C,pfam_GIT_SHD,pfam_ArfGAP,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_ArfGAP,smart_Ankyrin_rpt,smart_GIT_SHD,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_ArfGAP,prints_ArfGAP	p.L644I	ENST00000225394.3	37	c.1930	CCDS11250.1	17	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400822	0.25291	.	.	ENSG00000108262	ENST00000225394;ENST00000394869	T;T	0.70749	-0.44;-0.51	4.72	3.67	0.42095	G protein-coupled receptor kinase-interacting protein 1 C term (1);	0.234339	0.35262	N	0.003340	T	0.52125	0.1715	N	0.22421	0.69	0.33591	D	0.601148	B;B;B;B	0.17465	0.022;0.009;0.011;0.011	B;B;B;B	0.18263	0.021;0.012;0.021;0.021	T	0.54931	-0.8219	10	0.22706	T	0.39	.	8.3236	0.32142	0.1988:0.0:0.8012:0.0	.	648;644;644;635	Q59FC3;Q9Y2X7-3;B4DGU9;Q9Y2X7	.;.;.;GIT1_HUMAN	I	635;644	ENSP00000225394:L635I;ENSP00000378338:L644I	ENSP00000225394:L635I	L	-	1	2	GIT1	24926538	1.000000	0.71417	0.952000	0.39060	0.989000	0.77384	3.087000	0.50167	1.203000	0.43233	0.655000	0.94253	CTA	GIT1	-	pfam_GIT1_C	ENSG00000108262		0.547	GIT1-001	KNOWN	basic|CCDS	protein_coding	GIT1	HGNC	protein_coding	OTTHUMT00000256073.1	40	0.00	0	G	NM_014030		27902412	27902412	-1	no_errors	ENST00000394869	ensembl	human	known	69_37n	missense	54	23.94	17	SNP	0.997	T
GIT1	28964	genome.wustl.edu	37	17	27902412	27902412	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr17:27902412G>T	ENST00000225394.3	-	18	2151	c.1903C>A	c.(1903-1905)Cta>Ata	p.L635I	RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000579937.1_Missense_Mutation_p.L635I|GIT1_ENST00000581348.1_Missense_Mutation_p.L621I|GIT1_ENST00000394869.3_Missense_Mutation_p.L644I	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	635					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		CCAGGATCTAGGTCTCCATCC	0.547																																					Colon(81;41 1719 20078 35068)	dbGAP											0													117.0	124.0	122.0					17																	27902412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1903C>A	17.37:g.27902412G>T	ENSP00000225394:p.Leu635Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Missense_Mutation	SNP	pfam_GIT1_C,pfam_GIT_SHD,pfam_ArfGAP,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_ArfGAP,smart_Ankyrin_rpt,smart_GIT_SHD,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_ArfGAP,prints_ArfGAP	p.L644I	ENST00000225394.3	37	c.1930	CCDS11250.1	17	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400822	0.25291	.	.	ENSG00000108262	ENST00000225394;ENST00000394869	T;T	0.70749	-0.44;-0.51	4.72	3.67	0.42095	G protein-coupled receptor kinase-interacting protein 1 C term (1);	0.234339	0.35262	N	0.003340	T	0.52125	0.1715	N	0.22421	0.69	0.33591	D	0.601148	B;B;B;B	0.17465	0.022;0.009;0.011;0.011	B;B;B;B	0.18263	0.021;0.012;0.021;0.021	T	0.54931	-0.8219	10	0.22706	T	0.39	.	8.3236	0.32142	0.1988:0.0:0.8012:0.0	.	648;644;644;635	Q59FC3;Q9Y2X7-3;B4DGU9;Q9Y2X7	.;.;.;GIT1_HUMAN	I	635;644	ENSP00000225394:L635I;ENSP00000378338:L644I	ENSP00000225394:L635I	L	-	1	2	GIT1	24926538	1.000000	0.71417	0.952000	0.39060	0.989000	0.77384	3.087000	0.50167	1.203000	0.43233	0.655000	0.94253	CTA	GIT1	-	pfam_GIT1_C	ENSG00000108262		0.547	GIT1-001	KNOWN	basic|CCDS	protein_coding	GIT1	HGNC	protein_coding	OTTHUMT00000256073.1	34	0.00	0	G	NM_014030		27902412	27902412	-1	no_errors	ENST00000394869	ensembl	human	known	69_37n	missense	54	23.94	17	SNP	0.997	T
GOLGA6B	55889	genome.wustl.edu	37	15	72955060	72955060	+	Missense_Mutation	SNP	G	G	A	rs200016190	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr15:72955060G>A	ENST00000421285.3	+	11	1315	c.1315G>A	c.(1315-1317)Gac>Aac	p.D439N	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	439						Golgi apparatus (GO:0005794)				NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						CCACAAGCTCGACAAGCAGCT	0.612																																						dbGAP											0													1.0	1.0	1.0					15																	72955060		23	70	93	-	-	-	SO:0001583	missense	0				CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.1315G>A	15.37:g.72955060G>A	ENSP00000408132:p.Asp439Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYY7	Missense_Mutation	SNP	NULL	p.D439N	ENST00000421285.3	37	c.1315	CCDS10245.2	15	.	.	.	.	.	.	.	.	.	.	.	0.038	-1.295585	0.01375	.	.	ENSG00000215186	ENST00000421285	T	0.05513	3.43	0.372	-0.744	0.11101	.	.	.	.	.	T	0.02418	0.0074	N	0.04508	-0.205	0.21527	N	0.999657	B	0.15473	0.013	B	0.11329	0.006	T	0.47861	-0.9084	9	0.18276	T	0.48	.	3.7773	0.08665	0.6615:0.0:0.3385:0.0	.	439	A6NDN3	GOG6B_HUMAN	N	439	ENSP00000408132:D439N	ENSP00000408132:D439N	D	+	1	0	GOLGA6B	70742114	1.000000	0.71417	0.019000	0.16419	0.077000	0.17291	4.339000	0.59322	-0.453000	0.07076	0.089000	0.15464	GAC	GOLGA6B	-	NULL	ENSG00000215186		0.612	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6B	HGNC	protein_coding	OTTHUMT00000257474.4	120	0.83	1	G	NM_018652		72955060	72955060	+1	no_errors	ENST00000421285	ensembl	human	known	69_37n	missense	84	13.40	13	SNP	0.995	A
GOLGA7	51125	genome.wustl.edu	37	8	41367608	41367608	+	3'UTR	SNP	T	T	C	rs1043869	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr8:41367608T>C	ENST00000357743.4	+	0	1136				GOLGA7_ENST00000520817.1_3'UTR|GOLGA7_ENST00000405786.2_3'UTR|GOLGA7_ENST00000521417.1_3'UTR	NM_001002296.1	NP_001002296.1	Q7Z5G4	GOGA7_HUMAN	golgin A7						Golgi to plasma membrane protein transport (GO:0043001)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)				breast(1)|large_intestine(1)	2	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			AAAGAATTACTGGTTTTACCA	0.328													C|||	750	0.14976	0.2352	0.3228	5008	,	,		16936	0.0327		0.1421	False		,,,				2504	0.0399					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF125102	CCDS34887.1, CCDS55226.1	8p11.21	2011-10-25	2010-02-12		ENSG00000147533	ENSG00000147533			24876	protein-coding gene	gene with protein product		609453	"""golgi autoantigen, golgin subfamily a, 7"""			11042152	Standard	NM_001174124		Approved	GCP16, HSPC041, GOLGA3AP1, GOLGA7A	uc003xnu.3	Q7Z5G4	OTTHUMG00000164077	ENST00000357743.4:c.*521T>C	8.37:g.41367608T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSX9|J3KQ24|Q96EQ4|Q9P1S0|Q9Y5U7	RNA	SNP	-	NULL	ENST00000357743.4	37	NULL	CCDS34887.1	8																																																																																			GOLGA7	-	-	ENSG00000147533		0.328	GOLGA7-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GOLGA7	HGNC	protein_coding	OTTHUMT00000377142.1	36	0.00	0	T	NM_016099		41367608	41367608	+1	no_errors	ENST00000521417	ensembl	human	known	69_37n	rna	30	14.29	5	SNP	0.004	C
HECW1	23072	genome.wustl.edu	37	7	43157968	43157968	+	Intron	SNP	G	G	T	rs2190947	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:43157968G>T	ENST00000395891.2	+	2	574				HECW1_ENST00000453890.1_Intron|HECW1-IT1_ENST00000322220.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CAGAGCAGTTGGAGAAACATA	0.378													T|||	3712	0.741214	0.8714	0.6254	5008	,	,		18165	0.8204		0.6272	False		,,,				2504	0.683					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.-32+3978G>T	7.37:g.43157968G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	RNA	SNP	-	NULL	ENST00000395891.2	37	NULL	CCDS5469.2	7																																																																																			HECW1-IT1	-	-	ENSG00000181211		0.378	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1-IT1	HGNC	protein_coding	OTTHUMT00000250893.2	33	0.00	0	G	NM_015052		43157968	43157968	+1	no_errors	ENST00000322220	ensembl	human	known	69_37n	rna	39	11.36	5	SNP	0.003	T
HEPACAM2	253012	genome.wustl.edu	37	7	92818293	92818293	+	3'UTR	SNP	T	T	C	rs42507	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:92818293T>C	ENST00000394468.2	-	0	1753				HEPACAM2_ENST00000341723.4_3'UTR|HEPACAM2_ENST00000453812.2_3'UTR|HEPACAM2_ENST00000492616.1_5'UTR|HEPACAM2_ENST00000440868.1_3'UTR	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						ACAAAACTTATGAGGAAACCC	0.408													T|||	2029	0.405152	0.0242	0.5288	5008	,	,		16670	0.4008		0.6412	False		,,,				2504	0.5941					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.*287A>G	7.37:g.92818293T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	RNA	SNP	-	NULL	ENST00000394468.2	37	NULL	CCDS43616.1	7																																																																																			HEPACAM2	-	-	ENSG00000188175		0.408	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM2	HGNC	protein_coding	OTTHUMT00000254651.1	37	0.00	0	T	NM_198151		92818293	92818293	-1	no_errors	ENST00000492616	ensembl	human	known	69_37n	rna	32	11.11	4	SNP	0.000	C
HJURP	55355	genome.wustl.edu	37	2	234750144	234750144	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:234750144C>G	ENST00000411486.2	-	8	1347	c.1282G>C	c.(1282-1284)Gag>Cag	p.E428Q	HJURP_ENST00000441687.1_Missense_Mutation_p.E343Q|HJURP_ENST00000432087.1_Missense_Mutation_p.E374Q|HJURP_ENST00000434039.1_5'Flank	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	428					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TGACGGTTCTCTCCATGGCCC	0.443																																						dbGAP											0													104.0	105.0	105.0					2																	234750144		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1282G>C	2.37:g.234750144C>G	ENSP00000414109:p.Glu428Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.E428Q	ENST00000411486.2	37	c.1282	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964846	0.34659	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	4.35	0.334	0.15948	Holliday junction regulator protein family C-terminal repeat (1);	1.411250	0.04245	N	0.337574	T	0.61999	0.2392	L	0.50333	1.59	0.09310	N	1	B;B;B	0.26547	0.126;0.126;0.152	B;B;B	0.29524	0.063;0.063;0.103	T	0.42189	-0.9466	10	0.37606	T	0.19	-4.5956	1.185	0.01853	0.1815:0.4417:0.1762:0.2006	.	343;374;428	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	Q	428;374;343;343	ENSP00000414109:E428Q;ENSP00000407208:E374Q;ENSP00000401944:E343Q;ENSP00000393253:E343Q	ENSP00000414109:E428Q	E	-	1	0	HJURP	234414883	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.436000	0.06922	0.047000	0.15862	0.655000	0.94253	GAG	HJURP	-	pfam_HJURP_C	ENSG00000123485		0.443	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	HGNC	protein_coding	OTTHUMT00000130996.6	79	0.00	0	C	NM_018410		234750144	234750144	-1	no_errors	ENST00000411486	ensembl	human	known	69_37n	missense	111	24.49	36	SNP	0.000	G
HJURP	55355	genome.wustl.edu	37	2	234750144	234750144	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:234750144C>G	ENST00000411486.2	-	8	1347	c.1282G>C	c.(1282-1284)Gag>Cag	p.E428Q	HJURP_ENST00000441687.1_Missense_Mutation_p.E343Q|HJURP_ENST00000432087.1_Missense_Mutation_p.E374Q|HJURP_ENST00000434039.1_5'Flank	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	428					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TGACGGTTCTCTCCATGGCCC	0.443																																						dbGAP											0													104.0	105.0	105.0					2																	234750144		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1282G>C	2.37:g.234750144C>G	ENSP00000414109:p.Glu428Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.E428Q	ENST00000411486.2	37	c.1282	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964846	0.34659	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	4.35	0.334	0.15948	Holliday junction regulator protein family C-terminal repeat (1);	1.411250	0.04245	N	0.337574	T	0.61999	0.2392	L	0.50333	1.59	0.09310	N	1	B;B;B	0.26547	0.126;0.126;0.152	B;B;B	0.29524	0.063;0.063;0.103	T	0.42189	-0.9466	10	0.37606	T	0.19	-4.5956	1.185	0.01853	0.1815:0.4417:0.1762:0.2006	.	343;374;428	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	Q	428;374;343;343	ENSP00000414109:E428Q;ENSP00000407208:E374Q;ENSP00000401944:E343Q;ENSP00000393253:E343Q	ENSP00000414109:E428Q	E	-	1	0	HJURP	234414883	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.436000	0.06922	0.047000	0.15862	0.655000	0.94253	GAG	HJURP	-	pfam_HJURP_C	ENSG00000123485		0.443	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	HGNC	protein_coding	OTTHUMT00000130996.6	98	0.00	0	C	NM_018410		234750144	234750144	-1	no_errors	ENST00000411486	ensembl	human	known	69_37n	missense	111	24.49	36	SNP	0.000	G
HOXC13	3229	genome.wustl.edu	37	12	54333415	54333415	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr12:54333415C>A	ENST00000243056.3	+	1	881	c.725C>A	c.(724-726)tCt>tAt	p.S242Y	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	242					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CTCTGGAAGTCTCCCTTCCCA	0.706			T	NUP98	AML																																	dbGAP		Dom	yes		12	12q13.3	3229	homeo box C13		L	0													8.0	10.0	9.0					12																	54333415		1899	3789	5688	-	-	-	SO:0001583	missense	0				CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.725C>A	12.37:g.54333415C>A	ENSP00000243056:p.Ser242Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	pfam_Homeodomain,pfam_HoxA13_N,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S242Y	ENST00000243056.3	37	c.725	CCDS8865.1	12	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972321	0.74246	.	.	ENSG00000123364	ENST00000243056	D	0.95885	-3.84	3.32	3.32	0.38043	.	0.000000	0.85682	D	0.000000	D	0.94994	0.8380	M	0.75777	2.31	0.58432	D	0.999997	B	0.32829	0.386	B	0.38106	0.265	D	0.95643	0.8700	10	0.62326	D	0.03	.	14.5783	0.68265	0.0:1.0:0.0:0.0	.	242	P31276	HXC13_HUMAN	Y	242	ENSP00000243056:S242Y	ENSP00000243056:S242Y	S	+	2	0	HOXC13	52619682	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.056000	0.76662	2.184000	0.69523	0.305000	0.20034	TCT	HOXC13	-	NULL	ENSG00000123364		0.706	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC13	HGNC	protein_coding	OTTHUMT00000358865.2	19	0.00	0	C			54333415	54333415	+1	no_errors	ENST00000243056	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	A
HOXC13	3229	genome.wustl.edu	37	12	54333415	54333415	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr12:54333415C>A	ENST00000243056.3	+	1	881	c.725C>A	c.(724-726)tCt>tAt	p.S242Y	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	242					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CTCTGGAAGTCTCCCTTCCCA	0.706			T	NUP98	AML																																	dbGAP		Dom	yes		12	12q13.3	3229	homeo box C13		L	0													8.0	10.0	9.0					12																	54333415		1899	3789	5688	-	-	-	SO:0001583	missense	0				CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.725C>A	12.37:g.54333415C>A	ENSP00000243056:p.Ser242Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	pfam_Homeodomain,pfam_HoxA13_N,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S242Y	ENST00000243056.3	37	c.725	CCDS8865.1	12	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972321	0.74246	.	.	ENSG00000123364	ENST00000243056	D	0.95885	-3.84	3.32	3.32	0.38043	.	0.000000	0.85682	D	0.000000	D	0.94994	0.8380	M	0.75777	2.31	0.58432	D	0.999997	B	0.32829	0.386	B	0.38106	0.265	D	0.95643	0.8700	10	0.62326	D	0.03	.	14.5783	0.68265	0.0:1.0:0.0:0.0	.	242	P31276	HXC13_HUMAN	Y	242	ENSP00000243056:S242Y	ENSP00000243056:S242Y	S	+	2	0	HOXC13	52619682	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.056000	0.76662	2.184000	0.69523	0.305000	0.20034	TCT	HOXC13	-	NULL	ENSG00000123364		0.706	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC13	HGNC	protein_coding	OTTHUMT00000358865.2	25	0.00	0	C			54333415	54333415	+1	no_errors	ENST00000243056	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	A
HPX	3263	genome.wustl.edu	37	11	6452495	6452495	+	Silent	SNP	G	G	C	rs544372651		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr11:6452495G>C	ENST00000265983.3	-	10	1435	c.1335C>G	c.(1333-1335)gcC>gcG	p.A445A		NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	445					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		GAAGGGCCTTGGCTGCATTCA	0.567																																						dbGAP											0													114.0	102.0	106.0					11																	6452495		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.1335C>G	11.37:g.6452495G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R957	Silent	SNP	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat,pirsf_Hemopexin_chordata	p.A445	ENST00000265983.3	37	c.1335	CCDS7763.1	11																																																																																			HPX	-	superfamily_Hemopexin/matrixin,pirsf_Hemopexin_chordata	ENSG00000110169		0.567	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPX	HGNC	protein_coding	OTTHUMT00000257256.1	63	0.00	0	G	NM_000613		6452495	6452495	-1	no_errors	ENST00000265983	ensembl	human	known	69_37n	silent	53	26.39	19	SNP	0.784	C
HPX	3263	genome.wustl.edu	37	11	6452495	6452495	+	Silent	SNP	G	G	C	rs544372651		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr11:6452495G>C	ENST00000265983.3	-	10	1435	c.1335C>G	c.(1333-1335)gcC>gcG	p.A445A		NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	445					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		GAAGGGCCTTGGCTGCATTCA	0.567																																						dbGAP											0													114.0	102.0	106.0					11																	6452495		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.1335C>G	11.37:g.6452495G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R957	Silent	SNP	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat,pirsf_Hemopexin_chordata	p.A445	ENST00000265983.3	37	c.1335	CCDS7763.1	11																																																																																			HPX	-	superfamily_Hemopexin/matrixin,pirsf_Hemopexin_chordata	ENSG00000110169		0.567	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPX	HGNC	protein_coding	OTTHUMT00000257256.1	66	0.00	0	G	NM_000613		6452495	6452495	-1	no_errors	ENST00000265983	ensembl	human	known	69_37n	silent	53	26.39	19	SNP	0.784	C
IFT81	28981	genome.wustl.edu	37	12	110566802	110566802	+	Missense_Mutation	SNP	A	A	G	rs113298674		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr12:110566802A>G	ENST00000242591.5	+	4	802	c.296A>G	c.(295-297)tAc>tGc	p.Y99C	IFT81_ENST00000361948.4_Missense_Mutation_p.Y99C|IFT81_ENST00000552912.1_Missense_Mutation_p.Y99C	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	99	CH (calponin-homology)-like region.				cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						CCTGTAATTTACCCAGTGCTC	0.388																																						dbGAP											0													114.0	108.0	110.0					12																	110566802		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.296A>G	12.37:g.110566802A>G	ENSP00000242591:p.Tyr99Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	NULL	p.Y99C	ENST00000242591.5	37	c.296	CCDS41831.1	12	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055006	0.75960	.	.	ENSG00000122970	ENST00000361948;ENST00000552912;ENST00000242591;ENST00000546374	T	0.39787	1.06	5.55	5.55	0.83447	.	0.047787	0.85682	D	0.000000	T	0.54565	0.1866	L	0.59436	1.845	0.80722	D	1	D;D	0.60575	0.98;0.988	P;P	0.54629	0.757;0.724	T	0.58295	-0.7661	10	0.66056	D	0.02	-4.8962	15.6967	0.77506	1.0:0.0:0.0:0.0	.	99;99	Q8WYA0;Q8WYA0-3	IFT81_HUMAN;.	C	99	ENSP00000355372:Y99C	ENSP00000242591:Y99C	Y	+	2	0	IFT81	109051185	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.930000	0.92872	2.111000	0.64477	0.383000	0.25322	TAC	IFT81	-	NULL	ENSG00000122970		0.388	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IFT81	HGNC	protein_coding	OTTHUMT00000403529.1	36	0.00	0	A	NM_014055		110566802	110566802	+1	no_errors	ENST00000242591	ensembl	human	known	69_37n	missense	73	13.10	11	SNP	1.000	G
IGFLR1	79713	genome.wustl.edu	37	19	36230200	36230200	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr19:36230200G>A	ENST00000592537.1	-	5	1149	c.1049C>T	c.(1048-1050)tCt>tTt	p.S350F	IGFLR1_ENST00000588992.1_Missense_Mutation_p.S182F|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000246532.1_Missense_Mutation_p.S350F|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000344990.3_Missense_Mutation_p.S162F|IGFLR1_ENST00000592889.1_Missense_Mutation_p.S162F|IGFLR1_ENST00000587101.1_5'Flank			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	350						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						GCAAACCCCAGATGAGCCAAG	0.532																																						dbGAP											0													12.0	13.0	13.0					19																	36230200		2198	4289	6487	-	-	-	SO:0001583	missense	0			AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.1049C>T	19.37:g.36230200G>A	ENSP00000466181:p.Ser350Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5X0	Missense_Mutation	SNP	superfamily_DEATH-like	p.S350F	ENST00000592537.1	37	c.1049	CCDS12472.1	19	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705601	0.30232	.	.	ENSG00000126246	ENST00000246532;ENST00000344990	T	0.55052	0.54	3.26	-2.66	0.06077	.	4.140480	0.00649	N	0.000542	T	0.34832	0.0911	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.0	T	0.20571	-1.0271	10	0.56958	D	0.05	.	2.8048	0.05424	0.2562:0.0:0.3809:0.3629	.	350;162	Q9H665;Q9H665-2	IGFR1_HUMAN;.	F	350;162	ENSP00000246532:S350F	ENSP00000246532:S350F	S	-	2	0	IGFLR1	40922040	0.000000	0.05858	0.000000	0.03702	0.244000	0.25665	0.014000	0.13333	-0.440000	0.07211	0.462000	0.41574	TCT	IGFLR1	-	NULL	ENSG00000126246		0.532	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	IGFLR1	HGNC	protein_coding	OTTHUMT00000459077.1	13	0.00	0	G	NM_024660		36230200	36230200	-1	no_errors	ENST00000246532	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	0.000	A
