#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA6	23460	genome.wustl.edu	37	17	67125767	67125767	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:67125767delA	ENST00000284425.2	-	7	1091	c.917delT	c.(916-918)ttafs	p.L306fs		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	306					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TAAGCCATATAAAAAAAAGAG	0.308																																						dbGAP											0													75.0	81.0	79.0					17																	67125767		2202	4295	6497	-	-	-	SO:0001589	frameshift_variant	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.917delT	17.37:g.67125767delA	ENSP00000284425:p.Leu306fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSH9|Q8N856|Q8WWZ6	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L306fs	ENST00000284425.2	37	c.917	CCDS11683.1	17																																																																																			ABCA6	-	NULL	ENSG00000154262		0.308	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	12	0.00	0	A	NM_080284		67125767	67125767	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000	-
ABCA6	23460	genome.wustl.edu	37	17	67125767	67125767	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:67125767delA	ENST00000284425.2	-	7	1091	c.917delT	c.(916-918)ttafs	p.L306fs		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	306					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TAAGCCATATAAAAAAAAGAG	0.308																																						dbGAP											0													75.0	81.0	79.0					17																	67125767		2202	4295	6497	-	-	-	SO:0001589	frameshift_variant	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.917delT	17.37:g.67125767delA	ENSP00000284425:p.Leu306fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSH9|Q8N856|Q8WWZ6	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L306fs	ENST00000284425.2	37	c.917	CCDS11683.1	17																																																																																			ABCA6	-	NULL	ENSG00000154262		0.308	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	35	0.00	0	A	NM_080284		67125767	67125767	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000	-
ABCB10	23456	genome.wustl.edu	37	1	229676430	229676430	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:229676430T>C	ENST00000344517.4	-	5	1168	c.1126A>G	c.(1126-1128)Aaa>Gaa	p.K376E		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	376	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CTGGCATATTTCTCGATTTCA	0.418																																						dbGAP											0													112.0	104.0	107.0					1																	229676430		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1126A>G	1.37:g.229676430T>C	ENSP00000355637:p.Lys376Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.K376E	ENST00000344517.4	37	c.1126	CCDS1580.1	1	.	.	.	.	.	.	.	.	.	.	T	10.18	1.279723	0.23392	.	.	ENSG00000135776	ENST00000344517	D	0.90504	-2.68	5.27	5.27	0.74061	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.241697	0.47852	D	0.000204	D	0.85146	0.5630	N	0.25992	0.78	0.49213	D	0.999767	B	0.16396	0.017	B	0.18561	0.022	T	0.80966	-0.1146	10	0.38643	T	0.18	-15.1391	15.4864	0.75571	0.0:0.0:0.0:1.0	.	376	Q9NRK6	ABCBA_HUMAN	E	376	ENSP00000355637:K376E	ENSP00000355637:K376E	K	-	1	0	ABCB10	227743053	0.998000	0.40836	0.566000	0.28421	0.007000	0.05969	4.753000	0.62183	2.106000	0.64143	0.482000	0.46254	AAA	ABCB10	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000135776		0.418	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	HGNC	protein_coding	OTTHUMT00000095240.1	59	0.00	0	T	NM_012089		229676430	229676430	-1	no_errors	ENST00000344517	ensembl	human	known	69_37n	missense	96	17.95	21	SNP	1.000	C
ABCB10	23456	genome.wustl.edu	37	1	229676430	229676430	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:229676430T>C	ENST00000344517.4	-	5	1168	c.1126A>G	c.(1126-1128)Aaa>Gaa	p.K376E		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	376	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CTGGCATATTTCTCGATTTCA	0.418																																						dbGAP											0													112.0	104.0	107.0					1																	229676430		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1126A>G	1.37:g.229676430T>C	ENSP00000355637:p.Lys376Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.K376E	ENST00000344517.4	37	c.1126	CCDS1580.1	1	.	.	.	.	.	.	.	.	.	.	T	10.18	1.279723	0.23392	.	.	ENSG00000135776	ENST00000344517	D	0.90504	-2.68	5.27	5.27	0.74061	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.241697	0.47852	D	0.000204	D	0.85146	0.5630	N	0.25992	0.78	0.49213	D	0.999767	B	0.16396	0.017	B	0.18561	0.022	T	0.80966	-0.1146	10	0.38643	T	0.18	-15.1391	15.4864	0.75571	0.0:0.0:0.0:1.0	.	376	Q9NRK6	ABCBA_HUMAN	E	376	ENSP00000355637:K376E	ENSP00000355637:K376E	K	-	1	0	ABCB10	227743053	0.998000	0.40836	0.566000	0.28421	0.007000	0.05969	4.753000	0.62183	2.106000	0.64143	0.482000	0.46254	AAA	ABCB10	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000135776		0.418	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	HGNC	protein_coding	OTTHUMT00000095240.1	115	0.00	0	T	NM_012089		229676430	229676430	-1	no_errors	ENST00000344517	ensembl	human	known	69_37n	missense	96	17.95	21	SNP	1.000	C
ACTR1B	10120	genome.wustl.edu	37	2	98274896	98274896	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:98274896G>C	ENST00000289228.5	-	6	867	c.651C>G	c.(649-651)atC>atG	p.I217M		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	217					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						TCACCTCTTTGATTGTCCGGA	0.612																																						dbGAP											0													85.0	87.0	86.0					2																	98274896		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.651C>G	2.37:g.98274896G>C	ENSP00000289228:p.Ile217Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVH2|Q53SK5|Q9BRB7	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.I217M	ENST00000289228.5	37	c.651	CCDS2033.1	2	.	.	.	.	.	.	.	.	.	.	.	14.82	2.650787	0.47362	.	.	ENSG00000115073	ENST00000289228	T	0.11169	2.8	5.45	3.59	0.41128	.	0.057698	0.64402	D	0.000002	T	0.17365	0.0417	L	0.60845	1.875	0.58432	D	0.999997	B	0.16802	0.019	B	0.39299	0.296	T	0.05241	-1.0897	10	0.87932	D	0	.	8.7648	0.34696	0.0805:0.0:0.7708:0.1487	.	217	P42025	ACTY_HUMAN	M	217	ENSP00000289228:I217M	ENSP00000289228:I217M	I	-	3	3	ACTR1B	97641328	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.220000	0.42908	1.308000	0.44962	-0.137000	0.14449	ATC	ACTR1B	-	pfam_Actin-like,smart_Actin-like	ENSG00000115073		0.612	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR1B	HGNC	protein_coding	OTTHUMT00000252973.1	61	0.00	0	G	NM_005735		98274896	98274896	-1	no_errors	ENST00000289228	ensembl	human	known	69_37n	missense	89	17.59	19	SNP	1.000	C
ACTR1B	10120	genome.wustl.edu	37	2	98274896	98274896	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:98274896G>C	ENST00000289228.5	-	6	867	c.651C>G	c.(649-651)atC>atG	p.I217M		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	217					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						TCACCTCTTTGATTGTCCGGA	0.612																																						dbGAP											0													85.0	87.0	86.0					2																	98274896		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.651C>G	2.37:g.98274896G>C	ENSP00000289228:p.Ile217Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVH2|Q53SK5|Q9BRB7	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.I217M	ENST00000289228.5	37	c.651	CCDS2033.1	2	.	.	.	.	.	.	.	.	.	.	.	14.82	2.650787	0.47362	.	.	ENSG00000115073	ENST00000289228	T	0.11169	2.8	5.45	3.59	0.41128	.	0.057698	0.64402	D	0.000002	T	0.17365	0.0417	L	0.60845	1.875	0.58432	D	0.999997	B	0.16802	0.019	B	0.39299	0.296	T	0.05241	-1.0897	10	0.87932	D	0	.	8.7648	0.34696	0.0805:0.0:0.7708:0.1487	.	217	P42025	ACTY_HUMAN	M	217	ENSP00000289228:I217M	ENSP00000289228:I217M	I	-	3	3	ACTR1B	97641328	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.220000	0.42908	1.308000	0.44962	-0.137000	0.14449	ATC	ACTR1B	-	pfam_Actin-like,smart_Actin-like	ENSG00000115073		0.612	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR1B	HGNC	protein_coding	OTTHUMT00000252973.1	100	0.00	0	G	NM_005735		98274896	98274896	-1	no_errors	ENST00000289228	ensembl	human	known	69_37n	missense	89	17.59	19	SNP	1.000	C
ADAM5	255926	genome.wustl.edu	37	8	39250888	39250888	+	RNA	SNP	A	A	G	rs12544471	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr8:39250888A>G	ENST00000505455.1	+	0	1602							Q6NVV9	ADAM5_HUMAN	ADAM metallopeptidase domain 5, pseudogene								metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)										GATGATGGACACTTAGTACCA	0.348													A|||	2650	0.529153	0.3578	0.5245	5008	,	,		9699	0.4514		0.6869	False		,,,				2504	0.682					dbGAP											0																																										-	-	-			0			BC047448		8p11.23	2012-08-22	2010-03-12	2012-08-22	ENSG00000196115	ENSG00000196115		"""ADAM metallopeptidase domain containing"""	212	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 5"""	ADAM5P		8786143, 10417343	Standard	NR_001448		Approved	tMDCII	uc003xnb.3	Q6NVV9	OTTHUMG00000154982		8.37:g.39250888A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MW71|Q4G196	RNA	SNP	-	NULL	ENST00000505455.1	37	NULL		8																																																																																			ADAM5	-	-	ENSG00000196115		0.348	ADAM5-006	KNOWN	basic	processed_transcript	ADAM5	HGNC	pseudogene	OTTHUMT00000337882.1	25	0.00	0	A	NR_001448		39250888	39250888	+1	no_errors	ENST00000359790	ensembl	human	known	69_37n	rna	22	15.38	4	SNP	0.185	G
AGBL1	123624	genome.wustl.edu	37	15	86791010	86791010	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr15:86791010G>C	ENST00000441037.2	+	6	592	c.497G>C	c.(496-498)cGg>cCg	p.R166P	AGBL1_ENST00000421325.2_Missense_Mutation_p.R166P	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	166					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CAGATCCGACGGGGCTTGCTG	0.652																																						dbGAP											0													41.0	43.0	42.0					15																	86791010		2151	4258	6409	-	-	-	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.497G>C	15.37:g.86791010G>C	ENSP00000413001:p.Arg166Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.R166P	ENST00000441037.2	37	c.497	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405908	0.42715	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.49139	0.79	5.16	2.25	0.28309	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.50973	0.1647	L	0.50333	1.59	0.53005	D	0.999964	D	0.59767	0.986	P	0.55112	0.769	T	0.48019	-0.9071	9	0.87932	D	0	-5.232	7.7207	0.28731	0.2658:0.0:0.7342:0.0	.	166	Q96MI9	CBPC4_HUMAN	P	195;166	ENSP00000397173:R166P	ENSP00000397173:R166P	R	+	2	0	AGBL1	84592014	0.996000	0.38824	0.761000	0.31378	0.165000	0.22458	2.111000	0.41883	0.189000	0.20188	-0.224000	0.12420	CGG	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.652	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	62	0.00	0	G	NM_152336		86791010	86791010	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	0.809	C
AGBL1	123624	genome.wustl.edu	37	15	86791010	86791010	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr15:86791010G>C	ENST00000441037.2	+	6	592	c.497G>C	c.(496-498)cGg>cCg	p.R166P	AGBL1_ENST00000421325.2_Missense_Mutation_p.R166P	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	166					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CAGATCCGACGGGGCTTGCTG	0.652																																						dbGAP											0													41.0	43.0	42.0					15																	86791010		2151	4258	6409	-	-	-	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.497G>C	15.37:g.86791010G>C	ENSP00000413001:p.Arg166Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.R166P	ENST00000441037.2	37	c.497	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405908	0.42715	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.49139	0.79	5.16	2.25	0.28309	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.50973	0.1647	L	0.50333	1.59	0.53005	D	0.999964	D	0.59767	0.986	P	0.55112	0.769	T	0.48019	-0.9071	9	0.87932	D	0	-5.232	7.7207	0.28731	0.2658:0.0:0.7342:0.0	.	166	Q96MI9	CBPC4_HUMAN	P	195;166	ENSP00000397173:R166P	ENSP00000397173:R166P	R	+	2	0	AGBL1	84592014	0.996000	0.38824	0.761000	0.31378	0.165000	0.22458	2.111000	0.41883	0.189000	0.20188	-0.224000	0.12420	CGG	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.652	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	74	0.00	0	G	NM_152336		86791010	86791010	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	0.809	C
ALDH8A1	64577	genome.wustl.edu	37	6	135271075	135271075	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr6:135271075C>T	ENST00000265605.2	-	1	185	c.117G>A	c.(115-117)gtG>gtA	p.V39V	ALDH8A1_ENST00000367847.2_Silent_p.V39V|ALDH8A1_ENST00000367845.2_Silent_p.V39V	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	39					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CACTATTTGGCACTCTGCAAT	0.363																																						dbGAP											0													142.0	130.0	134.0					6																	135271075		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.117G>A	6.37:g.135271075C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Silent	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.V39	ENST00000265605.2	37	c.117	CCDS5171.1	6																																																																																			ALDH8A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000118514		0.363	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH8A1	HGNC	protein_coding	OTTHUMT00000042334.2	32	0.00	0	C			135271075	135271075	-1	no_errors	ENST00000265605	ensembl	human	known	69_37n	silent	69	24.18	22	SNP	0.140	T
ALDH8A1	64577	genome.wustl.edu	37	6	135271075	135271075	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:135271075C>T	ENST00000265605.2	-	1	185	c.117G>A	c.(115-117)gtG>gtA	p.V39V	ALDH8A1_ENST00000367847.2_Silent_p.V39V|ALDH8A1_ENST00000367845.2_Silent_p.V39V	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	39					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CACTATTTGGCACTCTGCAAT	0.363																																						dbGAP											0													142.0	130.0	134.0					6																	135271075		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.117G>A	6.37:g.135271075C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Silent	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.V39	ENST00000265605.2	37	c.117	CCDS5171.1	6																																																																																			ALDH8A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000118514		0.363	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH8A1	HGNC	protein_coding	OTTHUMT00000042334.2	69	0.00	0	C			135271075	135271075	-1	no_errors	ENST00000265605	ensembl	human	known	69_37n	silent	69	24.18	22	SNP	0.140	T
ALPK3	57538	genome.wustl.edu	37	15	85402487	85402487	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr15:85402487C>G	ENST00000258888.5	+	7	4604	c.4437C>G	c.(4435-4437)atC>atG	p.I1479M		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1479	Ig-like 2.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CACAGGTGATCCGGAAGATTC	0.557																																						dbGAP											0													71.0	62.0	65.0					15																	85402487		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4437C>G	15.37:g.85402487C>G	ENSP00000258888:p.Ile1479Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.I1479M	ENST00000258888.5	37	c.4437	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231416	0.58777	.	.	ENSG00000136383	ENST00000258888	T	0.50001	0.76	5.35	0.161	0.14977	Immunoglobulin-like (1);	0.061993	0.64402	D	0.000008	T	0.56062	0.1960	L	0.59436	1.845	0.37126	D	0.901043	D	0.76494	0.999	D	0.80764	0.994	T	0.58239	-0.7671	10	0.72032	D	0.01	-21.2358	5.1826	0.15167	0.133:0.4729:0.0:0.3941	.	1479	Q96L96	ALPK3_HUMAN	M	1479	ENSP00000258888:I1479M	ENSP00000258888:I1479M	I	+	3	3	ALPK3	83203491	0.089000	0.21612	0.997000	0.53966	0.993000	0.82548	-0.564000	0.05936	0.073000	0.16731	0.655000	0.94253	ATC	ALPK3	-	pfscan_Ig-like	ENSG00000136383		0.557	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	65	0.00	0	C	NM_020778		85402487	85402487	+1	no_errors	ENST00000258888	ensembl	human	known	69_37n	missense	45	57.41	62	SNP	0.931	G
ALPK3	57538	genome.wustl.edu	37	15	85402487	85402487	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr15:85402487C>G	ENST00000258888.5	+	7	4604	c.4437C>G	c.(4435-4437)atC>atG	p.I1479M		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1479	Ig-like 2.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CACAGGTGATCCGGAAGATTC	0.557																																						dbGAP											0													71.0	62.0	65.0					15																	85402487		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4437C>G	15.37:g.85402487C>G	ENSP00000258888:p.Ile1479Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.I1479M	ENST00000258888.5	37	c.4437	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231416	0.58777	.	.	ENSG00000136383	ENST00000258888	T	0.50001	0.76	5.35	0.161	0.14977	Immunoglobulin-like (1);	0.061993	0.64402	D	0.000008	T	0.56062	0.1960	L	0.59436	1.845	0.37126	D	0.901043	D	0.76494	0.999	D	0.80764	0.994	T	0.58239	-0.7671	10	0.72032	D	0.01	-21.2358	5.1826	0.15167	0.133:0.4729:0.0:0.3941	.	1479	Q96L96	ALPK3_HUMAN	M	1479	ENSP00000258888:I1479M	ENSP00000258888:I1479M	I	+	3	3	ALPK3	83203491	0.089000	0.21612	0.997000	0.53966	0.993000	0.82548	-0.564000	0.05936	0.073000	0.16731	0.655000	0.94253	ATC	ALPK3	-	pfscan_Ig-like	ENSG00000136383		0.557	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	107	0.00	0	C	NM_020778		85402487	85402487	+1	no_errors	ENST00000258888	ensembl	human	known	69_37n	missense	45	57.41	62	SNP	0.931	G
APOA1	335	genome.wustl.edu	37	11	116708076	116708076	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr11:116708076C>T	ENST00000236850.4	-	2	393	c.28G>A	c.(28-30)Gtg>Atg	p.V10M	APOA1_ENST00000375329.2_Missense_Mutation_p.R40H|APOA1_ENST00000359492.2_Missense_Mutation_p.V10M|AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000375323.1_Missense_Mutation_p.V10M|APOA1_ENST00000375320.1_Missense_Mutation_p.V10M	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	10					adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		AGGAAGAGCACGGCCAAGGTC	0.642																																						dbGAP											0													32.0	30.0	31.0					11																	116708076		2182	4277	6459	-	-	-	SO:0001583	missense	0			X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.28G>A	11.37:g.116708076C>T	ENSP00000236850:p.Val10Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	pfam_ApoA1_A4_E	p.V10M	ENST00000236850.4	37	c.28	CCDS8378.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.31|14.31	2.496266|2.496266	0.44352|0.44352	.|.	.|.	ENSG00000118137|ENSG00000118137	ENST00000375329|ENST00000375320;ENST00000359492;ENST00000375323;ENST00000236850	T|T;T;T;T	0.69806|0.69926	-0.43|-0.44;-0.44;-0.44;-0.44	4.89|4.89	0.0977|0.0977	0.14495|0.14495	.|.	.|0.468665	.|0.14467	.|U	.|0.317824	T|T	0.63838|0.63838	0.2545|0.2545	M|M	0.81682|0.81682	2.555|2.555	0.25055|0.25055	N|N	0.991106|0.991106	.|B	.|0.23185	.|0.081	.|B	.|0.17098	.|0.017	T|T	0.59461|0.59461	-0.7450|-0.7450	7|10	0.72032|0.62326	D|D	0.01|0.03	-16.9666|-16.9666	8.3276|8.3276	0.32167|0.32167	0.0:0.3865:0.4461:0.1673|0.0:0.3865:0.4461:0.1673	.|.	.|10	.|P02647	.|APOA1_HUMAN	H|M	40|10	ENSP00000364478:R40H|ENSP00000364469:V10M;ENSP00000352471:V10M;ENSP00000364472:V10M;ENSP00000236850:V10M	ENSP00000364478:R40H|ENSP00000236850:V10M	R|V	-|-	2|1	0|0	APOA1|APOA1	116213286|116213286	0.709000|0.709000	0.27886|0.27886	0.960000|0.960000	0.40013|0.40013	0.765000|0.765000	0.43378|0.43378	0.342000|0.342000	0.19926|0.19926	0.089000|0.089000	0.17243|0.17243	-0.254000|-0.254000	0.11334|0.11334	CGT|GTG	APOA1	-	NULL	ENSG00000118137		0.642	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA1	HGNC	protein_coding	OTTHUMT00000106281.2	54	0.00	0	C	NM_000039		116708076	116708076	-1	no_errors	ENST00000236850	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.934	T
APOA1	335	genome.wustl.edu	37	11	116708076	116708076	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr11:116708076C>T	ENST00000236850.4	-	2	393	c.28G>A	c.(28-30)Gtg>Atg	p.V10M	APOA1_ENST00000375329.2_Missense_Mutation_p.R40H|APOA1_ENST00000359492.2_Missense_Mutation_p.V10M|AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000375323.1_Missense_Mutation_p.V10M|APOA1_ENST00000375320.1_Missense_Mutation_p.V10M	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	10					adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		AGGAAGAGCACGGCCAAGGTC	0.642																																						dbGAP											0													32.0	30.0	31.0					11																	116708076		2182	4277	6459	-	-	-	SO:0001583	missense	0			X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.28G>A	11.37:g.116708076C>T	ENSP00000236850:p.Val10Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	pfam_ApoA1_A4_E	p.V10M	ENST00000236850.4	37	c.28	CCDS8378.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.31|14.31	2.496266|2.496266	0.44352|0.44352	.|.	.|.	ENSG00000118137|ENSG00000118137	ENST00000375329|ENST00000375320;ENST00000359492;ENST00000375323;ENST00000236850	T|T;T;T;T	0.69806|0.69926	-0.43|-0.44;-0.44;-0.44;-0.44	4.89|4.89	0.0977|0.0977	0.14495|0.14495	.|.	.|0.468665	.|0.14467	.|U	.|0.317824	T|T	0.63838|0.63838	0.2545|0.2545	M|M	0.81682|0.81682	2.555|2.555	0.25055|0.25055	N|N	0.991106|0.991106	.|B	.|0.23185	.|0.081	.|B	.|0.17098	.|0.017	T|T	0.59461|0.59461	-0.7450|-0.7450	7|10	0.72032|0.62326	D|D	0.01|0.03	-16.9666|-16.9666	8.3276|8.3276	0.32167|0.32167	0.0:0.3865:0.4461:0.1673|0.0:0.3865:0.4461:0.1673	.|.	.|10	.|P02647	.|APOA1_HUMAN	H|M	40|10	ENSP00000364478:R40H|ENSP00000364469:V10M;ENSP00000352471:V10M;ENSP00000364472:V10M;ENSP00000236850:V10M	ENSP00000364478:R40H|ENSP00000236850:V10M	R|V	-|-	2|1	0|0	APOA1|APOA1	116213286|116213286	0.709000|0.709000	0.27886|0.27886	0.960000|0.960000	0.40013|0.40013	0.765000|0.765000	0.43378|0.43378	0.342000|0.342000	0.19926|0.19926	0.089000|0.089000	0.17243|0.17243	-0.254000|-0.254000	0.11334|0.11334	CGT|GTG	APOA1	-	NULL	ENSG00000118137		0.642	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA1	HGNC	protein_coding	OTTHUMT00000106281.2	92	0.00	0	C	NM_000039		116708076	116708076	-1	no_errors	ENST00000236850	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.934	T
ARHGAP5	394	genome.wustl.edu	37	14	32561632	32561632	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr14:32561632T>A	ENST00000345122.3	+	2	2072	c.1757T>A	c.(1756-1758)tTa>tAa	p.L586*	ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.L586*|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.L586*|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.L586*|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	586					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CGCTTAAGATTATATCACGAT	0.368																																					NSCLC(9;77 350 3443 29227 41353)	dbGAP											0													70.0	69.0	69.0					14																	32561632		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1757T>A	14.37:g.32561632T>A	ENSP00000371897:p.Leu586*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.L586*	ENST00000345122.3	37	c.1757	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	T	38	7.198435	0.98129	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	.	.	.	5.72	5.72	0.89469	.	0.132739	0.50627	D	0.000119	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	16.3035	0.82836	0.0:0.0:0.0:1.0	.	.	.	.	X	586	.	ENSP00000371897:L586X	L	+	2	0	ARHGAP5	31631383	1.000000	0.71417	0.998000	0.56505	0.686000	0.39977	6.127000	0.71642	2.299000	0.77371	0.528000	0.53228	TTA	ARHGAP5	-	NULL	ENSG00000100852		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	27	0.00	0	T	NM_001030055		32561632	32561632	+1	no_errors	ENST00000345122	ensembl	human	known	69_37n	nonsense	16	48.39	15	SNP	0.986	A
ARHGAP5	394	genome.wustl.edu	37	14	32561632	32561632	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr14:32561632T>A	ENST00000345122.3	+	2	2072	c.1757T>A	c.(1756-1758)tTa>tAa	p.L586*	ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.L586*|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.L586*|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.L586*|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	586					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CGCTTAAGATTATATCACGAT	0.368																																					NSCLC(9;77 350 3443 29227 41353)	dbGAP											0													70.0	69.0	69.0					14																	32561632		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1757T>A	14.37:g.32561632T>A	ENSP00000371897:p.Leu586*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.L586*	ENST00000345122.3	37	c.1757	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	T	38	7.198435	0.98129	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	.	.	.	5.72	5.72	0.89469	.	0.132739	0.50627	D	0.000119	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	16.3035	0.82836	0.0:0.0:0.0:1.0	.	.	.	.	X	586	.	ENSP00000371897:L586X	L	+	2	0	ARHGAP5	31631383	1.000000	0.71417	0.998000	0.56505	0.686000	0.39977	6.127000	0.71642	2.299000	0.77371	0.528000	0.53228	TTA	ARHGAP5	-	NULL	ENSG00000100852		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	52	0.00	0	T	NM_001030055		32561632	32561632	+1	no_errors	ENST00000345122	ensembl	human	known	69_37n	nonsense	16	48.39	15	SNP	0.986	A
ARHGAP5	394	genome.wustl.edu	37	14	32562165	32562165	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr14:32562165G>C	ENST00000345122.3	+	2	2605	c.2290G>C	c.(2290-2292)Gtg>Ctg	p.V764L	ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V764L|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V764L|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V764L|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	764					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTTGGATGTGGTGAGCCCAAT	0.403																																					NSCLC(9;77 350 3443 29227 41353)	dbGAP											0													117.0	110.0	113.0					14																	32562165		2203	4300	6503	-	-	-	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.2290G>C	14.37:g.32562165G>C	ENSP00000371897:p.Val764Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.V764L	ENST00000345122.3	37	c.2290	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	1.201	-0.632502	0.03584	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.5	4.57	0.56435	.	0.282534	0.39909	N	0.001238	T	0.12817	0.0311	N	0.01352	-0.895	0.36103	D	0.844298	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.002	T	0.16808	-1.0390	10	0.06757	T	0.87	.	13.6496	0.62304	0.0792:0.0:0.9208:0.0	.	764;764	Q13017-2;Q13017	.;RHG05_HUMAN	L	764	ENSP00000452222:V764L;ENSP00000441692:V764L;ENSP00000371897:V764L;ENSP00000393307:V764L	ENSP00000371897:V764L	V	+	1	0	ARHGAP5	31631916	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	3.493000	0.53266	1.355000	0.45865	-0.355000	0.07637	GTG	ARHGAP5	-	NULL	ENSG00000100852		0.403	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	22	0.00	0	G	NM_001030055		32562165	32562165	+1	no_errors	ENST00000345122	ensembl	human	known	69_37n	missense	11	63.33	19	SNP	1.000	C
