#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL9	284382	genome.wustl.edu	37	19	8807880	8807880	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr19:8807880C>T	ENST00000324436.3	-	1	1292	c.1172G>A	c.(1171-1173)cGc>cAc	p.R391H		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						CTGGAAGGCGCGCAGGGAGGC	0.652																																						dbGAP											0													38.0	40.0	39.0					19																	8807880		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1172G>A	19.37:g.8807880C>T	ENSP00000316674:p.Arg391His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R391H	ENST00000324436.3	37	c.1172	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	c	12.78	2.040034	0.35989	.	.	ENSG00000181786	ENST00000324436	T	0.07800	3.16	4.51	2.32	0.28847	.	0.317190	0.22565	U	0.058402	T	0.05456	0.0144	N	0.20845	0.615	0.25834	N	0.984134	B	0.25521	0.128	B	0.23419	0.046	T	0.30650	-0.9971	10	0.87932	D	0	.	7.217	0.25965	0.0:0.5778:0.3287:0.0934	.	391	Q8TC94	ACTL9_HUMAN	H	391	ENSP00000316674:R391H	ENSP00000316674:R391H	R	-	2	0	ACTL9	8668880	0.005000	0.15991	0.279000	0.24732	0.748000	0.42578	0.594000	0.24014	0.592000	0.29728	0.457000	0.33378	CGC	ACTL9	-	pfam_Actin-like,smart_Actin-like	ENSG00000181786		0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	68	0.00	0	C	NM_178525		8807880	8807880	-1	no_errors	ENST00000324436	ensembl	human	known	69_37n	missense	46	24.19	15	SNP	0.971	T
ACTL9	284382	genome.wustl.edu	37	19	8807880	8807880	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr19:8807880C>T	ENST00000324436.3	-	1	1292	c.1172G>A	c.(1171-1173)cGc>cAc	p.R391H		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						CTGGAAGGCGCGCAGGGAGGC	0.652																																						dbGAP											0													38.0	40.0	39.0					19																	8807880		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1172G>A	19.37:g.8807880C>T	ENSP00000316674:p.Arg391His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R391H	ENST00000324436.3	37	c.1172	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	c	12.78	2.040034	0.35989	.	.	ENSG00000181786	ENST00000324436	T	0.07800	3.16	4.51	2.32	0.28847	.	0.317190	0.22565	U	0.058402	T	0.05456	0.0144	N	0.20845	0.615	0.25834	N	0.984134	B	0.25521	0.128	B	0.23419	0.046	T	0.30650	-0.9971	10	0.87932	D	0	.	7.217	0.25965	0.0:0.5778:0.3287:0.0934	.	391	Q8TC94	ACTL9_HUMAN	H	391	ENSP00000316674:R391H	ENSP00000316674:R391H	R	-	2	0	ACTL9	8668880	0.005000	0.15991	0.279000	0.24732	0.748000	0.42578	0.594000	0.24014	0.592000	0.29728	0.457000	0.33378	CGC	ACTL9	-	pfam_Actin-like,smart_Actin-like	ENSG00000181786		0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	123	0.00	0	C	NM_178525		8807880	8807880	-1	no_errors	ENST00000324436	ensembl	human	known	69_37n	missense	46	24.19	15	SNP	0.971	T
ADORA3	140	genome.wustl.edu	37	1	112032289	112032289	+	Intron	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr1:112032289G>A	ENST00000369716.4	-	3	591				ADORA3_ENST00000369717.4_Intron|RNU6-792P_ENST00000363490.1_RNA	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor						activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GAGGCTTACCGTTAGGAGGCC	0.547																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.458-643C>T	1.37:g.112032289G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3P4|Q6UWU0|Q9BYZ1	RNA	SNP	-	NULL	ENST00000369716.4	37	NULL	CCDS838.1	1																																																																																			ADORA3	-	-	ENSG00000121933		0.547	ADORA3-007	KNOWN	basic|CCDS	protein_coding	ADORA3	HGNC	protein_coding	OTTHUMT00000157679.1	56	0.00	0	G	NM_000677, NM_020683		112032289	112032289	-1	no_errors	ENST00000463993	ensembl	human	known	69_37n	rna	24	35.14	13	SNP	0.000	A
ADORA3	140	genome.wustl.edu	37	1	112032289	112032289	+	Intron	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:112032289G>A	ENST00000369716.4	-	3	591				ADORA3_ENST00000369717.4_Intron|RNU6-792P_ENST00000363490.1_RNA	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor						activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GAGGCTTACCGTTAGGAGGCC	0.547																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.458-643C>T	1.37:g.112032289G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3P4|Q6UWU0|Q9BYZ1	RNA	SNP	-	NULL	ENST00000369716.4	37	NULL	CCDS838.1	1																																																																																			ADORA3	-	-	ENSG00000121933		0.547	ADORA3-007	KNOWN	basic|CCDS	protein_coding	ADORA3	HGNC	protein_coding	OTTHUMT00000157679.1	119	0.00	0	G	NM_000677, NM_020683		112032289	112032289	-1	no_errors	ENST00000463993	ensembl	human	known	69_37n	rna	24	35.14	13	SNP	0.000	A
ANK2	287	genome.wustl.edu	37	4	114267087	114267087	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr4:114267087G>A	ENST00000357077.4	+	35	4333	c.4280G>A	c.(4279-4281)cGa>cAa	p.R1427Q	ANK2_ENST00000506722.1_Missense_Mutation_p.R1418Q|ANK2_ENST00000394537.3_Missense_Mutation_p.R1427Q|ANK2_ENST00000264366.6_Missense_Mutation_p.R1394Q|ANK2_ENST00000510275.2_Missense_Mutation_p.R79Q|ANK2_ENST00000509550.1_Missense_Mutation_p.R603Q	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1427					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCTTGCGGACGACTATCATTT	0.408																																						dbGAP											0													125.0	107.0	113.0					4																	114267087		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4280G>A	4.37:g.114267087G>A	ENSP00000349588:p.Arg1427Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.R1427Q	ENST00000357077.4	37	c.4280	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.014519	0.97200	.	.	ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275	T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	6.08	6.08	0.98989	.	0.000000	0.45361	D	0.000364	T	0.63954	0.2555	M	0.86268	2.805	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.973;0.996;0.927;0.996;0.976;0.999;0.996	T	0.66400	-0.5933	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	603;1394;473;439;1427;1427;1418	E9PCH6;Q01484;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.;ANK2_HUMAN;.;.;.;.;.	Q	1340;1418;473;1442;1427;1427;1394;1418;603;79	ENSP00000421011:R1340Q;ENSP00000421067:R1418Q;ENSP00000424722:R1442Q;ENSP00000378044:R1427Q;ENSP00000349588:R1427Q;ENSP00000264366:R1394Q;ENSP00000426944:R603Q;ENSP00000421023:R79Q	ENSP00000264366:R1394Q	R	+	2	0	ANK2	114486536	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	CGA	ANK2	-	NULL	ENSG00000145362		0.408	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	45	0.00	0	G	NM_001148		114267087	114267087	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	1.000	A
ANK2	287	genome.wustl.edu	37	4	114267087	114267087	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr4:114267087G>A	ENST00000357077.4	+	35	4333	c.4280G>A	c.(4279-4281)cGa>cAa	p.R1427Q	ANK2_ENST00000506722.1_Missense_Mutation_p.R1418Q|ANK2_ENST00000394537.3_Missense_Mutation_p.R1427Q|ANK2_ENST00000264366.6_Missense_Mutation_p.R1394Q|ANK2_ENST00000510275.2_Missense_Mutation_p.R79Q|ANK2_ENST00000509550.1_Missense_Mutation_p.R603Q	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1427					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCTTGCGGACGACTATCATTT	0.408																																						dbGAP											0													125.0	107.0	113.0					4																	114267087		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4280G>A	4.37:g.114267087G>A	ENSP00000349588:p.Arg1427Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.R1427Q	ENST00000357077.4	37	c.4280	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.014519	0.97200	.	.	ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275	T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	6.08	6.08	0.98989	.	0.000000	0.45361	D	0.000364	T	0.63954	0.2555	M	0.86268	2.805	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.973;0.996;0.927;0.996;0.976;0.999;0.996	T	0.66400	-0.5933	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	603;1394;473;439;1427;1427;1418	E9PCH6;Q01484;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.;ANK2_HUMAN;.;.;.;.;.	Q	1340;1418;473;1442;1427;1427;1394;1418;603;79	ENSP00000421011:R1340Q;ENSP00000421067:R1418Q;ENSP00000424722:R1442Q;ENSP00000378044:R1427Q;ENSP00000349588:R1427Q;ENSP00000264366:R1394Q;ENSP00000426944:R603Q;ENSP00000421023:R79Q	ENSP00000264366:R1394Q	R	+	2	0	ANK2	114486536	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	CGA	ANK2	-	NULL	ENSG00000145362		0.408	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	58	0.00	0	G	NM_001148		114267087	114267087	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	1.000	A
ANKRD20A1	84210	genome.wustl.edu	37	9	67934804	67934804	+	Missense_Mutation	SNP	T	T	A	rs28618293	byFrequency	TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr9:67934804T>A	ENST00000377477.2	+	4	686	c.574T>A	c.(574-576)Tca>Aca	p.S192T	RNU6-368P_ENST00000391117.1_RNA	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	192						plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						GAAAGCAAGTTCACATGCCGT	0.313													T|||	1806	0.360623	0.2292	0.4352	5008	,	,		18772	0.4038		0.3857	False		,,,				2504	0.4151					dbGAP											0													1.0	1.0	1.0					9																	67934804		246	547	793	-	-	-	SO:0001583	missense	0			AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.574T>A	9.37:g.67934804T>A	ENSP00000366697:p.Ser192Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0H6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S192T	ENST00000377477.2	37	c.574	CCDS6620.1	9	.	.	.	.	.	.	.	.	.	.	.	2.483	-0.319143	0.05386	.	.	ENSG00000196774	ENST00000377477	T	0.52057	0.68	1.88	0.715	0.18186	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.17408	0.0418	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15752	-1.0426	9	0.42905	T	0.14	.	1.6133	0.02698	0.5065:0.0:0.1974:0.296	.	192	Q5TYW2	A20A1_HUMAN	T	192	ENSP00000366697:S192T	ENSP00000366697:S192T	S	+	1	0	ANKRD20A1	67524624	0.000000	0.05858	0.003000	0.11579	0.025000	0.11179	-0.410000	0.07151	0.010000	0.14839	-2.408000	0.00222	TCA	ANKRD20A1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000196774		0.313	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A1	HGNC	protein_coding	OTTHUMT00000083800.1	30	0.00	0	T			67934804	67934804	+1	no_errors	ENST00000377477	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	0.007	A
BTBD11	121551	genome.wustl.edu	37	12	108011110	108011110	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr12:108011110C>T	ENST00000280758.5	+	9	2656	c.2128C>T	c.(2128-2130)Cgt>Tgt	p.R710C	BTBD11_ENST00000420571.2_Intron|BTBD11_ENST00000490090.2_Missense_Mutation_p.R710C|BTBD11_ENST00000357167.4_Missense_Mutation_p.R247C|RP11-128P10.1_ENST00000548473.1_RNA	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	710						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GCTGTTGGAGCGTGGTGCCGA	0.483																																						dbGAP											0													112.0	122.0	118.0					12																	108011110		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2128C>T	12.37:g.108011110C>T	ENSP00000280758:p.Arg710Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.R710C	ENST00000280758.5	37	c.2128	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091175	0.76756	.	.	ENSG00000151136	ENST00000280758;ENST00000490090;ENST00000357167	T;T;T	0.65732	-0.17;-0.17;-0.17	5.49	5.49	0.81192	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.74989	0.3789	L	0.43554	1.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.991;0.994;0.998	T	0.76817	-0.2819	10	0.87932	D	0	.	19.3748	0.94503	0.0:1.0:0.0:0.0	.	247;710;710	E9PHS4;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	C	710;710;247	ENSP00000280758:R710C;ENSP00000447319:R710C;ENSP00000349690:R247C	ENSP00000280758:R710C	R	+	1	0	BTBD11	106535240	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.549000	0.53681	2.572000	0.86782	0.655000	0.94253	CGT	BTBD11	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151136		0.483	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	69	0.00	0	C	NM_152322		108011110	108011110	+1	no_errors	ENST00000280758	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	T
BTBD11	121551	genome.wustl.edu	37	12	108011110	108011110	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr12:108011110C>T	ENST00000280758.5	+	9	2656	c.2128C>T	c.(2128-2130)Cgt>Tgt	p.R710C	BTBD11_ENST00000420571.2_Intron|BTBD11_ENST00000490090.2_Missense_Mutation_p.R710C|BTBD11_ENST00000357167.4_Missense_Mutation_p.R247C|RP11-128P10.1_ENST00000548473.1_RNA	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	710						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GCTGTTGGAGCGTGGTGCCGA	0.483																																						dbGAP											0													112.0	122.0	118.0					12																	108011110		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2128C>T	12.37:g.108011110C>T	ENSP00000280758:p.Arg710Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.R710C	ENST00000280758.5	37	c.2128	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091175	0.76756	.	.	ENSG00000151136	ENST00000280758;ENST00000490090;ENST00000357167	T;T;T	0.65732	-0.17;-0.17;-0.17	5.49	5.49	0.81192	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.74989	0.3789	L	0.43554	1.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.991;0.994;0.998	T	0.76817	-0.2819	10	0.87932	D	0	.	19.3748	0.94503	0.0:1.0:0.0:0.0	.	247;710;710	E9PHS4;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	C	710;710;247	ENSP00000280758:R710C;ENSP00000447319:R710C;ENSP00000349690:R247C	ENSP00000280758:R710C	R	+	1	0	BTBD11	106535240	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.549000	0.53681	2.572000	0.86782	0.655000	0.94253	CGT	BTBD11	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151136		0.483	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	119	0.00	0	C	NM_152322		108011110	108011110	+1	no_errors	ENST00000280758	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	T
C3orf52	79669	genome.wustl.edu	37	3	111805270	111805270	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr3:111805270C>T	ENST00000264848.5	+	1	75	c.16C>T	c.(16-18)Ccc>Tcc	p.P6S	C3orf52_ENST00000431717.2_Missense_Mutation_p.P6S|C3orf52_ENST00000430855.1_Missense_Mutation_p.P6S	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52	6						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						CCTGGCCCAACCCTCACAGCC	0.652																																						dbGAP											0													49.0	52.0	51.0					3																	111805270		692	1591	2283	-	-	-	SO:0001583	missense	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.16C>T	3.37:g.111805270C>T	ENSP00000264848:p.Pro6Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	Missense_Mutation	SNP	NULL	p.P6S	ENST00000264848.5	37	c.16	CCDS46887.1	3	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701126	0.30142	.	.	ENSG00000114529	ENST00000430855;ENST00000431717;ENST00000264848	T;T;T	0.30182	1.57;1.54;2.02	4.07	-8.14	0.01069	.	1.467820	0.03925	N	0.284159	T	0.16642	0.0400	L	0.31294	0.92	0.09310	N	1	B;B;B	0.24576	0.007;0.106;0.002	B;B;B	0.17722	0.006;0.019;0.003	T	0.22452	-1.0216	10	0.07644	T	0.81	-0.2054	9.2596	0.37603	0.1085:0.1319:0.0:0.7596	.	6;6;6	Q5BVD1-2;Q5BVD1-3;Q5BVD1	.;.;TTMP_HUMAN	S	6	ENSP00000390333:P6S;ENSP00000399392:P6S;ENSP00000264848:P6S	ENSP00000264848:P6S	P	+	1	0	C3orf52	113287960	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.631000	0.02026	-1.883000	0.01120	-0.481000	0.04817	CCC	C3orf52	-	NULL	ENSG00000114529		0.652	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353961.1	69	0.00	0	C	NM_024616		111805270	111805270	+1	no_errors	ENST00000431717	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	0.000	T