IGFLR1	79713	genome.wustl.edu	37	19	36230200	36230200	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr19:36230200G>A	ENST00000592537.1	-	5	1149	c.1049C>T	c.(1048-1050)tCt>tTt	p.S350F	IGFLR1_ENST00000588992.1_Missense_Mutation_p.S182F|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000246532.1_Missense_Mutation_p.S350F|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000344990.3_Missense_Mutation_p.S162F|IGFLR1_ENST00000592889.1_Missense_Mutation_p.S162F|IGFLR1_ENST00000587101.1_5'Flank			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	350						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						GCAAACCCCAGATGAGCCAAG	0.532																																						dbGAP											0													12.0	13.0	13.0					19																	36230200		2198	4289	6487	-	-	-	SO:0001583	missense	0			AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.1049C>T	19.37:g.36230200G>A	ENSP00000466181:p.Ser350Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5X0	Missense_Mutation	SNP	superfamily_DEATH-like	p.S350F	ENST00000592537.1	37	c.1049	CCDS12472.1	19	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705601	0.30232	.	.	ENSG00000126246	ENST00000246532;ENST00000344990	T	0.55052	0.54	3.26	-2.66	0.06077	.	4.140480	0.00649	N	0.000542	T	0.34832	0.0911	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.0	T	0.20571	-1.0271	10	0.56958	D	0.05	.	2.8048	0.05424	0.2562:0.0:0.3809:0.3629	.	350;162	Q9H665;Q9H665-2	IGFR1_HUMAN;.	F	350;162	ENSP00000246532:S350F	ENSP00000246532:S350F	S	-	2	0	IGFLR1	40922040	0.000000	0.05858	0.000000	0.03702	0.244000	0.25665	0.014000	0.13333	-0.440000	0.07211	0.462000	0.41574	TCT	IGFLR1	-	NULL	ENSG00000126246		0.532	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	IGFLR1	HGNC	protein_coding	OTTHUMT00000459077.1	24	0.00	0	G	NM_024660		36230200	36230200	-1	no_errors	ENST00000246532	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	0.000	A
IL1RL1	9173	genome.wustl.edu	37	2	102954653	102954653	+	5'UTR	SNP	C	C	T	rs13431828	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:102954653C>T	ENST00000233954.1	+	0	200				IL1RL1_ENST00000404917.2_Intron|IL1RL1_ENST00000393393.3_5'UTR|IL1RL1_ENST00000473175.1_3'UTR|IL1RL1_ENST00000409584.1_5'UTR|IL1RL1_ENST00000311734.2_5'UTR	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1						immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						CCTTCACTGTCGTATGCCAGT	0.408													c|||	800	0.159744	0.2973	0.1196	5008	,	,		14196	0.0952		0.1491	False		,,,				2504	0.0798					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.-72C>T	2.37:g.102954653C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	RNA	SNP	-	NULL	ENST00000233954.1	37	NULL	CCDS2057.1	2																																																																																			IL1RL1	-	-	ENSG00000115602		0.408	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL1	HGNC	protein_coding	OTTHUMT00000253296.1	26	0.00	0	C	NM_016232		102954653	102954653	+1	no_errors	ENST00000473175	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.002	T
IL32	9235	genome.wustl.edu	37	16	3131810	3131810	+	lincRNA	SNP	T	T	C	rs148052546	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr16:3131810T>C	ENST00000571404.1	-	0	210																		p.V172V(1)									GGCACGGGGTTCTGGCCTGGG	0.592													T|||	2501	0.499401	0.2564	0.5058	5008	,	,		14657	0.5417		0.6183	False		,,,				2504	0.6575					dbGAP											1	Substitution - coding silent(1)	central_nervous_system(1)																																								-	-	-			0																															16.37:g.3131810T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.V172	ENST00000571404.1	37	c.516		16																																																																																			IL32	-	NULL	ENSG00000008517		0.592	RP11-473M20.9-002	KNOWN	basic	lincRNA	IL32	HGNC	lincRNA	OTTHUMT00000437122.1	24	0.00	0	T			3131810	3131810	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000525377	ensembl	human	putative	69_37n	silent	22	31.25	10	SNP	0.000	C
INTS4L1	285905	genome.wustl.edu	37	7	64645801	64645801	+	RNA	SNP	C	C	G	rs62455701	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:64645801C>G	ENST00000587624.1	+	0	935							Q96LV5	IN4L1_HUMAN	integrator complex subunit 4-like 1																		GGCATCCAACCCTGGTGCTTC	0.448													C|||	2352	0.469649	0.5817	0.3069	5008	,	,		15191	0.5317		0.4205	False		,,,				2504	0.4202					dbGAP											0																																										-	-	-			0					7q11.21	2013-03-26			ENSG00000164669	ENSG00000164669			21925	other	unknown							Standard	XR_426205		Approved	FLJ25037		Q96LV5	OTTHUMG00000156510		7.37:g.64645801C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000587624.1	37	NULL		7																																																																																			INTS4L1	-	-	ENSG00000164669		0.448	INTS4L1-002	KNOWN	non_canonical_conserved|basic	processed_transcript	INTS4L1	HGNC	pseudogene	OTTHUMT00000460821.1	26	0.00	0	C	XR_041315		64645801	64645801	+1	no_errors	ENST00000587624	ensembl	human	known	69_37n	rna	13	23.53	4	SNP	1.000	G
KDM5C	8242	genome.wustl.edu	37	X	53250992	53250992	+	Intron	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chrX:53250992T>C	ENST00000375401.3	-	2	683				KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000375379.3_Intron|KDM5C_ENST00000375383.3_Intron|KDM5C_ENST00000404049.3_Intron	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C						histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TGGCAAAGAATGGGAGGATTT	0.572			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0																																										-	-	-	SO:0001627	intron_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.151-894A>G	X.37:g.53250992T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	RNA	SNP	-	NULL	ENST00000375401.3	37	NULL	CCDS14351.1	X																																																																																			KDM5C	-	-	ENSG00000126012		0.572	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	31	0.00	0	T	NM_004187		53250992	53250992	-1	no_errors	ENST00000467093	ensembl	human	known	69_37n	rna	25	35.90	14	SNP	0.001	C
KDM5C	8242	genome.wustl.edu	37	X	53250992	53250992	+	Intron	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chrX:53250992T>C	ENST00000375401.3	-	2	683				KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000375379.3_Intron|KDM5C_ENST00000375383.3_Intron|KDM5C_ENST00000404049.3_Intron	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C						histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TGGCAAAGAATGGGAGGATTT	0.572			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0																																										-	-	-	SO:0001627	intron_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.151-894A>G	X.37:g.53250992T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	RNA	SNP	-	NULL	ENST00000375401.3	37	NULL	CCDS14351.1	X																																																																																			KDM5C	-	-	ENSG00000126012		0.572	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	39	0.00	0	T	NM_004187		53250992	53250992	-1	no_errors	ENST00000467093	ensembl	human	known	69_37n	rna	25	35.90	14	SNP	0.001	C
KIF13A	63971	genome.wustl.edu	37	6	17773763	17773763	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr6:17773763C>G	ENST00000259711.6	-	36	4375	c.4270G>C	c.(4270-4272)Gat>Cat	p.D1424H	KIF13A_ENST00000378816.5_Missense_Mutation_p.D1424H|KIF13A_ENST00000378814.5_Missense_Mutation_p.D1411H|KIF13A_ENST00000378826.2_Missense_Mutation_p.D1424H|KIF13A_ENST00000378843.2_Missense_Mutation_p.D1411H	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1424					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CATGCTACATCTTGGTAACTG	0.373																																						dbGAP											0													131.0	122.0	125.0					6																	17773763		1846	4101	5947	-	-	-	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.4270G>C	6.37:g.17773763C>G	ENSP00000259711:p.Asp1424His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D1424H	ENST00000259711.6	37	c.4270	CCDS47381.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.8|26.8	4.770314|4.770314	0.90108|0.90108	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816|ENST00000358380	T;T;T;T;T;T|.	0.71817|.	-0.56;1.85;-0.6;-0.56;-0.56;-0.56|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.365574|.	0.31797|.	N|.	0.007052|.	T|T	0.57681|0.57681	0.2070|0.2070	L|L	0.36672|0.36672	1.1|1.1	0.49915|0.49915	D|D	0.999839|0.999839	D;P;P;P|.	0.53312|.	0.959;0.911;0.944;0.911|.	P;P;P;P|.	0.50490|.	0.642;0.562;0.593;0.562|.	T|T	0.51180|0.51180	-0.8738|-0.8738	10|5	0.36615|.	T|.	0.2|.	.|.	20.2406|20.2406	0.98372|0.98372	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1411;1424;1424;1411|.	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3|.	.;.;KI13A_HUMAN;.|.	H|N	1411;428;1424;1424;1411;1424|817	ENSP00000368091:D1411H;ENSP00000425616:D428H;ENSP00000259711:D1424H;ENSP00000368103:D1424H;ENSP00000368120:D1411H;ENSP00000368093:D1424H|.	ENSP00000259711:D1424H|.	D|K	-|-	1|3	0|2	KIF13A|KIF13A	17881742|17881742	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.549000|5.549000	0.67261|0.67261	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	GAT|AAG	KIF13A	-	NULL	ENSG00000137177		0.373	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	72	0.00	0	C			17773763	17773763	-1	no_errors	ENST00000259711	ensembl	human	known	69_37n	missense	102	13.56	16	SNP	1.000	G
KIF13A	63971	genome.wustl.edu	37	6	17773763	17773763	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr6:17773763C>G	ENST00000259711.6	-	36	4375	c.4270G>C	c.(4270-4272)Gat>Cat	p.D1424H	KIF13A_ENST00000378816.5_Missense_Mutation_p.D1424H|KIF13A_ENST00000378814.5_Missense_Mutation_p.D1411H|KIF13A_ENST00000378826.2_Missense_Mutation_p.D1424H|KIF13A_ENST00000378843.2_Missense_Mutation_p.D1411H	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1424					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CATGCTACATCTTGGTAACTG	0.373																																						dbGAP											0													131.0	122.0	125.0					6																	17773763		1846	4101	5947	-	-	-	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.4270G>C	6.37:g.17773763C>G	ENSP00000259711:p.Asp1424His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D1424H	ENST00000259711.6	37	c.4270	CCDS47381.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.8|26.8	4.770314|4.770314	0.90108|0.90108	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816|ENST00000358380	T;T;T;T;T;T|.	0.71817|.	-0.56;1.85;-0.6;-0.56;-0.56;-0.56|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.365574|.	0.31797|.	N|.	0.007052|.	T|T	0.57681|0.57681	0.2070|0.2070	L|L	0.36672|0.36672	1.1|1.1	0.49915|0.49915	D|D	0.999839|0.999839	D;P;P;P|.	0.53312|.	0.959;0.911;0.944;0.911|.	P;P;P;P|.	0.50490|.	0.642;0.562;0.593;0.562|.	T|T	0.51180|0.51180	-0.8738|-0.8738	10|5	0.36615|.	T|.	0.2|.	.|.	20.2406|20.2406	0.98372|0.98372	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1411;1424;1424;1411|.	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3|.	.;.;KI13A_HUMAN;.|.	H|N	1411;428;1424;1424;1411;1424|817	ENSP00000368091:D1411H;ENSP00000425616:D428H;ENSP00000259711:D1424H;ENSP00000368103:D1424H;ENSP00000368120:D1411H;ENSP00000368093:D1424H|.	ENSP00000259711:D1424H|.	D|K	-|-	1|3	0|2	KIF13A|KIF13A	17881742|17881742	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.549000|5.549000	0.67261|0.67261	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	GAT|AAG	KIF13A	-	NULL	ENSG00000137177		0.373	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	110	0.00	0	C			17773763	17773763	-1	no_errors	ENST00000259711	ensembl	human	known	69_37n	missense	102	13.56	16	SNP	1.000	G
KRTAP19-6	337973	genome.wustl.edu	37	21	31914008	31914008	+	Missense_Mutation	SNP	G	G	A	rs564699183		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr21:31914008G>A	ENST00000334046.5	-	1	175	c.145C>T	c.(145-147)Cgt>Tgt	p.R49C		NM_181612.2	NP_853643.1	Q3LI70	KR196_HUMAN	keratin associated protein 19-6	49						intermediate filament (GO:0005882)				breast(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	9						TATCCTTCACGGCATGATGGG	0.493																																						dbGAP											0													110.0	120.0	117.0					21																	31914008		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708	CCDS13598.1	21q22.1	2010-09-30			ENSG00000186925	ENSG00000186925		"""Keratin associated proteins"""	18941	protein-coding gene	gene with protein product						12359730	Standard	NM_181612		Approved	KAP19.6	uc002yok.1	Q3LI70	OTTHUMG00000057779	ENST00000334046.5:c.145C>T	21.37:g.31914008G>A	ENSP00000375107:p.Arg49Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3LI71	Missense_Mutation	SNP	pfam_KRTAP	p.R49C	ENST00000334046.5	37	c.145	CCDS13598.1	21	.	.	.	.	.	.	.	.	.	.	g	6.431	0.447737	0.12223	.	.	ENSG00000186925	ENST00000334046;ENST00000437381	T	0.08634	3.07	4.39	3.22	0.36961	.	1.153980	0.07023	U	0.827077	T	0.08846	0.0219	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39921	-0.9590	9	0.87932	D	0	3.6947	8.7267	0.34474	0.896:0.0:0.104:0.0	.	49	Q3LI70	KR196_HUMAN	C	49	ENSP00000375107:R49C	ENSP00000375107:R49C	R	-	1	0	KRTAP19-6	30835879	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	1.010000	0.29898	0.190000	0.20209	-1.214000	0.01621	CGT	KRTAP19-6	-	pfam_KRTAP	ENSG00000186925		0.493	KRTAP19-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP19-6	HGNC	protein_coding	OTTHUMT00000128231.4	77	0.00	0	G			31914008	31914008	-1	no_errors	ENST00000334046	ensembl	human	known	69_37n	missense	106	19.55	26	SNP	0.000	A
KRTAP19-6	337973	genome.wustl.edu	37	21	31914008	31914008	+	Missense_Mutation	SNP	G	G	A	rs564699183		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr21:31914008G>A	ENST00000334046.5	-	1	175	c.145C>T	c.(145-147)Cgt>Tgt	p.R49C		NM_181612.2	NP_853643.1	Q3LI70	KR196_HUMAN	keratin associated protein 19-6	49						intermediate filament (GO:0005882)				breast(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	9						TATCCTTCACGGCATGATGGG	0.493																																						dbGAP											0													110.0	120.0	117.0					21																	31914008		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708	CCDS13598.1	21q22.1	2010-09-30			ENSG00000186925	ENSG00000186925		"""Keratin associated proteins"""	18941	protein-coding gene	gene with protein product						12359730	Standard	NM_181612		Approved	KAP19.6	uc002yok.1	Q3LI70	OTTHUMG00000057779	ENST00000334046.5:c.145C>T	21.37:g.31914008G>A	ENSP00000375107:p.Arg49Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3LI71	Missense_Mutation	SNP	pfam_KRTAP	p.R49C	ENST00000334046.5	37	c.145	CCDS13598.1	21	.	.	.	.	.	.	.	.	.	.	g	6.431	0.447737	0.12223	.	.	ENSG00000186925	ENST00000334046;ENST00000437381	T	0.08634	3.07	4.39	3.22	0.36961	.	1.153980	0.07023	U	0.827077	T	0.08846	0.0219	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39921	-0.9590	9	0.87932	D	0	3.6947	8.7267	0.34474	0.896:0.0:0.104:0.0	.	49	Q3LI70	KR196_HUMAN	C	49	ENSP00000375107:R49C	ENSP00000375107:R49C	R	-	1	0	KRTAP19-6	30835879	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	1.010000	0.29898	0.190000	0.20209	-1.214000	0.01621	CGT	KRTAP19-6	-	pfam_KRTAP	ENSG00000186925		0.493	KRTAP19-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP19-6	HGNC	protein_coding	OTTHUMT00000128231.4	116	0.00	0	G			31914008	31914008	-1	no_errors	ENST00000334046	ensembl	human	known	69_37n	missense	106	19.55	26	SNP	0.000	A
LAX1	54900	genome.wustl.edu	37	1	203743475	203743475	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:203743475T>G	ENST00000442561.2	+	5	1253	c.863T>G	c.(862-864)tTt>tGt	p.F288C	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.F272C	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	288					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGGGTGGCTTTTCAGTGCTGC	0.493																																						dbGAP											0													61.0	62.0	62.0					1																	203743475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.863T>G	1.37:g.203743475T>G	ENSP00000406970:p.Phe288Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	NULL	p.F288C	ENST00000442561.2	37	c.863	CCDS1441.2	1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387755	0.61956	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.32	-1.31	0.09230	.	0.612389	0.15613	N	0.253269	T	0.37598	0.1009	L	0.58101	1.795	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.16722	0.016;0.016	T	0.34279	-0.9835	9	0.66056	D	0.02	-0.3679	4.6717	0.12692	0.0:0.2442:0.2942:0.4616	.	272;288	B7Z744;Q8IWV1	.;LAX1_HUMAN	C	288;272	.	ENSP00000356186:F272C	F	+	2	0	LAX1	202010098	0.002000	0.14202	0.006000	0.13384	0.559000	0.35586	0.459000	0.21908	-0.425000	0.07371	-0.313000	0.08912	TTT	LAX1	-	NULL	ENSG00000122188		0.493	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAX1	HGNC	protein_coding	OTTHUMT00000087468.3	40	0.00	0	T	NM_017773		203743475	203743475	+1	no_errors	ENST00000442561	ensembl	human	known	69_37n	missense	104	16.13	20	SNP	0.004	G
LAX1	54900	genome.wustl.edu	37	1	203743475	203743475	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:203743475T>G	ENST00000442561.2	+	5	1253	c.863T>G	c.(862-864)tTt>tGt	p.F288C	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.F272C	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	288					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGGGTGGCTTTTCAGTGCTGC	0.493																																						dbGAP											0													61.0	62.0	62.0					1																	203743475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.863T>G	1.37:g.203743475T>G	ENSP00000406970:p.Phe288Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	NULL	p.F288C	ENST00000442561.2	37	c.863	CCDS1441.2	1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387755	0.61956	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.32	-1.31	0.09230	.	0.612389	0.15613	N	0.253269	T	0.37598	0.1009	L	0.58101	1.795	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.16722	0.016;0.016	T	0.34279	-0.9835	9	0.66056	D	0.02	-0.3679	4.6717	0.12692	0.0:0.2442:0.2942:0.4616	.	272;288	B7Z744;Q8IWV1	.;LAX1_HUMAN	C	288;272	.	ENSP00000356186:F272C	F	+	2	0	LAX1	202010098	0.002000	0.14202	0.006000	0.13384	0.559000	0.35586	0.459000	0.21908	-0.425000	0.07371	-0.313000	0.08912	TTT	LAX1	-	NULL	ENSG00000122188		0.493	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAX1	HGNC	protein_coding	OTTHUMT00000087468.3	59	0.00	0	T	NM_017773		203743475	203743475	+1	no_errors	ENST00000442561	ensembl	human	known	69_37n	missense	104	16.13	20	SNP	0.004	G
LBR	3930	genome.wustl.edu	37	1	225610003	225610003	+	Intron	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:225610003G>C	ENST00000338179.2	-	3	291				LBR_ENST00000487054.1_5'Flank|LBR_ENST00000272163.4_Intron	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor						cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AGAAGGCAAAGAGCTTTACCA	0.463																																						dbGAP											0													24.0	23.0	23.0					1																	225610003		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.166-24C>G	1.37:g.225610003G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5P3|Q14740|Q53GU7|Q59FE6	RNA	SNP	-	NULL	ENST00000338179.2	37	NULL	CCDS1545.1	1																																																																																			LBR	-	-	ENSG00000143815		0.463	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LBR	HGNC	protein_coding	OTTHUMT00000091398.1	25	0.00	0	G	NM_002296		225610003	225610003	-1	no_errors	ENST00000488632	ensembl	human	known	69_37n	rna	35	18.60	8	SNP	0.000	C
LBR	3930	genome.wustl.edu	37	1	225610003	225610003	+	Intron	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:225610003G>C	ENST00000338179.2	-	3	291				LBR_ENST00000487054.1_5'Flank|LBR_ENST00000272163.4_Intron	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor						cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AGAAGGCAAAGAGCTTTACCA	0.463																																						dbGAP											0													24.0	23.0	23.0					1																	225610003		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.166-24C>G	1.37:g.225610003G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5P3|Q14740|Q53GU7|Q59FE6	RNA	SNP	-	NULL	ENST00000338179.2	37	NULL	CCDS1545.1	1																																																																																			LBR	-	-	ENSG00000143815		0.463	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LBR	HGNC	protein_coding	OTTHUMT00000091398.1	20	0.00	0	G	NM_002296		225610003	225610003	-1	no_errors	ENST00000488632	ensembl	human	known	69_37n	rna	35	18.60	8	SNP	0.000	C
LDLR	3949	genome.wustl.edu	37	19	11241989	11241989	+	Silent	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr19:11241989G>A	ENST00000558518.1	+	18	2767	c.2580G>A	c.(2578-2580)gcG>gcA	p.A860A	LDLR_ENST00000560628.1_Intron|LDLR_ENST00000545707.1_Silent_p.A682A|LDLR_ENST00000535915.1_Silent_p.A819A|LDLR_ENST00000557933.1_Missense_Mutation_p.R881H|LDLR_ENST00000455727.2_Silent_p.A692A|LDLR_ENST00000558013.1_Silent_p.A858A	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	860	Required for MYLIP-triggered down- regulation of LDLR.				cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	ATGACGTGGCGTGAACATCTG	0.542											OREG0025249	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(18;201 575 7820 21545)	dbGAP											0													237.0	198.0	211.0					19																	11241989		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.2580G>A	19.37:g.11241989G>A		Somatic	670	WXS	Illumina GAIIx	Phase_IV	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.R881H	ENST00000558518.1	37	c.2642	CCDS12254.1	19																																																																																			LDLR	-	NULL	ENSG00000130164		0.542	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	HGNC	protein_coding	OTTHUMT00000415973.2	51	0.00	0	G			11241989	11241989	+1	no_errors	ENST00000557933	ensembl	human	novel	69_37n	missense	72	23.40	22	SNP	0.180	A