ARHGAP5	394	genome.wustl.edu	37	14	32562165	32562165	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr14:32562165G>C	ENST00000345122.3	+	2	2605	c.2290G>C	c.(2290-2292)Gtg>Ctg	p.V764L	ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V764L|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V764L|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V764L|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	764					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTTGGATGTGGTGAGCCCAAT	0.403																																					NSCLC(9;77 350 3443 29227 41353)	dbGAP											0													117.0	110.0	113.0					14																	32562165		2203	4300	6503	-	-	-	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.2290G>C	14.37:g.32562165G>C	ENSP00000371897:p.Val764Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.V764L	ENST00000345122.3	37	c.2290	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	1.201	-0.632502	0.03584	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.5	4.57	0.56435	.	0.282534	0.39909	N	0.001238	T	0.12817	0.0311	N	0.01352	-0.895	0.36103	D	0.844298	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.002	T	0.16808	-1.0390	10	0.06757	T	0.87	.	13.6496	0.62304	0.0792:0.0:0.9208:0.0	.	764;764	Q13017-2;Q13017	.;RHG05_HUMAN	L	764	ENSP00000452222:V764L;ENSP00000441692:V764L;ENSP00000371897:V764L;ENSP00000393307:V764L	ENSP00000371897:V764L	V	+	1	0	ARHGAP5	31631916	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	3.493000	0.53266	1.355000	0.45865	-0.355000	0.07637	GTG	ARHGAP5	-	NULL	ENSG00000100852		0.403	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	65	0.00	0	G	NM_001030055		32562165	32562165	+1	no_errors	ENST00000345122	ensembl	human	known	69_37n	missense	11	63.33	19	SNP	1.000	C
ARMCX4	100131755	genome.wustl.edu	37	X	100750171	100750171	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chrX:100750171G>C	ENST00000423738.3	+	2	6797	c.6595G>C	c.(6595-6597)Gac>Cac	p.D2199H		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	0						integral component of membrane (GO:0016021)				lung(1)	1						TATGACAAAAGACTTGCTCAT	0.333																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.6595G>C	X.37:g.100750171G>C	ENSP00000404304:p.Asp2199His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.D2199H	ENST00000423738.3	37	c.6595	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	5.812	0.334131	0.11013	.	.	ENSG00000196440	ENST00000423738	.	.	.	3.55	3.55	0.40652	.	.	.	.	.	T	0.37571	0.1008	.	.	.	0.25731	N	0.985263	.	.	.	.	.	.	T	0.18555	-1.0333	4	.	.	.	.	9.6554	0.39923	0.0:0.0:1.0:0.0	.	.	.	.	H	2303	.	.	D	+	1	0	ARMCX4	100636827	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.030000	0.49720	2.023000	0.59567	0.384000	0.25694	GAC	ARMCX4	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000196440		0.333	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	28	0.00	0	G	NM_001256155		100750171	100750171	+1	no_errors	ENST00000423738	ensembl	human	putative	69_37n	missense	46	31.34	21	SNP	1.000	C
ARMCX4	100131755	genome.wustl.edu	37	X	100750171	100750171	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chrX:100750171G>C	ENST00000423738.3	+	2	6797	c.6595G>C	c.(6595-6597)Gac>Cac	p.D2199H		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	0						integral component of membrane (GO:0016021)				lung(1)	1						TATGACAAAAGACTTGCTCAT	0.333																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.6595G>C	X.37:g.100750171G>C	ENSP00000404304:p.Asp2199His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.D2199H	ENST00000423738.3	37	c.6595	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	5.812	0.334131	0.11013	.	.	ENSG00000196440	ENST00000423738	.	.	.	3.55	3.55	0.40652	.	.	.	.	.	T	0.37571	0.1008	.	.	.	0.25731	N	0.985263	.	.	.	.	.	.	T	0.18555	-1.0333	4	.	.	.	.	9.6554	0.39923	0.0:0.0:1.0:0.0	.	.	.	.	H	2303	.	.	D	+	1	0	ARMCX4	100636827	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.030000	0.49720	2.023000	0.59567	0.384000	0.25694	GAC	ARMCX4	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000196440		0.333	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	56	0.00	0	G	NM_001256155		100750171	100750171	+1	no_errors	ENST00000423738	ensembl	human	putative	69_37n	missense	46	31.34	21	SNP	1.000	C
BAZ2B	29994	genome.wustl.edu	37	2	160318652	160318652	+	Intron	SNP	A	A	C	rs56806726	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:160318652A>C	ENST00000392783.2	-	4	641				BAZ2B_ENST00000483316.1_5'UTR|BAZ2B_ENST00000392782.1_Intron|BAZ2B_ENST00000343439.5_Intron|BAZ2B_ENST00000355831.2_Intron	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CTCTCTCTCCAACATTAAATG	0.328													A|||	335	0.066893	0.1316	0.049	5008	,	,		20085	0.002		0.0507	False		,,,				2504	0.0757					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.146-8340T>G	2.37:g.160318652A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	RNA	SNP	-	NULL	ENST00000392783.2	37	NULL	CCDS2209.2	2																																																																																			BAZ2B	-	-	ENSG00000123636		0.328	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	8	0.00	0	A			160318652	160318652	-1	no_errors	ENST00000483316	ensembl	human	known	69_37n	rna	6	57.14	8	SNP	0.037	C
BOD1L1	259282	genome.wustl.edu	37	4	13605527	13605527	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr4:13605527C>T	ENST00000040738.5	-	10	3132	c.2997G>A	c.(2995-2997)gaG>gaA	p.E999E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	999	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										TCTTATATTTCTCCTTTGCTA	0.393																																						dbGAP											0													218.0	231.0	226.0					4																	13605527		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2997G>A	4.37:g.13605527C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	NULL	p.E999	ENST00000040738.5	37	c.2997	CCDS3411.2	4																																																																																			BOD1L1	-	NULL	ENSG00000038219		0.393	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	57	0.00	0	C	NM_148894		13605527	13605527	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	silent	105	18.60	24	SNP	1.000	T
BOD1L1	259282	genome.wustl.edu	37	4	13605527	13605527	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr4:13605527C>T	ENST00000040738.5	-	10	3132	c.2997G>A	c.(2995-2997)gaG>gaA	p.E999E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	999	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										TCTTATATTTCTCCTTTGCTA	0.393																																						dbGAP											0													218.0	231.0	226.0					4																	13605527		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2997G>A	4.37:g.13605527C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	NULL	p.E999	ENST00000040738.5	37	c.2997	CCDS3411.2	4																																																																																			BOD1L1	-	NULL	ENSG00000038219		0.393	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	160	0.00	0	C	NM_148894		13605527	13605527	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	silent	105	18.60	24	SNP	1.000	T
BPTF	2186	genome.wustl.edu	37	17	65908221	65908221	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:65908221A>G	ENST00000321892.4	+	13	4660	c.4599A>G	c.(4597-4599)atA>atG	p.I1533M	BPTF_ENST00000424123.3_Missense_Mutation_p.I1394M|BPTF_ENST00000335221.5_Missense_Mutation_p.I1533M|BPTF_ENST00000306378.6_Missense_Mutation_p.I1407M			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1533					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CATTTCAAATAAATGGAAAAG	0.294																																						dbGAP											0													44.0	50.0	48.0					17																	65908221		2190	4290	6480	-	-	-	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.4599A>G	17.37:g.65908221A>G	ENSP00000315454:p.Ile1533Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.I1533M	ENST00000321892.4	37	c.4599		17	.	.	.	.	.	.	.	.	.	.	A	9.704	1.155199	0.21371	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.67345	-0.26;-0.24;-0.24	5.6	1.84	0.25277	.	.	.	.	.	T	0.45175	0.1329	N	0.19112	0.55	0.27419	N	0.954346	P;P	0.42518	0.627;0.782	B;B	0.39258	0.295;0.28	T	0.44112	-0.9349	9	0.72032	D	0.01	-8.8472	1.6429	0.02756	0.3163:0.3518:0.0924:0.2395	.	1407;1533	Q12830-2;Q12830-4	.;.	M	1407;1533;1533	ENSP00000307208:I1407M;ENSP00000334351:I1533M;ENSP00000315454:I1533M	ENSP00000307208:I1407M	I	+	3	3	BPTF	63338683	0.916000	0.31088	1.000000	0.80357	0.912000	0.54170	-0.071000	0.11505	0.368000	0.24481	0.528000	0.53228	ATA	BPTF	-	NULL	ENSG00000171634		0.294	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		30	0.00	0	A	NM_182641, NM_004459		65908221	65908221	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.997	G
BPTF	2186	genome.wustl.edu	37	17	65908221	65908221	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:65908221A>G	ENST00000321892.4	+	13	4660	c.4599A>G	c.(4597-4599)atA>atG	p.I1533M	BPTF_ENST00000424123.3_Missense_Mutation_p.I1394M|BPTF_ENST00000335221.5_Missense_Mutation_p.I1533M|BPTF_ENST00000306378.6_Missense_Mutation_p.I1407M			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1533					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CATTTCAAATAAATGGAAAAG	0.294																																						dbGAP											0													44.0	50.0	48.0					17																	65908221		2190	4290	6480	-	-	-	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.4599A>G	17.37:g.65908221A>G	ENSP00000315454:p.Ile1533Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.I1533M	ENST00000321892.4	37	c.4599		17	.	.	.	.	.	.	.	.	.	.	A	9.704	1.155199	0.21371	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.67345	-0.26;-0.24;-0.24	5.6	1.84	0.25277	.	.	.	.	.	T	0.45175	0.1329	N	0.19112	0.55	0.27419	N	0.954346	P;P	0.42518	0.627;0.782	B;B	0.39258	0.295;0.28	T	0.44112	-0.9349	9	0.72032	D	0.01	-8.8472	1.6429	0.02756	0.3163:0.3518:0.0924:0.2395	.	1407;1533	Q12830-2;Q12830-4	.;.	M	1407;1533;1533	ENSP00000307208:I1407M;ENSP00000334351:I1533M;ENSP00000315454:I1533M	ENSP00000307208:I1407M	I	+	3	3	BPTF	63338683	0.916000	0.31088	1.000000	0.80357	0.912000	0.54170	-0.071000	0.11505	0.368000	0.24481	0.528000	0.53228	ATA	BPTF	-	NULL	ENSG00000171634		0.294	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		64	0.00	0	A	NM_182641, NM_004459		65908221	65908221	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.997	G
ZBED8	63920	genome.wustl.edu	37	5	159821012	159821012	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr5:159821012C>T	ENST00000408953.3	-	2	1993	c.1486G>A	c.(1486-1488)Gct>Act	p.A496T	C5orf54_ENST00000523213.1_Missense_Mutation_p.A496T	NM_022090.3	NP_071373.2														breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						cgtaattcagcaagatcattt	0.353																																						dbGAP											0													69.0	69.0	69.0					5																	159821012		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000408953.3:c.1486G>A	5.37:g.159821012C>T	ENSP00000386184:p.Ala496Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.A496T	ENST00000408953.3	37	c.1486	CCDS34283.1	5	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729753	0.30684	.	.	ENSG00000221886	ENST00000408953;ENST00000523213	T;T	0.22945	1.93;1.93	3.01	3.01	0.34805	.	.	.	.	.	T	0.09818	0.0241	N	0.02011	-0.69	0.25261	N	0.989598	B	0.24823	0.112	B	0.23574	0.047	T	0.22138	-1.0225	9	0.21540	T	0.41	.	9.7584	0.40517	0.0:1.0:0.0:0.0	.	496	Q8IZ13	CE054_HUMAN	T	496	ENSP00000386184:A496T;ENSP00000428831:A496T	ENSP00000386184:A496T	A	-	1	0	C5orf54	159753590	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.479000	0.22228	2.001000	0.58596	0.655000	0.94253	GCT	C5orf54	-	NULL	ENSG00000221886		0.353	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf54	HGNC	protein_coding	OTTHUMT00000374143.1	31	0.00	0	C			159821012	159821012	-1	no_errors	ENST00000408953	ensembl	human	known	69_37n	missense	21	53.19	25	SNP	1.000	T
ZBED8	63920	genome.wustl.edu	37	5	159821012	159821012	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr5:159821012C>T	ENST00000408953.3	-	2	1993	c.1486G>A	c.(1486-1488)Gct>Act	p.A496T	C5orf54_ENST00000523213.1_Missense_Mutation_p.A496T	NM_022090.3	NP_071373.2														breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						cgtaattcagcaagatcattt	0.353																																						dbGAP											0													69.0	69.0	69.0					5																	159821012		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000408953.3:c.1486G>A	5.37:g.159821012C>T	ENSP00000386184:p.Ala496Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.A496T	ENST00000408953.3	37	c.1486	CCDS34283.1	5	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729753	0.30684	.	.	ENSG00000221886	ENST00000408953;ENST00000523213	T;T	0.22945	1.93;1.93	3.01	3.01	0.34805	.	.	.	.	.	T	0.09818	0.0241	N	0.02011	-0.69	0.25261	N	0.989598	B	0.24823	0.112	B	0.23574	0.047	T	0.22138	-1.0225	9	0.21540	T	0.41	.	9.7584	0.40517	0.0:1.0:0.0:0.0	.	496	Q8IZ13	CE054_HUMAN	T	496	ENSP00000386184:A496T;ENSP00000428831:A496T	ENSP00000386184:A496T	A	-	1	0	C5orf54	159753590	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.479000	0.22228	2.001000	0.58596	0.655000	0.94253	GCT	C5orf54	-	NULL	ENSG00000221886		0.353	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf54	HGNC	protein_coding	OTTHUMT00000374143.1	45	0.00	0	C			159821012	159821012	-1	no_errors	ENST00000408953	ensembl	human	known	69_37n	missense	21	53.19	25	SNP	1.000	T
C6orf183	389422	genome.wustl.edu	37	6	109517780	109517780	+	RNA	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr6:109517780G>A	ENST00000417143.3	+	0	495							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		AGATCATGGAGCAACTTTATC	0.363																																						dbGAP											0																																										-	-	-			0					6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109517780G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000417143.3	37	NULL		6																																																																																			C6orf183	-	-	ENSG00000243587		0.363	C6orf183-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	C6orf183	HGNC	polymorphic_pseudogene	OTTHUMT00000041736.4	53	0.00	0	G			109517780	109517780	+1	no_errors	ENST00000417143	ensembl	human	known	69_37n	rna	57	26.92	21	SNP	0.997	A
C6orf183	389422	genome.wustl.edu	37	6	109517780	109517780	+	RNA	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:109517780G>A	ENST00000417143.3	+	0	495							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		AGATCATGGAGCAACTTTATC	0.363																																						dbGAP											0																																										-	-	-			0					6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109517780G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000417143.3	37	NULL		6																																																																																			C6orf183	-	-	ENSG00000243587		0.363	C6orf183-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	C6orf183	HGNC	polymorphic_pseudogene	OTTHUMT00000041736.4	79	0.00	0	G			109517780	109517780	+1	no_errors	ENST00000417143	ensembl	human	known	69_37n	rna	57	26.92	21	SNP	0.997	A
PRR31	101928638	genome.wustl.edu	37	9	139865478	139865478	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr9:139865478C>A	ENST00000371629.1	+	3	468	c.343C>A	c.(343-345)Ccc>Acc	p.P115T				Q5SQ13	PRR31_HUMAN		115										lung(1)	1						GCTCAGAACCCCCTTGGAGGC	0.627																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000371629.1:c.343C>A	9.37:g.139865478C>A	ENSP00000360692:p.Pro115Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Calycin-like	p.P115T	ENST00000371629.1	37	c.343		9	.	.	.	.	.	.	.	.	.	.	C	3.856	-0.030911	0.07543	.	.	ENSG00000198454	ENST00000371629	T	0.32515	1.45	1.56	-3.12	0.05282	.	.	.	.	.	T	0.32823	0.0842	.	.	.	.	.	.	.	.	.	.	.	.	T	0.46275	-0.9203	5	0.87932	D	0	.	8.0321	0.30472	0.0:0.6825:0.0:0.3175	.	.	.	.	T	115	ENSP00000360692:P115T	ENSP00000360692:P115T	P	+	1	0	C9orf141	138985299	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.391000	0.02525	-1.206000	0.02641	-2.684000	0.00141	CCC	C9orf141	-	NULL	ENSG00000198454		0.627	C9orf141-001	KNOWN	basic|appris_principal	protein_coding	C9orf141	HGNC	protein_coding	OTTHUMT00000055250.1	58	0.00	0	C			139865478	139865478	+1	no_errors	ENST00000371629	ensembl	human	known	69_37n	missense	46	27.69	18	SNP	0.000	A
CCBL2	56267	genome.wustl.edu	37	1	89426969	89426969	+	Splice_Site	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:89426969A>T	ENST00000260508.4	-	8	1005	c.668T>A	c.(667-669)gTg>gAg	p.V223E	CCBL2_ENST00000446900.2_5'UTR|CCBL2_ENST00000370491.3_Splice_Site_p.V189E|CCBL2_ENST00000370485.2_3'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	223					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		TCTGTTATACACCTACACATA	0.393																																						dbGAP											0													164.0	158.0	160.0					1																	89426969		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.667-1T>A	1.37:g.89426969A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.V223E	ENST00000260508.4	37	c.668	CCDS30766.1	1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.491605	0.64074	.	.	ENSG00000137944	ENST00000370491;ENST00000260508;ENST00000370486	T;T;T	0.53423	0.62;0.62;0.62	5.93	5.93	0.95920	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.107189	0.64402	D	0.000005	T	0.77226	0.4099	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85969	0.1475	10	0.87932	D	0	-14.2758	16.3654	0.83319	1.0:0.0:0.0:0.0	.	223	Q6YP21	KAT3_HUMAN	E	189;223;223	ENSP00000359522:V189E;ENSP00000260508:V223E;ENSP00000359517:V223E	ENSP00000260508:V223E	V	-	2	0	CCBL2	89199557	1.000000	0.71417	0.994000	0.49952	0.147000	0.21601	8.806000	0.91930	2.270000	0.75569	0.533000	0.62120	GTG	CCBL2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000137944		0.393	CCBL2-004	KNOWN	basic|CCDS	protein_coding	CCBL2	HGNC	protein_coding	OTTHUMT00000029300.3	40	0.00	0	A	NM_001008661	Missense_Mutation	89426969	89426969	-1	no_errors	ENST00000260508	ensembl	human	known	69_37n	missense	60	32.22	29	SNP	0.999	T
CFAP45	25790	genome.wustl.edu	37	1	159843016	159843016	+	Intron	SNP	G	G	C	rs192438911	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:159843016G>C	ENST00000368099.4	-	11	1417				CCDC19_ENST00000476696.1_Intron|RP11-190A12.7_ENST00000544342.1_5'Flank|CCDC19_ENST00000426543.2_Intron	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			GGCCAGGAAAGGTGGTGGGGG	0.597																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0																														ENST00000368099.4:c.1353-58C>G	1.37:g.159843016G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000368099.4	37	NULL	CCDS30914.1	1																																																																																			CCDC19	-	-	ENSG00000213085		0.597	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC19	HGNC	protein_coding	OTTHUMT00000085979.1	15	0.00	0	G			159843016	159843016	-1	no_errors	ENST00000479861	ensembl	human	known	69_37n	rna	41	16.33	8	SNP	0.000	C
CFAP45	25790	genome.wustl.edu	37	1	159843016	159843016	+	Intron	SNP	G	G	C	rs192438911	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:159843016G>C	ENST00000368099.4	-	11	1417				CCDC19_ENST00000476696.1_Intron|RP11-190A12.7_ENST00000544342.1_5'Flank|CCDC19_ENST00000426543.2_Intron	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			GGCCAGGAAAGGTGGTGGGGG	0.597																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0																														ENST00000368099.4:c.1353-58C>G	1.37:g.159843016G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000368099.4	37	NULL	CCDS30914.1	1																																																																																			CCDC19	-	-	ENSG00000213085		0.597	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC19	HGNC	protein_coding	OTTHUMT00000085979.1	31	0.00	0	G			159843016	159843016	-1	no_errors	ENST00000479861	ensembl	human	known	69_37n	rna	41	16.33	8	SNP	0.000	C
CD97	976	genome.wustl.edu	37	19	14508585	14508585	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:14508585C>G	ENST00000242786.5	+	7	821	c.741C>G	c.(739-741)atC>atG	p.I247M	CD97_ENST00000357355.3_Missense_Mutation_p.I198M|CD97_ENST00000358600.3_Missense_Mutation_p.I154M|CD97_ENST00000587728.1_3'UTR	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	247	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GACACGGAATCCCGAATAACC	0.597																																						dbGAP											0													10.0	14.0	13.0					19																	14508585		1973	4051	6024	-	-	-	SO:0001583	missense	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.741C>G	19.37:g.14508585C>G	ENSP00000242786:p.Ile247Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.I247M	ENST00000242786.5	37	c.741	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	c	7.545	0.661500	0.14645	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.71817	-0.6;-0.49;-0.11	3.66	-0.0245	0.13938	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.52092	0.1713	N	0.20986	0.625	0.09310	N	1	P;P;B	0.47191	0.465;0.891;0.043	B;B;B	0.42112	0.079;0.376;0.083	T	0.41484	-0.9506	9	0.31617	T	0.26	.	6.1131	0.20112	0.3651:0.451:0.1839:0.0	.	154;198;247	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	M	247;198;154;197	ENSP00000242786:I247M;ENSP00000349918:I198M;ENSP00000351413:I154M	ENSP00000242786:I247M	I	+	3	3	CD97	14369585	0.003000	0.15002	0.000000	0.03702	0.003000	0.03518	1.246000	0.32803	0.115000	0.18071	0.651000	0.88453	ATC	CD97	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000123146		0.597	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	13	0.00	0	C	NM_078481		14508585	14508585	+1	no_errors	ENST00000242786	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.000	G
CNTN6	27255	genome.wustl.edu	37	3	1427412	1427412	+	Missense_Mutation	SNP	G	G	A	rs180685101	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr3:1427412G>A	ENST00000446702.2	+	20	3262	c.2635G>A	c.(2635-2637)Gta>Ata	p.V879I	CNTN6_ENST00000350110.2_Missense_Mutation_p.V879I|CNTN6_ENST00000539053.1_Missense_Mutation_p.V807I			Q9UQ52	CNTN6_HUMAN	contactin 6	879	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CTTTGCTTCCGTAAGAGCTTA	0.443													G|||	4	0.000798722	0.0	0.0	5008	,	,		18216	0.002		0.0	False		,,,				2504	0.002					dbGAP											0													174.0	175.0	174.0					3																	1427412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2635G>A	3.37:g.1427412G>A	ENSP00000407822:p.Val879Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V879I	ENST00000446702.2	37	c.2635	CCDS2557.1	3	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	22.2	4.264095	0.80358	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.70749	-0.51;-0.51;-0.51	5.75	5.75	0.90469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000059	D	0.84147	0.5408	M	0.73319	2.225	0.49798	D	0.999829	D	0.76494	0.999	D	0.79784	0.993	D	0.83431	0.0038	10	0.49607	T	0.09	.	19.9564	0.97221	0.0:0.0:1.0:0.0	.	879	Q9UQ52	CNTN6_HUMAN	I	879;807;879	ENSP00000407822:V879I;ENSP00000442791:V807I;ENSP00000341882:V879I	ENSP00000341882:V879I	V	+	1	0	CNTN6	1402412	1.000000	0.71417	0.918000	0.36340	0.729000	0.41735	2.902000	0.48703	2.708000	0.92522	0.650000	0.86243	GTA	CNTN6	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.443	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	46	0.00	0	G	NM_014461		1427412	1427412	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	missense	71	32.38	34	SNP	0.977	A
CNTN6	27255	genome.wustl.edu	37	3	1427412	1427412	+	Missense_Mutation	SNP	G	G	A	rs180685101	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr3:1427412G>A	ENST00000446702.2	+	20	3262	c.2635G>A	c.(2635-2637)Gta>Ata	p.V879I	CNTN6_ENST00000350110.2_Missense_Mutation_p.V879I|CNTN6_ENST00000539053.1_Missense_Mutation_p.V807I			Q9UQ52	CNTN6_HUMAN	contactin 6	879	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CTTTGCTTCCGTAAGAGCTTA	0.443													G|||	4	0.000798722	0.0	0.0	5008	,	,		18216	0.002		0.0	False		,,,				2504	0.002					dbGAP											0													174.0	175.0	174.0					3																	1427412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2635G>A	3.37:g.1427412G>A	ENSP00000407822:p.Val879Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V879I	ENST00000446702.2	37	c.2635	CCDS2557.1	3	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	22.2	4.264095	0.80358	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.70749	-0.51;-0.51;-0.51	5.75	5.75	0.90469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000059	D	0.84147	0.5408	M	0.73319	2.225	0.49798	D	0.999829	D	0.76494	0.999	D	0.79784	0.993	D	0.83431	0.0038	10	0.49607	T	0.09	.	19.9564	0.97221	0.0:0.0:1.0:0.0	.	879	Q9UQ52	CNTN6_HUMAN	I	879;807;879	ENSP00000407822:V879I;ENSP00000442791:V807I;ENSP00000341882:V879I	ENSP00000341882:V879I	V	+	1	0	CNTN6	1402412	1.000000	0.71417	0.918000	0.36340	0.729000	0.41735	2.902000	0.48703	2.708000	0.92522	0.650000	0.86243	GTA	CNTN6	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.443	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	99	0.00	0	G	NM_014461		1427412	1427412	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	missense	71	32.38	34	SNP	0.977	A
CLDN18	51208	genome.wustl.edu	37	3	137717874	137717875	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G|A	G|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr3:137717874_137717875GA>TT	ENST00000343735.4	+	1	298_299	c.164_165GA>TT	c.(163-165)cGA>cTT	p.R55L		NM_001002026.2	NP_001002026.1	P56856	CLD18_HUMAN	claudin 18	55					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						TCCTGTGTCCGAGAGAGCTCTG	0.604																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	Exception_encountered	3.37:g.137717874_137717875delinsTT	ENSP00000340939:p.Arg55Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL21|Q96PH4	Missense_Mutation|Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin18,prints_Claudin	p.R55L|p.R55	ENST00000343735.4	37	c.164|c.165	CCDS33862.1	3																																																																																			CLDN18	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000066405		0.604	CLDN18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLDN18	HGNC	protein_coding	OTTHUMT00000357198.2	50	0.00	0	G|A	NM_001002026		137717874|137717875	137717874|137717875	+1	no_errors	ENST00000343735	ensembl	human	known	69_37n	missense|silent	96|97	31.69	45	SNP	0.996|0.987	T
CLDN18	51208	genome.wustl.edu	37	3	137717874	137717875	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G|A	G|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr3:137717874_137717875GA>TT	ENST00000343735.4	+	1	298_299	c.164_165GA>TT	c.(163-165)cGA>cTT	p.R55L		NM_001002026.2	NP_001002026.1	P56856	CLD18_HUMAN	claudin 18	55					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						TCCTGTGTCCGAGAGAGCTCTG	0.604																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	Exception_encountered	3.37:g.137717874_137717875delinsTT	ENSP00000340939:p.Arg55Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL21|Q96PH4	Missense_Mutation|Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin18,prints_Claudin	p.R55L|p.R55	ENST00000343735.4	37	c.164|c.165	CCDS33862.1	3																																																																																			CLDN18	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000066405		0.604	CLDN18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLDN18	HGNC	protein_coding	OTTHUMT00000357198.2	121|119	0.00	0	G|A	NM_001002026		137717874|137717875	137717874|137717875	+1	no_errors	ENST00000343735	ensembl	human	known	69_37n	missense|silent	96|97	31.69	45	SNP	0.996|0.987	T