C3orf52	79669	genome.wustl.edu	37	3	111805270	111805270	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr3:111805270C>T	ENST00000264848.5	+	1	75	c.16C>T	c.(16-18)Ccc>Tcc	p.P6S	C3orf52_ENST00000431717.2_Missense_Mutation_p.P6S|C3orf52_ENST00000430855.1_Missense_Mutation_p.P6S	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52	6						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						CCTGGCCCAACCCTCACAGCC	0.652																																						dbGAP											0													49.0	52.0	51.0					3																	111805270		692	1591	2283	-	-	-	SO:0001583	missense	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.16C>T	3.37:g.111805270C>T	ENSP00000264848:p.Pro6Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	Missense_Mutation	SNP	NULL	p.P6S	ENST00000264848.5	37	c.16	CCDS46887.1	3	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701126	0.30142	.	.	ENSG00000114529	ENST00000430855;ENST00000431717;ENST00000264848	T;T;T	0.30182	1.57;1.54;2.02	4.07	-8.14	0.01069	.	1.467820	0.03925	N	0.284159	T	0.16642	0.0400	L	0.31294	0.92	0.09310	N	1	B;B;B	0.24576	0.007;0.106;0.002	B;B;B	0.17722	0.006;0.019;0.003	T	0.22452	-1.0216	10	0.07644	T	0.81	-0.2054	9.2596	0.37603	0.1085:0.1319:0.0:0.7596	.	6;6;6	Q5BVD1-2;Q5BVD1-3;Q5BVD1	.;.;TTMP_HUMAN	S	6	ENSP00000390333:P6S;ENSP00000399392:P6S;ENSP00000264848:P6S	ENSP00000264848:P6S	P	+	1	0	C3orf52	113287960	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.631000	0.02026	-1.883000	0.01120	-0.481000	0.04817	CCC	C3orf52	-	NULL	ENSG00000114529		0.652	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353961.1	108	0.00	0	C	NM_024616		111805270	111805270	+1	no_errors	ENST00000431717	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	0.000	T
ERICH5	203111	genome.wustl.edu	37	8	99101489	99101489	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr8:99101489C>A	ENST00000318528.3	+	2	603	c.244C>A	c.(244-246)Cag>Aag	p.Q82K	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		82										kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			CCTCCAAGAACAGCCCCTGGC	0.537																																						dbGAP											0													82.0	84.0	83.0					8																	99101489		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000318528.3:c.244C>A	8.37:g.99101489C>A	ENSP00000315614:p.Gln82Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1K4|Q8N1L8	Missense_Mutation	SNP	NULL	p.Q82K	ENST00000318528.3	37	c.244	CCDS34929.1	8	.	.	.	.	.	.	.	.	.	.	C	7.247	0.602493	0.13939	.	.	ENSG00000177459	ENST00000318528	T	0.23950	1.88	4.82	1.77	0.24775	.	0.907853	0.09221	N	0.831895	T	0.22742	0.0549	L	0.57536	1.79	0.09310	N	1	B	0.24258	0.1	B	0.18561	0.022	T	0.31194	-0.9952	10	0.16896	T	0.51	-13.4311	7.9422	0.29965	0.1729:0.4918:0.3353:0.0	.	82	Q6P6B1	CH047_HUMAN	K	82	ENSP00000315614:Q82K	ENSP00000315614:Q82K	Q	+	1	0	C8orf47	99170665	0.000000	0.05858	0.030000	0.17652	0.073000	0.16967	0.144000	0.16135	0.722000	0.32252	0.650000	0.86243	CAG	C8orf47	-	NULL	ENSG00000177459		0.537	C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C8orf47	HGNC	protein_coding	OTTHUMT00000380465.1	21	0.00	0	C			99101489	99101489	+1	no_errors	ENST00000318528	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.025	A
ERICH5	203111	genome.wustl.edu	37	8	99101489	99101489	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr8:99101489C>A	ENST00000318528.3	+	2	603	c.244C>A	c.(244-246)Cag>Aag	p.Q82K	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		82										kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			CCTCCAAGAACAGCCCCTGGC	0.537																																						dbGAP											0													82.0	84.0	83.0					8																	99101489		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000318528.3:c.244C>A	8.37:g.99101489C>A	ENSP00000315614:p.Gln82Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1K4|Q8N1L8	Missense_Mutation	SNP	NULL	p.Q82K	ENST00000318528.3	37	c.244	CCDS34929.1	8	.	.	.	.	.	.	.	.	.	.	C	7.247	0.602493	0.13939	.	.	ENSG00000177459	ENST00000318528	T	0.23950	1.88	4.82	1.77	0.24775	.	0.907853	0.09221	N	0.831895	T	0.22742	0.0549	L	0.57536	1.79	0.09310	N	1	B	0.24258	0.1	B	0.18561	0.022	T	0.31194	-0.9952	10	0.16896	T	0.51	-13.4311	7.9422	0.29965	0.1729:0.4918:0.3353:0.0	.	82	Q6P6B1	CH047_HUMAN	K	82	ENSP00000315614:Q82K	ENSP00000315614:Q82K	Q	+	1	0	C8orf47	99170665	0.000000	0.05858	0.030000	0.17652	0.073000	0.16967	0.144000	0.16135	0.722000	0.32252	0.650000	0.86243	CAG	C8orf47	-	NULL	ENSG00000177459		0.537	C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C8orf47	HGNC	protein_coding	OTTHUMT00000380465.1	58	0.00	0	C			99101489	99101489	+1	no_errors	ENST00000318528	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.025	A
C9orf43	257169	genome.wustl.edu	37	9	116187646	116187648	+	In_Frame_Del	DEL	GCA	GCA	-	rs374165893|rs371732185		TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr9:116187646_116187648delGCA	ENST00000288462.4	+	10	1334_1336	c.888_890delGCA	c.(886-891)cggcag>cgg	p.Q304del	C9orf43_ENST00000374165.1_In_Frame_Del_p.Q304del	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	304	Gln-rich.									breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						agcagcagcggcagcagcagcag	0.557																																						dbGAP											0										2,231,68,3961		0,0,0,2,0,0,231,2,64,1832						-2.8	0.0			63	18,338,431,7463		2,0,0,14,0,0,338,9,413,3349	no	codingComplex	C9orf43	NM_152786.1		2,0,0,16,0,0,569,11,477,5181	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		9.5394,7.0624,8.6957				20,569,499,11424				-	-	-	SO:0001651	inframe_deletion	0			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.888_890delGCA	9.37:g.116187655_116187657delGCA	ENSP00000288462:p.Gln304del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	NULL	p.Q300in_frame_del	ENST00000288462.4	37	c.888_890	CCDS6796.1	9																																																																																			C9orf43	-	NULL	ENSG00000157653		0.557	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C9orf43	HGNC	protein_coding	OTTHUMT00000053739.1	35	0.00	0	GCA	NM_152786		116187646	116187648	+1	no_errors	ENST00000288462	ensembl	human	known	69_37n	in_frame_del	27	12.90	4	DEL	0.211:0.207:0.211	-
CACNA1E	777	genome.wustl.edu	37	1	181765969	181765969	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr1:181765969G>T	ENST00000367573.2	+	47	6374	c.6374G>T	c.(6373-6375)gGc>gTc	p.G2125V	CACNA1E_ENST00000367570.1_Missense_Mutation_p.G2082V|CACNA1E_ENST00000358338.5_Missense_Mutation_p.G2014V|CACNA1E_ENST00000526775.1_Missense_Mutation_p.G2063V|CACNA1E_ENST00000357570.5_Missense_Mutation_p.G2076V|CACNA1E_ENST00000360108.3_Missense_Mutation_p.G2106V|CACNA1E_ENST00000367567.4_Missense_Mutation_p.G1689V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2125					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCCAGTGAGGGCAGGTCACAG	0.592																																						dbGAP											0													20.0	22.0	21.0					1																	181765969		2043	4188	6231	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6374G>T	1.37:g.181765969G>T	ENSP00000356545:p.Gly2125Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.G2125V	ENST00000367573.2	37	c.6374	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896946	0.72639	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98060	-4.57;-4.56;-4.11;-4.55;-4.69;-4.11;-4.11	5.91	4.99	0.66335	.	0.391992	0.28577	N	0.014859	D	0.96661	0.8910	L	0.60067	1.865	0.80722	D	1	P;P	0.45078	0.85;0.719	B;B	0.43575	0.424;0.319	D	0.96543	0.9402	10	0.87932	D	0	.	15.1957	0.73084	0.0:0.1403:0.8597:0.0	.	2063;2082	Q15878-2;Q15878-3	.;.	V	2082;2063;2076;2014;1689;2106;2125	ENSP00000356542:G2082V;ENSP00000434814:G2063V;ENSP00000350183:G2076V;ENSP00000351101:G2014V;ENSP00000356539:G1689V;ENSP00000353222:G2106V;ENSP00000356545:G2125V	ENSP00000350183:G2076V	G	+	2	0	CACNA1E	180032592	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.488000	0.60300	1.483000	0.48342	0.655000	0.94253	GGC	CACNA1E	-	NULL	ENSG00000198216		0.592	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	38	0.00	0	G	NM_000721		181765969	181765969	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181765969	181765969	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:181765969G>T	ENST00000367573.2	+	47	6374	c.6374G>T	c.(6373-6375)gGc>gTc	p.G2125V	CACNA1E_ENST00000367570.1_Missense_Mutation_p.G2082V|CACNA1E_ENST00000358338.5_Missense_Mutation_p.G2014V|CACNA1E_ENST00000526775.1_Missense_Mutation_p.G2063V|CACNA1E_ENST00000357570.5_Missense_Mutation_p.G2076V|CACNA1E_ENST00000360108.3_Missense_Mutation_p.G2106V|CACNA1E_ENST00000367567.4_Missense_Mutation_p.G1689V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2125					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCCAGTGAGGGCAGGTCACAG	0.592																																						dbGAP											0													20.0	22.0	21.0					1																	181765969		2043	4188	6231	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6374G>T	1.37:g.181765969G>T	ENSP00000356545:p.Gly2125Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.G2125V	ENST00000367573.2	37	c.6374	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896946	0.72639	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98060	-4.57;-4.56;-4.11;-4.55;-4.69;-4.11;-4.11	5.91	4.99	0.66335	.	0.391992	0.28577	N	0.014859	D	0.96661	0.8910	L	0.60067	1.865	0.80722	D	1	P;P	0.45078	0.85;0.719	B;B	0.43575	0.424;0.319	D	0.96543	0.9402	10	0.87932	D	0	.	15.1957	0.73084	0.0:0.1403:0.8597:0.0	.	2063;2082	Q15878-2;Q15878-3	.;.	V	2082;2063;2076;2014;1689;2106;2125	ENSP00000356542:G2082V;ENSP00000434814:G2063V;ENSP00000350183:G2076V;ENSP00000351101:G2014V;ENSP00000356539:G1689V;ENSP00000353222:G2106V;ENSP00000356545:G2125V	ENSP00000350183:G2076V	G	+	2	0	CACNA1E	180032592	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.488000	0.60300	1.483000	0.48342	0.655000	0.94253	GGC	CACNA1E	-	NULL	ENSG00000198216		0.592	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	46	0.00	0	G	NM_000721		181765969	181765969	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	T
CBLN4	140689	genome.wustl.edu	37	20	54579033	54579033	+	Silent	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr20:54579033C>T	ENST00000064571.2	-	1	1495	c.195G>A	c.(193-195)cgG>cgA	p.R65R		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	65					protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			AGTTGGCCGCCCGGACCGATA	0.627																																						dbGAP											0													92.0	97.0	95.0					20																	54579033		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.195G>A	20.37:g.54579033C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0S5	Silent	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.R65	ENST00000064571.2	37	c.195	CCDS13448.1	20																																																																																			CBLN4	-	smart_C1q	ENSG00000054803		0.627	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN4	HGNC	protein_coding	OTTHUMT00000079783.2	59	0.00	0	C	NM_080617		54579033	54579033	-1	no_errors	ENST00000064571	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	1.000	T
CBY1	25776	genome.wustl.edu	37	22	39069235	39069235	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr22:39069235delA	ENST00000216029.3	+	5	509	c.375delA	c.(373-375)agafs	p.R125fs	RP3-508I15.9_ENST00000412067.1_RNA|RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000422408.2_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	125					cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					GCCGGAAGAGAAAATGAAGAC	0.468																																						dbGAP											0													79.0	71.0	74.0					22																	39069235		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.375delA	22.37:g.39069235delA	ENSP00000216029:p.Arg125fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4S2|Q66GT6|Q9UIK9	Frame_Shift_Del	DEL	NULL	p.K126fs	ENST00000216029.3	37	c.375	CCDS13974.1	22																																																																																			CBY1	-	NULL	ENSG00000100211		0.468	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBY1	HGNC	protein_coding	OTTHUMT00000320832.1	105	0.00	0	A	NM_015373		39069235	39069235	+1	no_errors	ENST00000216029	ensembl	human	known	69_37n	frame_shift_del	42	33.33	21	DEL	0.949	-
CBY1	25776	genome.wustl.edu	37	22	39069235	39069235	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr22:39069235delA	ENST00000216029.3	+	5	509	c.375delA	c.(373-375)agafs	p.R125fs	RP3-508I15.9_ENST00000412067.1_RNA|RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000422408.2_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	125					cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					GCCGGAAGAGAAAATGAAGAC	0.468																																						dbGAP											0													79.0	71.0	74.0					22																	39069235		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.375delA	22.37:g.39069235delA	ENSP00000216029:p.Arg125fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4S2|Q66GT6|Q9UIK9	Frame_Shift_Del	DEL	NULL	p.K126fs	ENST00000216029.3	37	c.375	CCDS13974.1	22																																																																																			CBY1	-	NULL	ENSG00000100211		0.468	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBY1	HGNC	protein_coding	OTTHUMT00000320832.1	137	0.00	0	A	NM_015373		39069235	39069235	+1	no_errors	ENST00000216029	ensembl	human	known	69_37n	frame_shift_del	42	33.33	21	DEL	0.949	-
CD74	972	genome.wustl.edu	37	5	149784309	149784309	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr5:149784309G>T	ENST00000009530.7	-	6	560	c.559C>A	c.(559-561)Cat>Aat	p.H187N	CD74_ENST00000524315.1_Intron|CD74_ENST00000377795.3_Intron|CD74_ENST00000353334.6_Missense_Mutation_p.H187N			P04233	HG2A_HUMAN	CD74 molecule, major histocompatibility complex, class II invariant chain	187					activation of MAPK activity (GO:0000187)|antigen processing and presentation of endogenous antigen (GO:0019883)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|chaperone mediated protein folding requiring cofactor (GO:0051085)|defense response (GO:0006952)|immunoglobulin mediated immune response (GO:0016064)|intracellular protein transport (GO:0006886)|macrophage migration inhibitory factor signaling pathway (GO:0035691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of peptide secretion (GO:0002792)|negative regulation of T cell differentiation (GO:0045581)|negative thymic T cell selection (GO:0045060)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type 2 immune response (GO:0002830)|positive thymic T cell selection (GO:0045059)|prostaglandin biosynthetic process (GO:0001516)|protein complex assembly (GO:0006461)|regulation of macrophage activation (GO:0043030)|signal transduction (GO:0007165)|T cell selection (GO:0045058)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|macrophage migration inhibitory factor receptor complex (GO:0035692)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|NOS2-CD74 complex (GO:0035693)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)|vacuole (GO:0005773)	beta-amyloid binding (GO:0001540)|cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|macrophage migration inhibitory factor binding (GO:0035718)|MHC class II protein binding (GO:0042289)|MHC class II protein binding, via antigen binding groove (GO:0042658)|MHC class II protein complex binding (GO:0023026)|protein binding involved in protein folding (GO:0044183)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	5		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGAGCCAATGGTGCATCCAG	0.572			T	ROS1	NSCLC																																	dbGAP		Dom	yes		5	5q32	972	"""CD74 molecule, major histocompatibility complex, class II invariant chain"""		E	0													46.0	49.0	48.0					5																	149784309		1986	4147	6133	-	-	-	SO:0001583	missense	0				CCDS34276.1, CCDS47308.1, CCDS47309.1	5q32	2012-09-20	2006-03-28		ENSG00000019582	ENSG00000019582		"""CD molecules"""	1697	protein-coding gene	gene with protein product	"""HLA-DR-gamma"", ""Ia-associated invariant chain"", ""gamma chain of class II antigens"", ""MHC HLA-DR gamma chain"""	142790	"""CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)"""	DHLAG		6324166, 3001652	Standard	NM_004355		Approved		uc003lsc.3	P04233	OTTHUMG00000163559	ENST00000009530.7:c.559C>A	5.37:g.149784309G>T	ENSP00000009530:p.His187Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7R1|B4DNE8|D3DQG3|D3DQG4|Q14597|Q29832|Q5U0J8|Q8SNA0|Q8WLP6	Missense_Mutation	SNP	pfam_MHC_II-assoc_invar/CLIP_MHC-bd,pfam_MHC_II-assoc_invariant_trimer,pfam_Thyroglobulin_1,superfamily_MHC_II-assoc_invariant_trimer,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_MHC_II-assoc_invar_chain,pfscan_Thyroglobulin_1,prints_MHC_II-assoc_invar_chain	p.H187N	ENST00000009530.7	37	c.559	CCDS47309.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.61|12.61	1.989596|1.989596	0.35131|0.35131	.|.	.|.	ENSG00000019582|ENSG00000019582	ENST00000353334;ENST00000009530|ENST00000518797	T|.	0.63744|.	-0.06|.	5.56|5.56	5.56|5.56	0.83823|0.83823	MHC class II-associated invariant chain, trimerisation (3);Thyroglobulin type-1 (1);|.	0.665907|.	0.17032|.	N|.	0.189646|.	T|T	0.32010|0.32010	0.0815|0.0815	N|N	0.17474|0.17474	0.49|0.49	0.25828|0.25828	N|N	0.984202|0.984202	D;P;P;P|.	0.53885|.	0.963;0.763;0.673;0.897|.	P;B;B;P|.	0.57425|.	0.82;0.163;0.167;0.498|.	T|T	0.19976|0.19976	-1.0289|-1.0289	10|5	0.23891|.	T|.	0.37|.	-14.3781|-14.3781	12.0568|12.0568	0.53540|0.53540	0.0:0.0:0.828:0.172|0.0:0.0:0.828:0.172	.|.	187;187;187;99|.	A9YLN4;P04233-2;P04233;B4DUJ2|.	.;.;HG2A_HUMAN;.|.	N|Q	187|181	ENSP00000009530:H187N|.	ENSP00000009530:H187N|.	H|P	-|-	1|2	0|0	CD74|CD74	149764502|149764502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	2.264000|2.264000	0.43302|0.43302	2.619000|2.619000	0.88677|0.88677	0.491000|0.491000	0.48974|0.48974	CAT|CCA	CD74	-	pfam_MHC_II-assoc_invariant_trimer,superfamily_MHC_II-assoc_invariant_trimer,superfamily_Thyroglobulin_1,pirsf_MHC_II-assoc_invar_chain,prints_MHC_II-assoc_invar_chain	ENSG00000019582		0.572	CD74-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD74	HGNC	protein_coding	OTTHUMT00000374178.1	28	0.00	0	G	NM_004355		149784309	149784309	-1	no_errors	ENST00000009530	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	T