LDLR	3949	genome.wustl.edu	37	19	11241989	11241989	+	Silent	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr19:11241989G>A	ENST00000558518.1	+	18	2767	c.2580G>A	c.(2578-2580)gcG>gcA	p.A860A	LDLR_ENST00000560628.1_Intron|LDLR_ENST00000545707.1_Silent_p.A682A|LDLR_ENST00000535915.1_Silent_p.A819A|LDLR_ENST00000557933.1_Missense_Mutation_p.R881H|LDLR_ENST00000455727.2_Silent_p.A692A|LDLR_ENST00000558013.1_Silent_p.A858A	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	860	Required for MYLIP-triggered down- regulation of LDLR.				cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	ATGACGTGGCGTGAACATCTG	0.542											OREG0025249	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(18;201 575 7820 21545)	dbGAP											0													237.0	198.0	211.0					19																	11241989		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.2580G>A	19.37:g.11241989G>A		Somatic	670	WXS	Illumina GAIIx	Phase_IV	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.R881H	ENST00000558518.1	37	c.2642	CCDS12254.1	19																																																																																			LDLR	-	NULL	ENSG00000130164		0.542	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	HGNC	protein_coding	OTTHUMT00000415973.2	66	0.00	0	G			11241989	11241989	+1	no_errors	ENST00000557933	ensembl	human	novel	69_37n	missense	72	23.40	22	SNP	0.180	A
LINC00299	339789	genome.wustl.edu	37	2	8437158	8437158	+	lincRNA	SNP	C	C	A	rs143827959	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:8437158C>A	ENST00000442956.1	-	0	776							Q6ZSB3	CB046_HUMAN	long intergenic non-protein coding RNA 299																		gagcaattcccagtgagagag	0.502													C|||	5	0.000998403	0.0038	0.0	5008	,	,		20068	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			AK127578		2p25.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000236790	ENSG00000236790		"""Long non-coding RNAs"""	27940	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 46"", ""non-protein coding RNA 299"""	C2orf46, NCRNA00299		12477932	Standard	NR_034135		Approved	FLJ45673	uc002qyy.1	Q6ZSB3	OTTHUMG00000112455		2.37:g.8437158C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000442956.1	37	NULL		2																																																																																			LINC00299	-	-	ENSG00000236790		0.502	LINC00299-001	KNOWN	basic	lincRNA	LINC00299	HGNC	lincRNA	OTTHUMT00000231926.3	26	0.00	0	C	NR_034135		8437158	8437158	-1	no_errors	ENST00000442956	ensembl	human	known	69_37n	rna	33	12.82	5	SNP	0.421	A
LINC00299	339789	genome.wustl.edu	37	2	8437158	8437158	+	lincRNA	SNP	C	C	A	rs143827959	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:8437158C>A	ENST00000442956.1	-	0	776							Q6ZSB3	CB046_HUMAN	long intergenic non-protein coding RNA 299																		gagcaattcccagtgagagag	0.502													C|||	5	0.000998403	0.0038	0.0	5008	,	,		20068	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			AK127578		2p25.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000236790	ENSG00000236790		"""Long non-coding RNAs"""	27940	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 46"", ""non-protein coding RNA 299"""	C2orf46, NCRNA00299		12477932	Standard	NR_034135		Approved	FLJ45673	uc002qyy.1	Q6ZSB3	OTTHUMG00000112455		2.37:g.8437158C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000442956.1	37	NULL		2																																																																																			LINC00299	-	-	ENSG00000236790		0.502	LINC00299-001	KNOWN	basic	lincRNA	LINC00299	HGNC	lincRNA	OTTHUMT00000231926.3	38	0.00	0	C	NR_034135		8437158	8437158	-1	no_errors	ENST00000442956	ensembl	human	known	69_37n	rna	33	12.82	5	SNP	0.421	A
LMCD1	29995	genome.wustl.edu	37	3	8556671	8556671	+	Intron	SNP	T	T	G	rs60137047	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr3:8556671T>G	ENST00000157600.3	+	1	274				LMCD1-AS1_ENST00000439407.1_RNA|LMCD1_ENST00000397386.3_Intron|LMCD1_ENST00000454244.1_Intron|LMCD1_ENST00000535732.1_Intron	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		attggtgcatttcgaccgcat	0.368													T|||	748	0.149361	0.143	0.0951	5008	,	,		18660	0.1161		0.1183	False		,,,				2504	0.2628					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.42+13005T>G	3.37:g.8556671T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG80	Missense_Mutation	SNP	pfam_PET_domain	p.F17C	ENST00000157600.3	37	c.50	CCDS33688.1	3	274	0.12545787545787546	89	0.18089430894308944	35	0.09668508287292818	58	0.10139860139860139	92	0.12137203166226913	T	4.426	0.078732	0.08533	.	.	ENSG00000071282	ENST00000415597	D	0.85955	-2.05	2.15	0.0725	0.14387	.	.	.	.	.	T	0.00608	0.0020	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.35151	-0.9800	5	0.59425	D	0.04	.	4.4568	0.11647	0.5038:0.0:0.0:0.4962	rs60137047	.	.	.	C	17	ENSP00000400555:F17C	ENSP00000400555:F17C	F	+	2	0	LMCD1	8531671	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	0.119000	0.15626	0.011000	0.14865	0.383000	0.25322	TTT	LMCD1	-	NULL	ENSG00000071282		0.368	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMCD1	HGNC	protein_coding	OTTHUMT00000337854.1	39	0.00	0	T	NM_014583		8556671	8556671	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000415597	ensembl	human	novel	69_37n	missense	62	10.14	7	SNP	0.001	G
LMCD1	29995	genome.wustl.edu	37	3	8556671	8556671	+	Intron	SNP	T	T	G	rs60137047	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr3:8556671T>G	ENST00000157600.3	+	1	274				LMCD1-AS1_ENST00000439407.1_RNA|LMCD1_ENST00000397386.3_Intron|LMCD1_ENST00000454244.1_Intron|LMCD1_ENST00000535732.1_Intron	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		attggtgcatttcgaccgcat	0.368													T|||	748	0.149361	0.143	0.0951	5008	,	,		18660	0.1161		0.1183	False		,,,				2504	0.2628					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.42+13005T>G	3.37:g.8556671T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG80	Missense_Mutation	SNP	pfam_PET_domain	p.F17C	ENST00000157600.3	37	c.50	CCDS33688.1	3	274	0.12545787545787546	89	0.18089430894308944	35	0.09668508287292818	58	0.10139860139860139	92	0.12137203166226913	T	4.426	0.078732	0.08533	.	.	ENSG00000071282	ENST00000415597	D	0.85955	-2.05	2.15	0.0725	0.14387	.	.	.	.	.	T	0.00608	0.0020	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.35151	-0.9800	5	0.59425	D	0.04	.	4.4568	0.11647	0.5038:0.0:0.0:0.4962	rs60137047	.	.	.	C	17	ENSP00000400555:F17C	ENSP00000400555:F17C	F	+	2	0	LMCD1	8531671	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	0.119000	0.15626	0.011000	0.14865	0.383000	0.25322	TTT	LMCD1	-	NULL	ENSG00000071282		0.368	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMCD1	HGNC	protein_coding	OTTHUMT00000337854.1	49	0.00	0	T	NM_014583		8556671	8556671	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000415597	ensembl	human	novel	69_37n	missense	62	10.14	7	SNP	0.001	G
LTBP4	8425	genome.wustl.edu	37	19	41123062	41123062	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr19:41123062C>T	ENST00000308370.7	+	24	3202	c.3202C>T	c.(3202-3204)Ctg>Ttg	p.L1068L	LTBP4_ENST00000204005.9_Silent_p.L1031L|LTBP4_ENST00000545697.1_Intron|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000243562.9_Silent_p.L122L|LTBP4_ENST00000396819.3_Silent_p.L1001L	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1068	Cys-rich.|EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTGCCAGAACCTGCCCGGCTC	0.617																																						dbGAP											0													47.0	53.0	51.0					19																	41123062		2035	4208	6243	-	-	-	SO:0001819	synonymous_variant	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3202C>T	19.37:g.41123062C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.L1068	ENST00000308370.7	37	c.3202		19																																																																																			LTBP4	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000090006		0.617	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		165	0.00	0	C	NM_003573		41123062	41123062	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	silent	136	21.84	38	SNP	1.000	T
LTBP4	8425	genome.wustl.edu	37	19	41123062	41123062	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr19:41123062C>T	ENST00000308370.7	+	24	3202	c.3202C>T	c.(3202-3204)Ctg>Ttg	p.L1068L	LTBP4_ENST00000204005.9_Silent_p.L1031L|LTBP4_ENST00000545697.1_Intron|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000243562.9_Silent_p.L122L|LTBP4_ENST00000396819.3_Silent_p.L1001L	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1068	Cys-rich.|EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTGCCAGAACCTGCCCGGCTC	0.617																																						dbGAP											0													47.0	53.0	51.0					19																	41123062		2035	4208	6243	-	-	-	SO:0001819	synonymous_variant	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3202C>T	19.37:g.41123062C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.L1068	ENST00000308370.7	37	c.3202		19																																																																																			LTBP4	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000090006		0.617	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		177	0.00	0	C	NM_003573		41123062	41123062	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	silent	136	21.84	38	SNP	1.000	T
MORN4	118812	genome.wustl.edu	37	10	99379309	99379309	+	Intron	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr10:99379309G>C	ENST00000307450.6	-	2	231				MORN4_ENST00000478953.1_Intron|PI4K2A_ENST00000555577.1_Intron|MORN4_ENST00000335628.3_Intron|MORN4_ENST00000370635.3_Missense_Mutation_p.N34K|PI4K2A_ENST00000370649.3_Intron	NM_001098831.1|NM_178832.3	NP_001092301.1|NP_849154.1	Q8NDC4	MORN4_HUMAN	MORN repeat containing 4											large_intestine(1)|lung(1)|stomach(2)	4						CAAATGAAGTGTTCATCATGG	0.458																																						dbGAP											0													96.0	92.0	93.0					10																	99379309		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ431726	CCDS7468.1	10q24.2	2008-06-23	2008-06-23	2008-06-23	ENSG00000171160	ENSG00000171160			24001	protein-coding gene	gene with protein product	"""44050 protein"""		"""chromosome 10 open reading frame 83"""	C10orf83		12477932	Standard	NM_178832		Approved	bA548K23.4, FLJ25925	uc001koe.3	Q8NDC4	OTTHUMG00000018861	ENST00000307450.6:c.67+34C>G	10.37:g.99379309G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86Y54	Missense_Mutation	SNP	NULL	p.N34K	ENST00000307450.6	37	c.102	CCDS7468.1	10	.	.	.	.	.	.	.	.	.	.	G	7.328	0.618308	0.14129	.	.	ENSG00000171160	ENST00000370635	.	.	.	4.84	0.702	0.18110	.	.	.	.	.	T	0.37625	0.1010	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34030	-0.9845	5	0.59425	D	0.04	.	5.9214	0.19084	0.2294:0.0:0.6378:0.1328	.	.	.	.	K	34	.	ENSP00000359669:N34K	N	-	3	2	MORN4	99369299	0.000000	0.05858	0.001000	0.08648	0.074000	0.17049	-0.994000	0.03716	0.259000	0.21709	0.561000	0.74099	AAC	MORN4	-	NULL	ENSG00000171160		0.458	MORN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MORN4	HGNC	protein_coding	OTTHUMT00000049730.1	34	0.00	0	G	NM_178832		99379309	99379309	-1	no_errors	ENST00000370635	ensembl	human	novel	69_37n	missense	48	34.25	25	SNP	0.001	C
MORN4	118812	genome.wustl.edu	37	10	99379309	99379309	+	Intron	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr10:99379309G>C	ENST00000307450.6	-	2	231				MORN4_ENST00000478953.1_Intron|PI4K2A_ENST00000555577.1_Intron|MORN4_ENST00000335628.3_Intron|MORN4_ENST00000370635.3_Missense_Mutation_p.N34K|PI4K2A_ENST00000370649.3_Intron	NM_001098831.1|NM_178832.3	NP_001092301.1|NP_849154.1	Q8NDC4	MORN4_HUMAN	MORN repeat containing 4											large_intestine(1)|lung(1)|stomach(2)	4						CAAATGAAGTGTTCATCATGG	0.458																																						dbGAP											0													96.0	92.0	93.0					10																	99379309		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ431726	CCDS7468.1	10q24.2	2008-06-23	2008-06-23	2008-06-23	ENSG00000171160	ENSG00000171160			24001	protein-coding gene	gene with protein product	"""44050 protein"""		"""chromosome 10 open reading frame 83"""	C10orf83		12477932	Standard	NM_178832		Approved	bA548K23.4, FLJ25925	uc001koe.3	Q8NDC4	OTTHUMG00000018861	ENST00000307450.6:c.67+34C>G	10.37:g.99379309G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86Y54	Missense_Mutation	SNP	NULL	p.N34K	ENST00000307450.6	37	c.102	CCDS7468.1	10	.	.	.	.	.	.	.	.	.	.	G	7.328	0.618308	0.14129	.	.	ENSG00000171160	ENST00000370635	.	.	.	4.84	0.702	0.18110	.	.	.	.	.	T	0.37625	0.1010	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34030	-0.9845	5	0.59425	D	0.04	.	5.9214	0.19084	0.2294:0.0:0.6378:0.1328	.	.	.	.	K	34	.	ENSP00000359669:N34K	N	-	3	2	MORN4	99369299	0.000000	0.05858	0.001000	0.08648	0.074000	0.17049	-0.994000	0.03716	0.259000	0.21709	0.561000	0.74099	AAC	MORN4	-	NULL	ENSG00000171160		0.458	MORN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MORN4	HGNC	protein_coding	OTTHUMT00000049730.1	65	0.00	0	G	NM_178832		99379309	99379309	-1	no_errors	ENST00000370635	ensembl	human	novel	69_37n	missense	48	34.25	25	SNP	0.001	C
MRGPRX2	117194	genome.wustl.edu	37	11	19077008	19077008	+	Silent	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr11:19077008T>C	ENST00000329773.2	-	2	1029	c.942A>G	c.(940-942)gaA>gaG	p.E314E		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	314					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GGAAGCATCCTTCACTGTGAT	0.557																																					GBM(198;1966 2199 4849 37227 49954)	dbGAP											0													66.0	68.0	67.0					11																	19077008		2199	4293	6492	-	-	-	SO:0001819	synonymous_variant	0				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.942A>G	11.37:g.19077008T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.E314	ENST00000329773.2	37	c.942	CCDS7847.1	11																																																																																			MRGPRX2	-	NULL	ENSG00000183695		0.557	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX2	HGNC	protein_coding	OTTHUMT00000387819.1	47	0.00	0	T	NM_054030		19077008	19077008	-1	no_errors	ENST00000329773	ensembl	human	known	69_37n	silent	64	21.43	18	SNP	0.000	C
MRGPRX2	117194	genome.wustl.edu	37	11	19077008	19077008	+	Silent	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr11:19077008T>C	ENST00000329773.2	-	2	1029	c.942A>G	c.(940-942)gaA>gaG	p.E314E		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	314					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GGAAGCATCCTTCACTGTGAT	0.557																																					GBM(198;1966 2199 4849 37227 49954)	dbGAP											0													66.0	68.0	67.0					11																	19077008		2199	4293	6492	-	-	-	SO:0001819	synonymous_variant	0				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.942A>G	11.37:g.19077008T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.E314	ENST00000329773.2	37	c.942	CCDS7847.1	11																																																																																			MRGPRX2	-	NULL	ENSG00000183695		0.557	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX2	HGNC	protein_coding	OTTHUMT00000387819.1	56	0.00	0	T	NM_054030		19077008	19077008	-1	no_errors	ENST00000329773	ensembl	human	known	69_37n	silent	64	21.43	18	SNP	0.000	C
MUC20	200958	genome.wustl.edu	37	3	195453258	195453258	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr3:195453258C>A	ENST00000447234.2	+	2	1910	c.1784C>A	c.(1783-1785)gCa>gAa	p.A595E	MUC20_ENST00000320736.6_Missense_Mutation_p.A424E|MUC20_ENST00000445522.2_Missense_Mutation_p.A560E|MUC20_ENST00000436408.1_Missense_Mutation_p.A595E	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	595	Involved in oligomerization.|Thr-rich.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		ATGGACATCGCAACCAAGGGG	0.582																																						dbGAP											0													62.0	60.0	60.0					3																	195453258		2075	4196	6271	-	-	-	SO:0001583	missense	0			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1784C>A	3.37:g.195453258C>A	ENSP00000414350:p.Ala595Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	NULL	p.A595E	ENST00000447234.2	37	c.1784		3	.	.	.	.	.	.	.	.	.	.	C	9.121	1.008903	0.19199	.	.	ENSG00000176945	ENST00000381954;ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.16196	2.79;2.81;2.96;2.36	4.48	0.438	0.16560	.	0.826684	0.10455	N	0.672700	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32851	-0.9891	10	0.72032	D	0.01	-0.0298	7.7514	0.28898	0.0:0.4315:0.4743:0.0942	.	424	E9PH32	.	E	406;595;424;595;560	ENSP00000414350:A595E;ENSP00000325431:A424E;ENSP00000396774:A595E;ENSP00000405629:A560E	ENSP00000325431:A424E	A	+	2	0	MUC20	196938929	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.216000	0.09266	-0.029000	0.13827	0.558000	0.71614	GCA	MUC20	-	NULL	ENSG00000176945		0.582	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	HGNC	protein_coding	OTTHUMT00000341835.1	38	0.00	0	C	NM_152673		195453258	195453258	+1	no_errors	ENST00000447234	ensembl	human	known	69_37n	missense	82	15.46	15	SNP	0.001	A
MUC20	200958	genome.wustl.edu	37	3	195453258	195453258	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr3:195453258C>A	ENST00000447234.2	+	2	1910	c.1784C>A	c.(1783-1785)gCa>gAa	p.A595E	MUC20_ENST00000320736.6_Missense_Mutation_p.A424E|MUC20_ENST00000445522.2_Missense_Mutation_p.A560E|MUC20_ENST00000436408.1_Missense_Mutation_p.A595E	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	595	Involved in oligomerization.|Thr-rich.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		ATGGACATCGCAACCAAGGGG	0.582																																						dbGAP											0													62.0	60.0	60.0					3																	195453258		2075	4196	6271	-	-	-	SO:0001583	missense	0			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1784C>A	3.37:g.195453258C>A	ENSP00000414350:p.Ala595Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	NULL	p.A595E	ENST00000447234.2	37	c.1784		3	.	.	.	.	.	.	.	.	.	.	C	9.121	1.008903	0.19199	.	.	ENSG00000176945	ENST00000381954;ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.16196	2.79;2.81;2.96;2.36	4.48	0.438	0.16560	.	0.826684	0.10455	N	0.672700	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32851	-0.9891	10	0.72032	D	0.01	-0.0298	7.7514	0.28898	0.0:0.4315:0.4743:0.0942	.	424	E9PH32	.	E	406;595;424;595;560	ENSP00000414350:A595E;ENSP00000325431:A424E;ENSP00000396774:A595E;ENSP00000405629:A560E	ENSP00000325431:A424E	A	+	2	0	MUC20	196938929	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.216000	0.09266	-0.029000	0.13827	0.558000	0.71614	GCA	MUC20	-	NULL	ENSG00000176945		0.582	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	HGNC	protein_coding	OTTHUMT00000341835.1	45	0.00	0	C	NM_152673		195453258	195453258	+1	no_errors	ENST00000447234	ensembl	human	known	69_37n	missense	82	15.46	15	SNP	0.001	A
NCR3LG1	374383	genome.wustl.edu	37	11	17393584	17393584	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr11:17393584C>T	ENST00000338965.4	+	5	1134	c.890C>T	c.(889-891)cCt>cTt	p.P297L		NM_001202439.1	NP_001189368.1	Q68D85	NR3L1_HUMAN	natural killer cell cytotoxicity receptor 3 ligand 1	297	Retroviral-Gag-like.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral capsid (GO:0019028)	structural molecule activity (GO:0005198)										gcctatactcctctcaagtgc	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55748.1	11p15.1	2014-01-30			ENSG00000188211	ENSG00000188211		"""Immunoglobulin superfamily / C1-set domain containing"", ""Endogenous ligands"""	42400	protein-coding gene	gene with protein product	"""B7 homolog 6"""	613714				19528259	Standard	XR_242803		Approved	DKFZp686O24166, B7-H6	uc001mmz.4	Q68D85	OTTHUMG00000165913	ENST00000338965.4:c.890C>T	11.37:g.17393584C>T	ENSP00000341637:p.Pro297Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3M6	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_G_retro_matrix_N,pfam_CD80_C2-set,superfamily_Retrovr_matrix_N,smart_Ig_sub,smart_Ig_C1-set,pfscan_Ig-like	p.P297L	ENST00000338965.4	37	c.890	CCDS55748.1	11	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687830	0.29962	.	.	ENSG00000188211	ENST00000338965	T	0.01203	5.18	0.109	0.109	0.14578	Retroviral matrix, N-terminal (1);Gamma-retroviral matrix, N-terminal (2);	.	.	.	.	T	0.02380	0.0073	L	0.27053	0.805	0.09310	N	0.999996	D	0.69078	0.997	D	0.71870	0.975	T	0.52147	-0.8614	8	0.56958	D	0.05	.	.	.	.	.	297	Q68D85	B7H6_HUMAN	L	297	ENSP00000341637:P297L	ENSP00000341637:P297L	P	+	2	0	RP1-239B22.1	17350160	0.444000	0.25649	0.222000	0.23844	0.224000	0.24922	0.203000	0.17315	0.181000	0.19994	0.184000	0.17185	CCT	NCR3LG1	-	pfam_G_retro_matrix_N,superfamily_Retrovr_matrix_N	ENSG00000188211		0.448	NCR3LG1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NCR3LG1	HGNC	protein_coding	OTTHUMT00000387035.2	60	0.00	0	C	NM_001202439		17393584	17393584	+1	no_errors	ENST00000530403	ensembl	human	known	69_37n	missense	64	17.95	14	SNP	0.265	T
NCR3LG1	374383	genome.wustl.edu	37	11	17393584	17393584	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr11:17393584C>T	ENST00000338965.4	+	5	1134	c.890C>T	c.(889-891)cCt>cTt	p.P297L		NM_001202439.1	NP_001189368.1	Q68D85	NR3L1_HUMAN	natural killer cell cytotoxicity receptor 3 ligand 1	297	Retroviral-Gag-like.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral capsid (GO:0019028)	structural molecule activity (GO:0005198)										gcctatactcctctcaagtgc	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55748.1	11p15.1	2014-01-30			ENSG00000188211	ENSG00000188211		"""Immunoglobulin superfamily / C1-set domain containing"", ""Endogenous ligands"""	42400	protein-coding gene	gene with protein product	"""B7 homolog 6"""	613714				19528259	Standard	XR_242803		Approved	DKFZp686O24166, B7-H6	uc001mmz.4	Q68D85	OTTHUMG00000165913	ENST00000338965.4:c.890C>T	11.37:g.17393584C>T	ENSP00000341637:p.Pro297Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3M6	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_G_retro_matrix_N,pfam_CD80_C2-set,superfamily_Retrovr_matrix_N,smart_Ig_sub,smart_Ig_C1-set,pfscan_Ig-like	p.P297L	ENST00000338965.4	37	c.890	CCDS55748.1	11	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687830	0.29962	.	.	ENSG00000188211	ENST00000338965	T	0.01203	5.18	0.109	0.109	0.14578	Retroviral matrix, N-terminal (1);Gamma-retroviral matrix, N-terminal (2);	.	.	.	.	T	0.02380	0.0073	L	0.27053	0.805	0.09310	N	0.999996	D	0.69078	0.997	D	0.71870	0.975	T	0.52147	-0.8614	8	0.56958	D	0.05	.	.	.	.	.	297	Q68D85	B7H6_HUMAN	L	297	ENSP00000341637:P297L	ENSP00000341637:P297L	P	+	2	0	RP1-239B22.1	17350160	0.444000	0.25649	0.222000	0.23844	0.224000	0.24922	0.203000	0.17315	0.181000	0.19994	0.184000	0.17185	CCT	NCR3LG1	-	pfam_G_retro_matrix_N,superfamily_Retrovr_matrix_N	ENSG00000188211		0.448	NCR3LG1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NCR3LG1	HGNC	protein_coding	OTTHUMT00000387035.2	61	0.00	0	C	NM_001202439		17393584	17393584	+1	no_errors	ENST00000530403	ensembl	human	known	69_37n	missense	64	17.95	14	SNP	0.265	T