COL3A1	1281	genome.wustl.edu	37	2	189849533	189849533	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:189849533G>C	ENST00000304636.3	+	2	297	c.127G>C	c.(127-129)Gat>Cat	p.D43H	COL3A1_ENST00000317840.5_Missense_Mutation_p.D43H	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	43	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.D43H(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGCGGATAGAGATGTCTGGAA	0.443																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											178.0	159.0	165.0					2																	189849533		2203	4299	6502	-	-	-	SO:0001583	missense	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.127G>C	2.37:g.189849533G>C	ENSP00000304408:p.Asp43His	Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.D43H	ENST00000304636.3	37	c.127	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760755	0.89932	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.67171	-0.25;-0.25	4.95	4.95	0.65309	von Willebrand factor, type C (3);	0.000000	0.47455	D	0.000240	D	0.86814	0.6023	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90451	0.4439	10	0.87932	D	0	.	18.5426	0.91035	0.0:0.0:1.0:0.0	.	43	P02461	CO3A1_HUMAN	H	43	ENSP00000304408:D43H;ENSP00000315243:D43H	ENSP00000304408:D43H	D	+	1	0	COL3A1	189557778	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.711000	0.84669	2.457000	0.83068	0.467000	0.42956	GAT	COL3A1	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	ENSG00000168542		0.443	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3	35	0.00	0	G	NM_000090		189849533	189849533	+1	no_errors	ENST00000304636	ensembl	human	known	69_37n	missense	45	18.18	10	SNP	1.000	C
COL3A1	1281	genome.wustl.edu	37	2	189849533	189849533	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:189849533G>C	ENST00000304636.3	+	2	297	c.127G>C	c.(127-129)Gat>Cat	p.D43H	COL3A1_ENST00000317840.5_Missense_Mutation_p.D43H	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	43	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.D43H(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGCGGATAGAGATGTCTGGAA	0.443																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											178.0	159.0	165.0					2																	189849533		2203	4299	6502	-	-	-	SO:0001583	missense	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.127G>C	2.37:g.189849533G>C	ENSP00000304408:p.Asp43His	Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.D43H	ENST00000304636.3	37	c.127	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760755	0.89932	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.67171	-0.25;-0.25	4.95	4.95	0.65309	von Willebrand factor, type C (3);	0.000000	0.47455	D	0.000240	D	0.86814	0.6023	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90451	0.4439	10	0.87932	D	0	.	18.5426	0.91035	0.0:0.0:1.0:0.0	.	43	P02461	CO3A1_HUMAN	H	43	ENSP00000304408:D43H;ENSP00000315243:D43H	ENSP00000304408:D43H	D	+	1	0	COL3A1	189557778	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.711000	0.84669	2.457000	0.83068	0.467000	0.42956	GAT	COL3A1	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	ENSG00000168542		0.443	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3	62	0.00	0	G	NM_000090		189849533	189849533	+1	no_errors	ENST00000304636	ensembl	human	known	69_37n	missense	45	18.18	10	SNP	1.000	C
COL3A1	1281	genome.wustl.edu	37	2	189854152	189854152	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:189854152C>T	ENST00000304636.3	+	8	837	c.667C>T	c.(667-669)Cca>Tca	p.P223S	COL3A1_ENST00000317840.5_Missense_Mutation_p.P223S	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	223	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.P223S(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGCTATAGGTCCATCTGGTCC	0.318																																						dbGAP											1	Substitution - Missense(1)	skin(1)											25.0	26.0	26.0					2																	189854152		2200	4295	6495	-	-	-	SO:0001583	missense	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.667C>T	2.37:g.189854152C>T	ENSP00000304408:p.Pro223Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P223S	ENST00000304636.3	37	c.667	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007336	0.75046	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.98649	-4.13;-5.05	5.65	5.65	0.86999	.	0.000000	0.51477	D	0.000095	D	0.98988	0.9655	M	0.70787	2.145	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.99226	1.0880	10	0.41790	T	0.15	.	20.0752	0.97739	0.0:1.0:0.0:0.0	.	223	P02461	CO3A1_HUMAN	S	223	ENSP00000304408:P223S;ENSP00000315243:P223S	ENSP00000304408:P223S	P	+	1	0	COL3A1	189562397	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	5.600000	0.67599	2.826000	0.97356	0.491000	0.48974	CCA	COL3A1	-	NULL	ENSG00000168542		0.318	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3	35	0.00	0	C	NM_000090		189854152	189854152	+1	no_errors	ENST00000304636	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	T
COL3A1	1281	genome.wustl.edu	37	2	189854152	189854152	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:189854152C>T	ENST00000304636.3	+	8	837	c.667C>T	c.(667-669)Cca>Tca	p.P223S	COL3A1_ENST00000317840.5_Missense_Mutation_p.P223S	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	223	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.P223S(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGCTATAGGTCCATCTGGTCC	0.318																																						dbGAP											1	Substitution - Missense(1)	skin(1)											25.0	26.0	26.0					2																	189854152		2200	4295	6495	-	-	-	SO:0001583	missense	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.667C>T	2.37:g.189854152C>T	ENSP00000304408:p.Pro223Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P223S	ENST00000304636.3	37	c.667	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007336	0.75046	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.98649	-4.13;-5.05	5.65	5.65	0.86999	.	0.000000	0.51477	D	0.000095	D	0.98988	0.9655	M	0.70787	2.145	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.99226	1.0880	10	0.41790	T	0.15	.	20.0752	0.97739	0.0:1.0:0.0:0.0	.	223	P02461	CO3A1_HUMAN	S	223	ENSP00000304408:P223S;ENSP00000315243:P223S	ENSP00000304408:P223S	P	+	1	0	COL3A1	189562397	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	5.600000	0.67599	2.826000	0.97356	0.491000	0.48974	CCA	COL3A1	-	NULL	ENSG00000168542		0.318	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3	74	0.00	0	C	NM_000090		189854152	189854152	+1	no_errors	ENST00000304636	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	T
CPS1	1373	genome.wustl.edu	37	2	211481258	211481258	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:211481258C>G	ENST00000233072.5	+	21	2876	c.2680C>G	c.(2680-2682)Ctc>Gtc	p.L894V	CPS1_ENST00000430249.2_Missense_Mutation_p.L900V|CPS1_ENST00000451903.2_Missense_Mutation_p.L443V	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	894					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ACTGAAAGGCCTCAACAGGTA	0.398																																						dbGAP											0													144.0	146.0	146.0					2																	211481258		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2680C>G	2.37:g.211481258C>G	ENSP00000233072:p.Leu894Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE_1,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,smart_MGS-like_dom,prints_CbamoylP_synth_lsu_CPSase_dom,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.L900V	ENST00000233072.5	37	c.2698	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	9.589	1.125540	0.20959	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.96554	-4.05;-4.05;-4.05	5.77	5.77	0.91146	Carbamoyl-phosphate synthetase, large subunit, oligomerisation (3);	0.256704	0.40728	N	0.001026	D	0.91492	0.7314	N	0.13299	0.325	0.28836	N	0.896854	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.006	T	0.83095	-0.0131	10	0.33940	T	0.23	-6.9979	15.1785	0.72934	0.0:0.8498:0.1502:0.0	.	904;894	Q59HF8;P31327	.;CPSM_HUMAN	V	900;902;894;443	ENSP00000402608:L900V;ENSP00000233072:L894V;ENSP00000406136:L443V	ENSP00000233072:L894V	L	+	1	0	CPS1	211189503	0.413000	0.25400	1.000000	0.80357	0.803000	0.45373	0.888000	0.28268	2.884000	0.98904	0.655000	0.94253	CTC	CPS1	-	pfam_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_lsu_oligo,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.398	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	28	0.00	0	C			211481258	211481258	+1	no_errors	ENST00000430249	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.969	G
CPS1	1373	genome.wustl.edu	37	2	211481258	211481258	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:211481258C>G	ENST00000233072.5	+	21	2876	c.2680C>G	c.(2680-2682)Ctc>Gtc	p.L894V	CPS1_ENST00000430249.2_Missense_Mutation_p.L900V|CPS1_ENST00000451903.2_Missense_Mutation_p.L443V	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	894					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ACTGAAAGGCCTCAACAGGTA	0.398																																						dbGAP											0													144.0	146.0	146.0					2																	211481258		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2680C>G	2.37:g.211481258C>G	ENSP00000233072:p.Leu894Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE_1,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,smart_MGS-like_dom,prints_CbamoylP_synth_lsu_CPSase_dom,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.L900V	ENST00000233072.5	37	c.2698	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	9.589	1.125540	0.20959	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.96554	-4.05;-4.05;-4.05	5.77	5.77	0.91146	Carbamoyl-phosphate synthetase, large subunit, oligomerisation (3);	0.256704	0.40728	N	0.001026	D	0.91492	0.7314	N	0.13299	0.325	0.28836	N	0.896854	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.006	T	0.83095	-0.0131	10	0.33940	T	0.23	-6.9979	15.1785	0.72934	0.0:0.8498:0.1502:0.0	.	904;894	Q59HF8;P31327	.;CPSM_HUMAN	V	900;902;894;443	ENSP00000402608:L900V;ENSP00000233072:L894V;ENSP00000406136:L443V	ENSP00000233072:L894V	L	+	1	0	CPS1	211189503	0.413000	0.25400	1.000000	0.80357	0.803000	0.45373	0.888000	0.28268	2.884000	0.98904	0.655000	0.94253	CTC	CPS1	-	pfam_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_lsu_oligo,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.398	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	52	0.00	0	C			211481258	211481258	+1	no_errors	ENST00000430249	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.969	G
CTNNBL1	56259	genome.wustl.edu	37	20	36470666	36470666	+	Intron	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr20:36470666G>C	ENST00000361383.6	+	13	1428				CTNNBL1_ENST00000473857.1_Intron|CTNNBL1_ENST00000373469.1_Intron|CTNNBL1_ENST00000405275.2_Intron|CTNNBL1_ENST00000373473.1_Intron	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1						apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				ACAGTGAGATGAATAGGAGTG	0.483																																					Ovarian(184;582 2038 3273 4106 42608)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1312-75G>C	20.37:g.36470666G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	RNA	SNP	-	NULL	ENST00000361383.6	37	NULL	CCDS13298.1	20																																																																																			CTNNBL1	-	-	ENSG00000132792		0.483	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CTNNBL1	HGNC	protein_coding	OTTHUMT00000079125.1	28	0.00	0	G	NM_030877		36470666	36470666	+1	no_errors	ENST00000472237	ensembl	human	putative	69_37n	rna	27	35.71	15	SNP	0.455	C
CTNNBL1	56259	genome.wustl.edu	37	20	36470666	36470666	+	Intron	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr20:36470666G>C	ENST00000361383.6	+	13	1428				CTNNBL1_ENST00000473857.1_Intron|CTNNBL1_ENST00000373469.1_Intron|CTNNBL1_ENST00000405275.2_Intron|CTNNBL1_ENST00000373473.1_Intron	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1						apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				ACAGTGAGATGAATAGGAGTG	0.483																																					Ovarian(184;582 2038 3273 4106 42608)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1312-75G>C	20.37:g.36470666G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	RNA	SNP	-	NULL	ENST00000361383.6	37	NULL	CCDS13298.1	20																																																																																			CTNNBL1	-	-	ENSG00000132792		0.483	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CTNNBL1	HGNC	protein_coding	OTTHUMT00000079125.1	55	0.00	0	G	NM_030877		36470666	36470666	+1	no_errors	ENST00000472237	ensembl	human	putative	69_37n	rna	27	35.71	15	SNP	0.455	C
DGKH	160851	genome.wustl.edu	37	13	42748218	42748218	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr13:42748218C>T	ENST00000337343.4	+	12	1411	c.1390C>T	c.(1390-1392)Ctc>Ttc	p.L464F	DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000536612.1_Missense_Mutation_p.L328F|DGKH_ENST00000538674.1_Missense_Mutation_p.L219F|DGKH_ENST00000261491.5_Missense_Mutation_p.L464F|AL139328.1_ENST00000582753.1_RNA|DGKH_ENST00000540693.1_Missense_Mutation_p.L464F|DGKH_ENST00000379274.2_Missense_Mutation_p.L328F	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	464					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GACATATGAACTCAAATTGCC	0.383																																						dbGAP											0													110.0	108.0	108.0					13																	42748218		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1390C>T	13.37:g.42748218C>T	ENSP00000337572:p.Leu464Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L464F	ENST00000337343.4	37	c.1390	CCDS9381.1	13	.	.	.	.	.	.	.	.	.	.	C	14.39	2.520790	0.44866	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.80566	-1.39;-1.21;-1.39;-1.38;-1.37;1.88	5.84	5.0	0.66597	.	0.195576	0.44097	D	0.000496	D	0.83982	0.5372	L	0.51422	1.61	0.46849	D	0.999227	B;P;D;B	0.63880	0.055;0.889;0.993;0.032	B;P;P;B	0.59487	0.061;0.562;0.858;0.028	T	0.81523	-0.0894	10	0.23891	T	0.37	.	14.9501	0.71067	0.0:0.9317:0.0:0.0683	.	219;328;464;464	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	F	464;464;464;328;328;219	ENSP00000440823:L464F;ENSP00000337572:L464F;ENSP00000261491:L464F;ENSP00000368576:L328F;ENSP00000445114:L328F;ENSP00000441308:L219F	ENSP00000261491:L464F	L	+	1	0	DGKH	41646218	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.486000	0.53215	1.488000	0.48433	0.591000	0.81541	CTC	DGKH	-	NULL	ENSG00000102780		0.383	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKH	HGNC	protein_coding	OTTHUMT00000044699.2	49	0.00	0	C	NM_178009		42748218	42748218	+1	no_errors	ENST00000337343	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	1.000	T
DSP	1832	genome.wustl.edu	37	6	7583868	7583868	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:7583868C>T	ENST00000379802.3	+	24	6714	c.6373C>T	c.(6373-6375)Ctg>Ttg	p.L2125L	DSP_ENST00000418664.2_Silent_p.L1526L	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2125	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AATGCGCCTGCTGGAAGCCCA	0.458																																						dbGAP											0													58.0	64.0	62.0					6																	7583868		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6373C>T	6.37:g.7583868C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L2125	ENST00000379802.3	37	c.6373	CCDS4501.1	6																																																																																			DSP	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000096696		0.458	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	38	0.00	0	C	NM_004415		7583868	7583868	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	silent	30	14.29	5	SNP	1.000	T
DYTN	391475	genome.wustl.edu	37	2	207564451	207564451	+	Splice_Site	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:207564451C>A	ENST00000452335.2	-	7	835	c.719G>T	c.(718-720)aGa>aTa	p.R240I	DYTN_ENST00000477734.1_5'UTR|Y_RNA_ENST00000384589.1_RNA	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	240						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		ATGACTGTACCTGAGTCCCGT	0.517																																						dbGAP											0													65.0	66.0	66.0					2																	207564451		1991	4167	6158	-	-	-	SO:0001630	splice_region_variant	0			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.719+1G>T	2.37:g.207564451C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EF-hand_dom_typ2,pfam_EF-hand_dom_typ1,pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	p.R240I	ENST00000452335.2	37	c.719	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860877	0.51482	.	.	ENSG00000232125	ENST00000452335	D	0.96491	-4.03	5.36	4.41	0.53225	Zinc finger, ZZ-type (4);	.	.	.	.	D	0.98642	0.9545	H	0.96889	3.9	0.51012	D	0.999903	D	0.89917	1.0	D	0.91635	0.999	D	0.98496	1.0612	8	.	.	.	-10.2316	12.7206	0.57140	0.0:0.9135:0.0:0.0865	.	240	A2CJ06	DYTN_HUMAN	I	240	ENSP00000396593:R240I	.	R	-	2	0	DYTN	207272696	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	2.972000	0.49256	2.793000	0.96121	0.561000	0.74099	AGA	DYTN	-	pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	ENSG00000232125		0.517	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	HGNC	protein_coding	OTTHUMT00000336799.1	28	0.00	0	C		Missense_Mutation	207564451	207564451	-1	no_errors	ENST00000452335	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	A
DYTN	391475	genome.wustl.edu	37	2	207564451	207564451	+	Splice_Site	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:207564451C>A	ENST00000452335.2	-	7	835	c.719G>T	c.(718-720)aGa>aTa	p.R240I	DYTN_ENST00000477734.1_5'UTR|Y_RNA_ENST00000384589.1_RNA	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	240						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		ATGACTGTACCTGAGTCCCGT	0.517																																						dbGAP											0													65.0	66.0	66.0					2																	207564451		1991	4167	6158	-	-	-	SO:0001630	splice_region_variant	0			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.719+1G>T	2.37:g.207564451C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EF-hand_dom_typ2,pfam_EF-hand_dom_typ1,pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	p.R240I	ENST00000452335.2	37	c.719	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860877	0.51482	.	.	ENSG00000232125	ENST00000452335	D	0.96491	-4.03	5.36	4.41	0.53225	Zinc finger, ZZ-type (4);	.	.	.	.	D	0.98642	0.9545	H	0.96889	3.9	0.51012	D	0.999903	D	0.89917	1.0	D	0.91635	0.999	D	0.98496	1.0612	8	.	.	.	-10.2316	12.7206	0.57140	0.0:0.9135:0.0:0.0865	.	240	A2CJ06	DYTN_HUMAN	I	240	ENSP00000396593:R240I	.	R	-	2	0	DYTN	207272696	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	2.972000	0.49256	2.793000	0.96121	0.561000	0.74099	AGA	DYTN	-	pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	ENSG00000232125		0.517	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	HGNC	protein_coding	OTTHUMT00000336799.1	69	0.00	0	C		Missense_Mutation	207564451	207564451	-1	no_errors	ENST00000452335	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	A
EIF2S2	8894	genome.wustl.edu	37	20	32677589	32677589	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr20:32677589C>A	ENST00000374980.2	-	9	1170	c.949G>T	c.(949-951)Ggc>Tgc	p.G317C		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	317					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						GCCTGGAAGCCGGTTTTGATA	0.488																																						dbGAP											0													102.0	86.0	92.0					20																	32677589		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.949G>T	20.37:g.32677589C>A	ENSP00000364119:p.Gly317Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5	p.G317C	ENST00000374980.2	37	c.949	CCDS13231.1	20	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030348	0.93575	.	.	ENSG00000125977	ENST00000374980	T	0.69561	-0.41	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	D	0.87293	0.6141	M	0.92555	3.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.88685	0.3205	10	0.87932	D	0	-5.4408	20.8599	0.99761	0.0:1.0:0.0:0.0	.	317;317;317	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	C	317	ENSP00000364119:G317C	ENSP00000364119:G317C	G	-	1	0	EIF2S2	32141250	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.783000	0.85696	2.937000	0.99478	0.650000	0.86243	GGC	EIF2S2	-	NULL	ENSG00000125977		0.488	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S2	HGNC	protein_coding	OTTHUMT00000078765.2	28	0.00	0	C	NM_003908		32677589	32677589	-1	no_errors	ENST00000374980	ensembl	human	known	69_37n	missense	72	15.29	13	SNP	1.000	A
EIF2S2	8894	genome.wustl.edu	37	20	32677589	32677589	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr20:32677589C>A	ENST00000374980.2	-	9	1170	c.949G>T	c.(949-951)Ggc>Tgc	p.G317C		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	317					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						GCCTGGAAGCCGGTTTTGATA	0.488																																						dbGAP											0													102.0	86.0	92.0					20																	32677589		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.949G>T	20.37:g.32677589C>A	ENSP00000364119:p.Gly317Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5	p.G317C	ENST00000374980.2	37	c.949	CCDS13231.1	20	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030348	0.93575	.	.	ENSG00000125977	ENST00000374980	T	0.69561	-0.41	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	D	0.87293	0.6141	M	0.92555	3.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.88685	0.3205	10	0.87932	D	0	-5.4408	20.8599	0.99761	0.0:1.0:0.0:0.0	.	317;317;317	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	C	317	ENSP00000364119:G317C	ENSP00000364119:G317C	G	-	1	0	EIF2S2	32141250	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.783000	0.85696	2.937000	0.99478	0.650000	0.86243	GGC	EIF2S2	-	NULL	ENSG00000125977		0.488	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S2	HGNC	protein_coding	OTTHUMT00000078765.2	47	0.00	0	C	NM_003908		32677589	32677589	-1	no_errors	ENST00000374980	ensembl	human	known	69_37n	missense	72	15.29	13	SNP	1.000	A
ELFN1	392617	genome.wustl.edu	37	7	1784920	1784920	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr7:1784920T>A	ENST00000424383.2	+	3	1175	c.688T>A	c.(688-690)Tac>Aac	p.Y230N	ELFN1_ENST00000541472.1_Missense_Mutation_p.Y230N|ELFN1_ENST00000561626.1_Missense_Mutation_p.Y230N			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	230	LRRCT.				negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						CTCCGGCTACTACCTCCTGGG	0.692																																						dbGAP											0													7.0	9.0	8.0					7																	1784920		683	1580	2263	-	-	-	SO:0001583	missense	0				CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.688T>A	7.37:g.1784920T>A	ENSP00000456548:p.Tyr230Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BS57	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Y230N	ENST00000424383.2	37	c.688	CCDS59046.1	7																																																																																			ELFN1	-	smart_Cys-rich_flank_reg_C	ENSG00000225968		0.692	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ELFN1	HGNC	protein_coding	OTTHUMT00000322893.2	16	0.00	0	T	NM_001128636		1784920	1784920	+1	no_errors	ENST00000424383	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	1.000	A
ELFN1	392617	genome.wustl.edu	37	7	1784920	1784920	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr7:1784920T>A	ENST00000424383.2	+	3	1175	c.688T>A	c.(688-690)Tac>Aac	p.Y230N	ELFN1_ENST00000541472.1_Missense_Mutation_p.Y230N|ELFN1_ENST00000561626.1_Missense_Mutation_p.Y230N			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	230	LRRCT.				negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						CTCCGGCTACTACCTCCTGGG	0.692																																						dbGAP											0													7.0	9.0	8.0					7																	1784920		683	1580	2263	-	-	-	SO:0001583	missense	0				CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.688T>A	7.37:g.1784920T>A	ENSP00000456548:p.Tyr230Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BS57	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Y230N	ENST00000424383.2	37	c.688	CCDS59046.1	7																																																																																			ELFN1	-	smart_Cys-rich_flank_reg_C	ENSG00000225968		0.692	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ELFN1	HGNC	protein_coding	OTTHUMT00000322893.2	34	0.00	0	T	NM_001128636		1784920	1784920	+1	no_errors	ENST00000424383	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	1.000	A
EMR2	30817	genome.wustl.edu	37	19	14876501	14876501	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:14876501G>C	ENST00000315576.3	-	8	1201	c.750C>G	c.(748-750)atC>atG	p.I250M	EMR2_ENST00000601345.1_Missense_Mutation_p.I250M|EMR2_ENST00000392964.3_De_novo_Start_InFrame|EMR2_ENST00000346057.1_Missense_Mutation_p.I201M|EMR2_ENST00000596991.2_Missense_Mutation_p.I250M|EMR2_ENST00000594294.1_Missense_Mutation_p.I201M|EMR2_ENST00000595839.1_Intron|EMR2_ENST00000594076.1_Missense_Mutation_p.I157M|EMR2_ENST00000353876.1_Missense_Mutation_p.I157M|EMR2_ENST00000392965.3_Missense_Mutation_p.I250M|EMR2_ENST00000392967.2_Missense_Mutation_p.I250M|EMR2_ENST00000353005.1_Intron	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	250	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GGTTATTCGGGATTCCGTGTC	0.607																																						dbGAP											0													103.0	98.0	100.0					19																	14876501		2202	4278	6480	-	-	-	SO:0001583	missense	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.750C>G	19.37:g.14876501G>C	ENSP00000319883:p.Ile250Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like	p.I250M	ENST00000315576.3	37	c.750	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	G	10.71	1.425728	0.25639	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000392965;ENST00000392962	T;T;T;T;T;T	0.79352	-0.98;-1.1;-0.48;0.3;-1.26;-1.15	3.22	1.03	0.20045	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.58864	0.2152	N	0.20986	0.625	0.09310	N	0.999998	B;B;B;B;B;B;B	0.32693	0.1;0.05;0.062;0.38;0.006;0.127;0.189	B;B;B;B;B;B;B	0.29440	0.04;0.024;0.04;0.04;0.002;0.061;0.102	T	0.49661	-0.8916	9	0.42905	T	0.14	.	4.6065	0.12380	0.3116:0.0:0.6884:0.0	.	250;157;250;201;250;250;250	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;EMR2_HUMAN;.	M	250;250;201;157;250;201	ENSP00000319883:I250M;ENSP00000376694:I250M;ENSP00000263380:I201M;ENSP00000319454:I157M;ENSP00000376692:I250M;ENSP00000376689:I201M	ENSP00000319883:I250M	I	-	3	3	EMR2	14737501	0.017000	0.18338	0.006000	0.13384	0.081000	0.17604	2.180000	0.42537	0.669000	0.31146	0.121000	0.15741	ATC	EMR2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000127507		0.607	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	39	0.00	0	G			14876501	14876501	-1	no_errors	ENST00000315576	ensembl	human	known	69_37n	missense	72	11.11	9	SNP	0.002	C
EMR2	30817	genome.wustl.edu	37	19	14876501	14876501	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:14876501G>C	ENST00000315576.3	-	8	1201	c.750C>G	c.(748-750)atC>atG	p.I250M	EMR2_ENST00000601345.1_Missense_Mutation_p.I250M|EMR2_ENST00000392964.3_De_novo_Start_InFrame|EMR2_ENST00000346057.1_Missense_Mutation_p.I201M|EMR2_ENST00000596991.2_Missense_Mutation_p.I250M|EMR2_ENST00000594294.1_Missense_Mutation_p.I201M|EMR2_ENST00000595839.1_Intron|EMR2_ENST00000594076.1_Missense_Mutation_p.I157M|EMR2_ENST00000353876.1_Missense_Mutation_p.I157M|EMR2_ENST00000392965.3_Missense_Mutation_p.I250M|EMR2_ENST00000392967.2_Missense_Mutation_p.I250M|EMR2_ENST00000353005.1_Intron	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	250	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GGTTATTCGGGATTCCGTGTC	0.607																																						dbGAP											0													103.0	98.0	100.0					19																	14876501		2202	4278	6480	-	-	-	SO:0001583	missense	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.750C>G	19.37:g.14876501G>C	ENSP00000319883:p.Ile250Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like	p.I250M	ENST00000315576.3	37	c.750	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	G	10.71	1.425728	0.25639	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000392965;ENST00000392962	T;T;T;T;T;T	0.79352	-0.98;-1.1;-0.48;0.3;-1.26;-1.15	3.22	1.03	0.20045	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.58864	0.2152	N	0.20986	0.625	0.09310	N	0.999998	B;B;B;B;B;B;B	0.32693	0.1;0.05;0.062;0.38;0.006;0.127;0.189	B;B;B;B;B;B;B	0.29440	0.04;0.024;0.04;0.04;0.002;0.061;0.102	T	0.49661	-0.8916	9	0.42905	T	0.14	.	4.6065	0.12380	0.3116:0.0:0.6884:0.0	.	250;157;250;201;250;250;250	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;EMR2_HUMAN;.	M	250;250;201;157;250;201	ENSP00000319883:I250M;ENSP00000376694:I250M;ENSP00000263380:I201M;ENSP00000319454:I157M;ENSP00000376692:I250M;ENSP00000376689:I201M	ENSP00000319883:I250M	I	-	3	3	EMR2	14737501	0.017000	0.18338	0.006000	0.13384	0.081000	0.17604	2.180000	0.42537	0.669000	0.31146	0.121000	0.15741	ATC	EMR2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000127507		0.607	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	74	0.00	0	G			14876501	14876501	-1	no_errors	ENST00000315576	ensembl	human	known	69_37n	missense	72	11.11	9	SNP	0.002	C