CD74	972	genome.wustl.edu	37	5	149784309	149784309	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr5:149784309G>T	ENST00000009530.7	-	6	560	c.559C>A	c.(559-561)Cat>Aat	p.H187N	CD74_ENST00000524315.1_Intron|CD74_ENST00000377795.3_Intron|CD74_ENST00000353334.6_Missense_Mutation_p.H187N			P04233	HG2A_HUMAN	CD74 molecule, major histocompatibility complex, class II invariant chain	187					activation of MAPK activity (GO:0000187)|antigen processing and presentation of endogenous antigen (GO:0019883)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|chaperone mediated protein folding requiring cofactor (GO:0051085)|defense response (GO:0006952)|immunoglobulin mediated immune response (GO:0016064)|intracellular protein transport (GO:0006886)|macrophage migration inhibitory factor signaling pathway (GO:0035691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of peptide secretion (GO:0002792)|negative regulation of T cell differentiation (GO:0045581)|negative thymic T cell selection (GO:0045060)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type 2 immune response (GO:0002830)|positive thymic T cell selection (GO:0045059)|prostaglandin biosynthetic process (GO:0001516)|protein complex assembly (GO:0006461)|regulation of macrophage activation (GO:0043030)|signal transduction (GO:0007165)|T cell selection (GO:0045058)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|macrophage migration inhibitory factor receptor complex (GO:0035692)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|NOS2-CD74 complex (GO:0035693)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)|vacuole (GO:0005773)	beta-amyloid binding (GO:0001540)|cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|macrophage migration inhibitory factor binding (GO:0035718)|MHC class II protein binding (GO:0042289)|MHC class II protein binding, via antigen binding groove (GO:0042658)|MHC class II protein complex binding (GO:0023026)|protein binding involved in protein folding (GO:0044183)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	5		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGAGCCAATGGTGCATCCAG	0.572			T	ROS1	NSCLC																																	dbGAP		Dom	yes		5	5q32	972	"""CD74 molecule, major histocompatibility complex, class II invariant chain"""		E	0													46.0	49.0	48.0					5																	149784309		1986	4147	6133	-	-	-	SO:0001583	missense	0				CCDS34276.1, CCDS47308.1, CCDS47309.1	5q32	2012-09-20	2006-03-28		ENSG00000019582	ENSG00000019582		"""CD molecules"""	1697	protein-coding gene	gene with protein product	"""HLA-DR-gamma"", ""Ia-associated invariant chain"", ""gamma chain of class II antigens"", ""MHC HLA-DR gamma chain"""	142790	"""CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)"""	DHLAG		6324166, 3001652	Standard	NM_004355		Approved		uc003lsc.3	P04233	OTTHUMG00000163559	ENST00000009530.7:c.559C>A	5.37:g.149784309G>T	ENSP00000009530:p.His187Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7R1|B4DNE8|D3DQG3|D3DQG4|Q14597|Q29832|Q5U0J8|Q8SNA0|Q8WLP6	Missense_Mutation	SNP	pfam_MHC_II-assoc_invar/CLIP_MHC-bd,pfam_MHC_II-assoc_invariant_trimer,pfam_Thyroglobulin_1,superfamily_MHC_II-assoc_invariant_trimer,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_MHC_II-assoc_invar_chain,pfscan_Thyroglobulin_1,prints_MHC_II-assoc_invar_chain	p.H187N	ENST00000009530.7	37	c.559	CCDS47309.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.61|12.61	1.989596|1.989596	0.35131|0.35131	.|.	.|.	ENSG00000019582|ENSG00000019582	ENST00000353334;ENST00000009530|ENST00000518797	T|.	0.63744|.	-0.06|.	5.56|5.56	5.56|5.56	0.83823|0.83823	MHC class II-associated invariant chain, trimerisation (3);Thyroglobulin type-1 (1);|.	0.665907|.	0.17032|.	N|.	0.189646|.	T|T	0.32010|0.32010	0.0815|0.0815	N|N	0.17474|0.17474	0.49|0.49	0.25828|0.25828	N|N	0.984202|0.984202	D;P;P;P|.	0.53885|.	0.963;0.763;0.673;0.897|.	P;B;B;P|.	0.57425|.	0.82;0.163;0.167;0.498|.	T|T	0.19976|0.19976	-1.0289|-1.0289	10|5	0.23891|.	T|.	0.37|.	-14.3781|-14.3781	12.0568|12.0568	0.53540|0.53540	0.0:0.0:0.828:0.172|0.0:0.0:0.828:0.172	.|.	187;187;187;99|.	A9YLN4;P04233-2;P04233;B4DUJ2|.	.;.;HG2A_HUMAN;.|.	N|Q	187|181	ENSP00000009530:H187N|.	ENSP00000009530:H187N|.	H|P	-|-	1|2	0|0	CD74|CD74	149764502|149764502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	2.264000|2.264000	0.43302|0.43302	2.619000|2.619000	0.88677|0.88677	0.491000|0.491000	0.48974|0.48974	CAT|CCA	CD74	-	pfam_MHC_II-assoc_invariant_trimer,superfamily_MHC_II-assoc_invariant_trimer,superfamily_Thyroglobulin_1,pirsf_MHC_II-assoc_invar_chain,prints_MHC_II-assoc_invar_chain	ENSG00000019582		0.572	CD74-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD74	HGNC	protein_coding	OTTHUMT00000374178.1	62	0.00	0	G	NM_004355		149784309	149784309	-1	no_errors	ENST00000009530	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	T
CDH1	999	genome.wustl.edu	37	16	68845617	68845618	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr16:68845617_68845618delAC	ENST00000261769.5	+	7	1054_1055	c.863_864delAC	c.(862-864)gacfs	p.D288fs	CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Frame_Shift_Del_p.D288fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	288	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.A289fs*3(1)|p.E283fs*4(1)|p.D288fs*3(1)|p.D288D(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACAGCCACAGACGCGGACGATG	0.49			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	5	Deletion - Frameshift(2)|Unknown(1)|Complex - frameshift(1)|Substitution - coding silent(1)	breast(4)|stomach(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.863_864delAC	16.37:g.68845617_68845618delAC	ENSP00000261769:p.Asp288fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D288fs	ENST00000261769.5	37	c.863_864	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.490	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	85	0.00	0	AC	NM_004360		68845617	68845618	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	43	13.73	7	DEL	0.991:0.001	-
CDH1	999	genome.wustl.edu	37	16	68845617	68845618	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr16:68845617_68845618delAC	ENST00000261769.5	+	7	1054_1055	c.863_864delAC	c.(862-864)gacfs	p.D288fs	CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Frame_Shift_Del_p.D288fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	288	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.A289fs*3(1)|p.E283fs*4(1)|p.D288fs*3(1)|p.D288D(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACAGCCACAGACGCGGACGATG	0.49			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	5	Deletion - Frameshift(2)|Unknown(1)|Complex - frameshift(1)|Substitution - coding silent(1)	breast(4)|stomach(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.863_864delAC	16.37:g.68845617_68845618delAC	ENSP00000261769:p.Asp288fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D288fs	ENST00000261769.5	37	c.863_864	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.490	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	119	0.00	0	AC	NM_004360		68845617	68845618	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	43	13.73	7	DEL	0.991:0.001	-
CDKL3	51265	genome.wustl.edu	37	5	133644285	133644285	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr5:133644285T>G	ENST00000265334.4	-	8	1133	c.1015A>C	c.(1015-1017)Agt>Cgt	p.S339R	CDKL3_ENST00000609654.1_Missense_Mutation_p.S150R|CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000521755.1_Intron|CDKL3_ENST00000609383.1_Missense_Mutation_p.S44R|CDKL3_ENST00000521118.1_Missense_Mutation_p.S339R|CDKL3_ENST00000536186.1_Missense_Mutation_p.S44R|CDKL3_ENST00000435240.2_Missense_Mutation_p.S44R|CDKL3_ENST00000523832.1_Missense_Mutation_p.S339R|CDKL3_ENST00000435211.1_Missense_Mutation_p.S339R|CDKL3_ENST00000523054.1_Missense_Mutation_p.S150R	NM_001113575.1	NP_001107047.1	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3	339					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(3)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTGAACTACTTAGCAGTGTA	0.299																																						dbGAP											0													77.0	71.0	73.0					5																	133644285		1800	4070	5870	-	-	-	SO:0001583	missense	0			AF130372	CCDS47264.1, CCDS47265.1, CCDS75303.1	5q31.1	2014-09-09			ENSG00000006837	ENSG00000006837	2.7.11.22	"""Cyclin-dependent kinases"""	15483	protein-coding gene	gene with protein product	"""serine-threonine protein kinase NKIAMRE"""	608459				10463609	Standard	NM_016508		Approved	NKIAMRE	uc003kzf.4	Q8IVW4	OTTHUMG00000186341	ENST00000265334.4:c.1015A>C	5.37:g.133644285T>G	ENSP00000265334:p.Ser339Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQA0|D3DQA1|Q9P114	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S339R	ENST00000265334.4	37	c.1015	CCDS47264.1	5	.	.	.	.	.	.	.	.	.	.	T	2.217	-0.379218	0.05000	.	.	ENSG00000006837	ENST00000536186;ENST00000435240;ENST00000265334;ENST00000523054;ENST00000521118;ENST00000523832;ENST00000435211	T;T;T;T;T;T;T	0.72835	0.87;0.84;-0.64;-0.46;-0.69;-0.67;-0.67	5.66	3.2	0.36748	.	0.770478	0.12416	N	0.470874	T	0.54983	0.1892	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.14805	0.005;0.004;0.011;0.001;0.002	B;B;B;B;B	0.15052	0.004;0.007;0.012;0.001;0.001	T	0.35301	-0.9794	10	0.20046	T	0.44	-5.7977	10.855	0.46794	0.0:0.0:0.3026:0.6974	.	150;44;44;150;339	B4DX41;B4DRK6;B4DGS2;B7Z2C5;Q8IVW4	.;.;.;.;CDKL3_HUMAN	R	44;44;339;150;339;339;339	ENSP00000441545:S44R;ENSP00000399807:S44R;ENSP00000265334:S339R;ENSP00000428500:S150R;ENSP00000428689:S339R;ENSP00000430496:S339R;ENSP00000395559:S339R	ENSP00000265334:S339R	S	-	1	0	CDKL3	133672184	0.206000	0.23470	0.033000	0.17914	0.173000	0.22820	1.866000	0.39489	0.393000	0.25203	-0.501000	0.04562	AGT	CDKL3	-	NULL	ENSG00000006837		0.299	CDKL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDKL3	HGNC	protein_coding	OTTHUMT00000377697.1	45	0.00	0	T	NM_001113575		133644285	133644285	-1	no_errors	ENST00000265334	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.126	G
CDKL3	51265	genome.wustl.edu	37	5	133644285	133644285	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr5:133644285T>G	ENST00000265334.4	-	8	1133	c.1015A>C	c.(1015-1017)Agt>Cgt	p.S339R	CDKL3_ENST00000609654.1_Missense_Mutation_p.S150R|CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000521755.1_Intron|CDKL3_ENST00000609383.1_Missense_Mutation_p.S44R|CDKL3_ENST00000521118.1_Missense_Mutation_p.S339R|CDKL3_ENST00000536186.1_Missense_Mutation_p.S44R|CDKL3_ENST00000435240.2_Missense_Mutation_p.S44R|CDKL3_ENST00000523832.1_Missense_Mutation_p.S339R|CDKL3_ENST00000435211.1_Missense_Mutation_p.S339R|CDKL3_ENST00000523054.1_Missense_Mutation_p.S150R	NM_001113575.1	NP_001107047.1	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3	339					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(3)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTGAACTACTTAGCAGTGTA	0.299																																						dbGAP											0													77.0	71.0	73.0					5																	133644285		1800	4070	5870	-	-	-	SO:0001583	missense	0			AF130372	CCDS47264.1, CCDS47265.1, CCDS75303.1	5q31.1	2014-09-09			ENSG00000006837	ENSG00000006837	2.7.11.22	"""Cyclin-dependent kinases"""	15483	protein-coding gene	gene with protein product	"""serine-threonine protein kinase NKIAMRE"""	608459				10463609	Standard	NM_016508		Approved	NKIAMRE	uc003kzf.4	Q8IVW4	OTTHUMG00000186341	ENST00000265334.4:c.1015A>C	5.37:g.133644285T>G	ENSP00000265334:p.Ser339Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQA0|D3DQA1|Q9P114	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S339R	ENST00000265334.4	37	c.1015	CCDS47264.1	5	.	.	.	.	.	.	.	.	.	.	T	2.217	-0.379218	0.05000	.	.	ENSG00000006837	ENST00000536186;ENST00000435240;ENST00000265334;ENST00000523054;ENST00000521118;ENST00000523832;ENST00000435211	T;T;T;T;T;T;T	0.72835	0.87;0.84;-0.64;-0.46;-0.69;-0.67;-0.67	5.66	3.2	0.36748	.	0.770478	0.12416	N	0.470874	T	0.54983	0.1892	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.14805	0.005;0.004;0.011;0.001;0.002	B;B;B;B;B	0.15052	0.004;0.007;0.012;0.001;0.001	T	0.35301	-0.9794	10	0.20046	T	0.44	-5.7977	10.855	0.46794	0.0:0.0:0.3026:0.6974	.	150;44;44;150;339	B4DX41;B4DRK6;B4DGS2;B7Z2C5;Q8IVW4	.;.;.;.;CDKL3_HUMAN	R	44;44;339;150;339;339;339	ENSP00000441545:S44R;ENSP00000399807:S44R;ENSP00000265334:S339R;ENSP00000428500:S150R;ENSP00000428689:S339R;ENSP00000430496:S339R;ENSP00000395559:S339R	ENSP00000265334:S339R	S	-	1	0	CDKL3	133672184	0.206000	0.23470	0.033000	0.17914	0.173000	0.22820	1.866000	0.39489	0.393000	0.25203	-0.501000	0.04562	AGT	CDKL3	-	NULL	ENSG00000006837		0.299	CDKL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDKL3	HGNC	protein_coding	OTTHUMT00000377697.1	50	0.00	0	T	NM_001113575		133644285	133644285	-1	no_errors	ENST00000265334	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.126	G
CHD7	55636	genome.wustl.edu	37	8	61655528	61655528	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr8:61655528A>T	ENST00000423902.2	+	2	2016	c.1537A>T	c.(1537-1539)Acc>Tcc	p.T513S	CHD7_ENST00000525508.1_Missense_Mutation_p.T513S|CHD7_ENST00000524602.1_Missense_Mutation_p.T513S	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	513	Pro-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCAGTTGCCAACCTGTCCTCC	0.572																																						dbGAP											0													67.0	80.0	76.0					8																	61655528		2143	4242	6385	-	-	-	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.1537A>T	8.37:g.61655528A>T	ENSP00000392028:p.Thr513Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.T513S	ENST00000423902.2	37	c.1537	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	A	9.761	1.170125	0.21621	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	T;T;T	0.80393	-1.37;2.09;-0.93	5.67	4.51	0.55191	.	0.000000	0.41605	D	0.000841	T	0.58878	0.2153	N	0.04959	-0.14	0.27110	N	0.962402	B	0.02656	0.0	B	0.01281	0.0	T	0.39961	-0.9588	10	0.09338	T	0.73	-6.9726	11.5934	0.50959	0.9305:0.0:0.0695:0.0	.	513	Q9P2D1	CHD7_HUMAN	S	513	ENSP00000392028:T513S;ENSP00000437061:T513S;ENSP00000436027:T513S	ENSP00000307304:T513S	T	+	1	0	CHD7	61818082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.655000	0.46707	1.000000	0.39049	0.533000	0.62120	ACC	CHD7	-	NULL	ENSG00000171316		0.572	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	29	0.00	0	A	XM_098762		61655528	61655528	+1	no_errors	ENST00000307121	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	T