NDUFB2	4708	genome.wustl.edu	37	7	140397150	140397150	+	Intron	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:140397150C>G	ENST00000476279.1	+	1	172				NDUFB2_ENST00000476470.1_Intron|NDUFB2_ENST00000460088.1_Intron|NDUFB2_ENST00000204307.5_Intron|NDUFB2_ENST00000482954.1_Intron|NDUFB2_ENST00000472695.1_Intron|NDUFB2_ENST00000461457.1_Intron|NDUFB2_ENST00000247866.4_Intron|NDUFB2-AS1_ENST00000465466.1_RNA|NDUFB2_ENST00000464564.2_Intron|NDUFB2_ENST00000471136.1_Silent_p.G7G|NDUFB2_ENST00000465506.1_Intron			O95178	NDUB2_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|stomach(1)	10	Melanoma(164;0.00956)					ATCACTCTGGCTGCAGGGAGT	0.597																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF050639	CCDS5862.1	7q34	2011-07-04	2002-08-29		ENSG00000090266	ENSG00000090266		"""Mitochondrial respiratory chain complex / Complex I"""	7697	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase AGGG subunit"", ""complex I AGGG subunit"""	603838	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 (8kD, AGGG)"""			9763677, 9878551	Standard	NM_004546		Approved	AGGG, CI-AGGG	uc003vwa.3	O95178	OTTHUMG00000157424	ENST00000476279.1:c.98+508C>G	7.37:g.140397150C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FGI6	Silent	SNP	NULL	p.G7	ENST00000476279.1	37	c.21	CCDS5862.1	7																																																																																			NDUFB2	-	NULL	ENSG00000090266		0.597	NDUFB2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	NDUFB2	HGNC	protein_coding	OTTHUMT00000348784.1	114	0.00	0	C	NM_004546		140397150	140397150	+1	no_errors	ENST00000471136	ensembl	human	putative	69_37n	silent	173	11.73	23	SNP	0.000	G
NDUFB2	4708	genome.wustl.edu	37	7	140397150	140397150	+	Intron	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:140397150C>G	ENST00000476279.1	+	1	172				NDUFB2_ENST00000476470.1_Intron|NDUFB2_ENST00000460088.1_Intron|NDUFB2_ENST00000204307.5_Intron|NDUFB2_ENST00000482954.1_Intron|NDUFB2_ENST00000472695.1_Intron|NDUFB2_ENST00000461457.1_Intron|NDUFB2_ENST00000247866.4_Intron|NDUFB2-AS1_ENST00000465466.1_RNA|NDUFB2_ENST00000464564.2_Intron|NDUFB2_ENST00000471136.1_Silent_p.G7G|NDUFB2_ENST00000465506.1_Intron			O95178	NDUB2_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|stomach(1)	10	Melanoma(164;0.00956)					ATCACTCTGGCTGCAGGGAGT	0.597																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF050639	CCDS5862.1	7q34	2011-07-04	2002-08-29		ENSG00000090266	ENSG00000090266		"""Mitochondrial respiratory chain complex / Complex I"""	7697	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase AGGG subunit"", ""complex I AGGG subunit"""	603838	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 (8kD, AGGG)"""			9763677, 9878551	Standard	NM_004546		Approved	AGGG, CI-AGGG	uc003vwa.3	O95178	OTTHUMG00000157424	ENST00000476279.1:c.98+508C>G	7.37:g.140397150C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FGI6	Silent	SNP	NULL	p.G7	ENST00000476279.1	37	c.21	CCDS5862.1	7																																																																																			NDUFB2	-	NULL	ENSG00000090266		0.597	NDUFB2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	NDUFB2	HGNC	protein_coding	OTTHUMT00000348784.1	127	0.00	0	C	NM_004546		140397150	140397150	+1	no_errors	ENST00000471136	ensembl	human	putative	69_37n	silent	173	11.73	23	SNP	0.000	G
NFKBIZ	64332	genome.wustl.edu	37	3	101572246	101572246	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr3:101572246G>C	ENST00000326172.5	+	5	991	c.876G>C	c.(874-876)caG>caC	p.Q292H	NFKBIZ_ENST00000394054.2_Missense_Mutation_p.Q192H|NFKBIZ_ENST00000326151.5_Intron	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	292					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						ATTCTCCACAGAACCAGCATG	0.517																																						dbGAP											0													117.0	113.0	114.0					3																	101572246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.876G>C	3.37:g.101572246G>C	ENSP00000325663:p.Gln292His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.Q292H	ENST00000326172.5	37	c.876	CCDS2946.1	3	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334241	0.60853	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326172	T;T;T	0.58060	0.41;0.36;0.43	5.6	4.73	0.59995	.	0.711165	0.13480	N	0.384816	T	0.60560	0.2278	M	0.64997	1.995	0.32303	N	0.56482	P	0.47409	0.895	P	0.51487	0.671	T	0.68542	-0.5381	10	0.66056	D	0.02	-17.0675	10.3104	0.43706	0.1493:0.0:0.8507:0.0	.	292	Q9BYH8	IKBZ_HUMAN	H	192;192;292	ENSP00000419800:Q192H;ENSP00000377618:Q192H;ENSP00000325663:Q292H	ENSP00000325663:Q292H	Q	+	3	2	NFKBIZ	103054936	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	3.531000	0.53546	1.355000	0.45865	0.563000	0.77884	CAG	NFKBIZ	-	NULL	ENSG00000144802		0.517	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	56	0.00	0	G	NM_031419		101572246	101572246	+1	no_errors	ENST00000326172	ensembl	human	known	69_37n	missense	68	20.00	17	SNP	1.000	C
NFKBIZ	64332	genome.wustl.edu	37	3	101572246	101572246	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr3:101572246G>C	ENST00000326172.5	+	5	991	c.876G>C	c.(874-876)caG>caC	p.Q292H	NFKBIZ_ENST00000394054.2_Missense_Mutation_p.Q192H|NFKBIZ_ENST00000326151.5_Intron	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	292					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						ATTCTCCACAGAACCAGCATG	0.517																																						dbGAP											0													117.0	113.0	114.0					3																	101572246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.876G>C	3.37:g.101572246G>C	ENSP00000325663:p.Gln292His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.Q292H	ENST00000326172.5	37	c.876	CCDS2946.1	3	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334241	0.60853	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326172	T;T;T	0.58060	0.41;0.36;0.43	5.6	4.73	0.59995	.	0.711165	0.13480	N	0.384816	T	0.60560	0.2278	M	0.64997	1.995	0.32303	N	0.56482	P	0.47409	0.895	P	0.51487	0.671	T	0.68542	-0.5381	10	0.66056	D	0.02	-17.0675	10.3104	0.43706	0.1493:0.0:0.8507:0.0	.	292	Q9BYH8	IKBZ_HUMAN	H	192;192;292	ENSP00000419800:Q192H;ENSP00000377618:Q192H;ENSP00000325663:Q292H	ENSP00000325663:Q292H	Q	+	3	2	NFKBIZ	103054936	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	3.531000	0.53546	1.355000	0.45865	0.563000	0.77884	CAG	NFKBIZ	-	NULL	ENSG00000144802		0.517	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	66	0.00	0	G	NM_031419		101572246	101572246	+1	no_errors	ENST00000326172	ensembl	human	known	69_37n	missense	68	20.00	17	SNP	1.000	C
NPTXR	23467	genome.wustl.edu	37	22	39222746	39222746	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr22:39222746G>T	ENST00000333039.2	-	3	980	c.857C>A	c.(856-858)tCa>tAa	p.S286*		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	286						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					ACTGTAGGCTGAGGACCCTGA	0.587																																					Pancreas(139;2521 3281 36965)	dbGAP											0													87.0	83.0	84.0					22																	39222746		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.857C>A	22.37:g.39222746G>T	ENSP00000327545:p.Ser286*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.S286*	ENST00000333039.2	37	c.857	CCDS33647.1	22	.	.	.	.	.	.	.	.	.	.	G	37	6.283188	0.97440	.	.	ENSG00000221890	ENST00000333039	.	.	.	4.64	4.64	0.57946	.	0.515252	0.20012	N	0.101092	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.7374	14.1736	0.65527	0.0756:0.0:0.9244:0.0	.	.	.	.	X	286	.	ENSP00000327545:S286X	S	-	2	0	NPTXR	37552692	1.000000	0.71417	0.977000	0.42913	0.968000	0.65278	4.986000	0.63851	2.861000	0.98227	0.655000	0.94253	TCA	NPTXR	-	NULL	ENSG00000221890		0.587	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2	30	0.00	0	G	NM_014293		39222746	39222746	-1	no_errors	ENST00000333039	ensembl	human	known	69_37n	nonsense	30	16.22	6	SNP	0.660	T
NPTXR	23467	genome.wustl.edu	37	22	39222746	39222746	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr22:39222746G>T	ENST00000333039.2	-	3	980	c.857C>A	c.(856-858)tCa>tAa	p.S286*		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	286						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					ACTGTAGGCTGAGGACCCTGA	0.587																																					Pancreas(139;2521 3281 36965)	dbGAP											0													87.0	83.0	84.0					22																	39222746		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.857C>A	22.37:g.39222746G>T	ENSP00000327545:p.Ser286*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.S286*	ENST00000333039.2	37	c.857	CCDS33647.1	22	.	.	.	.	.	.	.	.	.	.	G	37	6.283188	0.97440	.	.	ENSG00000221890	ENST00000333039	.	.	.	4.64	4.64	0.57946	.	0.515252	0.20012	N	0.101092	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.7374	14.1736	0.65527	0.0756:0.0:0.9244:0.0	.	.	.	.	X	286	.	ENSP00000327545:S286X	S	-	2	0	NPTXR	37552692	1.000000	0.71417	0.977000	0.42913	0.968000	0.65278	4.986000	0.63851	2.861000	0.98227	0.655000	0.94253	TCA	NPTXR	-	NULL	ENSG00000221890		0.587	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2	37	0.00	0	G	NM_014293		39222746	39222746	-1	no_errors	ENST00000333039	ensembl	human	known	69_37n	nonsense	30	16.22	6	SNP	0.660	T
OR10J5	127385	genome.wustl.edu	37	1	159505095	159505095	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:159505095T>C	ENST00000334857.2	-	1	747	c.703A>G	c.(703-705)Aag>Gag	p.K235E		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					GCAAAGGTCTTCTTCCGGCCC	0.473																																						dbGAP											0													85.0	83.0	84.0					1																	159505095		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.703A>G	1.37:g.159505095T>C	ENSP00000334441:p.Lys235Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH35|Q6IFH2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K235E	ENST00000334857.2	37	c.703	CCDS30910.1	1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544062	0.45280	.	.	ENSG00000184155	ENST00000334857	T	0.00364	7.81	4.13	3.0	0.34707	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00875	0.0029	H	0.98965	4.385	0.34968	D	0.752857	D	0.89917	1.0	D	0.83275	0.996	T	0.10154	-1.0642	9	0.87932	D	0	.	7.6538	0.28363	0.0:0.1042:0.0:0.8958	.	235	Q8NHC4	O10J5_HUMAN	E	235	ENSP00000334441:K235E	ENSP00000334441:K235E	K	-	1	0	OR10J5	157771719	1.000000	0.71417	0.550000	0.28217	0.195000	0.23768	4.755000	0.62198	0.727000	0.32360	0.482000	0.46254	AAG	OR10J5	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184155		0.473	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1	37	0.00	0	T	NM_001004469		159505095	159505095	-1	no_errors	ENST00000334857	ensembl	human	known	69_37n	missense	72	22.58	21	SNP	0.996	C
OR10J5	127385	genome.wustl.edu	37	1	159505095	159505095	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:159505095T>C	ENST00000334857.2	-	1	747	c.703A>G	c.(703-705)Aag>Gag	p.K235E		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					GCAAAGGTCTTCTTCCGGCCC	0.473																																						dbGAP											0													85.0	83.0	84.0					1																	159505095		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.703A>G	1.37:g.159505095T>C	ENSP00000334441:p.Lys235Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH35|Q6IFH2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K235E	ENST00000334857.2	37	c.703	CCDS30910.1	1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544062	0.45280	.	.	ENSG00000184155	ENST00000334857	T	0.00364	7.81	4.13	3.0	0.34707	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00875	0.0029	H	0.98965	4.385	0.34968	D	0.752857	D	0.89917	1.0	D	0.83275	0.996	T	0.10154	-1.0642	9	0.87932	D	0	.	7.6538	0.28363	0.0:0.1042:0.0:0.8958	.	235	Q8NHC4	O10J5_HUMAN	E	235	ENSP00000334441:K235E	ENSP00000334441:K235E	K	-	1	0	OR10J5	157771719	1.000000	0.71417	0.550000	0.28217	0.195000	0.23768	4.755000	0.62198	0.727000	0.32360	0.482000	0.46254	AAG	OR10J5	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184155		0.473	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1	60	0.00	0	T	NM_001004469		159505095	159505095	-1	no_errors	ENST00000334857	ensembl	human	known	69_37n	missense	72	22.58	21	SNP	0.996	C
OR2G3	81469	genome.wustl.edu	37	1	247769547	247769547	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:247769547C>T	ENST00000320002.2	+	1	692	c.660C>T	c.(658-660)ttC>ttT	p.F220F	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CCTATGGCTTCATAACTCAAG	0.458																																						dbGAP											0													185.0	159.0	168.0					1																	247769547		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.660C>T	1.37:g.247769547C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN64|Q5JQT1|Q6IF45	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F220	ENST00000320002.2	37	c.660	CCDS31093.1	1																																																																																			OR2G3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000177476		0.458	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	134	0.00	0	C			247769547	247769547	+1	no_errors	ENST00000320002	ensembl	human	known	69_37n	silent	177	16.51	35	SNP	0.672	T
OR2G3	81469	genome.wustl.edu	37	1	247769547	247769547	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:247769547C>T	ENST00000320002.2	+	1	692	c.660C>T	c.(658-660)ttC>ttT	p.F220F	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CCTATGGCTTCATAACTCAAG	0.458																																						dbGAP											0													185.0	159.0	168.0					1																	247769547		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.660C>T	1.37:g.247769547C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN64|Q5JQT1|Q6IF45	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F220	ENST00000320002.2	37	c.660	CCDS31093.1	1																																																																																			OR2G3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000177476		0.458	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	166	0.00	0	C			247769547	247769547	+1	no_errors	ENST00000320002	ensembl	human	known	69_37n	silent	177	16.51	35	SNP	0.672	T
OTUD7A	161725	genome.wustl.edu	37	15	31819475	31819475	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr15:31819475C>T	ENST00000307050.4	-	5	781	c.689G>A	c.(688-690)cGg>cAg	p.R230Q	OTUD7A_ENST00000382902.1_Missense_Mutation_p.R230Q	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	230	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GAGAGCTTTCCGTAACACCAG	0.562																																						dbGAP											0													142.0	131.0	135.0					15																	31819475		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.689G>A	15.37:g.31819475C>T	ENSP00000305926:p.Arg230Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWK5	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.R230Q	ENST00000307050.4	37	c.689	CCDS10026.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.765294	0.96906	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.33865	1.39;1.39	5.6	5.6	0.85130	Ovarian tumour, otubain (2);	0.048731	0.85682	D	0.000000	T	0.66076	0.2753	M	0.87038	2.855	0.52501	D	0.999955	D;D	0.89917	1.0;1.0	P;D	0.64687	0.883;0.928	T	0.72030	-0.4413	10	0.87932	D	0	-26.1842	19.6033	0.95572	0.0:1.0:0.0:0.0	.	230;230	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	Q	230	ENSP00000305926:R230Q;ENSP00000372358:R230Q	ENSP00000305926:R230Q	R	-	2	0	OTUD7A	29606767	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	6.933000	0.75874	2.624000	0.88883	0.563000	0.77884	CGG	OTUD7A	-	pfam_OTU,pfscan_OTU	ENSG00000169918		0.562	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	77	0.00	0	C	NM_130901		31819475	31819475	-1	no_errors	ENST00000382902	ensembl	human	known	69_37n	missense	96	19.17	23	SNP	1.000	T
OTUD7A	161725	genome.wustl.edu	37	15	31819475	31819475	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr15:31819475C>T	ENST00000307050.4	-	5	781	c.689G>A	c.(688-690)cGg>cAg	p.R230Q	OTUD7A_ENST00000382902.1_Missense_Mutation_p.R230Q	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	230	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GAGAGCTTTCCGTAACACCAG	0.562																																						dbGAP											0													142.0	131.0	135.0					15																	31819475		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.689G>A	15.37:g.31819475C>T	ENSP00000305926:p.Arg230Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWK5	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.R230Q	ENST00000307050.4	37	c.689	CCDS10026.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.765294	0.96906	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.33865	1.39;1.39	5.6	5.6	0.85130	Ovarian tumour, otubain (2);	0.048731	0.85682	D	0.000000	T	0.66076	0.2753	M	0.87038	2.855	0.52501	D	0.999955	D;D	0.89917	1.0;1.0	P;D	0.64687	0.883;0.928	T	0.72030	-0.4413	10	0.87932	D	0	-26.1842	19.6033	0.95572	0.0:1.0:0.0:0.0	.	230;230	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	Q	230	ENSP00000305926:R230Q;ENSP00000372358:R230Q	ENSP00000305926:R230Q	R	-	2	0	OTUD7A	29606767	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	6.933000	0.75874	2.624000	0.88883	0.563000	0.77884	CGG	OTUD7A	-	pfam_OTU,pfscan_OTU	ENSG00000169918		0.562	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	84	0.00	0	C	NM_130901		31819475	31819475	-1	no_errors	ENST00000382902	ensembl	human	known	69_37n	missense	96	19.17	23	SNP	1.000	T
PAG1	55824	genome.wustl.edu	37	8	81897317	81897317	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr8:81897317C>T	ENST00000220597.4	-	7	1280	c.570G>A	c.(568-570)gtG>gtA	p.V190V		NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	190					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			CAGCTGCAGCCACCTCCTTGA	0.537																																						dbGAP											0													83.0	80.0	81.0					8																	81897317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.570G>A	8.37:g.81897317C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Silent	SNP	NULL	p.V190	ENST00000220597.4	37	c.570	CCDS6227.1	8																																																																																			PAG1	-	NULL	ENSG00000076641		0.537	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	57	0.00	0	C	NM_018440		81897317	81897317	-1	no_errors	ENST00000220597	ensembl	human	known	69_37n	silent	145	10.37	17	SNP	0.733	T
PAG1	55824	genome.wustl.edu	37	8	81897317	81897317	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr8:81897317C>T	ENST00000220597.4	-	7	1280	c.570G>A	c.(568-570)gtG>gtA	p.V190V		NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	190					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			CAGCTGCAGCCACCTCCTTGA	0.537																																						dbGAP											0													83.0	80.0	81.0					8																	81897317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.570G>A	8.37:g.81897317C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Silent	SNP	NULL	p.V190	ENST00000220597.4	37	c.570	CCDS6227.1	8																																																																																			PAG1	-	NULL	ENSG00000076641		0.537	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	94	0.00	0	C	NM_018440		81897317	81897317	-1	no_errors	ENST00000220597	ensembl	human	known	69_37n	silent	145	10.37	17	SNP	0.733	T
PAG1	55824	genome.wustl.edu	37	8	81905418	81905418	+	Silent	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr8:81905418G>T	ENST00000220597.4	-	4	755	c.45C>A	c.(43-45)atC>atA	p.I15I		NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	15					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			CCCACAGGGTGATCTGCATCT	0.577																																						dbGAP											0													73.0	66.0	68.0					8																	81905418		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.45C>A	8.37:g.81905418G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Silent	SNP	NULL	p.I15	ENST00000220597.4	37	c.45	CCDS6227.1	8																																																																																			PAG1	-	NULL	ENSG00000076641		0.577	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	28	0.00	0	G	NM_018440		81905418	81905418	-1	no_errors	ENST00000220597	ensembl	human	known	69_37n	silent	52	18.75	12	SNP	0.000	T
PAG1	55824	genome.wustl.edu	37	8	81905418	81905418	+	Silent	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr8:81905418G>T	ENST00000220597.4	-	4	755	c.45C>A	c.(43-45)atC>atA	p.I15I		NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	15					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			CCCACAGGGTGATCTGCATCT	0.577																																						dbGAP											0													73.0	66.0	68.0					8																	81905418		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.45C>A	8.37:g.81905418G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Silent	SNP	NULL	p.I15	ENST00000220597.4	37	c.45	CCDS6227.1	8																																																																																			PAG1	-	NULL	ENSG00000076641		0.577	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	31	0.00	0	G	NM_018440		81905418	81905418	-1	no_errors	ENST00000220597	ensembl	human	known	69_37n	silent	52	18.75	12	SNP	0.000	T