ELL	8178	genome.wustl.edu	37	19	18557189	18557189	+	Missense_Mutation	SNP	C	C	T	rs538570775		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:18557189C>T	ENST00000262809.4	-	10	1705	c.1634G>A	c.(1633-1635)cGc>cAc	p.R545H	ELL_ENST00000596124.3_Missense_Mutation_p.R412H|CTD-3137H5.1_ENST00000594590.2_RNA	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	545					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		CCGCGTGATGCGCTCAATGCG	0.642			T	MLL	AL								c|||	1	0.000199681	0.0	0.0	5008	,	,		17848	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	0													50.0	43.0	46.0					19																	18557189		2202	4299	6501	-	-	-	SO:0001583	missense	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1634G>A	19.37:g.18557189C>T	ENSP00000262809:p.Arg545His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.R545H	ENST00000262809.4	37	c.1634	CCDS12380.1	19	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557537	0.65425	.	.	ENSG00000105656	ENST00000262809	T	0.22336	1.96	4.62	-5.58	0.02512	Occludin/RNA polymerase II elongation factor, ELL domain (1);	0.649458	0.14702	N	0.303490	T	0.13372	0.0324	L	0.29908	0.895	0.23314	N	0.997924	P;P	0.48350	0.909;0.842	P;P	0.46452	0.451;0.517	T	0.06716	-1.0811	10	0.52906	T	0.07	-7.7191	4.624	0.12469	0.113:0.6241:0.1225:0.1404	.	489;545	Q59HG4;P55199	.;ELL_HUMAN	H	545	ENSP00000262809:R545H	ENSP00000262809:R545H	R	-	2	0	ELL	18418189	0.785000	0.28726	0.095000	0.20976	0.707000	0.40811	1.088000	0.30877	-1.249000	0.02500	-0.283000	0.09986	CGC	ELL	-	pfam_Occludin_RNApol2_elong_fac_ELL	ENSG00000105656		0.642	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	HGNC	protein_coding	OTTHUMT00000466362.1	17	0.00	0	C	NM_006532		18557189	18557189	-1	no_errors	ENST00000262809	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	0.783	T
ELL	8178	genome.wustl.edu	37	19	18557189	18557189	+	Missense_Mutation	SNP	C	C	T	rs538570775		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:18557189C>T	ENST00000262809.4	-	10	1705	c.1634G>A	c.(1633-1635)cGc>cAc	p.R545H	ELL_ENST00000596124.3_Missense_Mutation_p.R412H|CTD-3137H5.1_ENST00000594590.2_RNA	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	545					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		CCGCGTGATGCGCTCAATGCG	0.642			T	MLL	AL								c|||	1	0.000199681	0.0	0.0	5008	,	,		17848	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	0													50.0	43.0	46.0					19																	18557189		2202	4299	6501	-	-	-	SO:0001583	missense	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1634G>A	19.37:g.18557189C>T	ENSP00000262809:p.Arg545His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.R545H	ENST00000262809.4	37	c.1634	CCDS12380.1	19	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557537	0.65425	.	.	ENSG00000105656	ENST00000262809	T	0.22336	1.96	4.62	-5.58	0.02512	Occludin/RNA polymerase II elongation factor, ELL domain (1);	0.649458	0.14702	N	0.303490	T	0.13372	0.0324	L	0.29908	0.895	0.23314	N	0.997924	P;P	0.48350	0.909;0.842	P;P	0.46452	0.451;0.517	T	0.06716	-1.0811	10	0.52906	T	0.07	-7.7191	4.624	0.12469	0.113:0.6241:0.1225:0.1404	.	489;545	Q59HG4;P55199	.;ELL_HUMAN	H	545	ENSP00000262809:R545H	ENSP00000262809:R545H	R	-	2	0	ELL	18418189	0.785000	0.28726	0.095000	0.20976	0.707000	0.40811	1.088000	0.30877	-1.249000	0.02500	-0.283000	0.09986	CGC	ELL	-	pfam_Occludin_RNApol2_elong_fac_ELL	ENSG00000105656		0.642	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	HGNC	protein_coding	OTTHUMT00000466362.1	31	0.00	0	C	NM_006532		18557189	18557189	-1	no_errors	ENST00000262809	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	0.783	T
ENC1	8507	genome.wustl.edu	37	5	73931271	73931271	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr5:73931271C>A	ENST00000302351.4	-	2	2170	c.1040G>T	c.(1039-1041)gGg>gTg	p.G347V	ENC1_ENST00000510316.1_Missense_Mutation_p.G274V|ENC1_ENST00000537006.1_Missense_Mutation_p.G347V	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	347					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		AGACCCCCGCCCCCCAGTAAT	0.532																																						dbGAP											0													90.0	99.0	96.0					5																	73931271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.1040G>T	5.37:g.73931271C>A	ENSP00000306356:p.Gly347Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.G347V	ENST00000302351.4	37	c.1040	CCDS4021.1	5	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676328	0.67928	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	D;D;D	0.99494	-6.01;-6.01;-6.01	5.89	5.89	0.94794	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	H	0.96269	3.795	0.80722	D	1	D	0.69078	0.997	D	0.68353	0.957	D	0.97629	1.0141	10	0.87932	D	0	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	347	O14682	ENC1_HUMAN	V	347;274;347	ENSP00000306356:G347V;ENSP00000423804:G274V;ENSP00000446289:G347V	ENSP00000306356:G347V	G	-	2	0	ENC1	73967027	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.818000	0.86416	2.793000	0.96121	0.561000	0.74099	GGG	ENC1	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000171617		0.532	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENC1	HGNC	protein_coding	OTTHUMT00000219862.2	15	0.00	0	C	NM_003633		73931271	73931271	-1	no_errors	ENST00000302351	ensembl	human	known	69_37n	missense	2	80.00	8	SNP	1.000	A
ENC1	8507	genome.wustl.edu	37	5	73931271	73931271	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr5:73931271C>A	ENST00000302351.4	-	2	2170	c.1040G>T	c.(1039-1041)gGg>gTg	p.G347V	ENC1_ENST00000510316.1_Missense_Mutation_p.G274V|ENC1_ENST00000537006.1_Missense_Mutation_p.G347V	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	347					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		AGACCCCCGCCCCCCAGTAAT	0.532																																						dbGAP											0													90.0	99.0	96.0					5																	73931271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.1040G>T	5.37:g.73931271C>A	ENSP00000306356:p.Gly347Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.G347V	ENST00000302351.4	37	c.1040	CCDS4021.1	5	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676328	0.67928	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	D;D;D	0.99494	-6.01;-6.01;-6.01	5.89	5.89	0.94794	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	H	0.96269	3.795	0.80722	D	1	D	0.69078	0.997	D	0.68353	0.957	D	0.97629	1.0141	10	0.87932	D	0	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	347	O14682	ENC1_HUMAN	V	347;274;347	ENSP00000306356:G347V;ENSP00000423804:G274V;ENSP00000446289:G347V	ENSP00000306356:G347V	G	-	2	0	ENC1	73967027	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.818000	0.86416	2.793000	0.96121	0.561000	0.74099	GGG	ENC1	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000171617		0.532	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENC1	HGNC	protein_coding	OTTHUMT00000219862.2	58	0.00	0	C	NM_003633		73931271	73931271	-1	no_errors	ENST00000302351	ensembl	human	known	69_37n	missense	2	80.00	8	SNP	1.000	A
ETV1	2115	genome.wustl.edu	37	7	13940403	13940403	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr7:13940403C>A	ENST00000430479.1	-	13	1839	c.1172G>T	c.(1171-1173)cGt>cTt	p.R391L	ETV1_ENST00000405192.2_Missense_Mutation_p.R368L|ETV1_ENST00000420159.2_Missense_Mutation_p.R333L|ETV1_ENST00000343495.5_Missense_Mutation_p.R373L|ETV1_ENST00000399357.3_Missense_Mutation_p.R288L|ETV1_ENST00000403685.1_Missense_Mutation_p.R373L|ETV1_ENST00000403527.1_Missense_Mutation_p.R351L|ETV1_ENST00000405218.2_Missense_Mutation_p.R391L|ETV1_ENST00000242066.5_Missense_Mutation_p.R373L|ETV1_ENST00000405358.4_Missense_Mutation_p.R405L	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	391					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						GCGGAGTGAACGGCTAAGTTT	0.388			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																	dbGAP		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	0													86.0	79.0	81.0					7																	13940403		1874	4135	6009	-	-	-	SO:0001583	missense	0				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.1172G>T	7.37:g.13940403C>A	ENSP00000405327:p.Arg391Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.R391L	ENST00000430479.1	37	c.1172	CCDS55088.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.801247	0.96960	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685	T;T;T;T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.84	5.84	0.93424	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (5);	0.000000	0.85682	D	0.000000	D	0.89424	0.6711	H	0.94658	3.565	0.80722	D	1	D;D;P;P;D;D;D	0.89917	1.0;1.0;0.956;0.891;0.998;0.998;0.997	D;D;P;B;D;D;D	0.91635	0.999;0.999;0.668;0.266;0.999;0.992;0.964	D	0.91461	0.5189	10	0.87932	D	0	.	20.2048	0.98273	0.0:1.0:0.0:0.0	.	379;373;405;333;288;351;391	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;P50549	.;.;.;.;.;.;ETV1_HUMAN	L	391;373;373;333;288;368;405;351;391;373	ENSP00000405327:R391L;ENSP00000242066:R373L;ENSP00000340853:R373L;ENSP00000411626:R333L;ENSP00000382293:R288L;ENSP00000385381:R368L;ENSP00000384085:R405L;ENSP00000384138:R351L;ENSP00000385551:R391L;ENSP00000385686:R373L	ENSP00000242066:R373L	R	-	2	0	ETV1	13906928	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.766000	0.95052	0.644000	0.83932	CGT	ETV1	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000006468		0.388	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	HGNC	protein_coding	OTTHUMT00000326111.1	97	0.00	0	C	NM_004956		13940403	13940403	-1	no_errors	ENST00000405218	ensembl	human	known	69_37n	missense	43	42.67	32	SNP	1.000	A
ETV1	2115	genome.wustl.edu	37	7	13940403	13940403	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr7:13940403C>A	ENST00000430479.1	-	13	1839	c.1172G>T	c.(1171-1173)cGt>cTt	p.R391L	ETV1_ENST00000405192.2_Missense_Mutation_p.R368L|ETV1_ENST00000420159.2_Missense_Mutation_p.R333L|ETV1_ENST00000343495.5_Missense_Mutation_p.R373L|ETV1_ENST00000399357.3_Missense_Mutation_p.R288L|ETV1_ENST00000403685.1_Missense_Mutation_p.R373L|ETV1_ENST00000403527.1_Missense_Mutation_p.R351L|ETV1_ENST00000405218.2_Missense_Mutation_p.R391L|ETV1_ENST00000242066.5_Missense_Mutation_p.R373L|ETV1_ENST00000405358.4_Missense_Mutation_p.R405L	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	391					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						GCGGAGTGAACGGCTAAGTTT	0.388			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																	dbGAP		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	0													86.0	79.0	81.0					7																	13940403		1874	4135	6009	-	-	-	SO:0001583	missense	0				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.1172G>T	7.37:g.13940403C>A	ENSP00000405327:p.Arg391Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.R391L	ENST00000430479.1	37	c.1172	CCDS55088.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.801247	0.96960	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685	T;T;T;T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.84	5.84	0.93424	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (5);	0.000000	0.85682	D	0.000000	D	0.89424	0.6711	H	0.94658	3.565	0.80722	D	1	D;D;P;P;D;D;D	0.89917	1.0;1.0;0.956;0.891;0.998;0.998;0.997	D;D;P;B;D;D;D	0.91635	0.999;0.999;0.668;0.266;0.999;0.992;0.964	D	0.91461	0.5189	10	0.87932	D	0	.	20.2048	0.98273	0.0:1.0:0.0:0.0	.	379;373;405;333;288;351;391	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;P50549	.;.;.;.;.;.;ETV1_HUMAN	L	391;373;373;333;288;368;405;351;391;373	ENSP00000405327:R391L;ENSP00000242066:R373L;ENSP00000340853:R373L;ENSP00000411626:R333L;ENSP00000382293:R288L;ENSP00000385381:R368L;ENSP00000384085:R405L;ENSP00000384138:R351L;ENSP00000385551:R391L;ENSP00000385686:R373L	ENSP00000242066:R373L	R	-	2	0	ETV1	13906928	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.766000	0.95052	0.644000	0.83932	CGT	ETV1	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000006468		0.388	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	HGNC	protein_coding	OTTHUMT00000326111.1	149	0.00	0	C	NM_004956		13940403	13940403	-1	no_errors	ENST00000405218	ensembl	human	known	69_37n	missense	43	42.67	32	SNP	1.000	A
FAM69B	138311	genome.wustl.edu	37	9	139616392	139616392	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr9:139616392G>A	ENST00000371692.4	+	3	314	c.218G>A	c.(217-219)gGg>gAg	p.G73E	SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000416970.1_RNA|FAM69B_ENST00000371691.1_5'UTR	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	73						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		TACCGCAAGGGGATCATCTCG	0.677																																						dbGAP											0													62.0	54.0	57.0					9																	139616392		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.218G>A	9.37:g.139616392G>A	ENSP00000360757:p.Gly73Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUD7|Q8N5N0|Q8WYU5	Missense_Mutation	SNP	pfam_Uncharacterised_FAM69	p.G73E	ENST00000371692.4	37	c.218	CCDS7004.1	9	.	.	.	.	.	.	.	.	.	.	g	29.7	5.027070	0.93518	.	.	ENSG00000165716	ENST00000371692	T	0.49720	0.77	4.32	4.32	0.51571	.	0.112355	0.64402	D	0.000011	T	0.65460	0.2693	M	0.82823	2.61	0.80722	D	1	D	0.59767	0.986	P	0.55785	0.784	T	0.73626	-0.3923	10	0.66056	D	0.02	-35.6549	15.8315	0.78757	0.0:0.0:1.0:0.0	.	73	Q5VUD6	FA69B_HUMAN	E	73	ENSP00000360757:G73E	ENSP00000360757:G73E	G	+	2	0	FAM69B	138736213	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.598000	0.74122	1.981000	0.57761	0.478000	0.44815	GGG	FAM69B	-	NULL	ENSG00000165716		0.677	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69B	HGNC	protein_coding	OTTHUMT00000055102.1	182	0.55	1	G	NM_152421		139616392	139616392	+1	no_errors	ENST00000371692	ensembl	human	known	69_37n	missense	78	60.78	124	SNP	1.000	A
FAM69B	138311	genome.wustl.edu	37	9	139616392	139616392	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr9:139616392G>A	ENST00000371692.4	+	3	314	c.218G>A	c.(217-219)gGg>gAg	p.G73E	SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000416970.1_RNA|FAM69B_ENST00000371691.1_5'UTR	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	73						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		TACCGCAAGGGGATCATCTCG	0.677																																						dbGAP											0													62.0	54.0	57.0					9																	139616392		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.218G>A	9.37:g.139616392G>A	ENSP00000360757:p.Gly73Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUD7|Q8N5N0|Q8WYU5	Missense_Mutation	SNP	pfam_Uncharacterised_FAM69	p.G73E	ENST00000371692.4	37	c.218	CCDS7004.1	9	.	.	.	.	.	.	.	.	.	.	g	29.7	5.027070	0.93518	.	.	ENSG00000165716	ENST00000371692	T	0.49720	0.77	4.32	4.32	0.51571	.	0.112355	0.64402	D	0.000011	T	0.65460	0.2693	M	0.82823	2.61	0.80722	D	1	D	0.59767	0.986	P	0.55785	0.784	T	0.73626	-0.3923	10	0.66056	D	0.02	-35.6549	15.8315	0.78757	0.0:0.0:1.0:0.0	.	73	Q5VUD6	FA69B_HUMAN	E	73	ENSP00000360757:G73E	ENSP00000360757:G73E	G	+	2	0	FAM69B	138736213	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.598000	0.74122	1.981000	0.57761	0.478000	0.44815	GGG	FAM69B	-	NULL	ENSG00000165716		0.677	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69B	HGNC	protein_coding	OTTHUMT00000055102.1	221	0.00	0	G	NM_152421		139616392	139616392	+1	no_errors	ENST00000371692	ensembl	human	known	69_37n	missense	78	60.78	124	SNP	1.000	A
FLG2	388698	genome.wustl.edu	37	1	152329692	152329692	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:152329692C>G	ENST00000388718.5	-	3	642	c.570G>C	c.(568-570)tgG>tgC	p.W190C	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	190	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCCACCACTCCATGAATGAC	0.478																																						dbGAP											0													193.0	196.0	195.0					1																	152329692		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.570G>C	1.37:g.152329692C>G	ENSP00000373370:p.Trp190Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.W190C	ENST00000388718.5	37	c.570	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	6.278	0.419475	0.11928	.	.	ENSG00000143520	ENST00000388718	T	0.00691	5.84	5.61	4.69	0.59074	.	.	.	.	.	T	0.01320	0.0043	L	0.54323	1.7	0.46774	D	0.999197	D	0.76494	0.999	D	0.69142	0.962	T	0.71062	-0.4701	9	0.38643	T	0.18	-8.7339	12.5485	0.56214	0.0:0.8327:0.1673:0.0	.	190	Q5D862	FILA2_HUMAN	C	190	ENSP00000373370:W190C	ENSP00000373370:W190C	W	-	3	0	FLG2	150596316	0.003000	0.15002	0.985000	0.45067	0.002000	0.02628	1.338000	0.33873	1.351000	0.45789	-0.182000	0.12963	TGG	FLG2	-	NULL	ENSG00000143520		0.478	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	77	0.00	0	C	NM_001014342		152329692	152329692	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	202	17.21	42	SNP	0.945	G
FLG2	388698	genome.wustl.edu	37	1	152329692	152329692	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:152329692C>G	ENST00000388718.5	-	3	642	c.570G>C	c.(568-570)tgG>tgC	p.W190C	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	190	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCCACCACTCCATGAATGAC	0.478																																						dbGAP											0													193.0	196.0	195.0					1																	152329692		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.570G>C	1.37:g.152329692C>G	ENSP00000373370:p.Trp190Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.W190C	ENST00000388718.5	37	c.570	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	6.278	0.419475	0.11928	.	.	ENSG00000143520	ENST00000388718	T	0.00691	5.84	5.61	4.69	0.59074	.	.	.	.	.	T	0.01320	0.0043	L	0.54323	1.7	0.46774	D	0.999197	D	0.76494	0.999	D	0.69142	0.962	T	0.71062	-0.4701	9	0.38643	T	0.18	-8.7339	12.5485	0.56214	0.0:0.8327:0.1673:0.0	.	190	Q5D862	FILA2_HUMAN	C	190	ENSP00000373370:W190C	ENSP00000373370:W190C	W	-	3	0	FLG2	150596316	0.003000	0.15002	0.985000	0.45067	0.002000	0.02628	1.338000	0.33873	1.351000	0.45789	-0.182000	0.12963	TGG	FLG2	-	NULL	ENSG00000143520		0.478	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	161	0.00	0	C	NM_001014342		152329692	152329692	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	202	17.21	42	SNP	0.945	G
GATA2	2624	genome.wustl.edu	37	3	128199595	128199595	+	3'UTR	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr3:128199595C>G	ENST00000341105.2	-	0	2041				GATA2_ENST00000430265.2_3'UTR|GATA2_ENST00000489987.1_5'UTR	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2						blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		CCCTCCTTTTCTCTACATAAA	0.478			Mis		AML(CML blast transformation)																																	dbGAP		Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.*267G>C	3.37:g.128199595C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	RNA	SNP	-	NULL	ENST00000341105.2	37	NULL	CCDS3049.1	3																																																																																			GATA2	-	-	ENSG00000179348		0.478	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	HGNC	protein_coding	OTTHUMT00000356925.1	45	0.00	0	C	NM_032638		128199595	128199595	-1	no_errors	ENST00000489987	ensembl	human	known	69_37n	rna	71	12.35	10	SNP	0.000	G
GATA2	2624	genome.wustl.edu	37	3	128199595	128199595	+	3'UTR	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr3:128199595C>G	ENST00000341105.2	-	0	2041				GATA2_ENST00000430265.2_3'UTR|GATA2_ENST00000489987.1_5'UTR	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2						blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		CCCTCCTTTTCTCTACATAAA	0.478			Mis		AML(CML blast transformation)																																	dbGAP		Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.*267G>C	3.37:g.128199595C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	RNA	SNP	-	NULL	ENST00000341105.2	37	NULL	CCDS3049.1	3																																																																																			GATA2	-	-	ENSG00000179348		0.478	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	HGNC	protein_coding	OTTHUMT00000356925.1	85	0.00	0	C	NM_032638		128199595	128199595	-1	no_errors	ENST00000489987	ensembl	human	known	69_37n	rna	71	12.35	10	SNP	0.000	G
GCGR	2642	genome.wustl.edu	37	17	79768908	79768908	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:79768908G>C	ENST00000400723.3	+	5	587	c.294G>C	c.(292-294)aaG>aaC	p.K98N	GCGR_ENST00000570996.1_Missense_Mutation_p.K98N	NM_000160.3	NP_000151.1	P47871	GLR_HUMAN	glucagon receptor	98					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|hormone-mediated signaling pathway (GO:0009755)|positive regulation of GTPase activity (GO:0043547)|regulation of blood pressure (GO:0008217)|regulation of glycogen metabolic process (GO:0070873)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|guanyl-nucleotide exchange factor activity (GO:0005085)|peptide hormone binding (GO:0017046)			endometrium(2)	2					Glucagon recombinant(DB00040)	TCGTGTTCAAGAGATGCGGGC	0.687																																						dbGAP											0													18.0	21.0	20.0					17																	79768908		692	1590	2282	-	-	-	SO:0001583	missense	0			U03469, L20316	CCDS54177.1	17q25	2012-08-10			ENSG00000215644	ENSG00000215644		"""GPCR / Class B : Glucagon receptors"""	4192	protein-coding gene	gene with protein product		138033				8020989	Standard	XM_006722276		Approved	GGR	uc010wuw.2	P47871		ENST00000400723.3:c.294G>C	17.37:g.79768908G>C	ENSP00000383558:p.Lys98Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3M5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_glucagon_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.K98N	ENST00000400723.3	37	c.294	CCDS54177.1	17	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689166	0.48097	.	.	ENSG00000215644	ENST00000400723	T	0.60171	0.21	3.61	2.63	0.31362	GPCR, family 2, extracellular hormone receptor domain (3);	.	.	.	.	T	0.76328	0.3972	M	0.90145	3.09	0.39489	D	0.968017	D	0.58620	0.983	D	0.64506	0.926	T	0.80122	-0.1514	9	0.87932	D	0	.	10.5656	0.45171	0.0981:0.0:0.9019:0.0	.	98	P47871	GLR_HUMAN	N	98	ENSP00000383558:K98N	ENSP00000383558:K98N	K	+	3	2	GCGR	.	1.000000	0.71417	0.997000	0.53966	0.477000	0.33069	2.312000	0.43726	0.704000	0.31869	0.313000	0.20887	AAG	GCGR	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_glucagon_rcpt,prints_GPCR_2_GIP_rcpt	ENSG00000215644		0.687	GCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCGR	HGNC	protein_coding	OTTHUMT00000439676.1	55	0.00	0	G	NM_000160		79768908	79768908	+1	no_errors	ENST00000400723	ensembl	human	known	69_37n	missense	37	56.98	49	SNP	1.000	C
GCGR	2642	genome.wustl.edu	37	17	79768908	79768908	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:79768908G>C	ENST00000400723.3	+	5	587	c.294G>C	c.(292-294)aaG>aaC	p.K98N	GCGR_ENST00000570996.1_Missense_Mutation_p.K98N	NM_000160.3	NP_000151.1	P47871	GLR_HUMAN	glucagon receptor	98					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|hormone-mediated signaling pathway (GO:0009755)|positive regulation of GTPase activity (GO:0043547)|regulation of blood pressure (GO:0008217)|regulation of glycogen metabolic process (GO:0070873)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|guanyl-nucleotide exchange factor activity (GO:0005085)|peptide hormone binding (GO:0017046)			endometrium(2)	2					Glucagon recombinant(DB00040)	TCGTGTTCAAGAGATGCGGGC	0.687																																						dbGAP											0													18.0	21.0	20.0					17																	79768908		692	1590	2282	-	-	-	SO:0001583	missense	0			U03469, L20316	CCDS54177.1	17q25	2012-08-10			ENSG00000215644	ENSG00000215644		"""GPCR / Class B : Glucagon receptors"""	4192	protein-coding gene	gene with protein product		138033				8020989	Standard	XM_006722276		Approved	GGR	uc010wuw.2	P47871		ENST00000400723.3:c.294G>C	17.37:g.79768908G>C	ENSP00000383558:p.Lys98Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3M5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_glucagon_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.K98N	ENST00000400723.3	37	c.294	CCDS54177.1	17	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689166	0.48097	.	.	ENSG00000215644	ENST00000400723	T	0.60171	0.21	3.61	2.63	0.31362	GPCR, family 2, extracellular hormone receptor domain (3);	.	.	.	.	T	0.76328	0.3972	M	0.90145	3.09	0.39489	D	0.968017	D	0.58620	0.983	D	0.64506	0.926	T	0.80122	-0.1514	9	0.87932	D	0	.	10.5656	0.45171	0.0981:0.0:0.9019:0.0	.	98	P47871	GLR_HUMAN	N	98	ENSP00000383558:K98N	ENSP00000383558:K98N	K	+	3	2	GCGR	.	1.000000	0.71417	0.997000	0.53966	0.477000	0.33069	2.312000	0.43726	0.704000	0.31869	0.313000	0.20887	AAG	GCGR	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_glucagon_rcpt,prints_GPCR_2_GIP_rcpt	ENSG00000215644		0.687	GCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCGR	HGNC	protein_coding	OTTHUMT00000439676.1	116	0.00	0	G	NM_000160		79768908	79768908	+1	no_errors	ENST00000400723	ensembl	human	known	69_37n	missense	37	56.98	49	SNP	1.000	C
GDF3	9573	genome.wustl.edu	37	12	7842582	7842582	+	Silent	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr12:7842582A>G	ENST00000329913.3	-	2	1034	c.987T>C	c.(985-987)tgT>tgC	p.C329C		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	329					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TGGTGGGGATACACACAGCCT	0.483																																						dbGAP											0													115.0	104.0	107.0					12																	7842582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.987T>C	12.37:g.7842582A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEJ4	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.C329	ENST00000329913.3	37	c.987	CCDS8581.1	12																																																																																			GDF3	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000184344		0.483	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF3	HGNC	protein_coding	OTTHUMT00000399717.1	50	0.00	0	A			7842582	7842582	-1	no_errors	ENST00000329913	ensembl	human	known	69_37n	silent	40	36.92	24	SNP	0.663	G
GDF3	9573	genome.wustl.edu	37	12	7842582	7842582	+	Silent	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr12:7842582A>G	ENST00000329913.3	-	2	1034	c.987T>C	c.(985-987)tgT>tgC	p.C329C		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	329					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TGGTGGGGATACACACAGCCT	0.483																																						dbGAP											0													115.0	104.0	107.0					12																	7842582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.987T>C	12.37:g.7842582A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEJ4	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.C329	ENST00000329913.3	37	c.987	CCDS8581.1	12																																																																																			GDF3	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000184344		0.483	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF3	HGNC	protein_coding	OTTHUMT00000399717.1	78	0.00	0	A			7842582	7842582	-1	no_errors	ENST00000329913	ensembl	human	known	69_37n	silent	40	36.92	24	SNP	0.663	G