CHD7	55636	genome.wustl.edu	37	8	61655528	61655528	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr8:61655528A>T	ENST00000423902.2	+	2	2016	c.1537A>T	c.(1537-1539)Acc>Tcc	p.T513S	CHD7_ENST00000525508.1_Missense_Mutation_p.T513S|CHD7_ENST00000524602.1_Missense_Mutation_p.T513S	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	513	Pro-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCAGTTGCCAACCTGTCCTCC	0.572																																						dbGAP											0													67.0	80.0	76.0					8																	61655528		2143	4242	6385	-	-	-	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.1537A>T	8.37:g.61655528A>T	ENSP00000392028:p.Thr513Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.T513S	ENST00000423902.2	37	c.1537	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	A	9.761	1.170125	0.21621	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	T;T;T	0.80393	-1.37;2.09;-0.93	5.67	4.51	0.55191	.	0.000000	0.41605	D	0.000841	T	0.58878	0.2153	N	0.04959	-0.14	0.27110	N	0.962402	B	0.02656	0.0	B	0.01281	0.0	T	0.39961	-0.9588	10	0.09338	T	0.73	-6.9726	11.5934	0.50959	0.9305:0.0:0.0695:0.0	.	513	Q9P2D1	CHD7_HUMAN	S	513	ENSP00000392028:T513S;ENSP00000437061:T513S;ENSP00000436027:T513S	ENSP00000307304:T513S	T	+	1	0	CHD7	61818082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.655000	0.46707	1.000000	0.39049	0.533000	0.62120	ACC	CHD7	-	NULL	ENSG00000171316		0.572	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	63	0.00	0	A	XM_098762		61655528	61655528	+1	no_errors	ENST00000307121	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	T
CSNK1E	1454	genome.wustl.edu	37	22	38710134	38710134	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr22:38710134C>A	ENST00000396832.1	-	2	289	c.29G>T	c.(28-30)cGc>cTc	p.R10L	CSNK1E_ENST00000413574.2_Missense_Mutation_p.R10L|CSNK1E_ENST00000400206.2_Missense_Mutation_p.R10L|CSNK1E_ENST00000403904.1_Missense_Mutation_p.R10L|CSNK1E_ENST00000359867.3_Missense_Mutation_p.R10L|CSNK1E_ENST00000405675.3_Missense_Mutation_p.R10L	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	10	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					CCGTCCCAGGCGGTACTTGTT	0.617																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	dbGAP											0													104.0	88.0	94.0					22																	38710134		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.29G>T	22.37:g.38710134C>A	ENSP00000380044:p.Arg10Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R10L	ENST00000396832.1	37	c.29	CCDS13970.1	22	.	.	.	.	.	.	.	.	.	.	C	34	5.355270	0.95854	.	.	ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904;ENST00000413574;ENST00000405675;ENST00000430335	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	4.81	4.81	0.61882	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79764	0.4502	M	0.79343	2.45	0.80722	D	1	B;D;D	0.59357	0.001;0.985;0.984	B;P;P	0.60609	0.024;0.877;0.742	T	0.82969	-0.0193	10	0.87932	D	0	.	15.1631	0.72801	0.0:1.0:0.0:0.0	.	10;10;10	B0QY35;B0QY34;P49674	.;.;KC1E_HUMAN	L	10	ENSP00000352929:R10L;ENSP00000380044:R10L;ENSP00000383067:R10L;ENSP00000384074:R10L;ENSP00000407235:R10L;ENSP00000384426:R10L;ENSP00000412335:R10L	ENSP00000352929:R10L	R	-	2	0	CSNK1E	37040080	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.053000	0.64269	2.383000	0.81215	0.561000	0.74099	CGC	CSNK1E	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000213923		0.617	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1E	HGNC	protein_coding	OTTHUMT00000321462.1	53	0.00	0	C	NM_001894		38710134	38710134	-1	no_errors	ENST00000359867	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	A
CSNK1E	1454	genome.wustl.edu	37	22	38710134	38710134	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr22:38710134C>A	ENST00000396832.1	-	2	289	c.29G>T	c.(28-30)cGc>cTc	p.R10L	CSNK1E_ENST00000413574.2_Missense_Mutation_p.R10L|CSNK1E_ENST00000400206.2_Missense_Mutation_p.R10L|CSNK1E_ENST00000403904.1_Missense_Mutation_p.R10L|CSNK1E_ENST00000359867.3_Missense_Mutation_p.R10L|CSNK1E_ENST00000405675.3_Missense_Mutation_p.R10L	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	10	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					CCGTCCCAGGCGGTACTTGTT	0.617																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	dbGAP											0													104.0	88.0	94.0					22																	38710134		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.29G>T	22.37:g.38710134C>A	ENSP00000380044:p.Arg10Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R10L	ENST00000396832.1	37	c.29	CCDS13970.1	22	.	.	.	.	.	.	.	.	.	.	C	34	5.355270	0.95854	.	.	ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904;ENST00000413574;ENST00000405675;ENST00000430335	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	4.81	4.81	0.61882	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79764	0.4502	M	0.79343	2.45	0.80722	D	1	B;D;D	0.59357	0.001;0.985;0.984	B;P;P	0.60609	0.024;0.877;0.742	T	0.82969	-0.0193	10	0.87932	D	0	.	15.1631	0.72801	0.0:1.0:0.0:0.0	.	10;10;10	B0QY35;B0QY34;P49674	.;.;KC1E_HUMAN	L	10	ENSP00000352929:R10L;ENSP00000380044:R10L;ENSP00000383067:R10L;ENSP00000384074:R10L;ENSP00000407235:R10L;ENSP00000384426:R10L;ENSP00000412335:R10L	ENSP00000352929:R10L	R	-	2	0	CSNK1E	37040080	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.053000	0.64269	2.383000	0.81215	0.561000	0.74099	CGC	CSNK1E	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000213923		0.617	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1E	HGNC	protein_coding	OTTHUMT00000321462.1	90	0.00	0	C	NM_001894		38710134	38710134	-1	no_errors	ENST00000359867	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	A
CYP2A13	1553	genome.wustl.edu	37	19	41596408	41596408	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr19:41596408T>G	ENST00000330436.3	+	4	593	c.593T>G	c.(592-594)tTc>tGc	p.F198C		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	198					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GACAAAGAGTTCCTGTCACTG	0.567																																						dbGAP											0													148.0	130.0	136.0					19																	41596408		2203	4300	6503	-	-	-	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.593T>G	19.37:g.41596408T>G	ENSP00000332679:p.Phe198Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.F198C	ENST00000330436.3	37	c.593	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	14.84	2.656547	0.47467	.	.	ENSG00000197838	ENST00000330436	T	0.69926	-0.44	3.66	3.66	0.41972	.	0.056032	0.64402	U	0.000001	D	0.84365	0.5456	M	0.93594	3.435	0.37902	D	0.931066	D	0.89917	1.0	D	0.81914	0.995	D	0.88778	0.3269	10	0.66056	D	0.02	.	11.399	0.49860	0.0:0.0:0.0:1.0	.	198	Q16696	CP2AD_HUMAN	C	198	ENSP00000332679:F198C	ENSP00000332679:F198C	F	+	2	0	CYP2A13	46288248	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	6.900000	0.75687	1.524000	0.49035	0.164000	0.16699	TTC	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197838		0.567	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	183	0.00	0	T	NM_000766		41596408	41596408	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	missense	127	22.09	36	SNP	1.000	G
CYP2A13	1553	genome.wustl.edu	37	19	41596408	41596408	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr19:41596408T>G	ENST00000330436.3	+	4	593	c.593T>G	c.(592-594)tTc>tGc	p.F198C		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	198					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GACAAAGAGTTCCTGTCACTG	0.567																																						dbGAP											0													148.0	130.0	136.0					19																	41596408		2203	4300	6503	-	-	-	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.593T>G	19.37:g.41596408T>G	ENSP00000332679:p.Phe198Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.F198C	ENST00000330436.3	37	c.593	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	14.84	2.656547	0.47467	.	.	ENSG00000197838	ENST00000330436	T	0.69926	-0.44	3.66	3.66	0.41972	.	0.056032	0.64402	U	0.000001	D	0.84365	0.5456	M	0.93594	3.435	0.37902	D	0.931066	D	0.89917	1.0	D	0.81914	0.995	D	0.88778	0.3269	10	0.66056	D	0.02	.	11.399	0.49860	0.0:0.0:0.0:1.0	.	198	Q16696	CP2AD_HUMAN	C	198	ENSP00000332679:F198C	ENSP00000332679:F198C	F	+	2	0	CYP2A13	46288248	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	6.900000	0.75687	1.524000	0.49035	0.164000	0.16699	TTC	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197838		0.567	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	246	0.00	0	T	NM_000766		41596408	41596408	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	missense	127	22.09	36	SNP	1.000	G
DAAM1	23002	genome.wustl.edu	37	14	59836141	59836141	+	3'UTR	SNP	A	A	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr14:59836141A>G	ENST00000395125.1	+	0	3824				DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000351081.1_3'UTR|DAAM1_ENST00000360909.3_3'UTR	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1						actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		AATTTCTGACATTGGTGTGGG	0.313																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.*564A>G	14.37:g.59836141A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86U34|Q8N1Z8|Q8TB39	RNA	SNP	-	NULL	ENST00000395125.1	37	NULL	CCDS9737.1	14																																																																																			DAAM1	-	-	ENSG00000100592		0.313	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2	85	0.00	0	A	NM_014992		59836141	59836141	+1	no_errors	ENST00000553966	ensembl	human	known	69_37n	rna	67	20.24	17	SNP	0.000	G
DAAM1	23002	genome.wustl.edu	37	14	59836141	59836141	+	3'UTR	SNP	A	A	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr14:59836141A>G	ENST00000395125.1	+	0	3824				DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000351081.1_3'UTR|DAAM1_ENST00000360909.3_3'UTR	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1						actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		AATTTCTGACATTGGTGTGGG	0.313																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.*564A>G	14.37:g.59836141A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86U34|Q8N1Z8|Q8TB39	RNA	SNP	-	NULL	ENST00000395125.1	37	NULL	CCDS9737.1	14																																																																																			DAAM1	-	-	ENSG00000100592		0.313	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2	110	0.00	0	A	NM_014992		59836141	59836141	+1	no_errors	ENST00000553966	ensembl	human	known	69_37n	rna	67	20.24	17	SNP	0.000	G
DAPK1	1612	genome.wustl.edu	37	9	90321697	90321697	+	Silent	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr9:90321697G>A	ENST00000408954.3	+	26	4046	c.3711G>A	c.(3709-3711)ctG>ctA	p.L1237L	DAPK1_ENST00000472284.1_Silent_p.L1237L|DAPK1_ENST00000469640.2_Silent_p.L1262L|DAPK1_ENST00000358077.5_Silent_p.L1237L|DAPK1_ENST00000491893.1_Silent_p.L1171L	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1237					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						AGCATTACCTGAGCCCCCAGC	0.592									Chronic Lymphocytic Leukemia, Familial Clustering of																													dbGAP											0													29.0	33.0	32.0					9																	90321697		2138	4251	6389	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3711G>A	9.37:g.90321697G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt	p.L1262	ENST00000408954.3	37	c.3786	CCDS43842.1	9																																																																																			DAPK1	-	NULL	ENSG00000196730		0.592	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	23	0.00	0	G	NM_004938		90321697	90321697	+1	no_errors	ENST00000469640	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	1.000	A
DAPK1	1612	genome.wustl.edu	37	9	90321697	90321697	+	Silent	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr9:90321697G>A	ENST00000408954.3	+	26	4046	c.3711G>A	c.(3709-3711)ctG>ctA	p.L1237L	DAPK1_ENST00000472284.1_Silent_p.L1237L|DAPK1_ENST00000469640.2_Silent_p.L1262L|DAPK1_ENST00000358077.5_Silent_p.L1237L|DAPK1_ENST00000491893.1_Silent_p.L1171L	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1237					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						AGCATTACCTGAGCCCCCAGC	0.592									Chronic Lymphocytic Leukemia, Familial Clustering of																													dbGAP											0													29.0	33.0	32.0					9																	90321697		2138	4251	6389	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3711G>A	9.37:g.90321697G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt	p.L1262	ENST00000408954.3	37	c.3786	CCDS43842.1	9																																																																																			DAPK1	-	NULL	ENSG00000196730		0.592	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	54	0.00	0	G	NM_004938		90321697	90321697	+1	no_errors	ENST00000469640	ensembl	human	known	69_37n	silent	20	16.67	4	SNP	1.000	A
AGO2	27161	genome.wustl.edu	37	8	141549448	141549448	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr8:141549448G>A	ENST00000220592.5	-	16	2252	c.2140C>T	c.(2140-2142)Cgg>Tgg	p.R714W	AGO2_ENST00000519980.1_Missense_Mutation_p.R714W	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	714	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										CAGAAGAGCCGGGTGTGGTGC	0.597																																						dbGAP											0													83.0	80.0	81.0					8																	141549448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.2140C>T	8.37:g.141549448G>A	ENSP00000220592:p.Arg714Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R714W	ENST00000220592.5	37	c.2140	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701348	0.48307	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.53640	0.61;0.61	5.09	0.0596	0.14333	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.80628	0.4659	H	0.99590	4.645	0.45366	D	0.998352	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87899	0.2689	10	0.87932	D	0	-28.4698	14.8093	0.69982	0.0:0.0:0.3671:0.6329	.	714;714	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	W	714	ENSP00000220592:R714W;ENSP00000430176:R714W	ENSP00000220592:R714W	R	-	1	2	EIF2C2	141618630	0.945000	0.32115	0.225000	0.23894	0.630000	0.37929	1.561000	0.36342	0.187000	0.20147	-0.181000	0.13052	CGG	EIF2C2	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000123908		0.597	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C2	HGNC	protein_coding	OTTHUMT00000377866.4	56	0.00	0	G			141549448	141549448	-1	no_errors	ENST00000220592	ensembl	human	known	69_37n	missense	73	32.41	35	SNP	0.083	A
AGO2	27161	genome.wustl.edu	37	8	141549448	141549448	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr8:141549448G>A	ENST00000220592.5	-	16	2252	c.2140C>T	c.(2140-2142)Cgg>Tgg	p.R714W	AGO2_ENST00000519980.1_Missense_Mutation_p.R714W	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	714	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										CAGAAGAGCCGGGTGTGGTGC	0.597																																						dbGAP											0													83.0	80.0	81.0					8																	141549448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.2140C>T	8.37:g.141549448G>A	ENSP00000220592:p.Arg714Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R714W	ENST00000220592.5	37	c.2140	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701348	0.48307	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.53640	0.61;0.61	5.09	0.0596	0.14333	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.80628	0.4659	H	0.99590	4.645	0.45366	D	0.998352	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87899	0.2689	10	0.87932	D	0	-28.4698	14.8093	0.69982	0.0:0.0:0.3671:0.6329	.	714;714	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	W	714	ENSP00000220592:R714W;ENSP00000430176:R714W	ENSP00000220592:R714W	R	-	1	2	EIF2C2	141618630	0.945000	0.32115	0.225000	0.23894	0.630000	0.37929	1.561000	0.36342	0.187000	0.20147	-0.181000	0.13052	CGG	EIF2C2	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000123908		0.597	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C2	HGNC	protein_coding	OTTHUMT00000377866.4	112	0.00	0	G			141549448	141549448	-1	no_errors	ENST00000220592	ensembl	human	known	69_37n	missense	73	32.41	35	SNP	0.083	A