PCK1	5105	genome.wustl.edu	37	20	56136552	56136552	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr20:56136552G>A	ENST00000319441.4	+	2	249	c.85G>A	c.(85-87)Gag>Aag	p.E29K	PCK1_ENST00000543666.1_5'UTR|PCK1_ENST00000535860.1_5'Flank	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	29					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GGCAGTGAGGGAGTTTCTCGA	0.577																																						dbGAP											0													101.0	96.0	98.0					20																	56136552		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.85G>A	20.37:g.56136552G>A	ENSP00000319814:p.Glu29Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	p.E29K	ENST00000319441.4	37	c.85	CCDS13460.1	20	.	.	.	.	.	.	.	.	.	.	G	2.904	-0.226799	0.06022	.	.	ENSG00000124253	ENST00000319441	T	0.04360	3.64	5.42	2.42	0.29668	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.504404	0.25288	N	0.031745	T	0.02888	0.0086	N	0.21240	0.645	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.40515	-0.9559	10	0.06099	T	0.92	-17.8279	8.5287	0.33321	0.2993:0.0:0.7007:0.0	.	29	P35558	PCKGC_HUMAN	K	29	ENSP00000319814:E29K	ENSP00000319814:E29K	E	+	1	0	PCK1	55569958	1.000000	0.71417	0.710000	0.30468	0.116000	0.19942	2.080000	0.41586	0.269000	0.21961	-0.224000	0.12420	GAG	PCK1	-	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	ENSG00000124253		0.577	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK1	HGNC	protein_coding	OTTHUMT00000079851.2	27	0.00	0	G			56136552	56136552	+1	no_errors	ENST00000319441	ensembl	human	known	69_37n	missense	72	11.11	9	SNP	0.998	A
POLM	27434	genome.wustl.edu	37	7	44121874	44121874	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:44121874C>G	ENST00000242248.5	-	1	265	c.164G>C	c.(163-165)gGc>gCc	p.G55A	POLM_ENST00000395831.3_Missense_Mutation_p.G55A|POLM_ENST00000335195.6_Missense_Mutation_p.G55A	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	55	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GACGCGGAAGCCTTTGGAGCG	0.682								DNA polymerases (catalytic subunits)																														dbGAP											0													5.0	6.0	6.0					7																	44121874		2037	4074	6111	-	-	-	SO:0001583	missense	0			AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.164G>C	7.37:g.44121874C>G	ENSP00000242248:p.Gly55Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	pfam_DNA_pol_lambd_fingers_domain,superfamily_DNA-dir_DNA_pol_X_beta-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_DNA-dir_DNA_pol_X,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	p.G55A	ENST00000242248.5	37	c.164	CCDS34625.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.159710	0.94727	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831;ENST00000414235;ENST00000452049	T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07	5.45	5.45	0.79879	BRCT (3);	0.000000	0.85682	D	0.000000	T	0.76919	0.4055	M	0.81802	2.56	0.58432	D	0.999998	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.999;0.999	T	0.79974	-0.1577	10	0.87932	D	0	-41.842	14.7727	0.69691	0.0:1.0:0.0:0.0	.	55;55;55;55;55;55	B4DG75;Q6PIY2;Q9H980;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;.;DPOLM_HUMAN	A	55	ENSP00000335141:G55A;ENSP00000242248:G55A;ENSP00000379174:G55A;ENSP00000390899:G55A;ENSP00000399244:G55A	ENSP00000242248:G55A	G	-	2	0	POLM	44088399	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.548000	0.60718	2.561000	0.86390	0.655000	0.94253	GGC	POLM	-	superfamily_BRCT_dom,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase	ENSG00000122678		0.682	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLM	HGNC	protein_coding	OTTHUMT00000339594.1	19	0.00	0	C	NM_013284		44121874	44121874	-1	no_errors	ENST00000242248	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	G
POLM	27434	genome.wustl.edu	37	7	44121874	44121874	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:44121874C>G	ENST00000242248.5	-	1	265	c.164G>C	c.(163-165)gGc>gCc	p.G55A	POLM_ENST00000395831.3_Missense_Mutation_p.G55A|POLM_ENST00000335195.6_Missense_Mutation_p.G55A	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	55	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GACGCGGAAGCCTTTGGAGCG	0.682								DNA polymerases (catalytic subunits)																														dbGAP											0													5.0	6.0	6.0					7																	44121874		2037	4074	6111	-	-	-	SO:0001583	missense	0			AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.164G>C	7.37:g.44121874C>G	ENSP00000242248:p.Gly55Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	pfam_DNA_pol_lambd_fingers_domain,superfamily_DNA-dir_DNA_pol_X_beta-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_DNA-dir_DNA_pol_X,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	p.G55A	ENST00000242248.5	37	c.164	CCDS34625.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.159710	0.94727	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831;ENST00000414235;ENST00000452049	T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07	5.45	5.45	0.79879	BRCT (3);	0.000000	0.85682	D	0.000000	T	0.76919	0.4055	M	0.81802	2.56	0.58432	D	0.999998	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.999;0.999	T	0.79974	-0.1577	10	0.87932	D	0	-41.842	14.7727	0.69691	0.0:1.0:0.0:0.0	.	55;55;55;55;55;55	B4DG75;Q6PIY2;Q9H980;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;.;DPOLM_HUMAN	A	55	ENSP00000335141:G55A;ENSP00000242248:G55A;ENSP00000379174:G55A;ENSP00000390899:G55A;ENSP00000399244:G55A	ENSP00000242248:G55A	G	-	2	0	POLM	44088399	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.548000	0.60718	2.561000	0.86390	0.655000	0.94253	GGC	POLM	-	superfamily_BRCT_dom,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase	ENSG00000122678		0.682	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLM	HGNC	protein_coding	OTTHUMT00000339594.1	12	0.00	0	C	NM_013284		44121874	44121874	-1	no_errors	ENST00000242248	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	G
PIK3CG	5294	genome.wustl.edu	37	7	106509637	106509637	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr7:106509637G>C	ENST00000359195.3	+	2	1941	c.1631G>C	c.(1630-1632)cGa>cCa	p.R544P	PIK3CG_ENST00000496166.1_Missense_Mutation_p.R544P|PIK3CG_ENST00000440650.2_Missense_Mutation_p.R544P	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	544	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GACCGGGTTCGAGCAGAAATG	0.537																																						dbGAP											0													82.0	79.0	80.0					7																	106509637		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1631G>C	7.37:g.106509637G>C	ENSP00000352121:p.Arg544Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.R544P	ENST00000359195.3	37	c.1631	CCDS5739.1	7	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894361	0.33442	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.64085	-0.08;-0.08;-0.08	5.81	5.81	0.92471	Phosphoinositide 3-kinase, accessory (PIK) domain (2);Armadillo-type fold (1);	0.127310	0.52532	D	0.000061	T	0.55768	0.1941	L	0.36672	1.1	0.52099	D	0.999945	B	0.06786	0.001	B	0.04013	0.001	T	0.46219	-0.9207	10	0.27785	T	0.31	-12.7755	20.0833	0.97789	0.0:0.0:1.0:0.0	.	544	P48736	PK3CG_HUMAN	P	544	ENSP00000392258:R544P;ENSP00000419260:R544P;ENSP00000352121:R544P	ENSP00000352121:R544P	R	+	2	0	PIK3CG	106296873	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	5.193000	0.65120	2.756000	0.94617	0.655000	0.94253	CGA	PIK3CG	-	superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000105851		0.537	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIK3CG	HGNC	protein_coding	OTTHUMT00000349294.1	29	0.00	0	G			106509637	106509637	+1	no_errors	ENST00000359195	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.999	C
PIK3CG	5294	genome.wustl.edu	37	7	106509637	106509637	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:106509637G>C	ENST00000359195.3	+	2	1941	c.1631G>C	c.(1630-1632)cGa>cCa	p.R544P	PIK3CG_ENST00000496166.1_Missense_Mutation_p.R544P|PIK3CG_ENST00000440650.2_Missense_Mutation_p.R544P	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	544	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GACCGGGTTCGAGCAGAAATG	0.537																																						dbGAP											0													82.0	79.0	80.0					7																	106509637		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1631G>C	7.37:g.106509637G>C	ENSP00000352121:p.Arg544Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.R544P	ENST00000359195.3	37	c.1631	CCDS5739.1	7	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894361	0.33442	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.64085	-0.08;-0.08;-0.08	5.81	5.81	0.92471	Phosphoinositide 3-kinase, accessory (PIK) domain (2);Armadillo-type fold (1);	0.127310	0.52532	D	0.000061	T	0.55768	0.1941	L	0.36672	1.1	0.52099	D	0.999945	B	0.06786	0.001	B	0.04013	0.001	T	0.46219	-0.9207	10	0.27785	T	0.31	-12.7755	20.0833	0.97789	0.0:0.0:1.0:0.0	.	544	P48736	PK3CG_HUMAN	P	544	ENSP00000392258:R544P;ENSP00000419260:R544P;ENSP00000352121:R544P	ENSP00000352121:R544P	R	+	2	0	PIK3CG	106296873	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	5.193000	0.65120	2.756000	0.94617	0.655000	0.94253	CGA	PIK3CG	-	superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000105851		0.537	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIK3CG	HGNC	protein_coding	OTTHUMT00000349294.1	30	0.00	0	G			106509637	106509637	+1	no_errors	ENST00000359195	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.999	C
PPP1R26	9858	genome.wustl.edu	37	9	138376403	138376403	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr9:138376403G>T	ENST00000356818.2	+	4	596	c.47G>T	c.(46-48)tGg>tTg	p.W16L	PPP1R26_ENST00000604351.1_Missense_Mutation_p.W16L|PPP1R26_ENST00000605286.1_Missense_Mutation_p.W16L|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000605660.1_Missense_Mutation_p.W16L|PPP1R26_ENST00000401470.3_Missense_Mutation_p.W16L	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	16					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CAGTCCAAATGGGAGGCCTTT	0.627																																						dbGAP											0													40.0	45.0	43.0					9																	138376403		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.47G>T	9.37:g.138376403G>T	ENSP00000349274:p.Trp16Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	NULL	p.W16L	ENST00000356818.2	37	c.47	CCDS6988.1	9	.	.	.	.	.	.	.	.	.	.	G	19.95	3.922159	0.73213	.	.	ENSG00000196422	ENST00000356818;ENST00000401470	T;T	0.23348	1.91;1.91	5.44	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.51449	0.1675	M	0.75264	2.295	0.58432	D	0.999993	D	0.89917	1.0	D	0.77557	0.99	T	0.57734	-0.7760	10	0.87932	D	0	-21.5782	15.3073	0.74001	0.0:0.1404:0.8596:0.0	.	16	Q5T8A7	PPR26_HUMAN	L	16	ENSP00000349274:W16L;ENSP00000385826:W16L	ENSP00000349274:W16L	W	+	2	0	KIAA0649	137516224	1.000000	0.71417	0.967000	0.41034	0.508000	0.34012	9.031000	0.93731	1.278000	0.44430	-0.176000	0.13171	TGG	PPP1R26	-	NULL	ENSG00000196422		0.627	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1	60	0.00	0	G	NM_014811		138376403	138376403	+1	no_errors	ENST00000356818	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	1.000	T
PPP1R26	9858	genome.wustl.edu	37	9	138376403	138376403	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr9:138376403G>T	ENST00000356818.2	+	4	596	c.47G>T	c.(46-48)tGg>tTg	p.W16L	PPP1R26_ENST00000604351.1_Missense_Mutation_p.W16L|PPP1R26_ENST00000605286.1_Missense_Mutation_p.W16L|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000605660.1_Missense_Mutation_p.W16L|PPP1R26_ENST00000401470.3_Missense_Mutation_p.W16L	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	16					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CAGTCCAAATGGGAGGCCTTT	0.627																																						dbGAP											0													40.0	45.0	43.0					9																	138376403		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.47G>T	9.37:g.138376403G>T	ENSP00000349274:p.Trp16Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	NULL	p.W16L	ENST00000356818.2	37	c.47	CCDS6988.1	9	.	.	.	.	.	.	.	.	.	.	G	19.95	3.922159	0.73213	.	.	ENSG00000196422	ENST00000356818;ENST00000401470	T;T	0.23348	1.91;1.91	5.44	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.51449	0.1675	M	0.75264	2.295	0.58432	D	0.999993	D	0.89917	1.0	D	0.77557	0.99	T	0.57734	-0.7760	10	0.87932	D	0	-21.5782	15.3073	0.74001	0.0:0.1404:0.8596:0.0	.	16	Q5T8A7	PPR26_HUMAN	L	16	ENSP00000349274:W16L;ENSP00000385826:W16L	ENSP00000349274:W16L	W	+	2	0	KIAA0649	137516224	1.000000	0.71417	0.967000	0.41034	0.508000	0.34012	9.031000	0.93731	1.278000	0.44430	-0.176000	0.13171	TGG	PPP1R26	-	NULL	ENSG00000196422		0.627	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1	51	0.00	0	G	NM_014811		138376403	138376403	+1	no_errors	ENST00000356818	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	1.000	T
PRDX2	7001	genome.wustl.edu	37	19	12907948	12907948	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr19:12907948T>A	ENST00000301522.2	-	6	672	c.544A>T	c.(544-546)Acg>Tcg	p.T182S	CTD-2659N19.10_ENST00000585496.1_RNA|PRDX2_ENST00000334482.5_3'UTR	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2	182					cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						GGCTTAATCGTGTCACTGCCA	0.537											OREG0025274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													159.0	115.0	130.0					19																	12907948		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.544A>T	19.37:g.12907948T>A	ENSP00000301522:p.Thr182Ser	Somatic	683	WXS	Illumina GAIIx	Phase_IV	A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Redoxin,pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	p.T182S	ENST00000301522.2	37	c.544	CCDS12281.1	19	.	.	.	.	.	.	.	.	.	.	T	24.2	4.504154	0.85176	.	.	ENSG00000167815	ENST00000301522	T	0.34472	1.36	4.94	4.94	0.65067	Peroxiredoxin, C-terminal (1);Thioredoxin-like fold (1);	0.171581	0.39083	N	0.001478	T	0.58836	0.2150	M	0.89968	3.075	0.80722	D	1	P	0.36753	0.568	P	0.48524	0.58	T	0.66408	-0.5931	10	0.66056	D	0.02	-53.2188	13.7047	0.62631	0.0:0.0:0.0:1.0	.	182	P32119	PRDX2_HUMAN	S	182	ENSP00000301522:T182S	ENSP00000301522:T182S	T	-	1	0	PRDX2	12768948	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.462000	0.80851	2.077000	0.62373	0.379000	0.24179	ACG	PRDX2	-	pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	ENSG00000167815		0.537	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX2	HGNC	protein_coding	OTTHUMT00000258950.2	74	0.00	0	T	NM_005809		12907948	12907948	-1	no_errors	ENST00000301522	ensembl	human	known	69_37n	missense	92	10.58	11	SNP	1.000	A
PRDX2	7001	genome.wustl.edu	37	19	12907948	12907948	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr19:12907948T>A	ENST00000301522.2	-	6	672	c.544A>T	c.(544-546)Acg>Tcg	p.T182S	CTD-2659N19.10_ENST00000585496.1_RNA|PRDX2_ENST00000334482.5_3'UTR	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2	182					cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						GGCTTAATCGTGTCACTGCCA	0.537											OREG0025274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													159.0	115.0	130.0					19																	12907948		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.544A>T	19.37:g.12907948T>A	ENSP00000301522:p.Thr182Ser	Somatic	683	WXS	Illumina GAIIx	Phase_IV	A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Redoxin,pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	p.T182S	ENST00000301522.2	37	c.544	CCDS12281.1	19	.	.	.	.	.	.	.	.	.	.	T	24.2	4.504154	0.85176	.	.	ENSG00000167815	ENST00000301522	T	0.34472	1.36	4.94	4.94	0.65067	Peroxiredoxin, C-terminal (1);Thioredoxin-like fold (1);	0.171581	0.39083	N	0.001478	T	0.58836	0.2150	M	0.89968	3.075	0.80722	D	1	P	0.36753	0.568	P	0.48524	0.58	T	0.66408	-0.5931	10	0.66056	D	0.02	-53.2188	13.7047	0.62631	0.0:0.0:0.0:1.0	.	182	P32119	PRDX2_HUMAN	S	182	ENSP00000301522:T182S	ENSP00000301522:T182S	T	-	1	0	PRDX2	12768948	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.462000	0.80851	2.077000	0.62373	0.379000	0.24179	ACG	PRDX2	-	pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	ENSG00000167815		0.537	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX2	HGNC	protein_coding	OTTHUMT00000258950.2	73	0.00	0	T	NM_005809		12907948	12907948	-1	no_errors	ENST00000301522	ensembl	human	known	69_37n	missense	92	10.58	11	SNP	1.000	A
PREX2	80243	genome.wustl.edu	37	8	68995526	68995526	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr8:68995526G>A	ENST00000288368.4	+	18	2207	c.1930G>A	c.(1930-1932)Gtt>Att	p.V644I	PREX2_ENST00000529398.1_3'UTR|RP11-403D15.2_ENST00000526901.1_RNA	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	644	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGGTGACCTAGTTTTTATGAG	0.343																																						dbGAP											0													102.0	102.0	102.0					8																	68995526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1930G>A	8.37:g.68995526G>A	ENSP00000288368:p.Val644Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.V644I	ENST00000288368.4	37	c.1930	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.125528	0.94429	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.20598	2.06	5.77	5.77	0.91146	PDZ/DHR/GLGF (2);	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	L	0.59436	1.845	0.80722	D	1	D;P;P	0.54772	0.968;0.64;0.944	P;B;P	0.58210	0.835;0.222;0.729	T	0.10405	-1.0631	10	0.87932	D	0	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	644;644;644	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	I	644	ENSP00000288368:V644I	ENSP00000288368:V644I	V	+	1	0	PREX2	69158080	1.000000	0.71417	0.989000	0.46669	0.882000	0.50991	9.374000	0.97172	2.885000	0.99019	0.655000	0.94253	GTT	PREX2	-	superfamily_PDZ,smart_PDZ	ENSG00000046889		0.343	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	65	0.00	0	G	NM_025170		68995526	68995526	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	140	11.32	18	SNP	1.000	A
PREX2	80243	genome.wustl.edu	37	8	68995526	68995526	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr8:68995526G>A	ENST00000288368.4	+	18	2207	c.1930G>A	c.(1930-1932)Gtt>Att	p.V644I	PREX2_ENST00000529398.1_3'UTR|RP11-403D15.2_ENST00000526901.1_RNA	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	644	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGGTGACCTAGTTTTTATGAG	0.343																																						dbGAP											0													102.0	102.0	102.0					8																	68995526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1930G>A	8.37:g.68995526G>A	ENSP00000288368:p.Val644Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.V644I	ENST00000288368.4	37	c.1930	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.125528	0.94429	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.20598	2.06	5.77	5.77	0.91146	PDZ/DHR/GLGF (2);	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	L	0.59436	1.845	0.80722	D	1	D;P;P	0.54772	0.968;0.64;0.944	P;B;P	0.58210	0.835;0.222;0.729	T	0.10405	-1.0631	10	0.87932	D	0	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	644;644;644	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	I	644	ENSP00000288368:V644I	ENSP00000288368:V644I	V	+	1	0	PREX2	69158080	1.000000	0.71417	0.989000	0.46669	0.882000	0.50991	9.374000	0.97172	2.885000	0.99019	0.655000	0.94253	GTT	PREX2	-	superfamily_PDZ,smart_PDZ	ENSG00000046889		0.343	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	135	0.00	0	G	NM_025170		68995526	68995526	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	140	11.32	18	SNP	1.000	A
PSMD12	5718	genome.wustl.edu	37	17	65337029	65337029	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr17:65337029G>C	ENST00000356126.3	-	11	1408	c.1301C>G	c.(1300-1302)tCa>tGa	p.S434*	PSMD12_ENST00000357146.4_Nonsense_Mutation_p.S414*	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	434					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					AGACATTAATGAGTTCAGTTT	0.343																																						dbGAP											0													93.0	93.0	93.0					17																	65337029		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1301C>G	17.37:g.65337029G>C	ENSP00000348442:p.Ser434*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP15|Q53HA2|Q6P053	Nonsense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.S434*	ENST00000356126.3	37	c.1301	CCDS11669.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.028363	0.97216	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-8.8923	17.8938	0.88880	0.0:0.0:1.0:0.0	.	.	.	.	X	434;414	.	ENSP00000348442:S434X	S	-	2	0	PSMD12	62767491	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	9.402000	0.97298	2.226000	0.72624	0.484000	0.47621	TCA	PSMD12	-	smart_PCI_dom	ENSG00000197170		0.343	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD12	HGNC	protein_coding	OTTHUMT00000277103.1	67	0.00	0	G	NM_002816, NM_174871		65337029	65337029	-1	no_errors	ENST00000356126	ensembl	human	known	69_37n	nonsense	113	16.30	22	SNP	1.000	C