GLTSCR1	29998	genome.wustl.edu	37	19	48205643	48205643	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:48205643G>A	ENST00000396720.3	+	15	4848	c.4654G>A	c.(4654-4656)Ggc>Agc	p.G1552S	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1552										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		TCACAACGGTGGCCTCGGCGC	0.746																																						dbGAP											0													8.0	9.0	9.0					19																	48205643		1875	4053	5928	-	-	-	SO:0001583	missense	0			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4654G>A	19.37:g.48205643G>A	ENSP00000379946:p.Gly1552Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MW01	Missense_Mutation	SNP	NULL	p.G1552S	ENST00000396720.3	37	c.4654	CCDS46134.1	19	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893763	0.33442	.	.	ENSG00000063169	ENST00000396720	T	0.32753	1.44	3.51	3.51	0.40186	.	.	.	.	.	T	0.22589	0.0545	N	0.24115	0.695	0.39394	D	0.966469	P	0.35745	0.518	B	0.36504	0.226	T	0.18304	-1.0341	9	0.66056	D	0.02	.	12.0434	0.53466	0.0:0.0:1.0:0.0	.	1552	Q9NZM4	GSCR1_HUMAN	S	1552	ENSP00000379946:G1552S	ENSP00000379946:G1552S	G	+	1	0	GLTSCR1	52897455	1.000000	0.71417	0.977000	0.42913	0.444000	0.32077	3.326000	0.52037	1.772000	0.52199	0.313000	0.20887	GGC	GLTSCR1	-	NULL	ENSG00000063169		0.746	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR1	HGNC	protein_coding	OTTHUMT00000465846.1	22	0.00	0	G	NM_015711		48205643	48205643	+1	no_errors	ENST00000396720	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.949	A
GOLGA8G	283768	genome.wustl.edu	37	15	28775283	28775283	+	Missense_Mutation	SNP	A	A	G	rs529940464	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr15:28775283A>G	ENST00000525590.2	-	4	369	c.308T>C	c.(307-309)gTa>gCa	p.V103A	GOLGA8G_ENST00000329523.6_5'UTR			Q08AF8	GOG8F_HUMAN	golgin A8 family, member G	0						Golgi apparatus (GO:0005794)				lung(1)	1		all_lung(180;1.98e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;4.69e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0201)|GBM - Glioblastoma multiforme(186;0.0503)|Lung(196;0.171)		ACTGACTTTTACGGACCTCGA	0.557													A|||	14	0.00279553	0.0061	0.0014	5008	,	,		28062	0.005		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0					15q13.1	2013-01-17	2010-02-12		ENSG00000183629	ENSG00000183629			25328	other	unknown			"""golgi autoantigen, golgin subfamily a, 8G"""			12477932	Standard	NR_033353		Approved	DKFZp434K052		Q08AF8	OTTHUMG00000167134	ENST00000525590.2:c.308T>C	15.37:g.28775283A>G	ENSP00000458130:p.Val103Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTY1|Q1A5X9|Q8NDK0	Missense_Mutation	SNP	NULL	p.V103A	ENST00000525590.2	37	c.308		15																																																																																			GOLGA8G	-	NULL	ENSG00000183629		0.557	GOLGA8G-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8G	HGNC	protein_coding	OTTHUMT00000393332.2	15	0.00	0	A	NR_033353.1		28775283	28775283	-1	no_errors	ENST00000416855	ensembl	human	known	69_37n	missense	6	33.33	3	SNP	0.908	G
GPR125	166647	genome.wustl.edu	37	4	22439915	22439915	+	Missense_Mutation	SNP	G	G	A	rs147843055		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr4:22439915G>A	ENST00000334304.5	-	8	1318	c.1049C>T	c.(1048-1050)cCt>cTt	p.P350L	GPR125_ENST00000508133.1_Missense_Mutation_p.P124L|GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000502482.1_Missense_Mutation_p.P350L	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	350					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CCTCTCTGGAGGACAGTACTG	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		17210	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													164.0	144.0	150.0					4																	22439915		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1049C>T	4.37:g.22439915G>A	ENSP00000334952:p.Pro350Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like	p.P350L	ENST00000334304.5	37	c.1049	CCDS33964.1	4	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167523	0.57476	.	.	ENSG00000152990	ENST00000334304;ENST00000508133;ENST00000502482;ENST00000514129	T;T;T	0.55760	0.5;0.5;0.5	5.6	5.6	0.85130	GPCR, family 2, extracellular hormone receptor domain (1);	0.054916	0.85682	D	0.000000	T	0.66076	0.2753	M	0.69823	2.125	0.80722	D	1	P;B;B;B	0.43094	0.799;0.343;0.005;0.166	P;B;B;B	0.49561	0.615;0.192;0.007;0.063	T	0.69150	-0.5221	10	0.87932	D	0	-24.3783	19.618	0.95643	0.0:0.0:1.0:0.0	.	225;350;124;350	Q8IWK6-3;Q8IWK6-2;Q8IWK6-4;Q8IWK6	.;.;.;GP125_HUMAN	L	350;124;350;86	ENSP00000334952:P350L;ENSP00000422606:P124L;ENSP00000421006:P350L	ENSP00000334952:P350L	P	-	2	0	GPR125	22049013	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	4.196000	0.58407	2.635000	0.89317	0.650000	0.86243	CCT	GPR125	-	pfscan_GPCR_2_extracellular_dom	ENSG00000152990		0.448	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	37	0.00	0	G			22439915	22439915	-1	no_errors	ENST00000334304	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	1.000	A
GPR125	166647	genome.wustl.edu	37	4	22439915	22439915	+	Missense_Mutation	SNP	G	G	A	rs147843055		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr4:22439915G>A	ENST00000334304.5	-	8	1318	c.1049C>T	c.(1048-1050)cCt>cTt	p.P350L	GPR125_ENST00000508133.1_Missense_Mutation_p.P124L|GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000502482.1_Missense_Mutation_p.P350L	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	350					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CCTCTCTGGAGGACAGTACTG	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		17210	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													164.0	144.0	150.0					4																	22439915		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1049C>T	4.37:g.22439915G>A	ENSP00000334952:p.Pro350Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like	p.P350L	ENST00000334304.5	37	c.1049	CCDS33964.1	4	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167523	0.57476	.	.	ENSG00000152990	ENST00000334304;ENST00000508133;ENST00000502482;ENST00000514129	T;T;T	0.55760	0.5;0.5;0.5	5.6	5.6	0.85130	GPCR, family 2, extracellular hormone receptor domain (1);	0.054916	0.85682	D	0.000000	T	0.66076	0.2753	M	0.69823	2.125	0.80722	D	1	P;B;B;B	0.43094	0.799;0.343;0.005;0.166	P;B;B;B	0.49561	0.615;0.192;0.007;0.063	T	0.69150	-0.5221	10	0.87932	D	0	-24.3783	19.618	0.95643	0.0:0.0:1.0:0.0	.	225;350;124;350	Q8IWK6-3;Q8IWK6-2;Q8IWK6-4;Q8IWK6	.;.;.;GP125_HUMAN	L	350;124;350;86	ENSP00000334952:P350L;ENSP00000422606:P124L;ENSP00000421006:P350L	ENSP00000334952:P350L	P	-	2	0	GPR125	22049013	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	4.196000	0.58407	2.635000	0.89317	0.650000	0.86243	CCT	GPR125	-	pfscan_GPCR_2_extracellular_dom	ENSG00000152990		0.448	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	92	0.00	0	G			22439915	22439915	-1	no_errors	ENST00000334304	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	1.000	A
HOOK2	29911	genome.wustl.edu	37	19	12885350	12885350	+	Intron	DEL	A	A	-			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:12885350delA	ENST00000397668.3	-	3	278				HOOK2_ENST00000264827.5_Intron|HOOK2_ENST00000589965.1_5'UTR	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2						early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						tccatagatgaatggatgaac	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.204+132T>-	19.37:g.12885350delA		Somatic		WXS	Illumina GAIIx	Phase_IV	O60562	RNA	DEL	-	NULL	ENST00000397668.3	37	NULL	CCDS42508.1	19																																																																																			HOOK2	-	-	ENSG00000095066		0.517	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	82	0.00	0	A	NM_013312		12885350	12885350	-1	no_errors	ENST00000589965	ensembl	human	known	69_37n	rna	102	28.17	40	DEL	0.000	-
HOOK2	29911	genome.wustl.edu	37	19	12885350	12885350	+	Intron	DEL	A	A	-			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:12885350delA	ENST00000397668.3	-	3	278				HOOK2_ENST00000264827.5_Intron|HOOK2_ENST00000589965.1_5'UTR	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2						early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						tccatagatgaatggatgaac	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.204+132T>-	19.37:g.12885350delA		Somatic		WXS	Illumina GAIIx	Phase_IV	O60562	RNA	DEL	-	NULL	ENST00000397668.3	37	NULL	CCDS42508.1	19																																																																																			HOOK2	-	-	ENSG00000095066		0.517	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	163	0.00	0	A	NM_013312		12885350	12885350	-1	no_errors	ENST00000589965	ensembl	human	known	69_37n	rna	102	28.17	40	DEL	0.000	-
KANK2	25959	genome.wustl.edu	37	19	11289299	11289299	+	Silent	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:11289299G>T	ENST00000586659.1	-	5	1661	c.1347C>A	c.(1345-1347)acC>acA	p.T449T	KANK2_ENST00000589894.1_Silent_p.T449T|KANK2_ENST00000355150.5_Silent_p.T449T|KANK2_ENST00000589359.1_Silent_p.T449T|KANK2_ENST00000432929.2_Silent_p.T449T			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	449					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TGGGCTCCTGGGTGGGCACTC	0.677																																						dbGAP											0													37.0	40.0	39.0					19																	11289299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1347C>A	19.37:g.11289299G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Silent	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T449	ENST00000586659.1	37	c.1347	CCDS12255.1	19																																																																																			KANK2	-	NULL	ENSG00000197256		0.677	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	90	0.00	0	G	NM_015493		11289299	11289299	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	silent	105	33.75	54	SNP	0.000	T
KANK2	25959	genome.wustl.edu	37	19	11289299	11289299	+	Silent	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:11289299G>T	ENST00000586659.1	-	5	1661	c.1347C>A	c.(1345-1347)acC>acA	p.T449T	KANK2_ENST00000589894.1_Silent_p.T449T|KANK2_ENST00000355150.5_Silent_p.T449T|KANK2_ENST00000589359.1_Silent_p.T449T|KANK2_ENST00000432929.2_Silent_p.T449T			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	449					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TGGGCTCCTGGGTGGGCACTC	0.677																																						dbGAP											0													37.0	40.0	39.0					19																	11289299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1347C>A	19.37:g.11289299G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Silent	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T449	ENST00000586659.1	37	c.1347	CCDS12255.1	19																																																																																			KANK2	-	NULL	ENSG00000197256		0.677	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	141	0.00	0	G	NM_015493		11289299	11289299	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	silent	105	33.75	54	SNP	0.000	T
KRTAP16-1	100505753	genome.wustl.edu	37	17	39464736	39464736	+	Missense_Mutation	SNP	C	C	G	rs2074284	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:39464736C>G	ENST00000391352.1	-	1	769	c.770G>C	c.(769-771)aGt>aCt	p.S257T		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	257	11 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						CTCTGAGCAACTTGGCTCACA	0.607													G|||	1605	0.320487	0.4818	0.1974	5008	,	,		22646	0.371		0.2634	False		,,,				2504	0.1963					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.770G>C	17.37:g.39464736C>G	ENSP00000375147:p.Ser257Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S257T	ENST00000391352.1	37	c.770	CCDS56032.1	17	717	0.3282967032967033	229	0.4654471544715447	79	0.21823204419889503	206	0.36013986013986016	203	0.2678100263852243	G	3.035	-0.198720	0.06219	.	.	ENSG00000212657	ENST00000391352	T	0.01787	4.64	5.1	4.13	0.48395	.	.	.	.	.	T	0.00012	0.0000	L	0.34521	1.04	0.51482	P	7.599999999996498E-5	.	.	.	.	.	.	T	0.19160	-1.0314	6	0.23891	T	0.37	.	3.6587	0.08230	0.0883:0.1689:0.5671:0.1757	rs2074284;rs2074284	.	.	.	T	257	ENSP00000375147:S257T	ENSP00000375147:S257T	S	-	2	0	KRTAP16-1	36718262	0.176000	0.23096	0.878000	0.34440	0.005000	0.04900	1.025000	0.30090	1.527000	0.49086	-0.120000	0.15030	AGT	KRTAP16-1	-	NULL	ENSG00000212657		0.607	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP16-1	HGNC	protein_coding	OTTHUMT00000257785.1	45	0.00	0	C	NM_001146182		39464736	39464736	-1	no_errors	ENST00000391352	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.831	G
LEMD2	221496	genome.wustl.edu	37	6	33747884	33747884	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr6:33747884C>T	ENST00000293760.5	-	5	1022	c.1003G>A	c.(1003-1005)Ggc>Agc	p.G335S	LEMD2_ENST00000502643.1_5'UTR|LEMD2_ENST00000508327.1_Missense_Mutation_p.G33S	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	335					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						CACCAGATGCCCACGTCCTTG	0.597																																						dbGAP											0													142.0	89.0	107.0					6																	33747884		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.1003G>A	6.37:g.33747884C>T	ENSP00000293760:p.Gly335Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVH5|E7EVT2|Q5T972|Q5T974	Nonsense_Mutation	SNP	pfam_Inner-Nucl-membr_MAN1	p.W200*	ENST00000293760.5	37	c.600	CCDS4785.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.304848|5.304848	0.95601|0.95601	.|.	.|.	ENSG00000161904|ENSG00000161904	ENST00000293760;ENST00000508327;ENST00000513701|ENST00000442696	.|.	.|.	.|.	5.79|5.79	5.79|5.79	0.91817|0.91817	Inner nuclear membrane protein MAN1 (1);|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|.	0.70272|.	0.3205|.	M|M	0.72118|0.72118	2.19|2.19	0.48975|0.48975	D|D	0.999735|0.999735	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|.	0.68465|.	-0.5401|.	9|.	0.32370|.	T|.	0.25|.	-11.6054|-11.6054	18.2279|18.2279	0.89924|0.89924	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	335;296|.	Q8NC56;A8MS91|.	LEMD2_HUMAN;.|.	S|X	335;33;33|200	.|.	ENSP00000293760:G335S|.	G|W	-|-	1|3	0|0	LEMD2|LEMD2	33855862|33855862	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.227000|3.227000	0.51262|0.51262	2.722000|2.722000	0.93159|0.93159	0.655000|0.655000	0.94253|0.94253	GGC|TGG	LEMD2	-	pfam_Inner-Nucl-membr_MAN1	ENSG00000161904		0.597	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEMD2	HGNC	protein_coding	OTTHUMT00000040209.3	102	0.00	0	C	XM_166338		33747884	33747884	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000442696	ensembl	human	novel	69_37n	nonsense	229	12.88	34	SNP	1.000	T
LEMD2	221496	genome.wustl.edu	37	6	33747884	33747884	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:33747884C>T	ENST00000293760.5	-	5	1022	c.1003G>A	c.(1003-1005)Ggc>Agc	p.G335S	LEMD2_ENST00000502643.1_5'UTR|LEMD2_ENST00000508327.1_Missense_Mutation_p.G33S	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	335					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						CACCAGATGCCCACGTCCTTG	0.597																																						dbGAP											0													142.0	89.0	107.0					6																	33747884		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.1003G>A	6.37:g.33747884C>T	ENSP00000293760:p.Gly335Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVH5|E7EVT2|Q5T972|Q5T974	Nonsense_Mutation	SNP	pfam_Inner-Nucl-membr_MAN1	p.W200*	ENST00000293760.5	37	c.600	CCDS4785.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.304848|5.304848	0.95601|0.95601	.|.	.|.	ENSG00000161904|ENSG00000161904	ENST00000293760;ENST00000508327;ENST00000513701|ENST00000442696	.|.	.|.	.|.	5.79|5.79	5.79|5.79	0.91817|0.91817	Inner nuclear membrane protein MAN1 (1);|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|.	0.70272|.	0.3205|.	M|M	0.72118|0.72118	2.19|2.19	0.48975|0.48975	D|D	0.999735|0.999735	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|.	0.68465|.	-0.5401|.	9|.	0.32370|.	T|.	0.25|.	-11.6054|-11.6054	18.2279|18.2279	0.89924|0.89924	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	335;296|.	Q8NC56;A8MS91|.	LEMD2_HUMAN;.|.	S|X	335;33;33|200	.|.	ENSP00000293760:G335S|.	G|W	-|-	1|3	0|0	LEMD2|LEMD2	33855862|33855862	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.227000|3.227000	0.51262|0.51262	2.722000|2.722000	0.93159|0.93159	0.655000|0.655000	0.94253|0.94253	GGC|TGG	LEMD2	-	pfam_Inner-Nucl-membr_MAN1	ENSG00000161904		0.597	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEMD2	HGNC	protein_coding	OTTHUMT00000040209.3	194	0.00	0	C	XM_166338		33747884	33747884	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000442696	ensembl	human	novel	69_37n	nonsense	229	12.88	34	SNP	1.000	T
LGALS12	85329	genome.wustl.edu	37	11	63279229	63279229	+	Silent	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr11:63279229G>T	ENST00000394618.3	+	7	921	c.630G>T	c.(628-630)gtG>gtT	p.V210V	LGALS12_ENST00000255684.5_Silent_p.V201V|LGALS12_ENST00000415491.2_Silent_p.V149V|LGALS12_ENST00000425950.2_Silent_p.V140V|LGALS12_ENST00000340246.5_Silent_p.V211V	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	210					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						TTCAGGAGGTGCCCTGCTCAC	0.607																																						dbGAP											0													91.0	77.0	82.0					11																	63279229		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.630G>T	11.37:g.63279229G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.V211	ENST00000394618.3	37	c.633	CCDS8045.1	11																																																																																			LGALS12	-	superfamily_ConA-like_lec_gl	ENSG00000133317		0.607	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LGALS12	HGNC	protein_coding	OTTHUMT00000396378.1	39	0.00	0	G	NM_033101		63279229	63279229	+1	no_errors	ENST00000340246	ensembl	human	known	69_37n	silent	44	20.00	11	SNP	0.982	T
LGALS12	85329	genome.wustl.edu	37	11	63279229	63279229	+	Silent	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr11:63279229G>T	ENST00000394618.3	+	7	921	c.630G>T	c.(628-630)gtG>gtT	p.V210V	LGALS12_ENST00000255684.5_Silent_p.V201V|LGALS12_ENST00000415491.2_Silent_p.V149V|LGALS12_ENST00000425950.2_Silent_p.V140V|LGALS12_ENST00000340246.5_Silent_p.V211V	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	210					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						TTCAGGAGGTGCCCTGCTCAC	0.607																																						dbGAP											0													91.0	77.0	82.0					11																	63279229		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.630G>T	11.37:g.63279229G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.V211	ENST00000394618.3	37	c.633	CCDS8045.1	11																																																																																			LGALS12	-	superfamily_ConA-like_lec_gl	ENSG00000133317		0.607	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LGALS12	HGNC	protein_coding	OTTHUMT00000396378.1	67	0.00	0	G	NM_033101		63279229	63279229	+1	no_errors	ENST00000340246	ensembl	human	known	69_37n	silent	44	20.00	11	SNP	0.982	T
FAM230C	26080	genome.wustl.edu	37	22	21662663	21662663	+	lincRNA	SNP	T	T	C	rs7289101		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr22:21662663T>C	ENST00000436681.1	-	0	1507																											tagttacatatgtatacatgt	0.448																																						dbGAP											0																																										-	-	-			0																															22.37:g.21662663T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			LINC00281	-	-	ENSG00000206142		0.448	KB-1183D5.13-003	KNOWN	basic	lincRNA	LINC00281	HGNC	lincRNA	OTTHUMT00000320109.1	24	0.00	0	T			21662663	21662663	-1	no_errors	ENST00000436681	ensembl	human	known	69_37n	rna	8	42.86	6	SNP	0.546	C
LNX1	84708	genome.wustl.edu	37	4	54327695	54327695	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr4:54327695A>G	ENST00000263925.7	-	10	2272	c.1958T>C	c.(1957-1959)aTt>aCt	p.I653T	LNX1_ENST00000306888.2_Missense_Mutation_p.I557T|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	653	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			ACCTCCTACAATGCAGAAGCC	0.343																																						dbGAP											0													92.0	88.0	89.0					4																	54327695		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1958T>C	4.37:g.54327695A>G	ENSP00000263925:p.Ile653Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.I653T	ENST00000263925.7	37	c.1958	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	A	24.0	4.479507	0.84747	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.52526	0.66;0.66	5.4	5.4	0.78164	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.79429	0.4444	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86742	0.1955	10	0.87932	D	0	.	15.7272	0.77770	1.0:0.0:0.0:0.0	.	653;557	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	T	557;491;653	ENSP00000302879:I557T;ENSP00000263925:I653T	ENSP00000263925:I653T	I	-	2	0	LNX1	54022452	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.910000	0.92685	2.176000	0.68965	0.528000	0.53228	ATT	LNX1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000072201		0.343	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	32	0.00	0	A			54327695	54327695	-1	no_errors	ENST00000263925	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	1.000	G
LNX1	84708	genome.wustl.edu	37	4	54327695	54327695	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr4:54327695A>G	ENST00000263925.7	-	10	2272	c.1958T>C	c.(1957-1959)aTt>aCt	p.I653T	LNX1_ENST00000306888.2_Missense_Mutation_p.I557T|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	653	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			ACCTCCTACAATGCAGAAGCC	0.343																																						dbGAP											0													92.0	88.0	89.0					4																	54327695		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1958T>C	4.37:g.54327695A>G	ENSP00000263925:p.Ile653Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.I653T	ENST00000263925.7	37	c.1958	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	A	24.0	4.479507	0.84747	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.52526	0.66;0.66	5.4	5.4	0.78164	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.79429	0.4444	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86742	0.1955	10	0.87932	D	0	.	15.7272	0.77770	1.0:0.0:0.0:0.0	.	653;557	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	T	557;491;653	ENSP00000302879:I557T;ENSP00000263925:I653T	ENSP00000263925:I653T	I	-	2	0	LNX1	54022452	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.910000	0.92685	2.176000	0.68965	0.528000	0.53228	ATT	LNX1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000072201		0.343	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	53	0.00	0	A			54327695	54327695	-1	no_errors	ENST00000263925	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	1.000	G
LRRC1	55227	genome.wustl.edu	37	6	53784344	53784344	+	Silent	SNP	G	G	A	rs373399190		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr6:53784344G>A	ENST00000370888.1	+	12	1432	c.1155G>A	c.(1153-1155)ctG>ctA	p.L385L	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	385						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		TGAAGGCTCTGTGGCTATCTG	0.418																																						dbGAP											0													92.0	84.0	86.0					6																	53784344		1929	4142	6071	-	-	-	SO:0001819	synonymous_variant	0			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1155G>A	6.37:g.53784344G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGN3|Q9HAC0|Q9NVF1	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L385	ENST00000370888.1	37	c.1155	CCDS4953.2	6																																																																																			LRRC1	-	NULL	ENSG00000137269		0.418	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC1	HGNC	protein_coding	OTTHUMT00000040970.2	55	0.00	0	G	NM_025168		53784344	53784344	+1	no_errors	ENST00000370888	ensembl	human	known	69_37n	silent	45	29.69	19	SNP	0.997	A
LRRC1	55227	genome.wustl.edu	37	6	53784344	53784344	+	Silent	SNP	G	G	A	rs373399190		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:53784344G>A	ENST00000370888.1	+	12	1432	c.1155G>A	c.(1153-1155)ctG>ctA	p.L385L	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	385						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		TGAAGGCTCTGTGGCTATCTG	0.418																																						dbGAP											0													92.0	84.0	86.0					6																	53784344		1929	4142	6071	-	-	-	SO:0001819	synonymous_variant	0			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1155G>A	6.37:g.53784344G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGN3|Q9HAC0|Q9NVF1	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L385	ENST00000370888.1	37	c.1155	CCDS4953.2	6																																																																																			LRRC1	-	NULL	ENSG00000137269		0.418	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC1	HGNC	protein_coding	OTTHUMT00000040970.2	95	0.00	0	G	NM_025168		53784344	53784344	+1	no_errors	ENST00000370888	ensembl	human	known	69_37n	silent	45	29.69	19	SNP	0.997	A
MAT1A	4143	genome.wustl.edu	37	10	82034939	82034939	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr10:82034939G>T	ENST00000372213.3	-	7	1045	c.785C>A	c.(784-786)aCt>aAt	p.T262N	MAT1A_ENST00000485270.1_5'UTR	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	262					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CTTACGGCCAGTGACACCCGC	0.577																																						dbGAP											0													34.0	28.0	30.0					10																	82034939		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.785C>A	10.37:g.82034939G>T	ENSP00000361287:p.Thr262Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWD5|Q5QP09	Missense_Mutation	SNP	pfam_S-AdoMet_synt_C,pfam_S-AdoMet_synt_central,pfam_S-AdoMet_synt_N,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	p.T262N	ENST00000372213.3	37	c.785	CCDS7365.1	10	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575887	0.86645	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.98684	-5.07	4.91	4.91	0.64330	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99591	0.9852	H	0.99619	4.66	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.97370	0.9975	10	0.87932	D	0	-21.2477	15.9505	0.79830	0.0:0.0:1.0:0.0	.	262	Q00266	METK1_HUMAN	N	262	ENSP00000361287:T262N	ENSP00000361280:T262N	T	-	2	0	MAT1A	82024919	1.000000	0.71417	0.991000	0.47740	0.962000	0.63368	9.476000	0.97823	2.443000	0.82685	0.655000	0.94253	ACT	MAT1A	-	pfam_S-AdoMet_synt_C,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	ENSG00000151224		0.577	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT1A	HGNC	protein_coding	OTTHUMT00000049070.1	39	0.00	0	G	NM_000429		82034939	82034939	-1	no_errors	ENST00000372206	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	1.000	T
MAT1A	4143	genome.wustl.edu	37	10	82034939	82034939	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr10:82034939G>T	ENST00000372213.3	-	7	1045	c.785C>A	c.(784-786)aCt>aAt	p.T262N	MAT1A_ENST00000485270.1_5'UTR	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	262					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CTTACGGCCAGTGACACCCGC	0.577																																						dbGAP											0													34.0	28.0	30.0					10																	82034939		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.785C>A	10.37:g.82034939G>T	ENSP00000361287:p.Thr262Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWD5|Q5QP09	Missense_Mutation	SNP	pfam_S-AdoMet_synt_C,pfam_S-AdoMet_synt_central,pfam_S-AdoMet_synt_N,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	p.T262N	ENST00000372213.3	37	c.785	CCDS7365.1	10	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575887	0.86645	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.98684	-5.07	4.91	4.91	0.64330	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99591	0.9852	H	0.99619	4.66	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.97370	0.9975	10	0.87932	D	0	-21.2477	15.9505	0.79830	0.0:0.0:1.0:0.0	.	262	Q00266	METK1_HUMAN	N	262	ENSP00000361287:T262N	ENSP00000361280:T262N	T	-	2	0	MAT1A	82024919	1.000000	0.71417	0.991000	0.47740	0.962000	0.63368	9.476000	0.97823	2.443000	0.82685	0.655000	0.94253	ACT	MAT1A	-	pfam_S-AdoMet_synt_C,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	ENSG00000151224		0.577	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT1A	HGNC	protein_coding	OTTHUMT00000049070.1	69	0.00	0	G	NM_000429		82034939	82034939	-1	no_errors	ENST00000372206	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	1.000	T