F13B	2165	genome.wustl.edu	37	1	197026274	197026274	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr1:197026274G>T	ENST00000367412.1	-	7	1083	c.1040C>A	c.(1039-1041)gCa>gAa	p.A347E		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	347	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						GTGTAAATTTGCTGCACCATT	0.403																																						dbGAP											0													100.0	92.0	95.0					1																	197026274		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1040C>A	1.37:g.197026274G>T	ENSP00000356382:p.Ala347Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3E5|Q5VYL5	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.A347E	ENST00000367412.1	37	c.1040	CCDS1388.1	1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.756610	0.31137	.	.	ENSG00000143278	ENST00000367412	T	0.64438	-0.1	5.99	5.99	0.97316	Complement control module (2);Sushi/SCR/CCP (3);	0.253200	0.20829	N	0.084922	T	0.65154	0.2664	M	0.78049	2.395	0.09310	N	1	B	0.32283	0.362	B	0.36244	0.22	T	0.63225	-0.6685	10	0.51188	T	0.08	.	11.2653	0.49106	0.0823:0.0:0.9177:0.0	.	347	P05160	F13B_HUMAN	E	347	ENSP00000356382:A347E	ENSP00000356382:A347E	A	-	2	0	F13B	195292897	0.714000	0.27936	0.014000	0.15608	0.004000	0.04260	3.998000	0.57024	2.844000	0.97970	0.650000	0.86243	GCA	F13B	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143278		0.403	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	HGNC	protein_coding	OTTHUMT00000088821.2	35	0.00	0	G	NM_001994		197026274	197026274	-1	no_errors	ENST00000367412	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	0.020	T
F13B	2165	genome.wustl.edu	37	1	197026274	197026274	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:197026274G>T	ENST00000367412.1	-	7	1083	c.1040C>A	c.(1039-1041)gCa>gAa	p.A347E		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	347	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						GTGTAAATTTGCTGCACCATT	0.403																																						dbGAP											0													100.0	92.0	95.0					1																	197026274		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1040C>A	1.37:g.197026274G>T	ENSP00000356382:p.Ala347Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3E5|Q5VYL5	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.A347E	ENST00000367412.1	37	c.1040	CCDS1388.1	1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.756610	0.31137	.	.	ENSG00000143278	ENST00000367412	T	0.64438	-0.1	5.99	5.99	0.97316	Complement control module (2);Sushi/SCR/CCP (3);	0.253200	0.20829	N	0.084922	T	0.65154	0.2664	M	0.78049	2.395	0.09310	N	1	B	0.32283	0.362	B	0.36244	0.22	T	0.63225	-0.6685	10	0.51188	T	0.08	.	11.2653	0.49106	0.0823:0.0:0.9177:0.0	.	347	P05160	F13B_HUMAN	E	347	ENSP00000356382:A347E	ENSP00000356382:A347E	A	-	2	0	F13B	195292897	0.714000	0.27936	0.014000	0.15608	0.004000	0.04260	3.998000	0.57024	2.844000	0.97970	0.650000	0.86243	GCA	F13B	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143278		0.403	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	HGNC	protein_coding	OTTHUMT00000088821.2	78	0.00	0	G	NM_001994		197026274	197026274	-1	no_errors	ENST00000367412	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	0.020	T
FAM83H	286077	genome.wustl.edu	37	8	144808720	144808720	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr8:144808720G>T	ENST00000388913.3	-	5	3036	c.2911C>A	c.(2911-2913)Cag>Aag	p.Q971K		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	971					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CTCAGCAGCTGCCTAAGACGC	0.697																																						dbGAP											0													13.0	15.0	15.0					8																	144808720		1867	4017	5884	-	-	-	SO:0001583	missense	0			AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2911C>A	8.37:g.144808720G>T	ENSP00000373565:p.Gln971Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLS2|Q8N4W0	Missense_Mutation	SNP	pfam_DUF1669	p.Q971K	ENST00000388913.3	37	c.2911	CCDS6410.2	8	.	.	.	.	.	.	.	.	.	.	g	19.38	3.815712	0.70912	.	.	ENSG00000180921	ENST00000388913	T	0.17213	2.29	5.11	5.11	0.69529	.	4.271340	0.00846	N	0.001786	T	0.21387	0.0515	L	0.32530	0.975	0.27940	N	0.937546	B	0.22346	0.068	B	0.18561	0.022	T	0.42865	-0.9426	10	0.32370	T	0.25	.	17.5903	0.87994	0.0:0.0:1.0:0.0	.	971	Q6ZRV2	FA83H_HUMAN	K	971	ENSP00000373565:Q971K	ENSP00000373565:Q971K	Q	-	1	0	FAM83H	144880708	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.462000	0.53042	2.392000	0.81423	0.550000	0.68814	CAG	FAM83H	-	NULL	ENSG00000180921		0.697	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83H	HGNC	protein_coding	OTTHUMT00000257632.2	24	0.00	0	G	NM_198488		144808720	144808720	-1	no_errors	ENST00000388913	ensembl	human	known	69_37n	missense	5	37.50	3	SNP	1.000	T
HK1	3098	genome.wustl.edu	37	10	71129355	71129355	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr10:71129355G>A	ENST00000359426.6	+	7	954	c.850G>A	c.(850-852)Gga>Aga	p.G284R	HK1_ENST00000298649.3_Missense_Mutation_p.G283R|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000448642.2_Missense_Mutation_p.G319R|HK1_ENST00000360289.2_Missense_Mutation_p.G272R|HK1_ENST00000404387.2_Missense_Mutation_p.G288R	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	284	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GATAGACCGGGGATCCCTCAA	0.473																																						dbGAP											0													90.0	89.0	89.0					10																	71129355		2203	4300	6503	-	-	-	SO:0001583	missense	0			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.850G>A	10.37:g.71129355G>A	ENSP00000352398:p.Gly284Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.G319R	ENST00000359426.6	37	c.955	CCDS7292.1	10	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983700	0.53827	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000436817;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94;-3.94;-3.94	5.34	5.34	0.76211	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97111	0.9056	L	0.58510	1.815	0.80722	D	1	D;D;D;D;D;P	0.89917	1.0;1.0;1.0;0.999;1.0;0.594	D;D;D;D;D;B	0.97110	0.996;0.994;1.0;0.965;0.986;0.194	D	0.96751	0.9554	10	0.42905	T	0.14	-3.7709	19.0383	0.92987	0.0:0.0:1.0:0.0	.	284;284;283;319;288;272	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	R	272;319;288;283;283;284;284	ENSP00000353433:G272R;ENSP00000402103:G319R;ENSP00000384774:G288R;ENSP00000415949:G283R;ENSP00000298649:G283R;ENSP00000352398:G284R	ENSP00000298649:G283R	G	+	1	0	HK1	70799361	1.000000	0.71417	0.731000	0.30826	0.253000	0.25986	8.062000	0.89475	2.499000	0.84300	0.563000	0.77884	GGA	HK1	-	pfam_Hexokinase_C	ENSG00000156515		0.473	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK1	HGNC	protein_coding	OTTHUMT00000048429.2	36	0.00	0	G	NM_000188		71129355	71129355	+1	no_errors	ENST00000448642	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	A
HK1	3098	genome.wustl.edu	37	10	71129355	71129355	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr10:71129355G>A	ENST00000359426.6	+	7	954	c.850G>A	c.(850-852)Gga>Aga	p.G284R	HK1_ENST00000298649.3_Missense_Mutation_p.G283R|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000448642.2_Missense_Mutation_p.G319R|HK1_ENST00000360289.2_Missense_Mutation_p.G272R|HK1_ENST00000404387.2_Missense_Mutation_p.G288R	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	284	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GATAGACCGGGGATCCCTCAA	0.473																																						dbGAP											0													90.0	89.0	89.0					10																	71129355		2203	4300	6503	-	-	-	SO:0001583	missense	0			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.850G>A	10.37:g.71129355G>A	ENSP00000352398:p.Gly284Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.G319R	ENST00000359426.6	37	c.955	CCDS7292.1	10	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983700	0.53827	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000436817;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94;-3.94;-3.94	5.34	5.34	0.76211	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97111	0.9056	L	0.58510	1.815	0.80722	D	1	D;D;D;D;D;P	0.89917	1.0;1.0;1.0;0.999;1.0;0.594	D;D;D;D;D;B	0.97110	0.996;0.994;1.0;0.965;0.986;0.194	D	0.96751	0.9554	10	0.42905	T	0.14	-3.7709	19.0383	0.92987	0.0:0.0:1.0:0.0	.	284;284;283;319;288;272	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	R	272;319;288;283;283;284;284	ENSP00000353433:G272R;ENSP00000402103:G319R;ENSP00000384774:G288R;ENSP00000415949:G283R;ENSP00000298649:G283R;ENSP00000352398:G284R	ENSP00000298649:G283R	G	+	1	0	HK1	70799361	1.000000	0.71417	0.731000	0.30826	0.253000	0.25986	8.062000	0.89475	2.499000	0.84300	0.563000	0.77884	GGA	HK1	-	pfam_Hexokinase_C	ENSG00000156515		0.473	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK1	HGNC	protein_coding	OTTHUMT00000048429.2	68	0.00	0	G	NM_000188		71129355	71129355	+1	no_errors	ENST00000448642	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	A
HOXA3	3200	genome.wustl.edu	37	7	27148062	27148062	+	Silent	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr7:27148062G>A	ENST00000396352.4	-	3	1003	c.804C>T	c.(802-804)ccC>ccT	p.P268P	HOXA3_ENST00000317201.2_Silent_p.P268P|HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	268					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CGGGGGGCACGGGGCTGCGAC	0.612																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	dbGAP											0													106.0	105.0	105.0					7																	27148062		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.804C>T	7.37:g.27148062G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D181	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.P268	ENST00000396352.4	37	c.804	CCDS5404.1	7																																																																																			HOXA3	-	NULL	ENSG00000105997		0.612	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA3	HGNC	protein_coding	OTTHUMT00000358708.2	53	0.00	0	G			27148062	27148062	-1	no_errors	ENST00000317201	ensembl	human	known	69_37n	silent	46	25.81	16	SNP	0.002	A
HOXA3	3200	genome.wustl.edu	37	7	27148062	27148062	+	Silent	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr7:27148062G>A	ENST00000396352.4	-	3	1003	c.804C>T	c.(802-804)ccC>ccT	p.P268P	HOXA3_ENST00000317201.2_Silent_p.P268P|HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	268					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CGGGGGGCACGGGGCTGCGAC	0.612																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	dbGAP											0													106.0	105.0	105.0					7																	27148062		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.804C>T	7.37:g.27148062G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D181	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.P268	ENST00000396352.4	37	c.804	CCDS5404.1	7																																																																																			HOXA3	-	NULL	ENSG00000105997		0.612	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA3	HGNC	protein_coding	OTTHUMT00000358708.2	102	0.00	0	G			27148062	27148062	-1	no_errors	ENST00000317201	ensembl	human	known	69_37n	silent	46	25.81	16	SNP	0.002	A
KLHL15	80311	genome.wustl.edu	37	X	24006791	24006791	+	Silent	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chrX:24006791C>T	ENST00000328046.8	-	4	1317	c.1062G>A	c.(1060-1062)ccG>ccA	p.P354P		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	354					protein ubiquitination (GO:0016567)					autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						AGTTCTGTCTCGGGTCATACC	0.483																																						dbGAP											0													95.0	94.0	95.0					X																	24006791		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.1062G>A	X.37:g.24006791C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.P354	ENST00000328046.8	37	c.1062	CCDS35217.1	X																																																																																			KLHL15	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000174010		0.483	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL15	HGNC	protein_coding	OTTHUMT00000056078.1	46	0.00	0	C	XM_040383		24006791	24006791	-1	no_errors	ENST00000328046	ensembl	human	known	69_37n	silent	36	28.00	14	SNP	0.159	T
KLHL15	80311	genome.wustl.edu	37	X	24006791	24006791	+	Silent	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chrX:24006791C>T	ENST00000328046.8	-	4	1317	c.1062G>A	c.(1060-1062)ccG>ccA	p.P354P		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	354					protein ubiquitination (GO:0016567)					autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						AGTTCTGTCTCGGGTCATACC	0.483																																						dbGAP											0													95.0	94.0	95.0					X																	24006791		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.1062G>A	X.37:g.24006791C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.P354	ENST00000328046.8	37	c.1062	CCDS35217.1	X																																																																																			KLHL15	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000174010		0.483	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL15	HGNC	protein_coding	OTTHUMT00000056078.1	115	0.00	0	C	XM_040383		24006791	24006791	-1	no_errors	ENST00000328046	ensembl	human	known	69_37n	silent	36	28.00	14	SNP	0.159	T
KRTAP9-1	728318	genome.wustl.edu	37	17	39346498	39346498	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr17:39346498C>G	ENST00000398470.1	+	1	360	c.360C>G	c.(358-360)caC>caG	p.H120Q	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Intron	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	120	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CTTGCTGTCACCCGACTTGCT	0.602																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.360C>G	17.37:g.39346498C>G	ENSP00000381488:p.His120Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.H120Q	ENST00000398470.1	37	c.360	CCDS56029.1	17	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.989359	0.00439	.	.	ENSG00000240542	ENST00000398470	T	0.00584	6.4	2.07	-2.85	0.05734	.	.	.	.	.	T	0.00241	0.0007	N	0.01140	-0.99	0.09310	N	1	.	.	.	.	.	.	T	0.33085	-0.9882	7	0.10377	T	0.69	.	5.5418	0.17041	0.1883:0.2829:0.5288:0.0	.	.	.	.	Q	120	ENSP00000381488:H120Q	ENSP00000381488:H120Q	H	+	3	2	KRTAP9-1	36600024	0.001000	0.12720	0.000000	0.03702	0.033000	0.12548	-0.017000	0.12590	-0.546000	0.06216	-0.723000	0.03601	CAC	KRTAP9-1	-	NULL	ENSG00000240542		0.602	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP9-1	HGNC	protein_coding	OTTHUMT00000257781.1	149	0.00	0	C			39346498	39346498	+1	no_errors	ENST00000398470	ensembl	human	known	69_37n	missense	120	25.93	42	SNP	0.000	G
KRTAP9-1	728318	genome.wustl.edu	37	17	39346498	39346498	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr17:39346498C>G	ENST00000398470.1	+	1	360	c.360C>G	c.(358-360)caC>caG	p.H120Q	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Intron	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	120	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CTTGCTGTCACCCGACTTGCT	0.602																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.360C>G	17.37:g.39346498C>G	ENSP00000381488:p.His120Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.H120Q	ENST00000398470.1	37	c.360	CCDS56029.1	17	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.989359	0.00439	.	.	ENSG00000240542	ENST00000398470	T	0.00584	6.4	2.07	-2.85	0.05734	.	.	.	.	.	T	0.00241	0.0007	N	0.01140	-0.99	0.09310	N	1	.	.	.	.	.	.	T	0.33085	-0.9882	7	0.10377	T	0.69	.	5.5418	0.17041	0.1883:0.2829:0.5288:0.0	.	.	.	.	Q	120	ENSP00000381488:H120Q	ENSP00000381488:H120Q	H	+	3	2	KRTAP9-1	36600024	0.001000	0.12720	0.000000	0.03702	0.033000	0.12548	-0.017000	0.12590	-0.546000	0.06216	-0.723000	0.03601	CAC	KRTAP9-1	-	NULL	ENSG00000240542		0.602	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP9-1	HGNC	protein_coding	OTTHUMT00000257781.1	267	0.00	0	C			39346498	39346498	+1	no_errors	ENST00000398470	ensembl	human	known	69_37n	missense	120	25.93	42	SNP	0.000	G