PSMD12	5718	genome.wustl.edu	37	17	65337029	65337029	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr17:65337029G>C	ENST00000356126.3	-	11	1408	c.1301C>G	c.(1300-1302)tCa>tGa	p.S434*	PSMD12_ENST00000357146.4_Nonsense_Mutation_p.S414*	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	434					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					AGACATTAATGAGTTCAGTTT	0.343																																						dbGAP											0													93.0	93.0	93.0					17																	65337029		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1301C>G	17.37:g.65337029G>C	ENSP00000348442:p.Ser434*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP15|Q53HA2|Q6P053	Nonsense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.S434*	ENST00000356126.3	37	c.1301	CCDS11669.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.028363	0.97216	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-8.8923	17.8938	0.88880	0.0:0.0:1.0:0.0	.	.	.	.	X	434;414	.	ENSP00000348442:S434X	S	-	2	0	PSMD12	62767491	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	9.402000	0.97298	2.226000	0.72624	0.484000	0.47621	TCA	PSMD12	-	smart_PCI_dom	ENSG00000197170		0.343	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD12	HGNC	protein_coding	OTTHUMT00000277103.1	97	0.00	0	G	NM_002816, NM_174871		65337029	65337029	-1	no_errors	ENST00000356126	ensembl	human	known	69_37n	nonsense	113	16.30	22	SNP	1.000	C
RBM43	375287	genome.wustl.edu	37	2	152107795	152107795	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:152107795C>A	ENST00000331426.5	-	4	850	c.699G>T	c.(697-699)aaG>aaT	p.K233N		NM_198557.2	NP_940959.1	Q6ZSC3	RBM43_HUMAN	RNA binding motif protein 43	233							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.131)		AAGATCCACACTTGTGTTTCA	0.393																																						dbGAP											0													96.0	89.0	91.0					2																	152107795		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127552	CCDS2191.1	2q23.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000184898	ENSG00000184898		"""RNA binding motif (RRM) containing"""	24790	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 38"""	C2orf38			Standard	NM_198557		Approved	FLJ45645	uc002txh.3	Q6ZSC3	OTTHUMG00000131866	ENST00000331426.5:c.699G>T	2.37:g.152107795C>A	ENSP00000331211:p.Lys233Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMT5	Missense_Mutation	SNP	pfscan_RRM_dom	p.K233N	ENST00000331426.5	37	c.699	CCDS2191.1	2	.	.	.	.	.	.	.	.	.	.	C	11.62	1.692763	0.30052	.	.	ENSG00000184898	ENST00000331426	T	0.56444	0.46	4.97	1.89	0.25635	.	0.350672	0.25741	N	0.028618	T	0.38374	0.1038	L	0.27053	0.805	0.09310	N	1	P	0.44429	0.835	B	0.43728	0.429	T	0.21075	-1.0256	10	0.59425	D	0.04	-13.5177	6.7491	0.23477	0.1516:0.6791:0.0:0.1692	.	233	Q6ZSC3	RBM43_HUMAN	N	233	ENSP00000331211:K233N	ENSP00000331211:K233N	K	-	3	2	RBM43	151816041	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.868000	0.27982	0.657000	0.30906	-0.150000	0.13652	AAG	RBM43	-	NULL	ENSG00000184898		0.393	RBM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM43	HGNC	protein_coding	OTTHUMT00000254816.2	67	0.00	0	C	NM_198557		152107795	152107795	-1	no_errors	ENST00000331426	ensembl	human	known	69_37n	missense	86	18.87	20	SNP	0.000	A
RBM43	375287	genome.wustl.edu	37	2	152107795	152107795	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:152107795C>A	ENST00000331426.5	-	4	850	c.699G>T	c.(697-699)aaG>aaT	p.K233N		NM_198557.2	NP_940959.1	Q6ZSC3	RBM43_HUMAN	RNA binding motif protein 43	233							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.131)		AAGATCCACACTTGTGTTTCA	0.393																																						dbGAP											0													96.0	89.0	91.0					2																	152107795		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127552	CCDS2191.1	2q23.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000184898	ENSG00000184898		"""RNA binding motif (RRM) containing"""	24790	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 38"""	C2orf38			Standard	NM_198557		Approved	FLJ45645	uc002txh.3	Q6ZSC3	OTTHUMG00000131866	ENST00000331426.5:c.699G>T	2.37:g.152107795C>A	ENSP00000331211:p.Lys233Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMT5	Missense_Mutation	SNP	pfscan_RRM_dom	p.K233N	ENST00000331426.5	37	c.699	CCDS2191.1	2	.	.	.	.	.	.	.	.	.	.	C	11.62	1.692763	0.30052	.	.	ENSG00000184898	ENST00000331426	T	0.56444	0.46	4.97	1.89	0.25635	.	0.350672	0.25741	N	0.028618	T	0.38374	0.1038	L	0.27053	0.805	0.09310	N	1	P	0.44429	0.835	B	0.43728	0.429	T	0.21075	-1.0256	10	0.59425	D	0.04	-13.5177	6.7491	0.23477	0.1516:0.6791:0.0:0.1692	.	233	Q6ZSC3	RBM43_HUMAN	N	233	ENSP00000331211:K233N	ENSP00000331211:K233N	K	-	3	2	RBM43	151816041	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.868000	0.27982	0.657000	0.30906	-0.150000	0.13652	AAG	RBM43	-	NULL	ENSG00000184898		0.393	RBM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM43	HGNC	protein_coding	OTTHUMT00000254816.2	66	0.00	0	C	NM_198557		152107795	152107795	-1	no_errors	ENST00000331426	ensembl	human	known	69_37n	missense	86	18.87	20	SNP	0.000	A
RBAK-RBAKDN	100533952	genome.wustl.edu	37	7	5028945	5028945	+	Intron	SNP	A	A	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:5028945A>G	ENST00000407184.1	+	2	222									RBAK-RBAKDN readthrough																		AAATTTTTAGAAAGTGGCTGC	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.-45+4239A>G	7.37:g.5028945A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000407184.1	37	NULL		7																																																																																			RNF216P1	-	-	ENSG00000196204		0.418	RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	RNF216P1	HGNC	protein_coding	OTTHUMT00000472007.1	27	0.00	0	A			5028945	5028945	+1	no_errors	ENST00000466622	ensembl	human	known	69_37n	rna	41	12.77	6	SNP	0.017	G
RBAK-RBAKDN	100533952	genome.wustl.edu	37	7	5028956	5028956	+	Intron	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr7:5028956C>A	ENST00000407184.1	+	2	222									RBAK-RBAKDN readthrough																		AAGTGGCTGCCCTTGTTGGCT	0.413																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.-45+4250C>A	7.37:g.5028956C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000407184.1	37	NULL		7																																																																																			RNF216P1	-	-	ENSG00000196204		0.413	RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	RNF216P1	HGNC	protein_coding	OTTHUMT00000472007.1	22	0.00	0	C			5028956	5028956	+1	no_errors	ENST00000466622	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.002	A
SLA2	84174	genome.wustl.edu	37	20	35262008	35262008	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr20:35262008C>G	ENST00000262866.4	-	4	638	c.216G>C	c.(214-216)ctG>ctC	p.L72L	SLA2_ENST00000360672.2_Silent_p.L72L	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	72	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				AGACTTCAGACAGCACCGTCC	0.587																																					Ovarian(59;720 1165 26994 46188 51693)	dbGAP											0													105.0	86.0	92.0					20																	35262008		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.216G>C	20.37:g.35262008C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Silent	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.L72	ENST00000262866.4	37	c.216	CCDS13282.1	20																																																																																			SLA2	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000101082		0.587	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2	28	0.00	0	C	NM_175077		35262008	35262008	-1	no_errors	ENST00000262866	ensembl	human	known	69_37n	silent	44	13.46	7	SNP	0.944	G
SLA2	84174	genome.wustl.edu	37	20	35262008	35262008	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr20:35262008C>G	ENST00000262866.4	-	4	638	c.216G>C	c.(214-216)ctG>ctC	p.L72L	SLA2_ENST00000360672.2_Silent_p.L72L	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	72	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				AGACTTCAGACAGCACCGTCC	0.587																																					Ovarian(59;720 1165 26994 46188 51693)	dbGAP											0													105.0	86.0	92.0					20																	35262008		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.216G>C	20.37:g.35262008C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Silent	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.L72	ENST00000262866.4	37	c.216	CCDS13282.1	20																																																																																			SLA2	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000101082		0.587	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2	32	0.00	0	C	NM_175077		35262008	35262008	-1	no_errors	ENST00000262866	ensembl	human	known	69_37n	silent	44	13.46	7	SNP	0.944	G
SLC30A9	10463	genome.wustl.edu	37	4	42080253	42080253	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr4:42080253G>A	ENST00000264451.7	+	17	1753	c.1573G>A	c.(1573-1575)Gaa>Aaa	p.E525K		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	525					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GAAAACTCCTGAAGAACTAGA	0.289																																						dbGAP											0													50.0	56.0	54.0					4																	42080253		2200	4296	6496	-	-	-	SO:0001583	missense	0			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1573G>A	4.37:g.42080253G>A	ENSP00000264451:p.Glu525Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.E525K	ENST00000264451.7	37	c.1573	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617999	0.87359	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.25749	1.78	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.37265	0.0997	L	0.60455	1.87	0.80722	D	1	P	0.38677	0.642	B	0.44224	0.444	T	0.03555	-1.1025	10	0.42905	T	0.14	-21.1802	19.8737	0.96861	0.0:0.0:1.0:0.0	.	525	Q6PML9	ZNT9_HUMAN	K	525;353	ENSP00000264451:E525K	ENSP00000264451:E525K	E	+	1	0	SLC30A9	41775010	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.185000	0.94900	2.693000	0.91896	0.650000	0.86243	GAA	SLC30A9	-	NULL	ENSG00000014824		0.289	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	HGNC	protein_coding	OTTHUMT00000216842.3	42	0.00	0	G			42080253	42080253	+1	no_errors	ENST00000264451	ensembl	human	known	69_37n	missense	60	18.92	14	SNP	1.000	A
SLC30A9	10463	genome.wustl.edu	37	4	42080253	42080253	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr4:42080253G>A	ENST00000264451.7	+	17	1753	c.1573G>A	c.(1573-1575)Gaa>Aaa	p.E525K		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	525					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GAAAACTCCTGAAGAACTAGA	0.289																																						dbGAP											0													50.0	56.0	54.0					4																	42080253		2200	4296	6496	-	-	-	SO:0001583	missense	0			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1573G>A	4.37:g.42080253G>A	ENSP00000264451:p.Glu525Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.E525K	ENST00000264451.7	37	c.1573	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617999	0.87359	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.25749	1.78	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.37265	0.0997	L	0.60455	1.87	0.80722	D	1	P	0.38677	0.642	B	0.44224	0.444	T	0.03555	-1.1025	10	0.42905	T	0.14	-21.1802	19.8737	0.96861	0.0:0.0:1.0:0.0	.	525	Q6PML9	ZNT9_HUMAN	K	525;353	ENSP00000264451:E525K	ENSP00000264451:E525K	E	+	1	0	SLC30A9	41775010	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.185000	0.94900	2.693000	0.91896	0.650000	0.86243	GAA	SLC30A9	-	NULL	ENSG00000014824		0.289	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	HGNC	protein_coding	OTTHUMT00000216842.3	50	0.00	0	G			42080253	42080253	+1	no_errors	ENST00000264451	ensembl	human	known	69_37n	missense	60	18.92	14	SNP	1.000	A
SLC4A11	83959	genome.wustl.edu	37	20	3215479	3215479	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr20:3215479C>G	ENST00000380056.3	-	2	245	c.198G>C	c.(196-198)gaG>gaC	p.E66D	SLC4A11_ENST00000539553.2_Missense_Mutation_p.E50D|SLC4A11_ENST00000380059.3_Missense_Mutation_p.E93D	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	66					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						TGTCGAAGGCCTCATCCCCCA	0.542																																					NSCLC(190;922 2139 10266 10292 38692)	dbGAP											0													125.0	107.0	113.0					20																	3215479		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.198G>C	20.37:g.3215479C>G	ENSP00000369396:p.Glu66Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_PTS_EIIA_2,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk	p.E93D	ENST00000380056.3	37	c.279	CCDS13052.1	20	.	.	.	.	.	.	.	.	.	.	C	9.309	1.054985	0.19907	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553;ENST00000437836	D;D;D;D	0.87029	-1.9;-1.84;-1.82;-2.2	4.76	1.11	0.20524	.	0.963446	0.08508	N	0.935424	D	0.83880	0.5350	M	0.62723	1.935	0.35888	D	0.829457	B;B;B	0.17465	0.02;0.005;0.022	B;B;B	0.16722	0.016;0.007;0.007	T	0.77130	-0.2701	10	0.42905	T	0.14	.	7.3899	0.26903	0.1401:0.679:0.0:0.1808	.	50;93;66	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	D	93;66;50;50	ENSP00000369399:E93D;ENSP00000369396:E66D;ENSP00000441370:E50D;ENSP00000404271:E50D	ENSP00000369396:E66D	E	-	3	2	SLC4A11	3163479	0.508000	0.26154	0.835000	0.33067	0.076000	0.17211	-0.116000	0.10724	0.414000	0.25790	0.655000	0.94253	GAG	SLC4A11	-	NULL	ENSG00000088836		0.542	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	50	0.00	0	C			3215479	3215479	-1	no_errors	ENST00000380059	ensembl	human	known	69_37n	missense	53	10.00	6	SNP	0.512	G
SLC4A11	83959	genome.wustl.edu	37	20	3215479	3215479	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr20:3215479C>G	ENST00000380056.3	-	2	245	c.198G>C	c.(196-198)gaG>gaC	p.E66D	SLC4A11_ENST00000539553.2_Missense_Mutation_p.E50D|SLC4A11_ENST00000380059.3_Missense_Mutation_p.E93D	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	66					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						TGTCGAAGGCCTCATCCCCCA	0.542																																					NSCLC(190;922 2139 10266 10292 38692)	dbGAP											0													125.0	107.0	113.0					20																	3215479		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.198G>C	20.37:g.3215479C>G	ENSP00000369396:p.Glu66Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_PTS_EIIA_2,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk	p.E93D	ENST00000380056.3	37	c.279	CCDS13052.1	20	.	.	.	.	.	.	.	.	.	.	C	9.309	1.054985	0.19907	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553;ENST00000437836	D;D;D;D	0.87029	-1.9;-1.84;-1.82;-2.2	4.76	1.11	0.20524	.	0.963446	0.08508	N	0.935424	D	0.83880	0.5350	M	0.62723	1.935	0.35888	D	0.829457	B;B;B	0.17465	0.02;0.005;0.022	B;B;B	0.16722	0.016;0.007;0.007	T	0.77130	-0.2701	10	0.42905	T	0.14	.	7.3899	0.26903	0.1401:0.679:0.0:0.1808	.	50;93;66	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	D	93;66;50;50	ENSP00000369399:E93D;ENSP00000369396:E66D;ENSP00000441370:E50D;ENSP00000404271:E50D	ENSP00000369396:E66D	E	-	3	2	SLC4A11	3163479	0.508000	0.26154	0.835000	0.33067	0.076000	0.17211	-0.116000	0.10724	0.414000	0.25790	0.655000	0.94253	GAG	SLC4A11	-	NULL	ENSG00000088836		0.542	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	33	0.00	0	C			3215479	3215479	-1	no_errors	ENST00000380059	ensembl	human	known	69_37n	missense	53	10.00	6	SNP	0.512	G
SLC7A11	23657	genome.wustl.edu	37	4	139092719	139092719	+	3'UTR	SNP	A	A	G	rs13120371	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr4:139092719A>G	ENST00000280612.5	-	0	2176				SLC7A11-AS1_ENST00000512538.1_RNA|SLC7A11-AS1_ENST00000512786.1_RNA|SLC7A11-AS1_ENST00000510767.1_RNA	NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	ATAGACATCTATAGTGTGTAA	0.308													A|||	1394	0.278355	0.0923	0.3444	5008	,	,		18029	0.2718		0.3807	False		,,,				2504	0.3845					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.*391T>C	4.37:g.139092719A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U4	RNA	SNP	-	NULL	ENST00000280612.5	37	NULL	CCDS3742.1	4																																																																																			SLC7A11-AS1	-	-	ENSG00000250033		0.308	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A11-AS1	HGNC	protein_coding	OTTHUMT00000257251.2	26	0.00	0	A			139092719	139092719	+1	no_errors	ENST00000510767	ensembl	human	known	69_37n	rna	54	10.00	6	SNP	0.035	G
SLC7A11	23657	genome.wustl.edu	37	4	139092719	139092719	+	3'UTR	SNP	A	A	G	rs13120371	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr4:139092719A>G	ENST00000280612.5	-	0	2176				SLC7A11-AS1_ENST00000512538.1_RNA|SLC7A11-AS1_ENST00000512786.1_RNA|SLC7A11-AS1_ENST00000510767.1_RNA	NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	ATAGACATCTATAGTGTGTAA	0.308													A|||	1394	0.278355	0.0923	0.3444	5008	,	,		18029	0.2718		0.3807	False		,,,				2504	0.3845					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.*391T>C	4.37:g.139092719A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U4	RNA	SNP	-	NULL	ENST00000280612.5	37	NULL	CCDS3742.1	4																																																																																			SLC7A11-AS1	-	-	ENSG00000250033		0.308	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A11-AS1	HGNC	protein_coding	OTTHUMT00000257251.2	61	0.00	0	A			139092719	139092719	+1	no_errors	ENST00000510767	ensembl	human	known	69_37n	rna	54	10.00	6	SNP	0.035	G
SLIT3	6586	genome.wustl.edu	37	5	168181006	168181006	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr5:168181006C>G	ENST00000519560.1	-	17	2111	c.1692G>C	c.(1690-1692)ctG>ctC	p.L564L	SLIT3_ENST00000404867.3_Silent_p.L564L|SLIT3_ENST00000332966.8_Silent_p.L564L	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	564					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TATTGTTACTCAGATTTCTAG	0.542																																					Ovarian(29;311 847 10864 17279 24903)	dbGAP											0													23.0	22.0	22.0					5																	168181006		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1692G>C	5.37:g.168181006C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	pfam_EGF-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.L564	ENST00000519560.1	37	c.1692	CCDS4369.1	5																																																																																			SLIT3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	ENSG00000184347		0.542	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	35	0.00	0	C	NM_003062		168181006	168181006	-1	no_errors	ENST00000519560	ensembl	human	known	69_37n	silent	56	15.15	10	SNP	1.000	G
SLIT3	6586	genome.wustl.edu	37	5	168181006	168181006	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr5:168181006C>G	ENST00000519560.1	-	17	2111	c.1692G>C	c.(1690-1692)ctG>ctC	p.L564L	SLIT3_ENST00000404867.3_Silent_p.L564L|SLIT3_ENST00000332966.8_Silent_p.L564L	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	564					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TATTGTTACTCAGATTTCTAG	0.542																																					Ovarian(29;311 847 10864 17279 24903)	dbGAP											0													23.0	22.0	22.0					5																	168181006		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1692G>C	5.37:g.168181006C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	pfam_EGF-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.L564	ENST00000519560.1	37	c.1692	CCDS4369.1	5																																																																																			SLIT3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	ENSG00000184347		0.542	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	45	0.00	0	C	NM_003062		168181006	168181006	-1	no_errors	ENST00000519560	ensembl	human	known	69_37n	silent	56	15.15	10	SNP	1.000	G
SORBS2	8470	genome.wustl.edu	37	4	186545551	186545551	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr4:186545551C>T	ENST00000284776.7	-	13	1529	c.1020G>A	c.(1018-1020)caG>caA	p.Q340Q	SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000431808.1_Silent_p.Q340Q|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000355634.5_Silent_p.Q440Q|SORBS2_ENST00000418609.1_Silent_p.Q244Q	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	340					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CATCCAAGTGCTGTCTGTAAG	0.502																																					Esophageal Squamous(153;41 2433 9491 36028)	dbGAP											0													80.0	80.0	80.0					4																	186545551		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1020G>A	4.37:g.186545551C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.Q340	ENST00000284776.7	37	c.1020	CCDS3845.1	4																																																																																			SORBS2	-	NULL	ENSG00000154556		0.502	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	41	0.00	0	C	NM_003603		186545551	186545551	-1	no_errors	ENST00000284776	ensembl	human	known	69_37n	silent	53	25.35	18	SNP	1.000	T
SORBS2	8470	genome.wustl.edu	37	4	186545551	186545551	+	Silent	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr4:186545551C>T	ENST00000284776.7	-	13	1529	c.1020G>A	c.(1018-1020)caG>caA	p.Q340Q	SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000431808.1_Silent_p.Q340Q|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000355634.5_Silent_p.Q440Q|SORBS2_ENST00000418609.1_Silent_p.Q244Q	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	340					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CATCCAAGTGCTGTCTGTAAG	0.502																																					Esophageal Squamous(153;41 2433 9491 36028)	dbGAP											0													80.0	80.0	80.0					4																	186545551		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1020G>A	4.37:g.186545551C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.Q340	ENST00000284776.7	37	c.1020	CCDS3845.1	4																																																																																			SORBS2	-	NULL	ENSG00000154556		0.502	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	65	0.00	0	C	NM_003603		186545551	186545551	-1	no_errors	ENST00000284776	ensembl	human	known	69_37n	silent	53	25.35	18	SNP	1.000	T