MCM9	254394	genome.wustl.edu	37	6	119136169	119136169	+	Silent	SNP	T	T	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr6:119136169T>G	ENST00000316316.6	-	13	3536	c.3250A>C	c.(3250-3252)Aga>Cga	p.R1084R		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	1084					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		CTTGGGCCTCTCTCACCTCGG	0.498																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.3250A>C	6.37:g.119136169T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Silent	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase	p.R1084	ENST00000316316.6	37	c.3250	CCDS56447.1	6																																																																																			MCM9	-	NULL	ENSG00000111877		0.498	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	HGNC	protein_coding	OTTHUMT00000042005.4	39	0.00	0	T	NM_153255		119136169	119136169	-1	no_errors	ENST00000316316	ensembl	human	known	69_37n	silent	38	33.33	19	SNP	0.004	G
MCM9	254394	genome.wustl.edu	37	6	119136169	119136169	+	Silent	SNP	T	T	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:119136169T>G	ENST00000316316.6	-	13	3536	c.3250A>C	c.(3250-3252)Aga>Cga	p.R1084R		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	1084					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		CTTGGGCCTCTCTCACCTCGG	0.498																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.3250A>C	6.37:g.119136169T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Silent	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase	p.R1084	ENST00000316316.6	37	c.3250	CCDS56447.1	6																																																																																			MCM9	-	NULL	ENSG00000111877		0.498	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	HGNC	protein_coding	OTTHUMT00000042005.4	88	0.00	0	T	NM_153255		119136169	119136169	-1	no_errors	ENST00000316316	ensembl	human	known	69_37n	silent	38	33.33	19	SNP	0.004	G
MGAM	8972	genome.wustl.edu	37	7	141738387	141738387	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr7:141738387G>A	ENST00000549489.2	+	19	2383	c.2288G>A	c.(2287-2289)gGc>gAc	p.G763D	MGAM_ENST00000475668.2_Missense_Mutation_p.G763D	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	763	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGGGGGCCCGGCCTCCTCATC	0.507																																						dbGAP											0													54.0	57.0	56.0					7																	141738387		1947	4145	6092	-	-	-	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2288G>A	7.37:g.141738387G>A	ENSP00000447378:p.Gly763Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.G763D	ENST00000549489.2	37	c.2288	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388322	0.61956	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.90844	-2.74	5.33	4.43	0.53597	.	0.000000	0.51477	D	0.000093	D	0.92512	0.7622	L	0.42008	1.315	0.20403	N	0.999907	D	0.67145	0.996	D	0.64776	0.929	D	0.87095	0.2175	10	0.72032	D	0.01	.	15.0818	0.72119	0.0:0.1429:0.8571:0.0	.	763	O43451	MGA_HUMAN	D	763;763;640	ENSP00000447378:G763D	ENSP00000316431:G640D	G	+	2	0	MGAM	141384856	0.936000	0.31750	0.833000	0.33012	0.851000	0.48451	3.317000	0.51968	1.354000	0.45846	0.655000	0.94253	GGC	MGAM	-	pfam_Glyco_hydro_31	ENSG00000257335		0.507	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	25	0.00	0	G			141738387	141738387	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	missense	14	62.16	23	SNP	0.279	A
MGAM	8972	genome.wustl.edu	37	7	141738387	141738387	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr7:141738387G>A	ENST00000549489.2	+	19	2383	c.2288G>A	c.(2287-2289)gGc>gAc	p.G763D	MGAM_ENST00000475668.2_Missense_Mutation_p.G763D	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	763	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGGGGGCCCGGCCTCCTCATC	0.507																																						dbGAP											0													54.0	57.0	56.0					7																	141738387		1947	4145	6092	-	-	-	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2288G>A	7.37:g.141738387G>A	ENSP00000447378:p.Gly763Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.G763D	ENST00000549489.2	37	c.2288	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388322	0.61956	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.90844	-2.74	5.33	4.43	0.53597	.	0.000000	0.51477	D	0.000093	D	0.92512	0.7622	L	0.42008	1.315	0.20403	N	0.999907	D	0.67145	0.996	D	0.64776	0.929	D	0.87095	0.2175	10	0.72032	D	0.01	.	15.0818	0.72119	0.0:0.1429:0.8571:0.0	.	763	O43451	MGA_HUMAN	D	763;763;640	ENSP00000447378:G763D	ENSP00000316431:G640D	G	+	2	0	MGAM	141384856	0.936000	0.31750	0.833000	0.33012	0.851000	0.48451	3.317000	0.51968	1.354000	0.45846	0.655000	0.94253	GGC	MGAM	-	pfam_Glyco_hydro_31	ENSG00000257335		0.507	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	52	0.00	0	G			141738387	141738387	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	missense	14	62.16	23	SNP	0.279	A
MGAM	8972	genome.wustl.edu	37	7	141794453	141794453	+	Splice_Site	SNP	A	A	T	rs202001107	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr7:141794453A>T	ENST00000549489.2	+	39	4747	c.4652A>T	c.(4651-4653)tAt>tTt	p.Y1551F	MGAM_ENST00000475668.2_Splice_Site_p.Y2447F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1551	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGCATATCCTATGTGAGTGTC	0.527													a|||	8	0.00159744	0.0061	0.0	5008	,	,		17903	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													120.0	108.0	112.0					7																	141794453		2075	4202	6277	-	-	-	SO:0001630	splice_region_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4653+1A>T	7.37:g.141794453A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.Y1551F	ENST00000549489.2	37	c.4652	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	A	16.16	3.045439	0.55110	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.93859	-3.3	5.15	3.98	0.46160	Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.91143	0.7211	L	0.28400	0.85	0.36228	D	0.852428	P	0.46706	0.883	P	0.50825	0.651	D	0.91753	0.5414	9	0.51188	T	0.08	.	10.8375	0.46696	0.8585:0.0:0.0:0.1415	.	1551	O43451	MGA_HUMAN	F	1551;2448	ENSP00000447378:Y1551F	ENSP00000373973:Y1551F	Y	+	2	0	MGAM	141440922	1.000000	0.71417	1.000000	0.80357	0.321000	0.28281	7.065000	0.76727	0.878000	0.35920	0.533000	0.62120	TAT	MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.527	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	62	0.00	0	A		Missense_Mutation	141794453	141794453	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	missense	98	13.27	15	SNP	1.000	T
MIPEP	4285	genome.wustl.edu	37	13	24411757	24411757	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr13:24411757G>C	ENST00000382172.3	-	13	1575	c.1477C>G	c.(1477-1479)Ctt>Gtt	p.L493V		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	493					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		TCATGGAAAAGATTTTCCATC	0.443																																						dbGAP											0													156.0	148.0	151.0					13																	24411757		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1477C>G	13.37:g.24411757G>C	ENSP00000371607:p.Leu493Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.L493V	ENST00000382172.3	37	c.1477	CCDS9303.1	13	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614188	0.87359	.	.	ENSG00000027001	ENST00000382172	T	0.24908	1.83	5.82	5.82	0.92795	Metallopeptidase, catalytic domain (1);	0.113535	0.64402	D	0.000009	T	0.56834	0.2012	M	0.86097	2.795	0.80722	D	1	D	0.56746	0.977	D	0.63877	0.919	T	0.60115	-0.7326	10	0.62326	D	0.03	.	20.1022	0.97879	0.0:0.0:1.0:0.0	.	493	Q99797	MIPEP_HUMAN	V	493	ENSP00000371607:L493V	ENSP00000371607:L493V	L	-	1	0	MIPEP	23309757	1.000000	0.71417	0.898000	0.35279	0.992000	0.81027	9.727000	0.98787	2.759000	0.94783	0.555000	0.69702	CTT	MIPEP	-	pfam_Pept_M3A_M3B	ENSG00000027001		0.443	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	HGNC	protein_coding	OTTHUMT00000044169.1	40	0.00	0	G			24411757	24411757	-1	no_errors	ENST00000382172	ensembl	human	known	69_37n	missense	29	35.56	16	SNP	1.000	C
MIPEP	4285	genome.wustl.edu	37	13	24411757	24411757	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr13:24411757G>C	ENST00000382172.3	-	13	1575	c.1477C>G	c.(1477-1479)Ctt>Gtt	p.L493V		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	493					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		TCATGGAAAAGATTTTCCATC	0.443																																						dbGAP											0													156.0	148.0	151.0					13																	24411757		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1477C>G	13.37:g.24411757G>C	ENSP00000371607:p.Leu493Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.L493V	ENST00000382172.3	37	c.1477	CCDS9303.1	13	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614188	0.87359	.	.	ENSG00000027001	ENST00000382172	T	0.24908	1.83	5.82	5.82	0.92795	Metallopeptidase, catalytic domain (1);	0.113535	0.64402	D	0.000009	T	0.56834	0.2012	M	0.86097	2.795	0.80722	D	1	D	0.56746	0.977	D	0.63877	0.919	T	0.60115	-0.7326	10	0.62326	D	0.03	.	20.1022	0.97879	0.0:0.0:1.0:0.0	.	493	Q99797	MIPEP_HUMAN	V	493	ENSP00000371607:L493V	ENSP00000371607:L493V	L	-	1	0	MIPEP	23309757	1.000000	0.71417	0.898000	0.35279	0.992000	0.81027	9.727000	0.98787	2.759000	0.94783	0.555000	0.69702	CTT	MIPEP	-	pfam_Pept_M3A_M3B	ENSG00000027001		0.443	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	HGNC	protein_coding	OTTHUMT00000044169.1	72	0.00	0	G			24411757	24411757	-1	no_errors	ENST00000382172	ensembl	human	known	69_37n	missense	29	35.56	16	SNP	1.000	C
ESPN	83715	genome.wustl.edu	37	1	6489937	6489937	+	Intron	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:6489937G>C	ENST00000377828.1	+	2	656				MIR4252_ENST00000585139.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin						locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GGCCTGGACTGATGAGCTGCC	0.642																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.488+1458G>C	1.37:g.6489937G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XYB2|Q9H0A2|Q9Y329	RNA	SNP	-	NULL	ENST00000377828.1	37	NULL	CCDS70.1	1																																																																																			MIR4252	-	-	ENSG00000265392		0.642	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR4252	HGNC	protein_coding	OTTHUMT00000001887.3	42	0.00	0	G	NM_031475		6489937	6489937	-1	no_errors	ENST00000585139	ensembl	human	known	69_37n	rna	24	33.33	12	SNP	0.036	C
ESPN	83715	genome.wustl.edu	37	1	6489937	6489937	+	Intron	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:6489937G>C	ENST00000377828.1	+	2	656				MIR4252_ENST00000585139.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin						locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GGCCTGGACTGATGAGCTGCC	0.642																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.488+1458G>C	1.37:g.6489937G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XYB2|Q9H0A2|Q9Y329	RNA	SNP	-	NULL	ENST00000377828.1	37	NULL	CCDS70.1	1																																																																																			MIR4252	-	-	ENSG00000265392		0.642	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR4252	HGNC	protein_coding	OTTHUMT00000001887.3	78	0.00	0	G	NM_031475		6489937	6489937	-1	no_errors	ENST00000585139	ensembl	human	known	69_37n	rna	24	33.33	12	SNP	0.036	C
MIR4477B	100616194	genome.wustl.edu	37	9	68415338	68415338	+	RNA	SNP	A	A	C	rs75019967		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr9:68415338A>C	ENST00000581659.1	+	0	31					NR_039688.1|NR_039689.1				microRNA 4477b																		aatgtccttaatagcaatcct	0.363																																						dbGAP											0																																										-	-	-			0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68415338A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581659.1	37	NULL		9																																																																																			MIR4477A	-	-	ENSG00000266017		0.363	MIR4477B-201	KNOWN	basic	miRNA	MIR4477A	HGNC	miRNA		12	0.00	0	A	NR_039689		68415338	68415338	+1	no_errors	ENST00000581659	ensembl	human	known	69_37n	rna	10	47.37	9	SNP	0.191	C
MYLK2	85366	genome.wustl.edu	37	20	30422261	30422261	+	3'UTR	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr20:30422261C>A	ENST00000375994.2	+	0	2725				MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_3'UTR			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2						cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GGGCGCCCAGCCCAGGCCTGG	0.677																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.*661C>A	20.37:g.30422261C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q569L1|Q96I84	RNA	SNP	-	NULL	ENST00000375994.2	37	NULL	CCDS13191.1	20																																																																																			MYLK2	-	-	ENSG00000101306		0.677	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYLK2	HGNC	protein_coding	OTTHUMT00000078583.2	27	0.00	0	C	NM_033118		30422261	30422261	+1	no_errors	ENST00000468730	ensembl	human	known	69_37n	rna	32	25.58	11	SNP	1.000	A
MYLK2	85366	genome.wustl.edu	37	20	30422261	30422261	+	3'UTR	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr20:30422261C>A	ENST00000375994.2	+	0	2725				MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_3'UTR			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2						cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GGGCGCCCAGCCCAGGCCTGG	0.677																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.*661C>A	20.37:g.30422261C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q569L1|Q96I84	RNA	SNP	-	NULL	ENST00000375994.2	37	NULL	CCDS13191.1	20																																																																																			MYLK2	-	-	ENSG00000101306		0.677	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYLK2	HGNC	protein_coding	OTTHUMT00000078583.2	47	0.00	0	C	NM_033118		30422261	30422261	+1	no_errors	ENST00000468730	ensembl	human	known	69_37n	rna	32	25.58	11	SNP	1.000	A
NDUFA1	4694	genome.wustl.edu	37	X	119007279	119007279	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chrX:119007279G>A	ENST00000371437.4	+	2	540	c.115G>A	c.(115-117)Gct>Act	p.A39T	RNF113A_ENST00000371442.2_5'Flank	NM_004541.3	NP_004532.1	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa	39					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|large_intestine(2)|stomach(1)	5						AAAAAGGGTTGCTCATTTTGG	0.388																																						dbGAP											0													156.0	138.0	144.0					X																	119007279		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14590.1	Xq24	2011-07-04	2002-08-29		ENSG00000125356	ENSG00000125356		"""Mitochondrial respiratory chain complex / Complex I"""	7683	protein-coding gene	gene with protein product	"""NADH:ubiquinone oxidoreductase (complex 1)"", ""type I dehydrogenase"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"", ""complex I MWFE subunit"""	300078	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"""			8938439	Standard	NM_004541		Approved	MWFE, CI-MWFE	uc004esc.4	O15239	OTTHUMG00000022287	ENST00000371437.4:c.115G>A	X.37:g.119007279G>A	ENSP00000360492:p.Ala39Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_NADH_Ub_cplx-1_asu_su-1	p.A39T	ENST00000371437.4	37	c.115	CCDS14590.1	X	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577298	0.45902	.	.	ENSG00000125356	ENST00000371437	T	0.73258	-0.73	4.88	4.88	0.63580	.	0.109575	0.64402	D	0.000007	D	0.83008	0.5161	.	.	.	0.45676	D	0.998592	D	0.89917	1.0	D	0.87578	0.998	D	0.84887	0.0834	9	0.62326	D	0.03	-15.5417	12.5458	0.56199	0.0:0.0:1.0:0.0	.	39	O15239	NDUA1_HUMAN	T	39	ENSP00000360492:A39T	ENSP00000360492:A39T	A	+	1	0	NDUFA1	118891307	1.000000	0.71417	0.518000	0.27811	0.074000	0.17049	6.058000	0.71126	2.011000	0.59026	0.513000	0.50165	GCT	NDUFA1	-	pirsf_NADH_Ub_cplx-1_asu_su-1	ENSG00000125356		0.388	NDUFA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA1	HGNC	protein_coding	OTTHUMT00000058080.1	48	0.00	0	G	NM_004541		119007279	119007279	+1	no_errors	ENST00000371437	ensembl	human	known	69_37n	missense	86	14.00	14	SNP	0.971	A
NDUFA1	4694	genome.wustl.edu	37	X	119007279	119007279	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chrX:119007279G>A	ENST00000371437.4	+	2	540	c.115G>A	c.(115-117)Gct>Act	p.A39T	RNF113A_ENST00000371442.2_5'Flank	NM_004541.3	NP_004532.1	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa	39					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|large_intestine(2)|stomach(1)	5						AAAAAGGGTTGCTCATTTTGG	0.388																																						dbGAP											0													156.0	138.0	144.0					X																	119007279		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14590.1	Xq24	2011-07-04	2002-08-29		ENSG00000125356	ENSG00000125356		"""Mitochondrial respiratory chain complex / Complex I"""	7683	protein-coding gene	gene with protein product	"""NADH:ubiquinone oxidoreductase (complex 1)"", ""type I dehydrogenase"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"", ""complex I MWFE subunit"""	300078	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"""			8938439	Standard	NM_004541		Approved	MWFE, CI-MWFE	uc004esc.4	O15239	OTTHUMG00000022287	ENST00000371437.4:c.115G>A	X.37:g.119007279G>A	ENSP00000360492:p.Ala39Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_NADH_Ub_cplx-1_asu_su-1	p.A39T	ENST00000371437.4	37	c.115	CCDS14590.1	X	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577298	0.45902	.	.	ENSG00000125356	ENST00000371437	T	0.73258	-0.73	4.88	4.88	0.63580	.	0.109575	0.64402	D	0.000007	D	0.83008	0.5161	.	.	.	0.45676	D	0.998592	D	0.89917	1.0	D	0.87578	0.998	D	0.84887	0.0834	9	0.62326	D	0.03	-15.5417	12.5458	0.56199	0.0:0.0:1.0:0.0	.	39	O15239	NDUA1_HUMAN	T	39	ENSP00000360492:A39T	ENSP00000360492:A39T	A	+	1	0	NDUFA1	118891307	1.000000	0.71417	0.518000	0.27811	0.074000	0.17049	6.058000	0.71126	2.011000	0.59026	0.513000	0.50165	GCT	NDUFA1	-	pirsf_NADH_Ub_cplx-1_asu_su-1	ENSG00000125356		0.388	NDUFA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA1	HGNC	protein_coding	OTTHUMT00000058080.1	89	0.00	0	G	NM_004541		119007279	119007279	+1	no_errors	ENST00000371437	ensembl	human	known	69_37n	missense	86	14.00	14	SNP	0.971	A
NPIPB15	440348	genome.wustl.edu	37	16	74425709	74425709	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr16:74425709C>A	ENST00000429990.1	+	7	1159	c.1063C>A	c.(1063-1065)Cca>Aca	p.P355T				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	355	Pro-rich.					extracellular region (GO:0005576)											ggcggaaaaaccacccaaacc	0.562																																						dbGAP											0													38.0	43.0	41.0					16																	74425709		1973	4158	6131	-	-	-	SO:0001583	missense	0			BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1063C>A	16.37:g.74425709C>A	ENSP00000411140:p.Pro355Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J9U8	Missense_Mutation	SNP	pfam_NPIP	p.P355T	ENST00000429990.1	37	c.1063		16	.	.	.	.	.	.	.	.	.	.	c	6.285	0.420645	0.11928	.	.	ENSG00000196436	ENST00000504746;ENST00000429990	T	0.59772	0.24	.	.	.	.	.	.	.	.	T	0.32436	0.0829	N	0.19112	0.55	0.20703	N	0.999869	P	0.45078	0.85	B	0.35114	0.196	T	0.23940	-1.0174	8	0.72032	D	0.01	.	2.6645	0.05037	0.0:0.505:0.0:0.495	.	294	A6NHN6	NPPL2_HUMAN	T	233;355	ENSP00000411140:P355T	ENSP00000411140:P355T	P	+	1	0	NPIPL2	72983210	0.032000	0.19561	0.020000	0.16555	0.020000	0.10135	0.064000	0.14437	0.073000	0.16731	0.074000	0.15403	CCA	NPIPL2	-	NULL	ENSG00000196436		0.562	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPL2	HGNC	protein_coding	OTTHUMT00000346597.2	279	0.00	0	C	NM_001018059		74425709	74425709	+1	no_errors	ENST00000429990	ensembl	human	known	69_37n	missense	296	20.43	76	SNP	0.936	A
NPIPB15	440348	genome.wustl.edu	37	16	74425709	74425709	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr16:74425709C>A	ENST00000429990.1	+	7	1159	c.1063C>A	c.(1063-1065)Cca>Aca	p.P355T				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	355	Pro-rich.					extracellular region (GO:0005576)											ggcggaaaaaccacccaaacc	0.562																																						dbGAP											0													38.0	43.0	41.0					16																	74425709		1973	4158	6131	-	-	-	SO:0001583	missense	0			BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1063C>A	16.37:g.74425709C>A	ENSP00000411140:p.Pro355Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J9U8	Missense_Mutation	SNP	pfam_NPIP	p.P355T	ENST00000429990.1	37	c.1063		16	.	.	.	.	.	.	.	.	.	.	c	6.285	0.420645	0.11928	.	.	ENSG00000196436	ENST00000504746;ENST00000429990	T	0.59772	0.24	.	.	.	.	.	.	.	.	T	0.32436	0.0829	N	0.19112	0.55	0.20703	N	0.999869	P	0.45078	0.85	B	0.35114	0.196	T	0.23940	-1.0174	8	0.72032	D	0.01	.	2.6645	0.05037	0.0:0.505:0.0:0.495	.	294	A6NHN6	NPPL2_HUMAN	T	233;355	ENSP00000411140:P355T	ENSP00000411140:P355T	P	+	1	0	NPIPL2	72983210	0.032000	0.19561	0.020000	0.16555	0.020000	0.10135	0.064000	0.14437	0.073000	0.16731	0.074000	0.15403	CCA	NPIPL2	-	NULL	ENSG00000196436		0.562	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPL2	HGNC	protein_coding	OTTHUMT00000346597.2	573	0.17	1	C	NM_001018059		74425709	74425709	+1	no_errors	ENST00000429990	ensembl	human	known	69_37n	missense	296	20.43	76	SNP	0.936	A
NT5DC3	51559	genome.wustl.edu	37	12	104174077	104174077	+	Splice_Site	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr12:104174077C>G	ENST00000392876.3	-	13	1435		c.e13+1			NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3							cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						GCCTCTCTTACCGCATCTCCT	0.498																																						dbGAP											0													273.0	226.0	242.0					12																	104174077		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1394+1G>C	12.37:g.104174077C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NUM7|Q9P2T2|Q9P2T3	Splice_Site	SNP	-	e13+1	ENST00000392876.3	37	c.1394+1	CCDS41824.1	12	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575301	0.65878	.	.	ENSG00000111696	ENST00000392876	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6592	0.91467	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NT5DC3	102698207	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	7.326000	0.79133	2.497000	0.84241	0.655000	0.94253	.	NT5DC3	-	-	ENSG00000111696		0.498	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5DC3	HGNC	protein_coding	OTTHUMT00000347118.2	70	0.00	0	C	NM_016575	Intron	104174077	104174077	-1	no_errors	ENST00000392876	ensembl	human	known	69_37n	splice_site	40	55.06	49	SNP	1.000	G
NT5DC3	51559	genome.wustl.edu	37	12	104174077	104174077	+	Splice_Site	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr12:104174077C>G	ENST00000392876.3	-	13	1435		c.e13+1			NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3							cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						GCCTCTCTTACCGCATCTCCT	0.498																																						dbGAP											0													273.0	226.0	242.0					12																	104174077		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1394+1G>C	12.37:g.104174077C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NUM7|Q9P2T2|Q9P2T3	Splice_Site	SNP	-	e13+1	ENST00000392876.3	37	c.1394+1	CCDS41824.1	12	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575301	0.65878	.	.	ENSG00000111696	ENST00000392876	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6592	0.91467	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NT5DC3	102698207	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	7.326000	0.79133	2.497000	0.84241	0.655000	0.94253	.	NT5DC3	-	-	ENSG00000111696		0.498	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5DC3	HGNC	protein_coding	OTTHUMT00000347118.2	143	0.00	0	C	NM_016575	Intron	104174077	104174077	-1	no_errors	ENST00000392876	ensembl	human	known	69_37n	splice_site	40	55.06	49	SNP	1.000	G
NWD1	284434	genome.wustl.edu	37	19	16842052	16842052	+	Missense_Mutation	SNP	G	G	T	rs8107776	byFrequency	TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:16842052G>T	ENST00000552788.1	+	1	44	c.44G>T	c.(43-45)tGc>tTc	p.C15F	NWD1_ENST00000549814.1_Missense_Mutation_p.C15F|NWD1_ENST00000379808.3_Missense_Mutation_p.C15F|NWD1_ENST00000523826.1_5'UTR|NWD1_ENST00000524140.2_Missense_Mutation_p.C15F			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	15				C -> F (in Ref. 1; CAH18655). {ECO:0000305}.			ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACCCTGAAGTGCCAGACCTTC	0.498													g|||	2480	0.495208	0.6407	0.3718	5008	,	,		16503	0.2619		0.6133	False		,,,				2504	0.5051					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.44G>T	19.37:g.16842052G>T	ENSP00000447224:p.Cys15Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C15F	ENST00000552788.1	37	c.44		19	1082	0.49542124542124544	313	0.6361788617886179	159	0.43922651933701656	153	0.2674825174825175	457	0.6029023746701847	g	7.655	0.683798	0.14907	.	.	ENSG00000188039	ENST00000524140;ENST00000549814;ENST00000379808;ENST00000552788	T;T;T;T	0.55413	0.52;0.58;0.52;0.58	4.68	-2.14	0.07123	.	1.465170	0.04678	N	0.411842	T	0.00012	0.0000	N	0.08118	0	0.20489	P	0.999892517	B	0.02656	0.0	B	0.01281	0.0	T	0.43589	-0.9382	9	0.08599	T	0.76	.	2.026	0.03519	0.1803:0.2826:0.3931:0.144	rs8107776;rs56832634	15	Q149M9-3	.	F	15	ENSP00000428579:C15F;ENSP00000447548:C15F;ENSP00000369136:C15F;ENSP00000447224:C15F	ENSP00000369136:C15F	C	+	2	0	NWD1	16703052	0.993000	0.37304	0.418000	0.26571	0.470000	0.32858	0.024000	0.13555	-0.140000	0.11394	0.437000	0.28790	TGC	NWD1	-	NULL	ENSG00000188039		0.498	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	30	0.00	0	G	NM_001007525		16842052	16842052	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.578	T
NXF4	55999	genome.wustl.edu	37	X	101826461	101826461	+	RNA	SNP	A	A	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chrX:101826461A>C	ENST00000360035.2	+	0	3455					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						TACCAGCCTAAGGCCGTGCCC	0.498																																						dbGAP											0																																										-	-	-			0			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101826461A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			NXF4	-	-	ENSG00000196970		0.498	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	24	0.00	0	A			101826461	101826461	+1	no_errors	ENST00000360035	ensembl	human	known	69_37n	rna	22	38.89	14	SNP	0.002	C
NXF4	55999	genome.wustl.edu	37	X	101826461	101826461	+	RNA	SNP	A	A	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chrX:101826461A>C	ENST00000360035.2	+	0	3455					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						TACCAGCCTAAGGCCGTGCCC	0.498																																						dbGAP											0																																										-	-	-			0			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101826461A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			NXF4	-	-	ENSG00000196970		0.498	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	52	0.00	0	A			101826461	101826461	+1	no_errors	ENST00000360035	ensembl	human	known	69_37n	rna	22	38.89	14	SNP	0.002	C