LYSMD1	388695	genome.wustl.edu	37	1	151137721	151137721	+	Missense_Mutation	SNP	G	G	A	rs200029870		TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr1:151137721G>A	ENST00000368908.5	-	1	674	c.14C>T	c.(13-15)tCt>tTt	p.S5F	SCNM1_ENST00000368905.4_5'Flank|LYSMD1_ENST00000440902.2_Intron	NM_212551.4	NP_997716.1	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain containing 1	5								p.S5F(1)		endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGGCTGTCTAGACGGGGAAGC	0.592																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											38.0	41.0	40.0					1																	151137721		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647911	CCDS986.1, CCDS44218.1	1q21.2	2008-02-05			ENSG00000163155	ENSG00000163155			32070	protein-coding gene	gene with protein product						12477932	Standard	NM_212551		Approved	SB145, MGC35223, RP11-68I18.5	uc001ewy.3	Q96S90	OTTHUMG00000012260	ENST00000368908.5:c.14C>T	1.37:g.151137721G>A	ENSP00000357904:p.Ser5Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQA1|Q69YX9	Missense_Mutation	SNP	pfam_Peptidoglycan-bd_lysin,smart_Peptidoglycan-bd_Lysin_subgr	p.S5F	ENST00000368908.5	37	c.14	CCDS986.1	1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508010	0.64410	.	.	ENSG00000163155	ENST00000368908	T	0.34472	1.36	5.04	5.04	0.67666	.	0.349858	0.30989	N	0.008479	T	0.32164	0.0820	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.03863	-1.0997	10	0.12430	T	0.62	.	17.3159	0.87224	0.0:0.0:1.0:0.0	.	5	Q96S90	LYSM1_HUMAN	F	5	ENSP00000357904:S5F	ENSP00000357904:S5F	S	-	2	0	LYSMD1	149404345	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	4.118000	0.57884	2.607000	0.88179	0.557000	0.71058	TCT	LYSMD1	-	NULL	ENSG00000163155		0.592	LYSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYSMD1	HGNC	protein_coding	OTTHUMT00000034070.3	27	0.00	0	G	NM_212551		151137721	151137721	-1	no_errors	ENST00000368908	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	0.995	A
LYSMD1	388695	genome.wustl.edu	37	1	151137721	151137721	+	Missense_Mutation	SNP	G	G	A	rs200029870		TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:151137721G>A	ENST00000368908.5	-	1	674	c.14C>T	c.(13-15)tCt>tTt	p.S5F	SCNM1_ENST00000368905.4_5'Flank|LYSMD1_ENST00000440902.2_Intron	NM_212551.4	NP_997716.1	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain containing 1	5								p.S5F(1)		endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGGCTGTCTAGACGGGGAAGC	0.592																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											38.0	41.0	40.0					1																	151137721		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647911	CCDS986.1, CCDS44218.1	1q21.2	2008-02-05			ENSG00000163155	ENSG00000163155			32070	protein-coding gene	gene with protein product						12477932	Standard	NM_212551		Approved	SB145, MGC35223, RP11-68I18.5	uc001ewy.3	Q96S90	OTTHUMG00000012260	ENST00000368908.5:c.14C>T	1.37:g.151137721G>A	ENSP00000357904:p.Ser5Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQA1|Q69YX9	Missense_Mutation	SNP	pfam_Peptidoglycan-bd_lysin,smart_Peptidoglycan-bd_Lysin_subgr	p.S5F	ENST00000368908.5	37	c.14	CCDS986.1	1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508010	0.64410	.	.	ENSG00000163155	ENST00000368908	T	0.34472	1.36	5.04	5.04	0.67666	.	0.349858	0.30989	N	0.008479	T	0.32164	0.0820	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.03863	-1.0997	10	0.12430	T	0.62	.	17.3159	0.87224	0.0:0.0:1.0:0.0	.	5	Q96S90	LYSM1_HUMAN	F	5	ENSP00000357904:S5F	ENSP00000357904:S5F	S	-	2	0	LYSMD1	149404345	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	4.118000	0.57884	2.607000	0.88179	0.557000	0.71058	TCT	LYSMD1	-	NULL	ENSG00000163155		0.592	LYSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYSMD1	HGNC	protein_coding	OTTHUMT00000034070.3	44	0.00	0	G	NM_212551		151137721	151137721	-1	no_errors	ENST00000368908	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	0.995	A
NAT16	375607	genome.wustl.edu	37	7	100815570	100815570	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr7:100815570G>T	ENST00000300303.2	-	4	1138	c.900C>A	c.(898-900)gaC>gaA	p.D300E	NAT16_ENST00000455377.1_Missense_Mutation_p.D300E	NM_198571.2	NP_940973.2	Q8N8M0	NAT16_HUMAN	N-acetyltransferase 16 (GCN5-related, putative)	300							N-acetyltransferase activity (GO:0008080)										TACCGAAGGCGTCGATGTTGA	0.711																																						dbGAP											0													14.0	14.0	14.0					7																	100815570		2184	4280	6464	-	-	-	SO:0001583	missense	0			AK096556	CCDS5713.1	7q22.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000167011	ENSG00000167011			22030	protein-coding gene	gene with protein product		615783	"""chromosome 7 open reading frame 52"""	C7orf52			Standard	NM_198571		Approved	FLJ39237	uc003uxy.2	Q8N8M0	OTTHUMG00000157110	ENST00000300303.2:c.900C>A	7.37:g.100815570G>T	ENSP00000300303:p.Asp300Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRS2|Q8NDR1	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.D300E	ENST00000300303.2	37	c.900	CCDS5713.1	7	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605349	0.66445	.	.	ENSG00000167011	ENST00000300303;ENST00000455377	T;T	0.60797	0.16;0.16	4.55	0.356	0.16074	.	0.072630	0.50627	D	0.000113	T	0.60157	0.2247	L	0.54323	1.7	0.19775	N	0.999959	D	0.59767	0.986	P	0.57960	0.83	T	0.52298	-0.8594	10	0.72032	D	0.01	.	6.6054	0.22721	0.5487:0.0:0.4513:0.0	.	300	Q8N8M0	CG052_HUMAN	E	300	ENSP00000300303:D300E;ENSP00000395125:D300E	ENSP00000300303:D300E	D	-	3	2	C7orf52	100602290	0.013000	0.17824	0.001000	0.08648	0.978000	0.69477	0.075000	0.14686	0.176000	0.19873	0.456000	0.33151	GAC	NAT16	-	NULL	ENSG00000167011		0.711	NAT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT16	HGNC	protein_coding	OTTHUMT00000347465.1	34	0.00	0	G	NM_198571		100815570	100815570	-1	no_errors	ENST00000300303	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	0.098	T
NOTCH2	4853	genome.wustl.edu	37	1	120465373	120465373	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:120465373G>C	ENST00000256646.2	-	27	5107	c.4888C>G	c.(4888-4890)Cgc>Ggc	p.R1630G	NOTCH2_ENST00000493703.1_5'UTR	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1630	Negative regulatory region (NRR).				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACACACTGGCGGTTGTCAATT	0.542			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													146.0	151.0	149.0					1																	120465373		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.4888C>G	1.37:g.120465373G>C	ENSP00000256646:p.Arg1630Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R1630G	ENST00000256646.2	37	c.4888	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.352643	0.95830	.	.	ENSG00000134250	ENST00000256646	T	0.39056	1.1	5.78	5.78	0.91487	Notch, NODP domain (1);	0.000000	0.36703	U	0.002453	T	0.65165	0.2665	M	0.87971	2.92	0.80722	D	1	D	0.76494	0.999	D	0.67231	0.95	T	0.70263	-0.4920	10	0.72032	D	0.01	.	18.9999	0.92829	0.0:0.0:1.0:0.0	.	1630	Q04721	NOTC2_HUMAN	G	1630	ENSP00000256646:R1630G	ENSP00000256646:R1630G	R	-	1	0	NOTCH2	120266896	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.744000	0.94065	0.563000	0.77884	CGC	NOTCH2	-	pirsf_Notch,pfam_Notch_NODP_dom	ENSG00000134250		0.542	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	73	0.00	0	G	NM_024408		120465373	120465373	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	C
NOTCH2NL	388677	genome.wustl.edu	37	1	145290819	145290819	+	3'UTR	SNP	G	G	A	rs4659318	byFrequency	TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:145290819G>A	ENST00000344859.3	+	0	1118				RP11-458D21.5_ENST00000468030.1_Intron|NBPF10_ENST00000369339.3_Intron|NOTCH2NL_ENST00000479995.2_3'UTR|NBPF10_ENST00000369338.1_5'Flank|NBPF10_ENST00000342960.5_5'Flank			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ATGGAATTGCGCAGTGCATGG	0.527																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000344859.3:c.*63G>A	1.37:g.145290819G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	RNA	SNP	-	NULL	ENST00000344859.3	37	NULL		1																																																																																			NOTCH2NL	-	-	ENSG00000213240		0.527	NOTCH2NL-001	KNOWN	basic|appris_candidate	protein_coding	NOTCH2NL	HGNC	protein_coding	OTTHUMT00000038544.1	35	0.00	0	G	NM_203458		145290819	145290819	+1	no_errors	ENST00000479995	ensembl	human	known	69_37n	rna	30	14.29	5	SNP	0.001	A
NRK	203447	genome.wustl.edu	37	X	105179171	105179171	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chrX:105179171G>T	ENST00000243300.9	+	21	3812	c.3509G>T	c.(3508-3510)gGa>gTa	p.G1170V	NRK_ENST00000428173.2_Missense_Mutation_p.G1171V	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1170					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GTATACGCTGGATTCGTAGAA	0.383										HNSCC(51;0.14)																												dbGAP											0													176.0	156.0	162.0					X																	105179171		1890	4103	5993	-	-	-	SO:0001583	missense	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3509G>T	X.37:g.105179171G>T	ENSP00000434830:p.Gly1170Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.G1171V	ENST00000243300.9	37	c.3512		X	.	.	.	.	.	.	.	.	.	.	G	9.152	1.016593	0.19355	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.79454	-1.26;-1.27	4.78	3.01	0.34805	.	0.478289	0.17925	N	0.157374	T	0.72716	0.3495	N	0.14661	0.345	0.09310	N	0.999999	D;D	0.67145	0.996;0.994	D;P	0.63957	0.92;0.799	T	0.60835	-0.7184	10	0.62326	D	0.03	.	5.8256	0.18552	0.237:0.0:0.763:0.0	.	838;1170	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	V	1170;1171	ENSP00000434830:G1170V;ENSP00000438378:G1171V	ENSP00000434830:G1170V	G	+	2	0	NRK	105065827	0.998000	0.40836	0.459000	0.27081	0.087000	0.18053	2.478000	0.45189	1.133000	0.42147	0.600000	0.82982	GGA	NRK	-	NULL	ENSG00000123572		0.383	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	81	0.00	0	G	NM_198465		105179171	105179171	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	missense	66	16.46	13	SNP	0.058	T
ODF3L2	284451	genome.wustl.edu	37	19	463881	463881	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr19:463881C>T	ENST00000315489.4	-	4	1068	c.833G>A	c.(832-834)cGg>cAg	p.R278Q	SHC2_ENST00000264554.6_5'Flank|ODF3L2_ENST00000382696.3_Missense_Mutation_p.R242Q	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	278						cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						CCCCGCAGGCCGGGAGGGCGT	0.697																																						dbGAP											0													18.0	21.0	20.0					19																	463881		2192	4284	6476	-	-	-	SO:0001583	missense	0			AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.833G>A	19.37:g.463881C>T	ENSP00000318029:p.Arg278Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SX65|Q8N1L2	Missense_Mutation	SNP	pfam_SHIPPO-rpt	p.R278Q	ENST00000315489.4	37	c.833	CCDS12027.1	19	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818306	0.50633	.	.	ENSG00000181781	ENST00000315489;ENST00000382696	T;T	0.45668	1.45;0.89	3.81	-5.72	0.02406	.	.	.	.	.	T	0.23926	0.0579	L	0.38175	1.15	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.04013	0.001;0.001	T	0.30357	-0.9981	9	0.48119	T	0.1	.	1.3911	0.02250	0.1212:0.3155:0.215:0.3483	.	242;278	Q3SX64-2;Q3SX64	.;OD3L2_HUMAN	Q	278;242	ENSP00000318029:R278Q;ENSP00000372143:R242Q	ENSP00000318029:R278Q	R	-	2	0	ODF3L2	414881	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.131000	0.01311	-0.656000	0.05380	0.555000	0.69702	CGG	ODF3L2	-	NULL	ENSG00000181781		0.697	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ODF3L2	HGNC	protein_coding	OTTHUMT00000451849.2	32	0.00	0	C	NM_182577		463881	463881	-1	no_errors	ENST00000315489	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.000	T
ODF3L2	284451	genome.wustl.edu	37	19	463881	463881	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr19:463881C>T	ENST00000315489.4	-	4	1068	c.833G>A	c.(832-834)cGg>cAg	p.R278Q	SHC2_ENST00000264554.6_5'Flank|ODF3L2_ENST00000382696.3_Missense_Mutation_p.R242Q	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	278						cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						CCCCGCAGGCCGGGAGGGCGT	0.697																																						dbGAP											0													18.0	21.0	20.0					19																	463881		2192	4284	6476	-	-	-	SO:0001583	missense	0			AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.833G>A	19.37:g.463881C>T	ENSP00000318029:p.Arg278Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SX65|Q8N1L2	Missense_Mutation	SNP	pfam_SHIPPO-rpt	p.R278Q	ENST00000315489.4	37	c.833	CCDS12027.1	19	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818306	0.50633	.	.	ENSG00000181781	ENST00000315489;ENST00000382696	T;T	0.45668	1.45;0.89	3.81	-5.72	0.02406	.	.	.	.	.	T	0.23926	0.0579	L	0.38175	1.15	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.04013	0.001;0.001	T	0.30357	-0.9981	9	0.48119	T	0.1	.	1.3911	0.02250	0.1212:0.3155:0.215:0.3483	.	242;278	Q3SX64-2;Q3SX64	.;OD3L2_HUMAN	Q	278;242	ENSP00000318029:R278Q;ENSP00000372143:R242Q	ENSP00000318029:R278Q	R	-	2	0	ODF3L2	414881	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.131000	0.01311	-0.656000	0.05380	0.555000	0.69702	CGG	ODF3L2	-	NULL	ENSG00000181781		0.697	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ODF3L2	HGNC	protein_coding	OTTHUMT00000451849.2	46	0.00	0	C	NM_182577		463881	463881	-1	no_errors	ENST00000315489	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.000	T
PLCL2	23228	genome.wustl.edu	37	3	17052497	17052497	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr3:17052497delT	ENST00000418129.2	+	2	1746	c.1281delT	c.(1279-1281)tctfs	p.S427fs	PLCL2_ENST00000432376.1_Frame_Shift_Del_p.S427fs|PLCL2_ENST00000460467.1_3'UTR|PLCL2_ENST00000396755.2_Frame_Shift_Del_p.S427fs	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	553	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						TTGAGGAATCTTATCTACCAT	0.398																																						dbGAP											0													43.0	42.0	42.0					3																	17052497		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1281delT	3.37:g.17052497delT	ENSP00000409637:p.Ser427fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Frame_Shift_Del	DEL	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.Y428fs	ENST00000418129.2	37	c.1281	CCDS33713.1	3																																																																																			PLCL2	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000154822		0.398	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	21	0.00	0	T			17052497	17052497	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	frame_shift_del	19	26.92	7	DEL	0.992	-
PLCL2	23228	genome.wustl.edu	37	3	17052497	17052497	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr3:17052497delT	ENST00000418129.2	+	2	1746	c.1281delT	c.(1279-1281)tctfs	p.S427fs	PLCL2_ENST00000432376.1_Frame_Shift_Del_p.S427fs|PLCL2_ENST00000460467.1_3'UTR|PLCL2_ENST00000396755.2_Frame_Shift_Del_p.S427fs	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	553	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						TTGAGGAATCTTATCTACCAT	0.398																																						dbGAP											0													43.0	42.0	42.0					3																	17052497		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1281delT	3.37:g.17052497delT	ENSP00000409637:p.Ser427fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Frame_Shift_Del	DEL	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.Y428fs	ENST00000418129.2	37	c.1281	CCDS33713.1	3																																																																																			PLCL2	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000154822		0.398	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	27	0.00	0	T			17052497	17052497	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	frame_shift_del	19	26.92	7	DEL	0.992	-