TACC2	10579	genome.wustl.edu	37	10	124008183	124008183	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr10:124008183C>G	ENST00000369005.1	+	20	8758	c.8418C>G	c.(8416-8418)gtC>gtG	p.V2806V	TACC2_ENST00000369004.3_Silent_p.V866V|TACC2_ENST00000368999.1_Silent_p.V896V|TACC2_ENST00000358010.1_Silent_p.V952V|TACC2_ENST00000369001.1_Silent_p.V433V|TACC2_ENST00000515603.1_Silent_p.V2684V|TACC2_ENST00000453444.2_Silent_p.V2733V|TACC2_ENST00000360561.3_Silent_p.V854V|TACC2_ENST00000513429.1_Silent_p.V952V|TACC2_ENST00000515273.1_Silent_p.V2733V|TACC2_ENST00000334433.3_Silent_p.V2806V|TACC2_ENST00000369000.1_Silent_p.V429V|TACC2_ENST00000260733.3_Silent_p.V884V	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2806					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AGAAGTCAGTCTCCCACCAGA	0.587																																						dbGAP											0													100.0	108.0	105.0					10																	124008183		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.8418C>G	10.37:g.124008183C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.S50C	ENST00000369005.1	37	c.149	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	C	1.575	-0.533223	0.04082	.	.	ENSG00000138162	ENST00000490979	.	.	.	5.29	0.984	0.19773	.	.	.	.	.	T	0.54303	0.1850	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42481	-0.9449	4	.	.	.	-9.5528	7.4581	0.27278	0.1186:0.3524:0.4618:0.0672	.	.	.	.	C	50	.	.	S	+	2	0	TACC2	123998173	0.997000	0.39634	0.773000	0.31616	0.162000	0.22319	0.225000	0.17757	-0.013000	0.14199	0.655000	0.94253	TCT	TACC2	-	pfam_TACC	ENSG00000138162		0.587	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	71	0.00	0	C			124008183	124008183	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000490979	ensembl	human	putative	69_37n	missense	79	24.76	26	SNP	0.986	G
TACC2	10579	genome.wustl.edu	37	10	124008183	124008183	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr10:124008183C>G	ENST00000369005.1	+	20	8758	c.8418C>G	c.(8416-8418)gtC>gtG	p.V2806V	TACC2_ENST00000369004.3_Silent_p.V866V|TACC2_ENST00000368999.1_Silent_p.V896V|TACC2_ENST00000358010.1_Silent_p.V952V|TACC2_ENST00000369001.1_Silent_p.V433V|TACC2_ENST00000515603.1_Silent_p.V2684V|TACC2_ENST00000453444.2_Silent_p.V2733V|TACC2_ENST00000360561.3_Silent_p.V854V|TACC2_ENST00000513429.1_Silent_p.V952V|TACC2_ENST00000515273.1_Silent_p.V2733V|TACC2_ENST00000334433.3_Silent_p.V2806V|TACC2_ENST00000369000.1_Silent_p.V429V|TACC2_ENST00000260733.3_Silent_p.V884V	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2806					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AGAAGTCAGTCTCCCACCAGA	0.587																																						dbGAP											0													100.0	108.0	105.0					10																	124008183		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.8418C>G	10.37:g.124008183C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.S50C	ENST00000369005.1	37	c.149	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	C	1.575	-0.533223	0.04082	.	.	ENSG00000138162	ENST00000490979	.	.	.	5.29	0.984	0.19773	.	.	.	.	.	T	0.54303	0.1850	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42481	-0.9449	4	.	.	.	-9.5528	7.4581	0.27278	0.1186:0.3524:0.4618:0.0672	.	.	.	.	C	50	.	.	S	+	2	0	TACC2	123998173	0.997000	0.39634	0.773000	0.31616	0.162000	0.22319	0.225000	0.17757	-0.013000	0.14199	0.655000	0.94253	TCT	TACC2	-	pfam_TACC	ENSG00000138162		0.587	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	79	0.00	0	C			124008183	124008183	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000490979	ensembl	human	putative	69_37n	missense	79	24.76	26	SNP	0.986	G
TCTEX1D1	200132	genome.wustl.edu	37	1	67242962	67242962	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:67242962T>C	ENST00000282670.2	+	5	493	c.365T>C	c.(364-366)aTg>aCg	p.M122T		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	122										large_intestine(2)|lung(10)|skin(1)	13						AAGGACTTGATGATTCCACGG	0.373																																						dbGAP											0													114.0	116.0	115.0					1																	67242962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.365T>C	1.37:g.67242962T>C	ENSP00000282670:p.Met122Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06YR9|Q5VYE1	Missense_Mutation	SNP	pfam_Tctex	p.M122T	ENST00000282670.2	37	c.365	CCDS633.1	1	.	.	.	.	.	.	.	.	.	.	T	1.051	-0.675969	0.03378	.	.	ENSG00000152760	ENST00000282670	T	0.26810	1.71	5.83	4.71	0.59529	.	0.374809	0.33253	N	0.005119	T	0.12475	0.0303	L	0.52266	1.64	0.39834	D	0.973012	B	0.26400	0.148	B	0.35770	0.21	T	0.05750	-1.0866	10	0.14656	T	0.56	-29.3903	11.2959	0.49277	0.0:0.0714:0.0:0.9286	.	122	Q8N7M0	TC1D1_HUMAN	T	122	ENSP00000282670:M122T	ENSP00000282670:M122T	M	+	2	0	TCTEX1D1	67015550	0.998000	0.40836	0.888000	0.34837	0.124000	0.20399	2.922000	0.48860	1.049000	0.40321	0.533000	0.62120	ATG	TCTEX1D1	-	pfam_Tctex	ENSG00000152760		0.373	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D1	HGNC	protein_coding	OTTHUMT00000025399.2	37	0.00	0	T	NM_152665		67242962	67242962	+1	no_errors	ENST00000282670	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	1.000	C
TCTEX1D1	200132	genome.wustl.edu	37	1	67242962	67242962	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:67242962T>C	ENST00000282670.2	+	5	493	c.365T>C	c.(364-366)aTg>aCg	p.M122T		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	122										large_intestine(2)|lung(10)|skin(1)	13						AAGGACTTGATGATTCCACGG	0.373																																						dbGAP											0													114.0	116.0	115.0					1																	67242962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.365T>C	1.37:g.67242962T>C	ENSP00000282670:p.Met122Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06YR9|Q5VYE1	Missense_Mutation	SNP	pfam_Tctex	p.M122T	ENST00000282670.2	37	c.365	CCDS633.1	1	.	.	.	.	.	.	.	.	.	.	T	1.051	-0.675969	0.03378	.	.	ENSG00000152760	ENST00000282670	T	0.26810	1.71	5.83	4.71	0.59529	.	0.374809	0.33253	N	0.005119	T	0.12475	0.0303	L	0.52266	1.64	0.39834	D	0.973012	B	0.26400	0.148	B	0.35770	0.21	T	0.05750	-1.0866	10	0.14656	T	0.56	-29.3903	11.2959	0.49277	0.0:0.0714:0.0:0.9286	.	122	Q8N7M0	TC1D1_HUMAN	T	122	ENSP00000282670:M122T	ENSP00000282670:M122T	M	+	2	0	TCTEX1D1	67015550	0.998000	0.40836	0.888000	0.34837	0.124000	0.20399	2.922000	0.48860	1.049000	0.40321	0.533000	0.62120	ATG	TCTEX1D1	-	pfam_Tctex	ENSG00000152760		0.373	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D1	HGNC	protein_coding	OTTHUMT00000025399.2	53	0.00	0	T	NM_152665		67242962	67242962	+1	no_errors	ENST00000282670	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	1.000	C
THADA	63892	genome.wustl.edu	37	2	43793725	43793725	+	Intron	SNP	G	G	A	rs1158411	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:43793725G>A	ENST00000405006.4	-	15	2663				THADA_ENST00000415080.2_Intron|THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Intron|THADA_ENST00000403856.1_Missense_Mutation_p.S808L|THADA_ENST00000402360.2_Intron|THADA_ENST00000404790.1_Intron	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated											breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AGGTAAGAATGAAACCTCAAA	0.294													A|||	1769	0.353235	0.438	0.2176	5008	,	,		16990	0.2569		0.3191	False		,,,				2504	0.4693					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2311+111C>T	2.37:g.43793725G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S808L	ENST00000405006.4	37	c.2423	CCDS46268.1	2	683	0.31272893772893773	206	0.4186991869918699	81	0.22375690607734808	160	0.27972027972027974	236	0.3113456464379947	A	11.94	1.789159	0.31685	.	.	ENSG00000115970	ENST00000403856	T	0.31247	1.5	4.3	1.99	0.26369	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.09022	0.002	B	0.11329	0.006	T	0.42799	-0.9430	7	0.72032	D	0.01	.	2.2653	0.04077	0.4144:0.0:0.3213:0.2643	rs1158411;rs17031044;rs58407399;rs1158411	808	B5MC89	.	L	808	ENSP00000385469:S808L	ENSP00000385469:S808L	S	-	2	0	THADA	43647229	0.000000	0.05858	0.030000	0.17652	0.237000	0.25408	0.398000	0.20899	0.032000	0.15435	-0.352000	0.07741	TCA	THADA	-	NULL	ENSG00000115970		0.294	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3	44	0.00	0	G	NM_022065		43793725	43793725	-1	no_errors	ENST00000403856	ensembl	human	putative	69_37n	missense	71	11.25	9	SNP	0.009	A
THADA	63892	genome.wustl.edu	37	2	43793725	43793725	+	Intron	SNP	G	G	A	rs1158411	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:43793725G>A	ENST00000405006.4	-	15	2663				THADA_ENST00000415080.2_Intron|THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Intron|THADA_ENST00000403856.1_Missense_Mutation_p.S808L|THADA_ENST00000402360.2_Intron|THADA_ENST00000404790.1_Intron	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated											breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AGGTAAGAATGAAACCTCAAA	0.294													A|||	1769	0.353235	0.438	0.2176	5008	,	,		16990	0.2569		0.3191	False		,,,				2504	0.4693					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2311+111C>T	2.37:g.43793725G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S808L	ENST00000405006.4	37	c.2423	CCDS46268.1	2	683	0.31272893772893773	206	0.4186991869918699	81	0.22375690607734808	160	0.27972027972027974	236	0.3113456464379947	A	11.94	1.789159	0.31685	.	.	ENSG00000115970	ENST00000403856	T	0.31247	1.5	4.3	1.99	0.26369	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.09022	0.002	B	0.11329	0.006	T	0.42799	-0.9430	7	0.72032	D	0.01	.	2.2653	0.04077	0.4144:0.0:0.3213:0.2643	rs1158411;rs17031044;rs58407399;rs1158411	808	B5MC89	.	L	808	ENSP00000385469:S808L	ENSP00000385469:S808L	S	-	2	0	THADA	43647229	0.000000	0.05858	0.030000	0.17652	0.237000	0.25408	0.398000	0.20899	0.032000	0.15435	-0.352000	0.07741	TCA	THADA	-	NULL	ENSG00000115970		0.294	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3	79	0.00	0	G	NM_022065		43793725	43793725	-1	no_errors	ENST00000403856	ensembl	human	putative	69_37n	missense	71	11.25	9	SNP	0.009	A
THEM5	284486	genome.wustl.edu	37	1	151819720	151819721	+	IGR	INS	-	-	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:151819720_151819721insC	ENST00000368817.5	-	0	984				AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5						cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ggggaggcaggaggcaggaggc	0.703																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070		1.37:g.151819720_151819721insC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1C3	Frame_Shift_Ins	INS	pfam_Thioestr_supf	p.S220fs	ENST00000368817.5	37	c.659_658	CCDS1005.1	1																																																																																			THEM5	-	NULL	ENSG00000196407		0.703	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	47	0.00	0	-	NM_182578		151819720	151819721	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453881	ensembl	human	known	69_37n	frame_shift_ins	58	10.77	7	INS	0.672:0.662	C
TMC2	117532	genome.wustl.edu	37	20	2591085	2591085	+	Silent	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr20:2591085G>A	ENST00000358864.1	+	12	1449	c.1434G>A	c.(1432-1434)ctG>ctA	p.L478L	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	478					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGATGTCCCTGCTTGGAATGT	0.517																																						dbGAP											0													343.0	283.0	304.0					20																	2591085		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1434G>A	20.37:g.2591085G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	pfam_TMC	p.L478	ENST00000358864.1	37	c.1434	CCDS13029.2	20																																																																																			TMC2	-	NULL	ENSG00000149488		0.517	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	99	0.00	0	G			2591085	2591085	+1	no_errors	ENST00000358864	ensembl	human	known	69_37n	silent	181	13.40	28	SNP	1.000	A
TMC2	117532	genome.wustl.edu	37	20	2591085	2591085	+	Silent	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr20:2591085G>A	ENST00000358864.1	+	12	1449	c.1434G>A	c.(1432-1434)ctG>ctA	p.L478L	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	478					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGATGTCCCTGCTTGGAATGT	0.517																																						dbGAP											0													343.0	283.0	304.0					20																	2591085		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1434G>A	20.37:g.2591085G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	pfam_TMC	p.L478	ENST00000358864.1	37	c.1434	CCDS13029.2	20																																																																																			TMC2	-	NULL	ENSG00000149488		0.517	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	146	0.00	0	G			2591085	2591085	+1	no_errors	ENST00000358864	ensembl	human	known	69_37n	silent	181	13.40	28	SNP	1.000	A
TMTC4	84899	genome.wustl.edu	37	13	101288907	101288907	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr13:101288907C>T	ENST00000376234.3	-	9	1213	c.1024G>A	c.(1024-1026)Ggc>Agc	p.G342S	TMTC4_ENST00000328767.5_Missense_Mutation_p.G231S|TMTC4_ENST00000342624.5_Missense_Mutation_p.G361S|TMTC4_ENST00000462211.1_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	342						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GGGATGCAGCCCATTGACCAA	0.502																																						dbGAP											0													136.0	128.0	131.0					13																	101288907		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1024G>A	13.37:g.101288907C>T	ENSP00000365408:p.Gly342Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G361S	ENST00000376234.3	37	c.1081	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.763252	0.96906	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.49139	0.79;0.79;0.79	6.17	6.17	0.99709	Domain of unknown function DUF1736 (1);	0.000000	0.85682	D	0.000000	T	0.74891	0.3776	M	0.84773	2.715	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.91635	0.997;0.976;0.999;0.996	T	0.76124	-0.3074	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	231;342;342;361	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	S	342;361;231	ENSP00000365408:G342S;ENSP00000343871:G361S;ENSP00000365409:G231S	ENSP00000365409:G231S	G	-	1	0	TMTC4	100086908	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGC	TMTC4	-	pfam_DUF1736	ENSG00000125247		0.502	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	54	0.00	0	C	NM_032813		101288907	101288907	-1	no_errors	ENST00000342624	ensembl	human	known	69_37n	missense	47	30.88	21	SNP	1.000	T
TMTC4	84899	genome.wustl.edu	37	13	101288907	101288907	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr13:101288907C>T	ENST00000376234.3	-	9	1213	c.1024G>A	c.(1024-1026)Ggc>Agc	p.G342S	TMTC4_ENST00000328767.5_Missense_Mutation_p.G231S|TMTC4_ENST00000342624.5_Missense_Mutation_p.G361S|TMTC4_ENST00000462211.1_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	342						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GGGATGCAGCCCATTGACCAA	0.502																																						dbGAP											0													136.0	128.0	131.0					13																	101288907		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1024G>A	13.37:g.101288907C>T	ENSP00000365408:p.Gly342Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G361S	ENST00000376234.3	37	c.1081	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.763252	0.96906	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.49139	0.79;0.79;0.79	6.17	6.17	0.99709	Domain of unknown function DUF1736 (1);	0.000000	0.85682	D	0.000000	T	0.74891	0.3776	M	0.84773	2.715	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.91635	0.997;0.976;0.999;0.996	T	0.76124	-0.3074	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	231;342;342;361	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	S	342;361;231	ENSP00000365408:G342S;ENSP00000343871:G361S;ENSP00000365409:G231S	ENSP00000365409:G231S	G	-	1	0	TMTC4	100086908	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGC	TMTC4	-	pfam_DUF1736	ENSG00000125247		0.502	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	54	0.00	0	C	NM_032813		101288907	101288907	-1	no_errors	ENST00000342624	ensembl	human	known	69_37n	missense	47	30.88	21	SNP	1.000	T
TNR	7143	genome.wustl.edu	37	1	175355301	175355301	+	Silent	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:175355301G>T	ENST00000367674.2	-	8	2352	c.1644C>A	c.(1642-1644)acC>acA	p.T548T	TNR_ENST00000263525.2_Silent_p.T548T			Q92752	TENR_HUMAN	tenascin R	548	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.T548T(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GCCGGAAGGTGGTCCTCCCAC	0.602																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											39.0	41.0	40.0					1																	175355301		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1644C>A	1.37:g.175355301G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J563|Q15568|Q5R3G0	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.T548	ENST00000367674.2	37	c.1644	CCDS1318.1	1																																																																																			TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.602	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	48	0.00	0	G	NM_003285		175355301	175355301	-1	no_errors	ENST00000263525	ensembl	human	known	69_37n	silent	69	25.00	23	SNP	1.000	T
TNR	7143	genome.wustl.edu	37	1	175355301	175355301	+	Silent	SNP	G	G	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:175355301G>T	ENST00000367674.2	-	8	2352	c.1644C>A	c.(1642-1644)acC>acA	p.T548T	TNR_ENST00000263525.2_Silent_p.T548T			Q92752	TENR_HUMAN	tenascin R	548	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.T548T(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GCCGGAAGGTGGTCCTCCCAC	0.602																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											39.0	41.0	40.0					1																	175355301		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1644C>A	1.37:g.175355301G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J563|Q15568|Q5R3G0	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.T548	ENST00000367674.2	37	c.1644	CCDS1318.1	1																																																																																			TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.602	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	59	0.00	0	G	NM_003285		175355301	175355301	-1	no_errors	ENST00000263525	ensembl	human	known	69_37n	silent	69	25.00	23	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578479	7578479	+	Missense_Mutation	SNP	G	G	C	rs28934874|rs137852790|rs137852791		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr17:7578479G>C	ENST00000269305.4	-	5	640	c.451C>G	c.(451-453)Ccc>Gcc	p.P151A	TP53_ENST00000445888.2_Missense_Mutation_p.P151A|TP53_ENST00000413465.2_Missense_Mutation_p.P151A|TP53_ENST00000420246.2_Missense_Mutation_p.P151A|TP53_ENST00000359597.4_Missense_Mutation_p.P151A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P151A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151S(68)|p.P151T(16)|p.P151A(13)|p.P152fs*18(9)|p.0?(8)|p.T150fs*16(6)|p.P151fs*30(6)|p.?(5)|p.P58A(2)|p.P58S(2)|p.P19A(2)|p.P19S(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.P58T(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.P19T(1)|p.P152fs*14(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGGCGGGGGTGTGGAATCA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	156	Substitution - Missense(107)|Deletion - Frameshift(23)|Whole gene deletion(8)|Deletion - In frame(7)|Insertion - Frameshift(6)|Unknown(5)	upper_aerodigestive_tract(20)|large_intestine(17)|ovary(16)|lung(15)|oesophagus(12)|endometrium(11)|stomach(9)|breast(9)|central_nervous_system(7)|liver(7)|skin(7)|haematopoietic_and_lymphoid_tissue(5)|soft_tissue(4)|urinary_tract(4)|prostate(4)|bone(4)|vulva(2)|pancreas(2)|biliary_tract(1)	GRCh37	CM012662|CM941326	TP53	M	rs28934874						55.0	55.0	55.0					17																	7578479		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.451C>G	17.37:g.7578479G>C	ENSP00000269305:p.Pro151Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P151A	ENST00000269305.4	37	c.451	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967091	0.53507	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99880	-7.46;-7.46;-7.46;-7.46;-7.46;-7.46;-7.46;-7.46;-7.46	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99885	0.9945	M	0.83692	2.655	0.53688	D	0.999972	D;P;D;P;D;P;D	0.89917	0.994;0.919;0.97;0.912;0.98;0.934;1.0	P;P;P;P;D;P;D	0.91635	0.854;0.796;0.867;0.819;0.918;0.871;0.999	D	0.96428	0.9317	10	0.87932	D	0	-14.1156	17.4784	0.87667	0.0:0.0:1.0:0.0	.	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	A	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151A;ENSP00000352610:P151A;ENSP00000269305:P151A;ENSP00000398846:P151A;ENSP00000391127:P151A;ENSP00000391478:P151A;ENSP00000425104:P19A;ENSP00000423862:P58A;ENSP00000424104:P151A	ENSP00000269305:P151A	P	-	1	0	TP53	7519204	1.000000	0.71417	0.971000	0.41717	0.067000	0.16453	7.823000	0.86660	2.804000	0.96469	0.655000	0.94253	CCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	38	0.00	0	G	NM_000546		7578479	7578479	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	0.999	C