OR11G2	390439	genome.wustl.edu	37	14	20665929	20665929	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr14:20665929G>C	ENST00000357366.3	+	1	435	c.435G>C	c.(433-435)ttG>ttC	p.L145F		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TCTTCTCCTTGGGCTCTACAG	0.498																																						dbGAP											0													66.0	62.0	64.0					14																	20665929		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.435G>C	14.37:g.20665929G>C	ENSP00000349930:p.Leu145Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF09|Q96R33	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L145F	ENST00000357366.3	37	c.435	CCDS32032.1	14	.	.	.	.	.	.	.	.	.	.	g	9.301	1.053010	0.19907	.	.	ENSG00000196832	ENST00000357366	T	0.03496	3.91	4.93	0.694	0.18062	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38326	N	0.001724	T	0.02571	0.0078	L	0.35414	1.06	0.23227	N	0.998083	B	0.26775	0.159	B	0.30105	0.111	T	0.45205	-0.9277	10	0.17369	T	0.5	.	3.4434	0.07472	0.2709:0.0:0.3163:0.4128	.	145	Q8NGC1	O11G2_HUMAN	F	145	ENSP00000349930:L145F	ENSP00000349930:L145F	L	+	3	2	OR11G2	19735769	0.000000	0.05858	1.000000	0.80357	0.962000	0.63368	-0.495000	0.06443	0.264000	0.21851	-0.145000	0.13849	TTG	OR11G2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196832		0.498	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR11G2	HGNC	protein_coding	OTTHUMT00000395722.1	50	0.00	0	G			20665929	20665929	+1	no_errors	ENST00000357366	ensembl	human	known	69_37n	missense	42	39.13	27	SNP	0.974	C
OR11G2	390439	genome.wustl.edu	37	14	20665929	20665929	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr14:20665929G>C	ENST00000357366.3	+	1	435	c.435G>C	c.(433-435)ttG>ttC	p.L145F		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TCTTCTCCTTGGGCTCTACAG	0.498																																						dbGAP											0													66.0	62.0	64.0					14																	20665929		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.435G>C	14.37:g.20665929G>C	ENSP00000349930:p.Leu145Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF09|Q96R33	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L145F	ENST00000357366.3	37	c.435	CCDS32032.1	14	.	.	.	.	.	.	.	.	.	.	g	9.301	1.053010	0.19907	.	.	ENSG00000196832	ENST00000357366	T	0.03496	3.91	4.93	0.694	0.18062	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38326	N	0.001724	T	0.02571	0.0078	L	0.35414	1.06	0.23227	N	0.998083	B	0.26775	0.159	B	0.30105	0.111	T	0.45205	-0.9277	10	0.17369	T	0.5	.	3.4434	0.07472	0.2709:0.0:0.3163:0.4128	.	145	Q8NGC1	O11G2_HUMAN	F	145	ENSP00000349930:L145F	ENSP00000349930:L145F	L	+	3	2	OR11G2	19735769	0.000000	0.05858	1.000000	0.80357	0.962000	0.63368	-0.495000	0.06443	0.264000	0.21851	-0.145000	0.13849	TTG	OR11G2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196832		0.498	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR11G2	HGNC	protein_coding	OTTHUMT00000395722.1	84	0.00	0	G			20665929	20665929	+1	no_errors	ENST00000357366	ensembl	human	known	69_37n	missense	42	39.13	27	SNP	0.974	C
OR52W1	120787	genome.wustl.edu	37	11	6221358	6221358	+	Missense_Mutation	SNP	C	C	A	rs139467264		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr11:6221358C>A	ENST00000311352.2	+	1	983	c.905C>A	c.(904-906)aCc>aAc	p.T302N	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGGCCCGCACCAAGCAGATC	0.532																																						dbGAP											0													141.0	152.0	148.0					11																	6221358		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.905C>A	11.37:g.6221358C>A	ENSP00000309673:p.Thr302Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NH78	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	p.T302N	ENST00000311352.2	37	c.905	CCDS31407.1	11	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347820	0.61183	.	.	ENSG00000175485	ENST00000311352	T	0.28454	1.61	4.59	4.59	0.56863	.	0.000000	0.39759	N	0.001278	T	0.51176	0.1659	L	0.58969	1.84	0.38124	D	0.937959	D	0.76494	0.999	D	0.66716	0.946	T	0.58188	-0.7680	10	0.72032	D	0.01	.	16.8991	0.86108	0.0:1.0:0.0:0.0	.	302	Q6IF63	O52W1_HUMAN	N	302	ENSP00000309673:T302N	ENSP00000309673:T302N	T	+	2	0	OR52W1	6177934	0.171000	0.23029	0.998000	0.56505	0.881000	0.50899	1.334000	0.33827	2.518000	0.84900	0.563000	0.77884	ACC	OR52W1	-	prints_Olfact_rcpt	ENSG00000175485		0.532	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52W1	HGNC	protein_coding	OTTHUMT00000383758.1	49	0.00	0	C	NM_001005178		6221358	6221358	+1	no_errors	ENST00000311352	ensembl	human	known	69_37n	missense	56	27.27	21	SNP	0.998	A
AKAP2	11217	genome.wustl.edu	37	9	112898773	112898773	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr9:112898773C>T	ENST00000259318.7	+	2	463	c.256C>T	c.(256-258)Ctg>Ttg	p.L86L	AKAP2_ENST00000434623.2_Silent_p.L175L|AKAP2_ENST00000555236.1_Silent_p.L317L|AKAP2_ENST00000374525.1_Silent_p.L175L|PALM2-AKAP2_ENST00000302798.7_Silent_p.L317L|PALM2-AKAP2_ENST00000374530.3_Silent_p.L317L|AKAP2_ENST00000510514.5_Silent_p.L317L	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	86										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TGCAGTGGTTCTGGTGGGCGG	0.582																																						dbGAP											0													99.0	79.0	86.0					9																	112898773		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.256C>T	9.37:g.112898773C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Silent	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.L317	ENST00000259318.7	37	c.949	CCDS48003.1	9																																																																																			PALM2-AKAP2	-	NULL	ENSG00000157654		0.582	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	40	0.00	0	C	NM_001004065		112898773	112898773	+1	no_errors	ENST00000374530	ensembl	human	known	69_37n	silent	38	35.59	21	SNP	0.005	T
AKAP2	11217	genome.wustl.edu	37	9	112898773	112898773	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr9:112898773C>T	ENST00000259318.7	+	2	463	c.256C>T	c.(256-258)Ctg>Ttg	p.L86L	AKAP2_ENST00000434623.2_Silent_p.L175L|AKAP2_ENST00000555236.1_Silent_p.L317L|AKAP2_ENST00000374525.1_Silent_p.L175L|PALM2-AKAP2_ENST00000302798.7_Silent_p.L317L|PALM2-AKAP2_ENST00000374530.3_Silent_p.L317L|AKAP2_ENST00000510514.5_Silent_p.L317L	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	86										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TGCAGTGGTTCTGGTGGGCGG	0.582																																						dbGAP											0													99.0	79.0	86.0					9																	112898773		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.256C>T	9.37:g.112898773C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Silent	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.L317	ENST00000259318.7	37	c.949	CCDS48003.1	9																																																																																			PALM2-AKAP2	-	NULL	ENSG00000157654		0.582	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	73	0.00	0	C	NM_001004065		112898773	112898773	+1	no_errors	ENST00000374530	ensembl	human	known	69_37n	silent	38	35.59	21	SNP	0.005	T
PHF1	5252	genome.wustl.edu	37	6	33382315	33382315	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr6:33382315A>G	ENST00000374516.3	+	10	1209	c.938A>G	c.(937-939)aAg>aGg	p.K313R	PHF1_ENST00000374512.3_Missense_Mutation_p.K313R	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	313					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				AACAGCCACAAGGACCGGTGA	0.562											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													92.0	92.0	92.0					6																	33382315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.938A>G	6.37:g.33382315A>G	ENSP00000363640:p.Lys313Arg	Somatic	839	WXS	Illumina GAIIx	Phase_IV	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K313R	ENST00000374516.3	37	c.938	CCDS4777.1	6	.	.	.	.	.	.	.	.	.	.	A	19.36	3.812888	0.70912	.	.	ENSG00000112511	ENST00000374512;ENST00000374516	T;T	0.24538	1.85;1.85	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	L	0.39467	1.215	0.44843	D	0.997851	D;D	0.61697	0.963;0.99	P;P	0.58454	0.839;0.757	T	0.01280	-1.1397	10	0.38643	T	0.18	-2.6277	13.502	0.61462	1.0:0.0:0.0:0.0	.	313;313	O43189-2;O43189	.;PHF1_HUMAN	R	313	ENSP00000363636:K313R;ENSP00000363640:K313R	ENSP00000363636:K313R	K	+	2	0	PHF1	33490293	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	6.200000	0.72118	2.288000	0.76882	0.533000	0.62120	AAG	PHF1	-	NULL	ENSG00000112511		0.562	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF1	HGNC	protein_coding	OTTHUMT00000076175.3	44	0.00	0	A			33382315	33382315	+1	no_errors	ENST00000374516	ensembl	human	known	69_37n	missense	83	14.43	14	SNP	1.000	G
PHF1	5252	genome.wustl.edu	37	6	33382315	33382315	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:33382315A>G	ENST00000374516.3	+	10	1209	c.938A>G	c.(937-939)aAg>aGg	p.K313R	PHF1_ENST00000374512.3_Missense_Mutation_p.K313R	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	313					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				AACAGCCACAAGGACCGGTGA	0.562											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													92.0	92.0	92.0					6																	33382315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.938A>G	6.37:g.33382315A>G	ENSP00000363640:p.Lys313Arg	Somatic	839	WXS	Illumina GAIIx	Phase_IV	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K313R	ENST00000374516.3	37	c.938	CCDS4777.1	6	.	.	.	.	.	.	.	.	.	.	A	19.36	3.812888	0.70912	.	.	ENSG00000112511	ENST00000374512;ENST00000374516	T;T	0.24538	1.85;1.85	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	L	0.39467	1.215	0.44843	D	0.997851	D;D	0.61697	0.963;0.99	P;P	0.58454	0.839;0.757	T	0.01280	-1.1397	10	0.38643	T	0.18	-2.6277	13.502	0.61462	1.0:0.0:0.0:0.0	.	313;313	O43189-2;O43189	.;PHF1_HUMAN	R	313	ENSP00000363636:K313R;ENSP00000363640:K313R	ENSP00000363636:K313R	K	+	2	0	PHF1	33490293	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	6.200000	0.72118	2.288000	0.76882	0.533000	0.62120	AAG	PHF1	-	NULL	ENSG00000112511		0.562	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF1	HGNC	protein_coding	OTTHUMT00000076175.3	99	0.00	0	A			33382315	33382315	+1	no_errors	ENST00000374516	ensembl	human	known	69_37n	missense	83	14.43	14	SNP	1.000	G
PKHD1	5314	genome.wustl.edu	37	6	51776625	51776625	+	Silent	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr6:51776625A>T	ENST00000371117.3	-	39	6737	c.6462T>A	c.(6460-6462)gtT>gtA	p.V2154V	PKHD1_ENST00000340994.4_Silent_p.V2154V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2154					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCTGGCATGAAACAAGCAGCT	0.433																																						dbGAP											0													132.0	127.0	129.0					6																	51776625		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.6462T>A	6.37:g.51776625A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.V2154	ENST00000371117.3	37	c.6462	CCDS4935.1	6																																																																																			PKHD1	-	NULL	ENSG00000170927		0.433	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	31	0.00	0	A	NM_138694		51776625	51776625	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	silent	26	42.22	19	SNP	0.009	T
PKHD1	5314	genome.wustl.edu	37	6	51776625	51776625	+	Silent	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr6:51776625A>T	ENST00000371117.3	-	39	6737	c.6462T>A	c.(6460-6462)gtT>gtA	p.V2154V	PKHD1_ENST00000340994.4_Silent_p.V2154V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2154					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCTGGCATGAAACAAGCAGCT	0.433																																						dbGAP											0													132.0	127.0	129.0					6																	51776625		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.6462T>A	6.37:g.51776625A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.V2154	ENST00000371117.3	37	c.6462	CCDS4935.1	6																																																																																			PKHD1	-	NULL	ENSG00000170927		0.433	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	41	0.00	0	A	NM_138694		51776625	51776625	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	silent	26	42.22	19	SNP	0.009	T
PLIN5	440503	genome.wustl.edu	37	19	4529549	4529550	+	Intron	DEL	CT	CT	-			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:4529549_4529550delCT	ENST00000381848.3	-	4	420				CTB-50L17.14_ENST00000586020.1_3'UTR	NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5						lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						tacatatatacttatacgtata	0.252																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.339+245AG>-	19.37:g.4529549_4529550delCT		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRC1|Q6ZS68	Frame_Shift_Del	DEL	pfam_Perilipin	p.S130fs	ENST00000381848.3	37	c.389_388	CCDS42473.1	19																																																																																			PLIN5	-	NULL	ENSG00000214456		0.252	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN5	HGNC	protein_coding	OTTHUMT00000458647.1	8	0.00	0	CT	NM_001013706		4529549	4529550	-1	no_stop_codon	ENST00000588887	ensembl	human	putative	69_37n	frame_shift_del	8	38.46	5	DEL	0.012:0.016	-
PLXDC2	84898	genome.wustl.edu	37	10	20534365	20534365	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr10:20534365C>T	ENST00000377252.4	+	13	2245	c.1404C>T	c.(1402-1404)gcC>gcT	p.A468A	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Silent_p.A419A	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	468					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TCATTGTAGCCACAGCCATTC	0.463																																						dbGAP											0													266.0	227.0	240.0					10																	20534365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.1404C>T	10.37:g.20534365C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96E59|Q96PD9|Q96SU9	Silent	SNP	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	p.A468	ENST00000377252.4	37	c.1404	CCDS7132.1	10																																																																																			PLXDC2	-	NULL	ENSG00000120594		0.463	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC2	HGNC	protein_coding	OTTHUMT00000047101.2	78	0.00	0	C	NM_032812		20534365	20534365	+1	no_errors	ENST00000377252	ensembl	human	known	69_37n	silent	62	45.13	51	SNP	0.173	T
PLXDC2	84898	genome.wustl.edu	37	10	20534365	20534365	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr10:20534365C>T	ENST00000377252.4	+	13	2245	c.1404C>T	c.(1402-1404)gcC>gcT	p.A468A	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Silent_p.A419A	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	468					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TCATTGTAGCCACAGCCATTC	0.463																																						dbGAP											0													266.0	227.0	240.0					10																	20534365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.1404C>T	10.37:g.20534365C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96E59|Q96PD9|Q96SU9	Silent	SNP	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	p.A468	ENST00000377252.4	37	c.1404	CCDS7132.1	10																																																																																			PLXDC2	-	NULL	ENSG00000120594		0.463	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC2	HGNC	protein_coding	OTTHUMT00000047101.2	149	0.00	0	C	NM_032812		20534365	20534365	+1	no_errors	ENST00000377252	ensembl	human	known	69_37n	silent	62	45.13	51	SNP	0.173	T
PMP2	5375	genome.wustl.edu	37	8	82359614	82359614	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr8:82359614T>C	ENST00000256103.2	-	1	144	c.8A>G	c.(7-9)aAc>aGc	p.N3S	RP11-157I4.4_ENST00000524085.2_RNA|PMP2_ENST00000519260.1_Missense_Mutation_p.N3S	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	3					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			CAGGAATTTGTTGCTCATCGT	0.433																																						dbGAP											0													106.0	102.0	103.0					8																	82359614		2203	4300	6503	-	-	-	SO:0001583	missense	0			X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.8A>G	8.37:g.82359614T>C	ENSP00000256103:p.Asn3Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHL4	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.N3S	ENST00000256103.2	37	c.8	CCDS6229.1	8	.	.	.	.	.	.	.	.	.	.	T	12.27	1.888929	0.33348	.	.	ENSG00000147588	ENST00000256103;ENST00000519260	T;T	0.40225	1.04;1.04	5.98	3.65	0.41850	Calycin-like (1);Calycin (1);	0.351548	0.37348	N	0.002127	T	0.24005	0.0581	N	0.12471	0.22	0.23550	N	0.997434	B	0.02656	0.0	B	0.01281	0.0	T	0.19386	-1.0307	10	0.66056	D	0.02	.	8.7495	0.34607	0.0:0.1457:0.0:0.8543	.	3	P02689	MYP2_HUMAN	S	3	ENSP00000256103:N3S;ENSP00000429917:N3S	ENSP00000256103:N3S	N	-	2	0	PMP2	82522169	1.000000	0.71417	0.996000	0.52242	0.904000	0.53231	3.711000	0.54868	1.086000	0.41228	0.528000	0.53228	AAC	PMP2	-	superfamily_Calycin-like	ENSG00000147588		0.433	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP2	HGNC	protein_coding	OTTHUMT00000379365.1	30	0.00	0	T	NM_002677		82359614	82359614	-1	no_errors	ENST00000256103	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	1.000	C
PMP2	5375	genome.wustl.edu	37	8	82359614	82359614	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr8:82359614T>C	ENST00000256103.2	-	1	144	c.8A>G	c.(7-9)aAc>aGc	p.N3S	RP11-157I4.4_ENST00000524085.2_RNA|PMP2_ENST00000519260.1_Missense_Mutation_p.N3S	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	3					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			CAGGAATTTGTTGCTCATCGT	0.433																																						dbGAP											0													106.0	102.0	103.0					8																	82359614		2203	4300	6503	-	-	-	SO:0001583	missense	0			X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.8A>G	8.37:g.82359614T>C	ENSP00000256103:p.Asn3Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHL4	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.N3S	ENST00000256103.2	37	c.8	CCDS6229.1	8	.	.	.	.	.	.	.	.	.	.	T	12.27	1.888929	0.33348	.	.	ENSG00000147588	ENST00000256103;ENST00000519260	T;T	0.40225	1.04;1.04	5.98	3.65	0.41850	Calycin-like (1);Calycin (1);	0.351548	0.37348	N	0.002127	T	0.24005	0.0581	N	0.12471	0.22	0.23550	N	0.997434	B	0.02656	0.0	B	0.01281	0.0	T	0.19386	-1.0307	10	0.66056	D	0.02	.	8.7495	0.34607	0.0:0.1457:0.0:0.8543	.	3	P02689	MYP2_HUMAN	S	3	ENSP00000256103:N3S;ENSP00000429917:N3S	ENSP00000256103:N3S	N	-	2	0	PMP2	82522169	1.000000	0.71417	0.996000	0.52242	0.904000	0.53231	3.711000	0.54868	1.086000	0.41228	0.528000	0.53228	AAC	PMP2	-	superfamily_Calycin-like	ENSG00000147588		0.433	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP2	HGNC	protein_coding	OTTHUMT00000379365.1	54	0.00	0	T	NM_002677		82359614	82359614	-1	no_errors	ENST00000256103	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	1.000	C
POLA1	5422	genome.wustl.edu	37	X	24721368	24721368	+	Splice_Site	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chrX:24721368G>C	ENST00000379059.3	+	3	166	c.151G>C	c.(151-153)Gtc>Ctc	p.V51L	POLA1_ENST00000379068.3_Splice_Site_p.V57L	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	51					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	ATAATGGTAGGTCGAGGACTT	0.388																																						dbGAP											0													72.0	59.0	64.0					X																	24721368		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.151-1G>C	X.37:g.24721368G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UQ7	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.V57L	ENST00000379059.3	37	c.169	CCDS14214.1	X	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584986	0.46110	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.21543	2.0;2.01	5.19	3.43	0.39272	DNA polymerase alpha catalytic subunit, N-terminal domain (1);	0.060127	0.64402	D	0.000003	T	0.33904	0.0879	M	0.73962	2.25	0.80722	D	1	P;P	0.36974	0.576;0.499	P;P	0.47430	0.547;0.52	T	0.03483	-1.1032	9	.	.	.	-8.805	10.8607	0.46825	0.158:0.0:0.842:0.0	.	57;51	A6NMQ1;P09884	.;DPOLA_HUMAN	L	57;51	ENSP00000368358:V57L;ENSP00000368349:V51L	.	V	+	1	0	POLA1	24631289	1.000000	0.71417	0.973000	0.42090	0.458000	0.32498	5.100000	0.64560	0.585000	0.29608	0.594000	0.82650	GTC	POLA1	-	pfam_DNA_pol_a_cat_su_N,tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000101868		0.388	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	29	0.00	0	G	NM_016937	Missense_Mutation	24721368	24721368	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	C
POLA1	5422	genome.wustl.edu	37	X	24721368	24721368	+	Splice_Site	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chrX:24721368G>C	ENST00000379059.3	+	3	166	c.151G>C	c.(151-153)Gtc>Ctc	p.V51L	POLA1_ENST00000379068.3_Splice_Site_p.V57L	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	51					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	ATAATGGTAGGTCGAGGACTT	0.388																																						dbGAP											0													72.0	59.0	64.0					X																	24721368		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.151-1G>C	X.37:g.24721368G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UQ7	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.V57L	ENST00000379059.3	37	c.169	CCDS14214.1	X	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584986	0.46110	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.21543	2.0;2.01	5.19	3.43	0.39272	DNA polymerase alpha catalytic subunit, N-terminal domain (1);	0.060127	0.64402	D	0.000003	T	0.33904	0.0879	M	0.73962	2.25	0.80722	D	1	P;P	0.36974	0.576;0.499	P;P	0.47430	0.547;0.52	T	0.03483	-1.1032	9	.	.	.	-8.805	10.8607	0.46825	0.158:0.0:0.842:0.0	.	57;51	A6NMQ1;P09884	.;DPOLA_HUMAN	L	57;51	ENSP00000368358:V57L;ENSP00000368349:V51L	.	V	+	1	0	POLA1	24631289	1.000000	0.71417	0.973000	0.42090	0.458000	0.32498	5.100000	0.64560	0.585000	0.29608	0.594000	0.82650	GTC	POLA1	-	pfam_DNA_pol_a_cat_su_N,tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000101868		0.388	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	47	0.00	0	G	NM_016937	Missense_Mutation	24721368	24721368	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	C
PRUNE	58497	genome.wustl.edu	37	1	150997190	150997190	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:150997190T>G	ENST00000271620.3	+	4	595	c.439T>G	c.(439-441)Tcc>Gcc	p.S147A	PRUNE_ENST00000368934.1_5'Flank|PRUNE_ENST00000467771.1_3'UTR|PRUNE_ENST00000271619.8_Intron|PRUNE_ENST00000368936.1_5'UTR|RNU6-884P_ENST00000363889.1_RNA|PRUNE_ENST00000368935.1_Intron|PRUNE_ENST00000368937.1_Intron	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	147						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCTGGTGGGGTCCTGTGCTAC	0.577											OREG0013792	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													85.0	73.0	77.0					1																	150997190		2203	4300	6503	-	-	-	SO:0001583	missense	0			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.439T>G	1.37:g.150997190T>G	ENSP00000271620:p.Ser147Ala	Somatic	1737	WXS	Illumina GAIIx	Phase_IV	B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	pfam_DHHA2,pfam_Pesterase_RecJ	p.S147A	ENST00000271620.3	37	c.439	CCDS977.1	1	.	.	.	.	.	.	.	.	.	.	t	27.2	4.811236	0.90707	.	.	ENSG00000143363	ENST00000271620;ENST00000302413	T	0.14640	2.49	5.76	5.76	0.90799	Phosphoesterase, RecJ-like (1);	0.000000	0.85682	D	0.000000	T	0.39384	0.1076	M	0.93763	3.455	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.54689	-0.8256	10	0.72032	D	0.01	.	14.046	0.64706	0.0:0.0:0.0:1.0	.	147	Q86TP1	PRUNE_HUMAN	A	147;80	ENSP00000271620:S147A	ENSP00000271620:S147A	S	+	1	0	PRUNE	149263814	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.277000	0.78572	2.202000	0.70862	0.524000	0.50904	TCC	PRUNE	-	pfam_Pesterase_RecJ	ENSG00000143363		0.577	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRUNE	HGNC	protein_coding	OTTHUMT00000084885.1	50	0.00	0	T	NM_021222		150997190	150997190	+1	no_errors	ENST00000271620	ensembl	human	known	69_37n	missense	48	46.67	42	SNP	1.000	G
PRUNE	58497	genome.wustl.edu	37	1	150997190	150997190	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:150997190T>G	ENST00000271620.3	+	4	595	c.439T>G	c.(439-441)Tcc>Gcc	p.S147A	PRUNE_ENST00000368934.1_5'Flank|PRUNE_ENST00000467771.1_3'UTR|PRUNE_ENST00000271619.8_Intron|PRUNE_ENST00000368936.1_5'UTR|RNU6-884P_ENST00000363889.1_RNA|PRUNE_ENST00000368935.1_Intron|PRUNE_ENST00000368937.1_Intron	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	147						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCTGGTGGGGTCCTGTGCTAC	0.577											OREG0013792	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													85.0	73.0	77.0					1																	150997190		2203	4300	6503	-	-	-	SO:0001583	missense	0			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.439T>G	1.37:g.150997190T>G	ENSP00000271620:p.Ser147Ala	Somatic	1737	WXS	Illumina GAIIx	Phase_IV	B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	pfam_DHHA2,pfam_Pesterase_RecJ	p.S147A	ENST00000271620.3	37	c.439	CCDS977.1	1	.	.	.	.	.	.	.	.	.	.	t	27.2	4.811236	0.90707	.	.	ENSG00000143363	ENST00000271620;ENST00000302413	T	0.14640	2.49	5.76	5.76	0.90799	Phosphoesterase, RecJ-like (1);	0.000000	0.85682	D	0.000000	T	0.39384	0.1076	M	0.93763	3.455	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.54689	-0.8256	10	0.72032	D	0.01	.	14.046	0.64706	0.0:0.0:0.0:1.0	.	147	Q86TP1	PRUNE_HUMAN	A	147;80	ENSP00000271620:S147A	ENSP00000271620:S147A	S	+	1	0	PRUNE	149263814	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.277000	0.78572	2.202000	0.70862	0.524000	0.50904	TCC	PRUNE	-	pfam_Pesterase_RecJ	ENSG00000143363		0.577	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRUNE	HGNC	protein_coding	OTTHUMT00000084885.1	62	0.00	0	T	NM_021222		150997190	150997190	+1	no_errors	ENST00000271620	ensembl	human	known	69_37n	missense	48	46.67	42	SNP	1.000	G
PTCH1	5727	genome.wustl.edu	37	9	98238441	98238441	+	Splice_Site	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr9:98238441C>A	ENST00000331920.6	-	12	1902	c.1603G>T	c.(1603-1605)Gac>Tac	p.D535Y	PTCH1_ENST00000418258.1_Splice_Site_p.D384Y|PTCH1_ENST00000430669.2_Splice_Site_p.D469Y|PTCH1_ENST00000429896.2_Splice_Site_p.D384Y|PTCH1_ENST00000375274.2_Splice_Site_p.D534Y|PTCH1_ENST00000437951.1_Splice_Site_p.D469Y|PTCH1_ENST00000421141.1_Splice_Site_p.D384Y	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	535	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCGGTCCTGTCCTGGGAATAA	0.547																																						dbGAP											0													49.0	38.0	42.0					9																	98238441		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1603-1G>T	9.37:g.98238441C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.D535Y	ENST00000331920.6	37	c.1603	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860876	0.91433	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271	D;D;D;D;D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05	5.1	5.1	0.69264	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.94709	0.8293	L	0.47190	1.495	0.80722	D	1	D;D;D;D	0.76494	0.999;0.989;0.991;0.992	D;D;D;D	0.75484	0.986;0.947;0.947;0.954	D	0.94957	0.8105	10	0.87932	D	0	-40.274	19.0716	0.93140	0.0:1.0:0.0:0.0	.	384;469;534;535	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	Y	535;469;384;384;469;384;534;200	ENSP00000332353:D535Y;ENSP00000389744:D469Y;ENSP00000399981:D384Y;ENSP00000396135:D384Y;ENSP00000410287:D469Y;ENSP00000414823:D384Y;ENSP00000364423:D534Y;ENSP00000364420:D200Y	ENSP00000332353:D535Y	D	-	1	0	PTCH1	97278262	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.278000	0.78587	2.805000	0.96524	0.655000	0.94253	GAC	PTCH1	-	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	ENSG00000185920		0.547	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2	18	0.00	0	C	NM_000264	Missense_Mutation	98238441	98238441	-1	no_errors	ENST00000331920	ensembl	human	known	69_37n	missense	10	58.33	14	SNP	1.000	A