PRICKLE3	4007	genome.wustl.edu	37	X	49040116	49040117	+	Intron	DEL	GT	GT	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chrX:49040116_49040117delGT	ENST00000376317.3	-	3	407				PRICKLE3_ENST00000538114.1_Frame_Shift_Del_p.T128fs|PRICKLE3_ENST00000536904.1_Frame_Shift_Del_p.T60fs|PRICKLE3_ENST00000540849.1_Intron|PRICKLE3_ENST00000376310.3_Intron	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)								zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						TCCCACCTGAGTGTGTGTGTGT	0.604																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.312+69AC>-	X.37:g.49040126_49040127delGT		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8F2|O76007|Q53XR5	Frame_Shift_Del	DEL	pfam_Znf_LIM,pfam_PET_domain,smart_Znf_LIM,pfscan_Znf_LIM	p.T60fs	ENST00000376317.3	37	c.179_178	CCDS14320.1	X																																																																																			PRICKLE3	-	NULL	ENSG00000012211		0.604	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	HGNC	protein_coding	OTTHUMT00000060811.1	50	0.00	0	GT	NM_006150		49040116	49040117	-1	no_errors	ENST00000536904	ensembl	human	known	69_37n	frame_shift_del	25	10.71	3	DEL	0.149:0.119	-
PYGB	5834	genome.wustl.edu	37	20	25273190	25273190	+	Silent	SNP	C	C	G	rs199844284		TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr20:25273190C>G	ENST00000216962.4	+	17	2228	c.2118C>G	c.(2116-2118)gcC>gcG	p.A706A		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	706					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						AGGCCGGGGCCGAGAACCTCT	0.657																																						dbGAP											0													64.0	60.0	62.0					20																	25273190		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.2118C>G	20.37:g.25273190C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35	p.P125R	ENST00000216962.4	37	c.374	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	C	8.894	0.954795	0.18431	.	.	ENSG00000100994	ENST00000428458	.	.	.	4.52	-8.02	0.01118	.	.	.	.	.	T	0.34106	0.0886	.	.	.	0.50632	D	0.99988	.	.	.	.	.	.	T	0.43327	-0.9398	4	.	.	.	-0.0627	1.4691	0.02412	0.1504:0.3083:0.2818:0.2595	.	.	.	.	R	125	.	.	P	+	2	0	PYGB	25221190	0.007000	0.16637	0.006000	0.13384	0.900000	0.52787	-0.495000	0.06443	-1.083000	0.03097	-0.672000	0.03802	CCG	PYGB	-	pfam_Glyco_trans_35	ENSG00000100994		0.657	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	93	0.00	0	C	NM_002862		25273190	25273190	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000428458	ensembl	human	known	69_37n	missense	63	28.09	25	SNP	0.017	G
PYGB	5834	genome.wustl.edu	37	20	25273190	25273190	+	Silent	SNP	C	C	G	rs199844284		TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr20:25273190C>G	ENST00000216962.4	+	17	2228	c.2118C>G	c.(2116-2118)gcC>gcG	p.A706A		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	706					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						AGGCCGGGGCCGAGAACCTCT	0.657																																						dbGAP											0													64.0	60.0	62.0					20																	25273190		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.2118C>G	20.37:g.25273190C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35	p.P125R	ENST00000216962.4	37	c.374	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	C	8.894	0.954795	0.18431	.	.	ENSG00000100994	ENST00000428458	.	.	.	4.52	-8.02	0.01118	.	.	.	.	.	T	0.34106	0.0886	.	.	.	0.50632	D	0.99988	.	.	.	.	.	.	T	0.43327	-0.9398	4	.	.	.	-0.0627	1.4691	0.02412	0.1504:0.3083:0.2818:0.2595	.	.	.	.	R	125	.	.	P	+	2	0	PYGB	25221190	0.007000	0.16637	0.006000	0.13384	0.900000	0.52787	-0.495000	0.06443	-1.083000	0.03097	-0.672000	0.03802	CCG	PYGB	-	pfam_Glyco_trans_35	ENSG00000100994		0.657	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	143	0.00	0	C	NM_002862		25273190	25273190	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000428458	ensembl	human	known	69_37n	missense	63	28.09	25	SNP	0.017	G
RIMBP2	23504	genome.wustl.edu	37	12	130921495	130921495	+	Silent	SNP	C	C	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr12:130921495C>A	ENST00000261655.4	-	10	2110	c.1947G>T	c.(1945-1947)tcG>tcT	p.S649S	RIMBP2_ENST00000535703.1_Silent_p.S557S|RIMBP2_ENST00000536002.1_Silent_p.S557S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	649	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGGGTGAGGGCGACCGCCTTC	0.731																																						dbGAP											0													17.0	22.0	20.0					12																	130921495		2186	4290	6476	-	-	-	SO:0001819	synonymous_variant	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1947G>T	12.37:g.130921495C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96ID2	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.S649	ENST00000261655.4	37	c.1947	CCDS31925.1	12																																																																																			RIMBP2	-	NULL	ENSG00000060709		0.731	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	46	0.00	0	C	NM_015347		130921495	130921495	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.001	A
RIMBP2	23504	genome.wustl.edu	37	12	130921495	130921495	+	Silent	SNP	C	C	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr12:130921495C>A	ENST00000261655.4	-	10	2110	c.1947G>T	c.(1945-1947)tcG>tcT	p.S649S	RIMBP2_ENST00000535703.1_Silent_p.S557S|RIMBP2_ENST00000536002.1_Silent_p.S557S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	649	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGGGTGAGGGCGACCGCCTTC	0.731																																						dbGAP											0													17.0	22.0	20.0					12																	130921495		2186	4290	6476	-	-	-	SO:0001819	synonymous_variant	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1947G>T	12.37:g.130921495C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96ID2	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.S649	ENST00000261655.4	37	c.1947	CCDS31925.1	12																																																																																			RIMBP2	-	NULL	ENSG00000060709		0.731	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	52	0.00	0	C	NM_015347		130921495	130921495	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.001	A
SEL1L2	80343	genome.wustl.edu	37	20	13830252	13830252	+	Splice_Site	SNP	T	T	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr20:13830252T>A	ENST00000284951.5	-	20	2022		c.e20-2		SEL1L2_ENST00000486903.1_Splice_Site|SEL1L2_ENST00000378072.5_Splice_Site			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						CGTTGTGAACTGCTGGCAAGA	0.507																																						dbGAP											0													141.0	141.0	141.0					20																	13830252		1991	4160	6151	-	-	-	SO:0001630	splice_region_variant	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1948-2A>T	20.37:g.13830252T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXX5	Splice_Site	SNP	-	e20-2	ENST00000284951.5	37	c.1948-2		20	.	.	.	.	.	.	.	.	.	.	T	16.19	3.053120	0.55218	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	.	.	.	5.4	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4841	0.38919	0.0:0.0:0.1782:0.8218	.	.	.	.	.	-1	.	.	.	-	.	.	SEL1L2	13778252	1.000000	0.71417	0.989000	0.46669	0.873000	0.50193	2.474000	0.45154	0.872000	0.35775	0.519000	0.50382	.	SEL1L2	-	-	ENSG00000101251		0.507	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	39	0.00	0	T	NM_025229	Intron	13830252	13830252	-1	no_errors	ENST00000284951	ensembl	human	known	69_37n	splice_site	26	23.53	8	SNP	0.998	A
SEL1L2	80343	genome.wustl.edu	37	20	13830252	13830252	+	Splice_Site	SNP	T	T	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr20:13830252T>A	ENST00000284951.5	-	20	2022		c.e20-2		SEL1L2_ENST00000486903.1_Splice_Site|SEL1L2_ENST00000378072.5_Splice_Site			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						CGTTGTGAACTGCTGGCAAGA	0.507																																						dbGAP											0													141.0	141.0	141.0					20																	13830252		1991	4160	6151	-	-	-	SO:0001630	splice_region_variant	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1948-2A>T	20.37:g.13830252T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXX5	Splice_Site	SNP	-	e20-2	ENST00000284951.5	37	c.1948-2		20	.	.	.	.	.	.	.	.	.	.	T	16.19	3.053120	0.55218	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	.	.	.	5.4	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4841	0.38919	0.0:0.0:0.1782:0.8218	.	.	.	.	.	-1	.	.	.	-	.	.	SEL1L2	13778252	1.000000	0.71417	0.989000	0.46669	0.873000	0.50193	2.474000	0.45154	0.872000	0.35775	0.519000	0.50382	.	SEL1L2	-	-	ENSG00000101251		0.507	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	57	0.00	0	T	NM_025229	Intron	13830252	13830252	-1	no_errors	ENST00000284951	ensembl	human	known	69_37n	splice_site	26	23.53	8	SNP	0.998	A
TRAT1	50852	genome.wustl.edu	37	3	108541770	108541770	+	5'UTR	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr3:108541770G>T	ENST00000295756.6	+	0	226				TRAT1_ENST00000493604.1_3'UTR|TRAT1_ENST00000426646.1_5'UTR	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1						cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						CTGAAAAAAAGAAGCATGTCA	0.308																																						dbGAP											0													102.0	116.0	111.0					3																	108541770		2201	4298	6499	-	-	-	SO:0001623	5_prime_UTR_variant	0			AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.-5G>T	3.37:g.108541770G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZX5	RNA	SNP	-	NULL	ENST00000295756.6	37	NULL	CCDS33813.1	3																																																																																			TRAT1	-	-	ENSG00000163519		0.308	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAT1	HGNC	protein_coding	OTTHUMT00000353794.1	61	0.00	0	G	NM_016388		108541770	108541770	+1	no_errors	ENST00000493604	ensembl	human	known	69_37n	rna	49	26.87	18	SNP	0.255	T
TRAT1	50852	genome.wustl.edu	37	3	108541770	108541770	+	5'UTR	SNP	G	G	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr3:108541770G>T	ENST00000295756.6	+	0	226				TRAT1_ENST00000493604.1_3'UTR|TRAT1_ENST00000426646.1_5'UTR	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1						cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						CTGAAAAAAAGAAGCATGTCA	0.308																																						dbGAP											0													102.0	116.0	111.0					3																	108541770		2201	4298	6499	-	-	-	SO:0001623	5_prime_UTR_variant	0			AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.-5G>T	3.37:g.108541770G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZX5	RNA	SNP	-	NULL	ENST00000295756.6	37	NULL	CCDS33813.1	3																																																																																			TRAT1	-	-	ENSG00000163519		0.308	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAT1	HGNC	protein_coding	OTTHUMT00000353794.1	119	0.00	0	G	NM_016388		108541770	108541770	+1	no_errors	ENST00000493604	ensembl	human	known	69_37n	rna	49	26.87	18	SNP	0.255	T
VEGFA	7422	genome.wustl.edu	37	6	43739002	43739003	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr6:43739002_43739003insG	ENST00000523873.1	+	1	57_58	c.19_20insG	c.(19-21)tggfs	p.W7fs	VEGFA_ENST00000417285.2_Frame_Shift_Ins_p.W187fs|VEGFA_ENST00000457104.2_Frame_Shift_Ins_p.W7fs|VEGFA_ENST00000518689.1_Frame_Shift_Ins_p.W7fs|VEGFA_ENST00000372055.4_Frame_Shift_Ins_p.W187fs|VEGFA_ENST00000372067.3_Frame_Shift_Ins_p.W187fs|RP1-261G23.7_ENST00000607600.1_RNA|VEGFA_ENST00000230480.6_5'Flank|VEGFA_ENST00000324450.6_Frame_Shift_Ins_p.W187fs|VEGFA_ENST00000523950.1_Frame_Shift_Ins_p.W7fs|VEGFA_ENST00000518824.1_Frame_Shift_Ins_p.W7fs|VEGFA_ENST00000372064.4_Frame_Shift_Ins_p.W187fs|VEGFA_ENST00000523125.1_Frame_Shift_Ins_p.W7fs|VEGFA_ENST00000413642.3_Frame_Shift_Ins_p.W187fs|VEGFA_ENST00000482630.2_Frame_Shift_Ins_p.W187fs|VEGFA_ENST00000372077.4_Frame_Shift_Ins_p.W7fs|VEGFA_ENST00000425836.2_Frame_Shift_Ins_p.W187fs|VEGFA_ENST00000520948.1_Frame_Shift_Ins_p.W7fs			P15692	VEGFA_HUMAN	vascular endothelial growth factor A	7					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|basophil chemotaxis (GO:0002575)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|camera-type eye morphogenesis (GO:0048593)|cardiac muscle fiber development (GO:0048739)|cardiac vascular smooth muscle cell development (GO:0060948)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to hypoxia (GO:0071456)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|dopaminergic neuron differentiation (GO:0071542)|endothelial cell chemotaxis (GO:0035767)|epithelial cell differentiation (GO:0030855)|eye photoreceptor cell development (GO:0042462)|growth (GO:0040007)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|induction of positive chemotaxis (GO:0050930)|kidney development (GO:0001822)|lactation (GO:0007595)|lung development (GO:0030324)|lymph vessel morphogenesis (GO:0036303)|macrophage differentiation (GO:0030225)|mammary gland alveolus development (GO:0060749)|mesoderm development (GO:0007498)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|outflow tract morphogenesis (GO:0003151)|ovarian follicle development (GO:0001541)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cellular component movement (GO:0051272)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein localization to early endosome (GO:1902966)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor internalization (GO:0002092)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular permeability (GO:0043117)|post-embryonic camera-type eye development (GO:0031077)|primitive erythrocyte differentiation (GO:0060319)|regulation of cell shape (GO:0008360)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)|surfactant homeostasis (GO:0043129)|tube formation (GO:0035148)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|VEGF-activated neuropilin signaling pathway (GO:0038190)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|neuropilin binding (GO:0038191)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor agonist activity (GO:0048018)|vascular endothelial growth factor receptor 1 binding (GO:0043183)|vascular endothelial growth factor receptor 2 binding (GO:0043184)|vascular endothelial growth factor receptor binding (GO:0005172)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Aflibercept(DB08885)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Dalteparin(DB06779)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Vandetanib(DB05294)	TCTGCTGTCTTGGGTGCATTGG	0.718																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB021221	CCDS34457.1, CCDS4907.2, CCDS34458.1, CCDS47432.1, CCDS47433.1, CCDS47434.1, CCDS47435.1, CCDS55007.1, CCDS55008.1, CCDS55009.1, CCDS55010.1, CCDS55011.1, CCDS55012.1, CCDS55013.1, CCDS55014.1, CCDS55015.1, CCDS69125.1	6p12	2008-02-05	2006-10-31	2006-10-31	ENSG00000112715	ENSG00000112715			12680	protein-coding gene	gene with protein product		192240	"""vascular endothelial growth factor"""	VEGF		8786112	Standard	NM_001025366		Approved	VEGF-A, VPF	uc003owh.3	P15692	OTTHUMG00000014745	ENST00000523873.1:c.22dupG	6.37:g.43739005_43739005dupG	ENSP00000430479:p.Trp7fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BU86|H0Y2S8|H0Y407|H0Y414|H0Y462|H0Y8N2|H3BLW7|O60720|O75875|Q074Z4|Q16889|Q5UB46|Q6P0P5|Q96KJ0|Q96L82|Q96NW5|Q9H1W8|Q9H1W9|Q9UH58|Q9UL23	Frame_Shift_Ins	INS	pfam_PD_growth_factor,smart_PD_growth_factor,pfscan_PD_growth_factor	p.V188fs	ENST00000523873.1	37	c.559_560	CCDS55010.1	6																																																																																			VEGFA	-	NULL	ENSG00000112715		0.718	VEGFA-021	KNOWN	basic|CCDS	protein_coding	VEGFA	HGNC	protein_coding	OTTHUMT00000374460.1	49	0.00	0	-	NM_001025366		43739002	43739003	+1	no_errors	ENST00000372055	ensembl	human	known	69_37n	frame_shift_ins	16	11.11	2	INS	1.000:1.000	G