TP53	7157	genome.wustl.edu	37	17	7578479	7578479	+	Missense_Mutation	SNP	G	G	C	rs28934874|rs137852790|rs137852791		TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr17:7578479G>C	ENST00000269305.4	-	5	640	c.451C>G	c.(451-453)Ccc>Gcc	p.P151A	TP53_ENST00000445888.2_Missense_Mutation_p.P151A|TP53_ENST00000413465.2_Missense_Mutation_p.P151A|TP53_ENST00000420246.2_Missense_Mutation_p.P151A|TP53_ENST00000359597.4_Missense_Mutation_p.P151A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P151A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151S(68)|p.P151T(16)|p.P151A(13)|p.P152fs*18(9)|p.0?(8)|p.T150fs*16(6)|p.P151fs*30(6)|p.?(5)|p.P58A(2)|p.P58S(2)|p.P19A(2)|p.P19S(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.P58T(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.P19T(1)|p.P152fs*14(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGGCGGGGGTGTGGAATCA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	156	Substitution - Missense(107)|Deletion - Frameshift(23)|Whole gene deletion(8)|Deletion - In frame(7)|Insertion - Frameshift(6)|Unknown(5)	upper_aerodigestive_tract(20)|large_intestine(17)|ovary(16)|lung(15)|oesophagus(12)|endometrium(11)|stomach(9)|breast(9)|central_nervous_system(7)|liver(7)|skin(7)|haematopoietic_and_lymphoid_tissue(5)|soft_tissue(4)|urinary_tract(4)|prostate(4)|bone(4)|vulva(2)|pancreas(2)|biliary_tract(1)	GRCh37	CM012662|CM941326	TP53	M	rs28934874						55.0	55.0	55.0					17																	7578479		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.451C>G	17.37:g.7578479G>C	ENSP00000269305:p.Pro151Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P151A	ENST00000269305.4	37	c.451	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967091	0.53507	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99880	-7.46;-7.46;-7.46;-7.46;-7.46;-7.46;-7.46;-7.46;-7.46	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99885	0.9945	M	0.83692	2.655	0.53688	D	0.999972	D;P;D;P;D;P;D	0.89917	0.994;0.919;0.97;0.912;0.98;0.934;1.0	P;P;P;P;D;P;D	0.91635	0.854;0.796;0.867;0.819;0.918;0.871;0.999	D	0.96428	0.9317	10	0.87932	D	0	-14.1156	17.4784	0.87667	0.0:0.0:1.0:0.0	.	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	A	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151A;ENSP00000352610:P151A;ENSP00000269305:P151A;ENSP00000398846:P151A;ENSP00000391127:P151A;ENSP00000391478:P151A;ENSP00000425104:P19A;ENSP00000423862:P58A;ENSP00000424104:P151A	ENSP00000269305:P151A	P	-	1	0	TP53	7519204	1.000000	0.71417	0.971000	0.41717	0.067000	0.16453	7.823000	0.86660	2.804000	0.96469	0.655000	0.94253	CCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	47	0.00	0	G	NM_000546		7578479	7578479	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	0.999	C
UBE3B	89910	genome.wustl.edu	37	12	109935652	109935652	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr12:109935652A>G	ENST00000342494.3	+	10	1338	c.743A>G	c.(742-744)aAt>aGt	p.N248S	UBE3B_ENST00000280774.5_Missense_Mutation_p.N248S|UBE3B_ENST00000434735.2_Missense_Mutation_p.N248S	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	248					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TTCTCAGACAATCTGATTCGG	0.527																																						dbGAP											0													254.0	192.0	213.0					12																	109935652		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.743A>G	12.37:g.109935652A>G	ENSP00000340596:p.Asn248Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.N248S	ENST00000342494.3	37	c.743	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	A	16.99	3.273777	0.59649	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	T;T;T;T	0.47869	1.19;0.83;1.44;1.19	5.95	4.81	0.61882	.	0.078950	0.85682	N	0.000000	T	0.47507	0.1449	M	0.70275	2.135	0.52501	D	0.999957	B	0.06786	0.001	B	0.06405	0.002	T	0.44221	-0.9342	10	0.56958	D	0.05	-45.6081	11.4276	0.50020	0.9295:0.0:0.0705:0.0	.	248	Q7Z3V4	UBE3B_HUMAN	S	248	ENSP00000391529:N248S;ENSP00000280774:N248S;ENSP00000443131:N248S;ENSP00000340596:N248S	ENSP00000280774:N248S	N	+	2	0	UBE3B	108420035	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.619000	0.61218	1.077000	0.40990	0.477000	0.44152	AAT	UBE3B	-	NULL	ENSG00000151148		0.527	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	76	0.00	0	A	NM_183415		109935652	109935652	+1	no_errors	ENST00000342494	ensembl	human	known	69_37n	missense	88	22.81	26	SNP	1.000	G
UBE3B	89910	genome.wustl.edu	37	12	109935652	109935652	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr12:109935652A>G	ENST00000342494.3	+	10	1338	c.743A>G	c.(742-744)aAt>aGt	p.N248S	UBE3B_ENST00000280774.5_Missense_Mutation_p.N248S|UBE3B_ENST00000434735.2_Missense_Mutation_p.N248S	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	248					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TTCTCAGACAATCTGATTCGG	0.527																																						dbGAP											0													254.0	192.0	213.0					12																	109935652		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.743A>G	12.37:g.109935652A>G	ENSP00000340596:p.Asn248Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.N248S	ENST00000342494.3	37	c.743	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	A	16.99	3.273777	0.59649	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	T;T;T;T	0.47869	1.19;0.83;1.44;1.19	5.95	4.81	0.61882	.	0.078950	0.85682	N	0.000000	T	0.47507	0.1449	M	0.70275	2.135	0.52501	D	0.999957	B	0.06786	0.001	B	0.06405	0.002	T	0.44221	-0.9342	10	0.56958	D	0.05	-45.6081	11.4276	0.50020	0.9295:0.0:0.0705:0.0	.	248	Q7Z3V4	UBE3B_HUMAN	S	248	ENSP00000391529:N248S;ENSP00000280774:N248S;ENSP00000443131:N248S;ENSP00000340596:N248S	ENSP00000280774:N248S	N	+	2	0	UBE3B	108420035	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.619000	0.61218	1.077000	0.40990	0.477000	0.44152	AAT	UBE3B	-	NULL	ENSG00000151148		0.527	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	65	0.00	0	A	NM_183415		109935652	109935652	+1	no_errors	ENST00000342494	ensembl	human	known	69_37n	missense	88	22.81	26	SNP	1.000	G
UBXN4	23190	genome.wustl.edu	37	2	136513204	136513204	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr2:136513204A>C	ENST00000272638.9	+	5	762	c.451A>C	c.(451-453)Aat>Cat	p.N151H	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	151					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						TCAGTCCAGAAATGCAGAGCT	0.408																																						dbGAP											0													109.0	104.0	106.0					2																	136513204		1856	4110	5966	-	-	-	SO:0001583	missense	0			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.451A>C	2.37:g.136513204A>C	ENSP00000272638:p.Asn151His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	pfam_UBX,superfamily_Thioredoxin-like_fold,smart_UBX,pfscan_UBX	p.N151H	ENST00000272638.9	37	c.451	CCDS42761.1	2	.	.	.	.	.	.	.	.	.	.	A	11.08	1.532264	0.27387	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.47177	0.85	5.51	1.66	0.24008	.	0.756116	0.13159	N	0.409240	T	0.36054	0.0953	L	0.59436	1.845	0.09310	N	1	P	0.39624	0.681	B	0.34722	0.188	T	0.25572	-1.0128	10	0.45353	T	0.12	.	3.3215	0.07052	0.5703:0.0:0.2649:0.1648	.	151	Q92575	UBXN4_HUMAN	H	151;133	ENSP00000272638:N151H	ENSP00000272638:N151H	N	+	1	0	UBXN4	136229674	0.002000	0.14202	0.045000	0.18777	0.439000	0.31926	0.742000	0.26216	0.401000	0.25424	0.455000	0.32223	AAT	UBXN4	-	NULL	ENSG00000144224		0.408	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN4	HGNC	protein_coding	OTTHUMT00000331696.1	38	0.00	0	A	NM_014607		136513204	136513204	+1	no_errors	ENST00000272638	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	0.010	C
UBXN4	23190	genome.wustl.edu	37	2	136513204	136513204	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr2:136513204A>C	ENST00000272638.9	+	5	762	c.451A>C	c.(451-453)Aat>Cat	p.N151H	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	151					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						TCAGTCCAGAAATGCAGAGCT	0.408																																						dbGAP											0													109.0	104.0	106.0					2																	136513204		1856	4110	5966	-	-	-	SO:0001583	missense	0			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.451A>C	2.37:g.136513204A>C	ENSP00000272638:p.Asn151His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	pfam_UBX,superfamily_Thioredoxin-like_fold,smart_UBX,pfscan_UBX	p.N151H	ENST00000272638.9	37	c.451	CCDS42761.1	2	.	.	.	.	.	.	.	.	.	.	A	11.08	1.532264	0.27387	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.47177	0.85	5.51	1.66	0.24008	.	0.756116	0.13159	N	0.409240	T	0.36054	0.0953	L	0.59436	1.845	0.09310	N	1	P	0.39624	0.681	B	0.34722	0.188	T	0.25572	-1.0128	10	0.45353	T	0.12	.	3.3215	0.07052	0.5703:0.0:0.2649:0.1648	.	151	Q92575	UBXN4_HUMAN	H	151;133	ENSP00000272638:N151H	ENSP00000272638:N151H	N	+	1	0	UBXN4	136229674	0.002000	0.14202	0.045000	0.18777	0.439000	0.31926	0.742000	0.26216	0.401000	0.25424	0.455000	0.32223	AAT	UBXN4	-	NULL	ENSG00000144224		0.408	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN4	HGNC	protein_coding	OTTHUMT00000331696.1	53	0.00	0	A	NM_014607		136513204	136513204	+1	no_errors	ENST00000272638	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	0.010	C
URB2	9816	genome.wustl.edu	37	1	229781694	229781694	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr1:229781694C>T	ENST00000258243.2	+	6	4020	c.3884C>T	c.(3883-3885)cCc>cTc	p.P1295L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1295						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CGTGCGTGTCCCCAGATAGTC	0.537																																						dbGAP											0													210.0	186.0	194.0					1																	229781694		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3884C>T	1.37:g.229781694C>T	ENSP00000258243:p.Pro1295Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.P1295L	ENST00000258243.2	37	c.3884	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611613	0.87258	.	.	ENSG00000135763	ENST00000258243	T	0.56275	0.47	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.71307	0.3324	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69895	-0.5021	9	.	.	.	-27.8976	17.7613	0.88465	0.0:1.0:0.0:0.0	.	1295	Q14146	URB2_HUMAN	L	1295	ENSP00000258243:P1295L	.	P	+	2	0	URB2	227848317	0.999000	0.42202	0.987000	0.45799	0.991000	0.79684	4.984000	0.63838	2.709000	0.92574	0.491000	0.48974	CCC	URB2	-	NULL	ENSG00000135763		0.537	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	107	0.00	0	C	NM_014777		229781694	229781694	+1	no_errors	ENST00000258243	ensembl	human	known	69_37n	missense	97	23.02	29	SNP	0.999	T
URB2	9816	genome.wustl.edu	37	1	229781694	229781694	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr1:229781694C>T	ENST00000258243.2	+	6	4020	c.3884C>T	c.(3883-3885)cCc>cTc	p.P1295L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1295						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CGTGCGTGTCCCCAGATAGTC	0.537																																						dbGAP											0													210.0	186.0	194.0					1																	229781694		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3884C>T	1.37:g.229781694C>T	ENSP00000258243:p.Pro1295Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.P1295L	ENST00000258243.2	37	c.3884	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611613	0.87258	.	.	ENSG00000135763	ENST00000258243	T	0.56275	0.47	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.71307	0.3324	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69895	-0.5021	9	.	.	.	-27.8976	17.7613	0.88465	0.0:1.0:0.0:0.0	.	1295	Q14146	URB2_HUMAN	L	1295	ENSP00000258243:P1295L	.	P	+	2	0	URB2	227848317	0.999000	0.42202	0.987000	0.45799	0.991000	0.79684	4.984000	0.63838	2.709000	0.92574	0.491000	0.48974	CCC	URB2	-	NULL	ENSG00000135763		0.537	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	103	0.00	0	C	NM_014777		229781694	229781694	+1	no_errors	ENST00000258243	ensembl	human	known	69_37n	missense	97	23.02	29	SNP	0.999	T
VCL	7414	genome.wustl.edu	37	10	75874588	75874588	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr10:75874588C>G	ENST00000211998.4	+	21	3283	c.3189C>G	c.(3187-3189)ctC>ctG	p.L1063L	VCL_ENST00000417648.2_Silent_p.L256L|VCL_ENST00000372755.3_Silent_p.L995L	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	1063	C-terminal tail.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GCACCCAGCTCAAAATCCTGT	0.488																																						dbGAP											0													92.0	82.0	86.0					10																	75874588		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.3189C>G	10.37:g.75874588C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.L1063	ENST00000211998.4	37	c.3189	CCDS7341.1	10																																																																																			VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.488	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		46	0.00	0	C	NM_003373, NM_014000		75874588	75874588	+1	no_errors	ENST00000211998	ensembl	human	known	69_37n	silent	46	19.30	11	SNP	1.000	G
VCL	7414	genome.wustl.edu	37	10	75874588	75874588	+	Silent	SNP	C	C	G			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr10:75874588C>G	ENST00000211998.4	+	21	3283	c.3189C>G	c.(3187-3189)ctC>ctG	p.L1063L	VCL_ENST00000417648.2_Silent_p.L256L|VCL_ENST00000372755.3_Silent_p.L995L	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	1063	C-terminal tail.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GCACCCAGCTCAAAATCCTGT	0.488																																						dbGAP											0													92.0	82.0	86.0					10																	75874588		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.3189C>G	10.37:g.75874588C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.L1063	ENST00000211998.4	37	c.3189	CCDS7341.1	10																																																																																			VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.488	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		74	0.00	0	C	NM_003373, NM_014000		75874588	75874588	+1	no_errors	ENST00000211998	ensembl	human	known	69_37n	silent	46	19.30	11	SNP	1.000	G
RNF169	254225	genome.wustl.edu	37	11	74556118	74556118	+	IGR	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr11:74556118C>A	ENST00000299563.4	+	0	7823				XRRA1_ENST00000340360.6_Splice_Site_p.G635*|RN7SL239P_ENST00000490061.2_RNA|XRRA1_ENST00000321448.8_Splice_Site_p.G360*|XRRA1_ENST00000527087.1_Splice_Site_p.G548*	NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169						cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						CCTCACATACCCTTTGGCTCA	0.547																																						dbGAP											0													137.0	140.0	139.0					11																	74556118		2015	4180	6195	-	-	-	SO:0001628	intergenic_variant	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516		11.37:g.74556118C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6N015	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.G635*	ENST00000299563.4	37	c.1903	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	C	46	12.640370	0.99684	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418;ENST00000527087	.	.	.	5.65	4.73	0.59995	.	0.076260	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.9827	13.7129	0.62678	0.155:0.845:0.0:0.0	.	.	.	.	X	635;360;621;579;548	.	.	G	-	1	0	XRRA1	74233766	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.284000	0.58983	1.602000	0.50124	0.655000	0.94253	GGA	XRRA1	-	NULL	ENSG00000166435		0.547	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384741.1	152	0.00	0	C	XM_495886		74556118	74556118	-1	no_errors	ENST00000340360	ensembl	human	known	69_37n	nonsense	182	20.52	47	SNP	1.000	A
RNF169	254225	genome.wustl.edu	37	11	74556118	74556118	+	IGR	SNP	C	C	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr11:74556118C>A	ENST00000299563.4	+	0	7823				XRRA1_ENST00000340360.6_Splice_Site_p.G635*|RN7SL239P_ENST00000490061.2_RNA|XRRA1_ENST00000321448.8_Splice_Site_p.G360*|XRRA1_ENST00000527087.1_Splice_Site_p.G548*	NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169						cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						CCTCACATACCCTTTGGCTCA	0.547																																						dbGAP											0													137.0	140.0	139.0					11																	74556118		2015	4180	6195	-	-	-	SO:0001628	intergenic_variant	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516		11.37:g.74556118C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6N015	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.G635*	ENST00000299563.4	37	c.1903	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	C	46	12.640370	0.99684	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418;ENST00000527087	.	.	.	5.65	4.73	0.59995	.	0.076260	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.9827	13.7129	0.62678	0.155:0.845:0.0:0.0	.	.	.	.	X	635;360;621;579;548	.	.	G	-	1	0	XRRA1	74233766	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.284000	0.58983	1.602000	0.50124	0.655000	0.94253	GGA	XRRA1	-	NULL	ENSG00000166435		0.547	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384741.1	164	0.00	0	C	XM_495886		74556118	74556118	-1	no_errors	ENST00000340360	ensembl	human	known	69_37n	nonsense	182	20.52	47	SNP	1.000	A
ZDHHC11	79844	genome.wustl.edu	37	5	711333	711333	+	Intron	SNP	G	G	C	rs112677584	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr5:711333G>C	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CCCTTTCCCAGTACTGTGCTC	0.542													-|||	806	0.160942	0.3782	0.0865	5008	,	,		30564	0.0952		0.0845	False		,,,				2504	0.0665					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-334C>G	5.37:g.711333G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.542	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		27	0.00	0	G	NM_024786		711333	711333	-1	no_errors	ENST00000522356	ensembl	human	known	69_37n	rna	43	10.42	5	SNP	0.000	C
ZDHHC11	79844	genome.wustl.edu	37	5	711333	711333	+	Intron	SNP	G	G	C	rs112677584	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr5:711333G>C	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CCCTTTCCCAGTACTGTGCTC	0.542													-|||	806	0.160942	0.3782	0.0865	5008	,	,		30564	0.0952		0.0845	False		,,,				2504	0.0665					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-334C>G	5.37:g.711333G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.542	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		56	0.00	0	G	NM_024786		711333	711333	-1	no_errors	ENST00000522356	ensembl	human	known	69_37n	rna	43	10.42	5	SNP	0.000	C
ZKSCAN8	7745	genome.wustl.edu	37	6	28121251	28121251	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr6:28121251G>A	ENST00000330236.6	+	6	1377	c.1193G>A	c.(1192-1194)aGa>aAa	p.R398K	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.R398K	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	398					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTGCACCAGAGAATCCACACT	0.488																																						dbGAP											0													93.0	104.0	100.0					6																	28121251		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.1193G>A	6.37:g.28121251G>A	ENSP00000332750:p.Arg398Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R398K	ENST00000330236.6	37	c.1193	CCDS4645.1	6	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678613	0.68042	.	.	ENSG00000198315	ENST00000330236;ENST00000457389	T;T	0.18338	2.22;2.22	5.99	5.99	0.97316	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000004	T	0.11324	0.0276	L	0.28344	0.845	0.80722	D	1	P	0.40000	0.698	P	0.48921	0.595	T	0.05852	-1.0860	10	0.35671	T	0.21	.	12.5675	0.56318	0.0768:0.0:0.9232:0.0	.	398	Q15776	ZN192_HUMAN	K	398	ENSP00000332750:R398K;ENSP00000402948:R398K	ENSP00000332750:R398K	R	+	2	0	ZNF192	28229230	0.001000	0.12720	1.000000	0.80357	0.999000	0.98932	0.868000	0.27982	2.853000	0.98044	0.655000	0.94253	AGA	ZNF192	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198315		0.488	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF192	HGNC	protein_coding	OTTHUMT00000040178.2	50	0.00	0	G			28121251	28121251	+1	no_errors	ENST00000330236	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	A
ZNF880	400713	genome.wustl.edu	37	19	52888048	52888048	+	Silent	SNP	G	G	A	rs324124	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	16213e15-1e04-43d3-969a-3c0de008d69e	g.chr19:52888048G>A	ENST00000422689.2	+	4	1230	c.1215G>A	c.(1213-1215)gaG>gaA	p.E405E		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	405					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						ACACGGGAGAGCAACCTTACA	0.403													G|||	772	0.154153	0.2526	0.1124	5008	,	,		20761	0.1468		0.1421	False		,,,				2504	0.0706					dbGAP											0													69.0	63.0	65.0					19																	52888048		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1215G>A	19.37:g.52888048G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNA6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E405	ENST00000422689.2	37	c.1215	CCDS46164.1	19																																																																																			ZNF880	-	pfscan_Znf_C2H2	ENSG00000221923		0.403	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	26	0.00	0	G	NM_001145434		52888048	52888048	+1	no_errors	ENST00000422689	ensembl	human	known	69_37n	silent	46	11.54	6	SNP	1.000	A
ZNF880	400713	genome.wustl.edu	37	19	52888048	52888048	+	Silent	SNP	G	G	A	rs324124	byFrequency	TCGA-A7-A4SA-01A-11D-A25Q-09	TCGA-A7-A4SA-11A-44D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d76ae66f-5c29-4e62-a943-b54b8c2c3dd6	53c7f39c-b4c7-48b6-8e7d-674f3dbb7811	g.chr19:52888048G>A	ENST00000422689.2	+	4	1230	c.1215G>A	c.(1213-1215)gaG>gaA	p.E405E		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	405					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						ACACGGGAGAGCAACCTTACA	0.403													G|||	772	0.154153	0.2526	0.1124	5008	,	,		20761	0.1468		0.1421	False		,,,				2504	0.0706					dbGAP											0													69.0	63.0	65.0					19																	52888048		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1215G>A	19.37:g.52888048G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNA6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E405	ENST00000422689.2	37	c.1215	CCDS46164.1	19																																																																																			ZNF880	-	pfscan_Znf_C2H2	ENSG00000221923		0.403	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	51	0.00	0	G	NM_001145434		52888048	52888048	+1	no_errors	ENST00000422689	ensembl	human	known	69_37n	silent	46	11.54	6	SNP	1.000	A