VWA5B1	127731	genome.wustl.edu	37	1	20645945	20645945	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:20645945delG	ENST00000375079.2	+	7	1108	c.912delG	c.(910-912)aagfs	p.K304fs	RP4-745E8.2_ENST00000444923.1_RNA|VWA5B1_ENST00000289815.8_Frame_Shift_Del_p.K304fs|VWA5B1_ENST00000375083.4_Frame_Shift_Del_p.K304fs|VWA5B1_ENST00000289825.4_Frame_Shift_Del_p.K21fs	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	304						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						AGCACTTGAAGGGAAGAACAG	0.532																																						dbGAP											0													93.0	90.0	91.0					1																	20645945		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.912delG	1.37:g.20645945delG	ENSP00000364220:p.Lys304fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Frame_Shift_Del	DEL	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.G305fs	ENST00000375079.2	37	c.912		1																																																																																			VWA5B1	-	NULL	ENSG00000158816		0.532	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4	54	0.00	0	G	XM_001722222		20645945	20645945	+1	no_errors	ENST00000375089	ensembl	human	known	69_37n	frame_shift_del	15	11.11	2	DEL	1.000	-
WASH6P	653440	genome.wustl.edu	37	X	155254531	155254531	+	RNA	SNP	T	T	G			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chrX:155254531T>G	ENST00000461007.1	+	0	3447				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										AACAGCCGCTTTCTCATCAGT	0.632																																						dbGAP											0																																										-	-	-			0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254531T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.632	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	17	0.00	0	T	NG_008380		155254531	155254531	+1	no_errors	ENST00000461007	ensembl	human	known	69_37n	rna	7	30.00	3	SNP	0.004	G
YIPF3	25844	genome.wustl.edu	37	6	43483923	43483923	+	Intron	DEL	C	C	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr6:43483923delC	ENST00000372422.2	-	2	264				POLR1C_ENST00000372389.3_5'Flank|POLR1C_ENST00000372344.2_5'Flank|RP3-337H4.9_ENST00000607571.1_RNA|YIPF3_ENST00000506469.1_Intron|POLR1C_ENST00000304004.3_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3						cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			CTTTGTTCTTCCACTGCTGAG	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.82-90G>-	6.37:g.43483923delC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Frame_Shift_Del	DEL	NULL	p.W29fs	ENST00000372422.2	37	c.87	CCDS4899.1	6																																																																																			YIPF3	-	NULL	ENSG00000137207		0.502	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF3	HGNC	protein_coding	OTTHUMT00000040639.2	9	0.00	0	C	NM_015388		43483923	43483923	-1	no_errors	ENST00000490447	ensembl	human	known	69_37n	frame_shift_del	3	40.00	2	DEL	0.002	-
YIPF3	25844	genome.wustl.edu	37	6	43483923	43483923	+	Intron	DEL	C	C	-			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr6:43483923delC	ENST00000372422.2	-	2	264				POLR1C_ENST00000372389.3_5'Flank|POLR1C_ENST00000372344.2_5'Flank|RP3-337H4.9_ENST00000607571.1_RNA|YIPF3_ENST00000506469.1_Intron|POLR1C_ENST00000304004.3_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3						cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			CTTTGTTCTTCCACTGCTGAG	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.82-90G>-	6.37:g.43483923delC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Frame_Shift_Del	DEL	NULL	p.W29fs	ENST00000372422.2	37	c.87	CCDS4899.1	6																																																																																			YIPF3	-	NULL	ENSG00000137207		0.502	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF3	HGNC	protein_coding	OTTHUMT00000040639.2	20	0.00	0	C	NM_015388		43483923	43483923	-1	no_errors	ENST00000490447	ensembl	human	known	69_37n	frame_shift_del	3	40.00	2	DEL	0.002	-
ZDHHC11B	653082	genome.wustl.edu	37	5	766939	766939	+	Silent	SNP	G	G	A	rs4957103	byFrequency	TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr5:766939G>A	ENST00000382776.4	-	1	95	c.96C>T	c.(94-96)aaC>aaT	p.N32N	ZDHHC11_ENST00000424784.2_Intron|ZDHHC11B_ENST00000508859.2_Silent_p.N43N			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	32						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						ACGACCAGCCGTTCACTCTGG	0.597																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.96C>T	5.37:g.766939G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHR3	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.N32	ENST00000382776.4	37	c.96		5																																																																																			ZDHHC11B	-	NULL	ENSG00000206077		0.597	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	HGNC	protein_coding		45	0.00	0	G	XM_926053		766939	766939	-1	no_errors	ENST00000382776	ensembl	human	known	69_37n	silent	54	10.00	6	SNP	0.990	A
ZNF333	84449	genome.wustl.edu	37	19	14817558	14817558	+	Missense_Mutation	SNP	C	C	T	rs199652435		TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr19:14817558C>T	ENST00000292530.6	+	7	575	c.484C>T	c.(484-486)Cgc>Tgc	p.R162C	ZNF333_ENST00000601134.1_Missense_Mutation_p.P102L|ZNF333_ENST00000540689.2_Missense_Mutation_p.R162C|ZNF333_ENST00000536363.1_Missense_Mutation_p.R53C	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						TCTGGGCCACCGCAACCCATG	0.572																																					NSCLC(60;75 1281 16985 25154 29885)	dbGAP											0													87.0	81.0	83.0					19																	14817558		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.484C>T	19.37:g.14817558C>T	ENSP00000292530:p.Arg162Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R162C	ENST00000292530.6	37	c.484	CCDS12316.1	19	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	9.207	1.029931	0.19512	.	.	ENSG00000160961	ENST00000536363;ENST00000540689;ENST00000292530	T;T;T	0.07216	3.21;5.8;3.28	2.29	0.141	0.14811	.	.	.	.	.	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	P	0.43287	0.802	B	0.34346	0.18	T	0.39354	-0.9618	9	0.56958	D	0.05	.	4.5191	0.11950	0.0:0.6677:0.0:0.3323	.	162	Q96JL9	ZN333_HUMAN	C	53;162;162	ENSP00000439749:R53C;ENSP00000438130:R162C;ENSP00000292530:R162C	ENSP00000292530:R162C	R	+	1	0	ZNF333	14678558	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.009000	0.12765	0.118000	0.18165	-0.194000	0.12790	CGC	ZNF333	-	NULL	ENSG00000160961		0.572	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF333	HGNC	protein_coding	OTTHUMT00000466496.1	54	0.00	0	C	NM_032433		14817558	14817558	+1	no_errors	ENST00000292530	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	0.000	T
ZNF333	84449	genome.wustl.edu	37	19	14817558	14817558	+	Missense_Mutation	SNP	C	C	T	rs199652435		TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr19:14817558C>T	ENST00000292530.6	+	7	575	c.484C>T	c.(484-486)Cgc>Tgc	p.R162C	ZNF333_ENST00000601134.1_Missense_Mutation_p.P102L|ZNF333_ENST00000540689.2_Missense_Mutation_p.R162C|ZNF333_ENST00000536363.1_Missense_Mutation_p.R53C	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						TCTGGGCCACCGCAACCCATG	0.572																																					NSCLC(60;75 1281 16985 25154 29885)	dbGAP											0													87.0	81.0	83.0					19																	14817558		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.484C>T	19.37:g.14817558C>T	ENSP00000292530:p.Arg162Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R162C	ENST00000292530.6	37	c.484	CCDS12316.1	19	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	9.207	1.029931	0.19512	.	.	ENSG00000160961	ENST00000536363;ENST00000540689;ENST00000292530	T;T;T	0.07216	3.21;5.8;3.28	2.29	0.141	0.14811	.	.	.	.	.	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	P	0.43287	0.802	B	0.34346	0.18	T	0.39354	-0.9618	9	0.56958	D	0.05	.	4.5191	0.11950	0.0:0.6677:0.0:0.3323	.	162	Q96JL9	ZN333_HUMAN	C	53;162;162	ENSP00000439749:R53C;ENSP00000438130:R162C;ENSP00000292530:R162C	ENSP00000292530:R162C	R	+	1	0	ZNF333	14678558	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.009000	0.12765	0.118000	0.18165	-0.194000	0.12790	CGC	ZNF333	-	NULL	ENSG00000160961		0.572	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF333	HGNC	protein_coding	OTTHUMT00000466496.1	86	0.00	0	C	NM_032433		14817558	14817558	+1	no_errors	ENST00000292530	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	0.000	T
ZNF846	162993	genome.wustl.edu	37	19	9869048	9869048	+	Silent	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr19:9869048G>A	ENST00000397902.2	-	6	1118	c.705C>T	c.(703-705)ttC>ttT	p.F235F	ZNF846_ENST00000586293.1_3'UTR|ZNF846_ENST00000588267.1_Silent_p.F106F|ZNF846_ENST00000592859.1_Silent_p.F106F	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						AGGAATTACTGAAGGCTTTCC	0.393																																						dbGAP											0													103.0	111.0	108.0					19																	9869048		2126	4254	6380	-	-	-	SO:0001819	synonymous_variant	0			AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.705C>T	19.37:g.9869048G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0H1|B3KUP1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F235	ENST00000397902.2	37	c.705	CCDS42496.1	19																																																																																			ZNF846	-	pfam_Znf_C2H2,smart_Znf_BED_prd,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196605		0.393	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF846	HGNC	protein_coding	OTTHUMT00000450253.1	70	0.00	0	G	NM_001077624		9869048	9869048	-1	no_errors	ENST00000397902	ensembl	human	known	69_37n	silent	65	23.53	20	SNP	0.081	A
ZNF846	162993	genome.wustl.edu	37	19	9869048	9869048	+	Silent	SNP	G	G	A			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr19:9869048G>A	ENST00000397902.2	-	6	1118	c.705C>T	c.(703-705)ttC>ttT	p.F235F	ZNF846_ENST00000586293.1_3'UTR|ZNF846_ENST00000588267.1_Silent_p.F106F|ZNF846_ENST00000592859.1_Silent_p.F106F	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						AGGAATTACTGAAGGCTTTCC	0.393																																						dbGAP											0													103.0	111.0	108.0					19																	9869048		2126	4254	6380	-	-	-	SO:0001819	synonymous_variant	0			AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.705C>T	19.37:g.9869048G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0H1|B3KUP1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F235	ENST00000397902.2	37	c.705	CCDS42496.1	19																																																																																			ZNF846	-	pfam_Znf_C2H2,smart_Znf_BED_prd,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196605		0.393	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF846	HGNC	protein_coding	OTTHUMT00000450253.1	122	0.00	0	G	NM_001077624		9869048	9869048	-1	no_errors	ENST00000397902	ensembl	human	known	69_37n	silent	65	23.53	20	SNP	0.081	A
ZNF8	7554	genome.wustl.edu	37	19	58797478	58797478	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr19:58797478C>T	ENST00000196548.5	+	3	327	c.196C>T	c.(196-198)Cct>Tct	p.P66S	ZNF8_ENST00000608843.1_Missense_Mutation_p.P66S|CTD-3138B18.4_ENST00000600029.1_3'UTR|AC010642.1_ENST00000591325.1_3'UTR			P17098	ZNF8_HUMAN	zinc finger protein 8	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		ATTTCCAGGTCCTGAGCTTCC	0.592																																						dbGAP											0													51.0	46.0	48.0					19																	58797478		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.196C>T	19.37:g.58797478C>T	ENSP00000196548:p.Pro66Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PI99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P66S	ENST00000196548.5	37	c.196	CCDS12974.1	19	.	.	.	.	.	.	.	.	.	.	C	11.54	1.667796	0.29604	.	.	ENSG00000083842	ENST00000196548	T	0.00760	5.73	5.0	3.89	0.44902	Krueppel-associated box (3);	0.000000	0.43579	D	0.000551	T	0.01189	0.0039	N	0.03084	-0.415	0.33650	D	0.60832	D	0.89917	1.0	D	0.74674	0.984	T	0.73892	-0.3839	10	0.41790	T	0.15	-2.3463	12.8644	0.57932	0.0:0.8347:0.1653:0.0	.	66	P17098	ZNF8_HUMAN	S	66	ENSP00000196548:P66S	ENSP00000196548:P66S	P	+	1	0	ZNF8	63489290	0.021000	0.18746	1.000000	0.80357	0.265000	0.26407	0.640000	0.24705	2.488000	0.83962	0.561000	0.74099	CCT	ZNF8	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000083842		0.592	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	ZNF8	HGNC	protein_coding	OTTHUMT00000459135.1	88	0.00	0	C	NM_021089		58797478	58797478	+1	no_errors	ENST00000196548	ensembl	human	known	69_37n	missense	74	16.85	15	SNP	0.976	T
ZNF8	7554	genome.wustl.edu	37	19	58797478	58797478	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr19:58797478C>T	ENST00000196548.5	+	3	327	c.196C>T	c.(196-198)Cct>Tct	p.P66S	ZNF8_ENST00000608843.1_Missense_Mutation_p.P66S|CTD-3138B18.4_ENST00000600029.1_3'UTR|AC010642.1_ENST00000591325.1_3'UTR			P17098	ZNF8_HUMAN	zinc finger protein 8	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		ATTTCCAGGTCCTGAGCTTCC	0.592																																						dbGAP											0													51.0	46.0	48.0					19																	58797478		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.196C>T	19.37:g.58797478C>T	ENSP00000196548:p.Pro66Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PI99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P66S	ENST00000196548.5	37	c.196	CCDS12974.1	19	.	.	.	.	.	.	.	.	.	.	C	11.54	1.667796	0.29604	.	.	ENSG00000083842	ENST00000196548	T	0.00760	5.73	5.0	3.89	0.44902	Krueppel-associated box (3);	0.000000	0.43579	D	0.000551	T	0.01189	0.0039	N	0.03084	-0.415	0.33650	D	0.60832	D	0.89917	1.0	D	0.74674	0.984	T	0.73892	-0.3839	10	0.41790	T	0.15	-2.3463	12.8644	0.57932	0.0:0.8347:0.1653:0.0	.	66	P17098	ZNF8_HUMAN	S	66	ENSP00000196548:P66S	ENSP00000196548:P66S	P	+	1	0	ZNF8	63489290	0.021000	0.18746	1.000000	0.80357	0.265000	0.26407	0.640000	0.24705	2.488000	0.83962	0.561000	0.74099	CCT	ZNF8	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000083842		0.592	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	ZNF8	HGNC	protein_coding	OTTHUMT00000459135.1	163	0.00	0	C	NM_021089		58797478	58797478	+1	no_errors	ENST00000196548	ensembl	human	known	69_37n	missense	74	16.85	15	SNP	0.976	T
ZP4	57829	genome.wustl.edu	37	1	238048465	238048465	+	Splice_Site	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	548fcaa0-101b-4c84-b65e-1bec3a6a4354	g.chr1:238048465C>T	ENST00000366570.4	-	9	1469	c.1311G>A	c.(1309-1311)ccG>ccA	p.P437P	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	437	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AACATCCTACCGGTCCCCTGA	0.522																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											0													77.0	82.0	80.0					1																	238048465		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1311+1G>A	1.37:g.238048465C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAE1	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.P437	ENST00000366570.4	37	c.1311	CCDS1615.1	1																																																																																			ZP4	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	ENSG00000116996		0.522	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	32	0.00	0	C		Silent	238048465	238048465	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	silent	42	16.00	8	SNP	0.901	T
ZP4	57829	genome.wustl.edu	37	1	238048465	238048465	+	Splice_Site	SNP	C	C	T			TCGA-A7-A4SC-01A-12D-A25Q-09	TCGA-A7-A4SC-11A-52D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c40d9be5-f017-4344-b3da-05330706ccfb	53bc33db-9b12-467b-aa69-b594ce0debee	g.chr1:238048465C>T	ENST00000366570.4	-	9	1469	c.1311G>A	c.(1309-1311)ccG>ccA	p.P437P	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	437	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AACATCCTACCGGTCCCCTGA	0.522																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											0													77.0	82.0	80.0					1																	238048465		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1311+1G>A	1.37:g.238048465C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAE1	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.P437	ENST00000366570.4	37	c.1311	CCDS1615.1	1																																																																																			ZP4	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	ENSG00000116996		0.522	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	55	0.00	0	C		Silent	238048465	238048465	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	silent	42	16.00	8	SNP	0.901	T