PTCH1	5727	genome.wustl.edu	37	9	98238441	98238441	+	Splice_Site	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr9:98238441C>A	ENST00000331920.6	-	12	1902	c.1603G>T	c.(1603-1605)Gac>Tac	p.D535Y	PTCH1_ENST00000418258.1_Splice_Site_p.D384Y|PTCH1_ENST00000430669.2_Splice_Site_p.D469Y|PTCH1_ENST00000429896.2_Splice_Site_p.D384Y|PTCH1_ENST00000375274.2_Splice_Site_p.D534Y|PTCH1_ENST00000437951.1_Splice_Site_p.D469Y|PTCH1_ENST00000421141.1_Splice_Site_p.D384Y	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	535	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCGGTCCTGTCCTGGGAATAA	0.547																																						dbGAP											0													49.0	38.0	42.0					9																	98238441		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1603-1G>T	9.37:g.98238441C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.D535Y	ENST00000331920.6	37	c.1603	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860876	0.91433	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271	D;D;D;D;D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05	5.1	5.1	0.69264	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.94709	0.8293	L	0.47190	1.495	0.80722	D	1	D;D;D;D	0.76494	0.999;0.989;0.991;0.992	D;D;D;D	0.75484	0.986;0.947;0.947;0.954	D	0.94957	0.8105	10	0.87932	D	0	-40.274	19.0716	0.93140	0.0:1.0:0.0:0.0	.	384;469;534;535	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	Y	535;469;384;384;469;384;534;200	ENSP00000332353:D535Y;ENSP00000389744:D469Y;ENSP00000399981:D384Y;ENSP00000396135:D384Y;ENSP00000410287:D469Y;ENSP00000414823:D384Y;ENSP00000364423:D534Y;ENSP00000364420:D200Y	ENSP00000332353:D535Y	D	-	1	0	PTCH1	97278262	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.278000	0.78587	2.805000	0.96524	0.655000	0.94253	GAC	PTCH1	-	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	ENSG00000185920		0.547	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2	33	0.00	0	C	NM_000264	Missense_Mutation	98238441	98238441	-1	no_errors	ENST00000331920	ensembl	human	known	69_37n	missense	10	58.33	14	SNP	1.000	A
PTPRVP	148713	genome.wustl.edu	37	1	202155706	202155706	+	RNA	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:202155706A>T	ENST00000482597.1	+	0	3293					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CCAGACGGGCACCTTCGTGGC	0.622																																						dbGAP											0																																										-	-	-			0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202155706A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.622	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	44	0.00	0	A	XM_086287		202155706	202155706	+1	no_errors	ENST00000482597	ensembl	human	known	69_37n	rna	85	12.24	12	SNP	1.000	T
PTPRVP	148713	genome.wustl.edu	37	1	202155706	202155706	+	RNA	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:202155706A>T	ENST00000482597.1	+	0	3293					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CCAGACGGGCACCTTCGTGGC	0.622																																						dbGAP											0																																										-	-	-			0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202155706A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.622	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	73	0.00	0	A	XM_086287		202155706	202155706	+1	no_errors	ENST00000482597	ensembl	human	known	69_37n	rna	85	12.24	12	SNP	1.000	T
QRICH2	84074	genome.wustl.edu	37	17	74273320	74273320	+	Missense_Mutation	SNP	T	T	C	rs74581625		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:74273320T>C	ENST00000262765.5	-	16	4870	c.4691A>G	c.(4690-4692)tAc>tGc	p.Y1564C		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1564										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GTGGTAGGGGTAGGTGAGGGT	0.617																																						dbGAP											0													45.0	53.0	50.0					17																	74273320		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.4691A>G	17.37:g.74273320T>C	ENSP00000262765:p.Tyr1564Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE1|Q96LM3	Missense_Mutation	SNP	NULL	p.Y1564C	ENST00000262765.5	37	c.4691	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	T	12.78	2.041894	0.35989	.	.	ENSG00000129646	ENST00000262765	T	0.12465	2.68	5.63	3.13	0.36017	.	.	.	.	.	T	0.33089	0.0851	M	0.69823	2.125	0.31180	N	0.702179	D	0.89917	1.0	D	0.83275	0.996	T	0.25847	-1.0120	9	0.66056	D	0.02	-10.6534	8.9065	0.35526	0.1307:0.0:0.1199:0.7494	.	1564	Q9H0J4	QRIC2_HUMAN	C	1564	ENSP00000262765:Y1564C	ENSP00000262765:Y1564C	Y	-	2	0	QRICH2	71784915	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	1.797000	0.38804	0.924000	0.37069	0.459000	0.35465	TAC	QRICH2	-	NULL	ENSG00000129646		0.617	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	149	0.66	1	T	NM_032134		74273320	74273320	-1	no_errors	ENST00000262765	ensembl	human	known	69_37n	missense	48	56.52	65	SNP	1.000	C
RASGEF1C	255426	genome.wustl.edu	37	5	179528345	179528345	+	3'UTR	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr5:179528345C>G	ENST00000393371.2	-	0	1853				RASGEF1C_ENST00000361132.4_3'UTR|RASGEF1C_ENST00000522500.1_3'UTR			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCGTATGGCCACTGTGGGG	0.667																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.*156G>C	5.37:g.179528345C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWQ7|Q7Z4T0|Q8NA49	RNA	SNP	-	NULL	ENST00000393371.2	37	NULL	CCDS4452.1	5																																																																																			RASGEF1C	-	-	ENSG00000146090		0.667	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	HGNC	protein_coding	OTTHUMT00000253506.2	34	0.00	0	C	NM_175062		179528345	179528345	-1	no_errors	ENST00000519456	ensembl	human	known	69_37n	rna	30	18.92	7	SNP	0.000	G
RASGEF1C	255426	genome.wustl.edu	37	5	179528345	179528345	+	3'UTR	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr5:179528345C>G	ENST00000393371.2	-	0	1853				RASGEF1C_ENST00000361132.4_3'UTR|RASGEF1C_ENST00000522500.1_3'UTR			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCGTATGGCCACTGTGGGG	0.667																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.*156G>C	5.37:g.179528345C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWQ7|Q7Z4T0|Q8NA49	RNA	SNP	-	NULL	ENST00000393371.2	37	NULL	CCDS4452.1	5																																																																																			RASGEF1C	-	-	ENSG00000146090		0.667	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	HGNC	protein_coding	OTTHUMT00000253506.2	44	0.00	0	C	NM_175062		179528345	179528345	-1	no_errors	ENST00000519456	ensembl	human	known	69_37n	rna	30	18.92	7	SNP	0.000	G
MFSD3	113655	genome.wustl.edu	37	8	145738069	145738069	+	IGR	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr8:145738069C>G	ENST00000301327.4	+	0	1548				CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Silent_p.L947L|RECQL4_ENST00000532237.1_5'UTR	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CAGGGCAGTTCAGACGGCAAT	0.647																																						dbGAP											0													35.0	43.0	40.0					8																	145738069		2049	4193	6242	-	-	-	SO:0001628	intergenic_variant	0				CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738069C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000301327.4	37	NULL	CCDS6431.1	8																																																																																			RECQL4	-	-	ENSG00000160957		0.647	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL4	HGNC	protein_coding	OTTHUMT00000382478.2	25	0.00	0	C	NM_138431		145738069	145738069	-1	no_errors	ENST00000301323	ensembl	human	known	69_37n	rna	30	30.23	13	SNP	0.009	G
MFSD3	113655	genome.wustl.edu	37	8	145738069	145738069	+	IGR	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr8:145738069C>G	ENST00000301327.4	+	0	1548				CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Silent_p.L947L|RECQL4_ENST00000532237.1_5'UTR	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CAGGGCAGTTCAGACGGCAAT	0.647																																						dbGAP											0													35.0	43.0	40.0					8																	145738069		2049	4193	6242	-	-	-	SO:0001628	intergenic_variant	0				CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738069C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000301327.4	37	NULL	CCDS6431.1	8																																																																																			RECQL4	-	-	ENSG00000160957		0.647	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL4	HGNC	protein_coding	OTTHUMT00000382478.2	45	0.00	0	C	NM_138431		145738069	145738069	-1	no_errors	ENST00000301323	ensembl	human	known	69_37n	rna	30	30.23	13	SNP	0.009	G
RET	5979	genome.wustl.edu	37	10	43619204	43619204	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr10:43619204C>G	ENST00000355710.3	+	17	3119	c.2887C>G	c.(2887-2889)Ctt>Gtt	p.L963V	RET_ENST00000340058.5_Missense_Mutation_p.L963V	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	963	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GCTCTTCAACCTTCTGAAGAC	0.592		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	dbGAP	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													83.0	86.0	85.0					10																	43619204		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2887C>G	10.37:g.43619204C>G	ENSP00000347942:p.Leu963Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Cadherin	p.L963V	ENST00000355710.3	37	c.2887	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	c	16.89	3.246449	0.59103	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	D;D	0.89552	-2.53;-2.53	5.2	3.36	0.38483	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.060056	0.64402	D	0.000002	D	0.86920	0.6049	N	0.05554	-0.025	0.80722	D	1	D;D;P	0.63046	0.961;0.992;0.951	P;D;P	0.72625	0.816;0.978;0.833	D	0.87562	0.2472	10	0.87932	D	0	.	11.3843	0.49776	0.0:0.8539:0.0:0.1461	.	709;963;963	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	V	963	ENSP00000347942:L963V;ENSP00000344798:L963V	ENSP00000344798:L963V	L	+	1	0	RET	42939210	1.000000	0.71417	0.999000	0.59377	0.394000	0.30568	6.079000	0.71291	0.609000	0.30018	-0.355000	0.07637	CTT	RET	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000165731		0.592	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	47	0.00	0	C	NM_020975		43619204	43619204	+1	no_errors	ENST00000355710	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	1.000	G
RET	5979	genome.wustl.edu	37	10	43619204	43619204	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr10:43619204C>G	ENST00000355710.3	+	17	3119	c.2887C>G	c.(2887-2889)Ctt>Gtt	p.L963V	RET_ENST00000340058.5_Missense_Mutation_p.L963V	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	963	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GCTCTTCAACCTTCTGAAGAC	0.592		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	dbGAP	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													83.0	86.0	85.0					10																	43619204		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2887C>G	10.37:g.43619204C>G	ENSP00000347942:p.Leu963Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Cadherin	p.L963V	ENST00000355710.3	37	c.2887	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	c	16.89	3.246449	0.59103	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	D;D	0.89552	-2.53;-2.53	5.2	3.36	0.38483	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.060056	0.64402	D	0.000002	D	0.86920	0.6049	N	0.05554	-0.025	0.80722	D	1	D;D;P	0.63046	0.961;0.992;0.951	P;D;P	0.72625	0.816;0.978;0.833	D	0.87562	0.2472	10	0.87932	D	0	.	11.3843	0.49776	0.0:0.8539:0.0:0.1461	.	709;963;963	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	V	963	ENSP00000347942:L963V;ENSP00000344798:L963V	ENSP00000344798:L963V	L	+	1	0	RET	42939210	1.000000	0.71417	0.999000	0.59377	0.394000	0.30568	6.079000	0.71291	0.609000	0.30018	-0.355000	0.07637	CTT	RET	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000165731		0.592	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	98	0.00	0	C	NM_020975		43619204	43619204	+1	no_errors	ENST00000355710	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	1.000	G
RIC3	79608	genome.wustl.edu	37	11	8148332	8148332	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr11:8148332C>T	ENST00000309737.6	-	5	543	c.544G>A	c.(544-546)Gac>Aac	p.D182N	RIC3_ENST00000335425.7_Intron|RIC3_ENST00000425599.2_Intron|RIC3_ENST00000396677.2_Missense_Mutation_p.D20N|RIC3_ENST00000343202.4_Missense_Mutation_p.D181N|RIC3_ENST00000530060.1_5'UTR|RIC3_ENST00000539720.1_Missense_Mutation_p.D133N			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone	182					cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		TTCTCTTGGTCAGAAGTCACA	0.423																																						dbGAP											0													119.0	107.0	111.0					11																	8148332		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.544G>A	11.37:g.8148332C>T	ENSP00000308820:p.Asp182Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	Missense_Mutation	SNP	NULL	p.D182N	ENST00000309737.6	37	c.544	CCDS55742.1	11	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761191	0.69763	.	.	ENSG00000166405	ENST00000396677;ENST00000343202;ENST00000309737;ENST00000543346;ENST00000539720;ENST00000531450	T;T;T;T	0.36340	1.26;1.27;1.28;1.29	5.66	5.66	0.87406	.	0.066358	0.64402	D	0.000010	T	0.43322	0.1242	M	0.76328	2.33	0.51482	D	0.999922	B;B;B;P	0.46142	0.326;0.197;0.197;0.873	B;B;B;B	0.42959	0.098;0.147;0.147;0.403	T	0.43376	-0.9395	10	0.51188	T	0.08	.	14.3143	0.66437	0.0:0.9291:0.0:0.0709	.	210;182;181;20	B7Z1U4;Q7Z5B4;Q7Z5B4-5;D3DQU6	.;RIC3_HUMAN;.;.	N	20;181;182;210;133;210	ENSP00000344904:D181N;ENSP00000308820:D182N;ENSP00000443871:D133N;ENSP00000431658:D210N	ENSP00000308820:D182N	D	-	1	0	RIC3	8104908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.070000	0.50033	2.832000	0.97577	0.655000	0.94253	GAC	RIC3	-	NULL	ENSG00000166405		0.423	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIC3	HGNC	protein_coding	OTTHUMT00000385900.1	46	0.00	0	C	NM_024557		8148332	8148332	-1	no_errors	ENST00000309737	ensembl	human	known	69_37n	missense	20	59.18	29	SNP	1.000	T
RIC3	79608	genome.wustl.edu	37	11	8148332	8148332	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr11:8148332C>T	ENST00000309737.6	-	5	543	c.544G>A	c.(544-546)Gac>Aac	p.D182N	RIC3_ENST00000335425.7_Intron|RIC3_ENST00000425599.2_Intron|RIC3_ENST00000396677.2_Missense_Mutation_p.D20N|RIC3_ENST00000343202.4_Missense_Mutation_p.D181N|RIC3_ENST00000530060.1_5'UTR|RIC3_ENST00000539720.1_Missense_Mutation_p.D133N			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone	182					cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		TTCTCTTGGTCAGAAGTCACA	0.423																																						dbGAP											0													119.0	107.0	111.0					11																	8148332		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.544G>A	11.37:g.8148332C>T	ENSP00000308820:p.Asp182Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	Missense_Mutation	SNP	NULL	p.D182N	ENST00000309737.6	37	c.544	CCDS55742.1	11	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761191	0.69763	.	.	ENSG00000166405	ENST00000396677;ENST00000343202;ENST00000309737;ENST00000543346;ENST00000539720;ENST00000531450	T;T;T;T	0.36340	1.26;1.27;1.28;1.29	5.66	5.66	0.87406	.	0.066358	0.64402	D	0.000010	T	0.43322	0.1242	M	0.76328	2.33	0.51482	D	0.999922	B;B;B;P	0.46142	0.326;0.197;0.197;0.873	B;B;B;B	0.42959	0.098;0.147;0.147;0.403	T	0.43376	-0.9395	10	0.51188	T	0.08	.	14.3143	0.66437	0.0:0.9291:0.0:0.0709	.	210;182;181;20	B7Z1U4;Q7Z5B4;Q7Z5B4-5;D3DQU6	.;RIC3_HUMAN;.;.	N	20;181;182;210;133;210	ENSP00000344904:D181N;ENSP00000308820:D182N;ENSP00000443871:D133N;ENSP00000431658:D210N	ENSP00000308820:D182N	D	-	1	0	RIC3	8104908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.070000	0.50033	2.832000	0.97577	0.655000	0.94253	GAC	RIC3	-	NULL	ENSG00000166405		0.423	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIC3	HGNC	protein_coding	OTTHUMT00000385900.1	90	0.00	0	C	NM_024557		8148332	8148332	-1	no_errors	ENST00000309737	ensembl	human	known	69_37n	missense	20	59.18	29	SNP	1.000	T
RTN3	10313	genome.wustl.edu	37	11	63487409	63487409	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr11:63487409G>C	ENST00000377819.5	+	3	1589	c.1435G>C	c.(1435-1437)Gat>Cat	p.D479H	RTN3_ENST00000540798.1_Missense_Mutation_p.D367H|RTN3_ENST00000339997.4_Missense_Mutation_p.D460H|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000356000.3_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	479					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						CCACCTGAAAGATGAAATGGA	0.463																																						dbGAP											0													79.0	79.0	79.0					11																	63487409		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.1435G>C	11.37:g.63487409G>C	ENSP00000367050:p.Asp479His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.D479H	ENST00000377819.5	37	c.1435	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143544	0.57044	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.17691	2.26;2.26;2.26	5.88	5.88	0.94601	.	1.639030	0.03363	N	0.197781	T	0.26195	0.0639	N	0.08118	0	0.80722	D	1	D;D;D	0.67145	0.996;0.993;0.996	P;P;P	0.59288	0.855;0.72;0.855	T	0.12837	-1.0532	10	0.66056	D	0.02	0.0268	15.7188	0.77691	0.0:0.0:1.0:0.0	.	367;479;460	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	H	479;460;367	ENSP00000367050:D479H;ENSP00000344106:D460H;ENSP00000442733:D367H	ENSP00000344106:D460H	D	+	1	0	RTN3	63243985	0.941000	0.31946	0.051000	0.19133	0.690000	0.40134	2.827000	0.48112	2.780000	0.95670	0.655000	0.94253	GAT	RTN3	-	NULL	ENSG00000133318		0.463	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1	34	0.00	0	G	NM_006054		63487409	63487409	+1	no_errors	ENST00000377819	ensembl	human	known	69_37n	missense	49	29.58	21	SNP	0.162	C
RTN3	10313	genome.wustl.edu	37	11	63487409	63487409	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr11:63487409G>C	ENST00000377819.5	+	3	1589	c.1435G>C	c.(1435-1437)Gat>Cat	p.D479H	RTN3_ENST00000540798.1_Missense_Mutation_p.D367H|RTN3_ENST00000339997.4_Missense_Mutation_p.D460H|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000356000.3_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	479					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						CCACCTGAAAGATGAAATGGA	0.463																																						dbGAP											0													79.0	79.0	79.0					11																	63487409		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.1435G>C	11.37:g.63487409G>C	ENSP00000367050:p.Asp479His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.D479H	ENST00000377819.5	37	c.1435	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143544	0.57044	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.17691	2.26;2.26;2.26	5.88	5.88	0.94601	.	1.639030	0.03363	N	0.197781	T	0.26195	0.0639	N	0.08118	0	0.80722	D	1	D;D;D	0.67145	0.996;0.993;0.996	P;P;P	0.59288	0.855;0.72;0.855	T	0.12837	-1.0532	10	0.66056	D	0.02	0.0268	15.7188	0.77691	0.0:0.0:1.0:0.0	.	367;479;460	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	H	479;460;367	ENSP00000367050:D479H;ENSP00000344106:D460H;ENSP00000442733:D367H	ENSP00000344106:D460H	D	+	1	0	RTN3	63243985	0.941000	0.31946	0.051000	0.19133	0.690000	0.40134	2.827000	0.48112	2.780000	0.95670	0.655000	0.94253	GAT	RTN3	-	NULL	ENSG00000133318		0.463	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1	57	0.00	0	G	NM_006054		63487409	63487409	+1	no_errors	ENST00000377819	ensembl	human	known	69_37n	missense	49	29.58	21	SNP	0.162	C
ROBO3	64221	genome.wustl.edu	37	11	124748259	124748259	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr11:124748259G>A	ENST00000397801.1	+	22	3439	c.3247G>A	c.(3247-3249)Gaa>Aaa	p.E1083K	ROBO3_ENST00000543966.1_Intron|ROBO3_ENST00000538940.1_Missense_Mutation_p.E1061K|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1083					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GAACTGGCCAGAAGCCCTGCC	0.607																																						dbGAP											0													39.0	49.0	46.0					11																	124748259		1890	4126	6016	-	-	-	SO:0001583	missense	0			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.3247G>A	11.37:g.124748259G>A	ENSP00000380903:p.Glu1083Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E1083K	ENST00000397801.1	37	c.3247	CCDS44755.1	11	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301940	0.81136	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.68479	-0.33;-0.31	5.44	5.44	0.79542	.	0.000000	0.39759	N	0.001266	T	0.62950	0.2470	L	0.55481	1.735	0.80722	D	1	P	0.42871	0.792	B	0.37731	0.257	T	0.65401	-0.6177	10	0.40728	T	0.16	.	17.5072	0.87749	0.0:0.0:1.0:0.0	.	1083	Q96MS0	ROBO3_HUMAN	K	1083;1061	ENSP00000380903:E1083K;ENSP00000441797:E1061K	ENSP00000380903:E1083K	E	+	1	0	ROBO3	124253469	1.000000	0.71417	0.999000	0.59377	0.825000	0.46686	8.339000	0.90041	2.561000	0.86390	0.650000	0.86243	GAA	ROBO3	-	NULL	ENSG00000154134		0.607	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1	27	0.00	0	G	XM_370663		124748259	124748259	+1	no_errors	ENST00000397801	ensembl	human	known	69_37n	missense	6	64.71	11	SNP	1.000	A
ROBO3	64221	genome.wustl.edu	37	11	124748259	124748259	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr11:124748259G>A	ENST00000397801.1	+	22	3439	c.3247G>A	c.(3247-3249)Gaa>Aaa	p.E1083K	ROBO3_ENST00000543966.1_Intron|ROBO3_ENST00000538940.1_Missense_Mutation_p.E1061K|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1083					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GAACTGGCCAGAAGCCCTGCC	0.607																																						dbGAP											0													39.0	49.0	46.0					11																	124748259		1890	4126	6016	-	-	-	SO:0001583	missense	0			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.3247G>A	11.37:g.124748259G>A	ENSP00000380903:p.Glu1083Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E1083K	ENST00000397801.1	37	c.3247	CCDS44755.1	11	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301940	0.81136	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.68479	-0.33;-0.31	5.44	5.44	0.79542	.	0.000000	0.39759	N	0.001266	T	0.62950	0.2470	L	0.55481	1.735	0.80722	D	1	P	0.42871	0.792	B	0.37731	0.257	T	0.65401	-0.6177	10	0.40728	T	0.16	.	17.5072	0.87749	0.0:0.0:1.0:0.0	.	1083	Q96MS0	ROBO3_HUMAN	K	1083;1061	ENSP00000380903:E1083K;ENSP00000441797:E1061K	ENSP00000380903:E1083K	E	+	1	0	ROBO3	124253469	1.000000	0.71417	0.999000	0.59377	0.825000	0.46686	8.339000	0.90041	2.561000	0.86390	0.650000	0.86243	GAA	ROBO3	-	NULL	ENSG00000154134		0.607	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1	37	0.00	0	G	XM_370663		124748259	124748259	+1	no_errors	ENST00000397801	ensembl	human	known	69_37n	missense	6	64.71	11	SNP	1.000	A
RUNDC3A	10900	genome.wustl.edu	37	17	42390505	42390505	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:42390505G>T	ENST00000426726.3	+	3	531	c.257G>T	c.(256-258)aGc>aTc	p.S86I	RUNDC3A_ENST00000225441.7_Missense_Mutation_p.S86I|AC003102.3_ENST00000588097.1_RNA|RUNDC3A_ENST00000590941.1_Missense_Mutation_p.S81I	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	86	Interaction with RAP2A. {ECO:0000250}.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)			large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		AGCTGGTTCAGCTCAGACGGG	0.602																																					Pancreas(82;1061 1416 11136 20771 23901)	dbGAP											0													44.0	47.0	46.0					17																	42390505		1981	4171	6152	-	-	-	SO:0001583	missense	0			AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.257G>T	17.37:g.42390505G>T	ENSP00000410862:p.Ser86Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.S86I	ENST00000426726.3	37	c.257	CCDS45698.1	17	.	.	.	.	.	.	.	.	.	.	g	19.98	3.926607	0.73327	.	.	ENSG00000108309	ENST00000426726;ENST00000225441	T;T	0.30182	1.54;1.54	4.48	4.48	0.54585	RUN (2);	0.052593	0.64402	D	0.000001	T	0.44973	0.1319	L	0.50333	1.59	0.58432	D	0.999999	D;D;D;D	0.61697	0.99;0.983;0.983;0.983	P;P;P;P	0.58331	0.798;0.837;0.837;0.837	T	0.34850	-0.9812	10	0.45353	T	0.12	-25.3069	16.0863	0.81056	0.0:0.0:1.0:0.0	.	86;86;81;86	Q59EK9;Q59EK9-4;Q59EK9-2;Q59EK9-3	RUN3A_HUMAN;.;.;.	I	86	ENSP00000410862:S86I;ENSP00000225441:S86I	ENSP00000225441:S86I	S	+	2	0	RUNDC3A	39746031	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.835000	0.92100	2.327000	0.79052	0.462000	0.41574	AGC	RUNDC3A	-	pfam_Run,pfscan_Run	ENSG00000108309		0.602	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC3A	HGNC	protein_coding	OTTHUMT00000403173.2	53	0.00	0	G	NM_006695		42390505	42390505	+1	no_errors	ENST00000426726	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	1.000	T
RUNDC3A	10900	genome.wustl.edu	37	17	42390505	42390505	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:42390505G>T	ENST00000426726.3	+	3	531	c.257G>T	c.(256-258)aGc>aTc	p.S86I	RUNDC3A_ENST00000225441.7_Missense_Mutation_p.S86I|AC003102.3_ENST00000588097.1_RNA|RUNDC3A_ENST00000590941.1_Missense_Mutation_p.S81I	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	86	Interaction with RAP2A. {ECO:0000250}.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)			large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		AGCTGGTTCAGCTCAGACGGG	0.602																																					Pancreas(82;1061 1416 11136 20771 23901)	dbGAP											0													44.0	47.0	46.0					17																	42390505		1981	4171	6152	-	-	-	SO:0001583	missense	0			AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.257G>T	17.37:g.42390505G>T	ENSP00000410862:p.Ser86Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.S86I	ENST00000426726.3	37	c.257	CCDS45698.1	17	.	.	.	.	.	.	.	.	.	.	g	19.98	3.926607	0.73327	.	.	ENSG00000108309	ENST00000426726;ENST00000225441	T;T	0.30182	1.54;1.54	4.48	4.48	0.54585	RUN (2);	0.052593	0.64402	D	0.000001	T	0.44973	0.1319	L	0.50333	1.59	0.58432	D	0.999999	D;D;D;D	0.61697	0.99;0.983;0.983;0.983	P;P;P;P	0.58331	0.798;0.837;0.837;0.837	T	0.34850	-0.9812	10	0.45353	T	0.12	-25.3069	16.0863	0.81056	0.0:0.0:1.0:0.0	.	86;86;81;86	Q59EK9;Q59EK9-4;Q59EK9-2;Q59EK9-3	RUN3A_HUMAN;.;.;.	I	86	ENSP00000410862:S86I;ENSP00000225441:S86I	ENSP00000225441:S86I	S	+	2	0	RUNDC3A	39746031	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.835000	0.92100	2.327000	0.79052	0.462000	0.41574	AGC	RUNDC3A	-	pfam_Run,pfscan_Run	ENSG00000108309		0.602	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC3A	HGNC	protein_coding	OTTHUMT00000403173.2	76	0.00	0	G	NM_006695		42390505	42390505	+1	no_errors	ENST00000426726	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	1.000	T
SFPQ	6421	genome.wustl.edu	37	1	35658567	35658567	+	Silent	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:35658567G>T	ENST00000357214.5	-	1	182	c.84C>A	c.(82-84)ctC>ctA	p.L28L		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	28	Gln/Glu/Pro-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GGAAGTCGTGGAGgccgccgc	0.716			T	TFE3	papillary renal cell																																	dbGAP		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	0													5.0	7.0	6.0					1																	35658567		1766	3660	5426	-	-	-	SO:0001819	synonymous_variant	0			X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.84C>A	1.37:g.35658567G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P30808|Q5SZ71	Silent	SNP	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.L28	ENST00000357214.5	37	c.84	CCDS388.1	1																																																																																			SFPQ	-	NULL	ENSG00000116560		0.716	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFPQ	HGNC	protein_coding	OTTHUMT00000011984.4	15	0.00	0	G	NM_005066		35658567	35658567	-1	no_errors	ENST00000357214	ensembl	human	known	69_37n	silent	15	42.31	11	SNP	0.985	T
SFPQ	6421	genome.wustl.edu	37	1	35658567	35658567	+	Silent	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:35658567G>T	ENST00000357214.5	-	1	182	c.84C>A	c.(82-84)ctC>ctA	p.L28L		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	28	Gln/Glu/Pro-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GGAAGTCGTGGAGgccgccgc	0.716			T	TFE3	papillary renal cell																																	dbGAP		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	0													5.0	7.0	6.0					1																	35658567		1766	3660	5426	-	-	-	SO:0001819	synonymous_variant	0			X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.84C>A	1.37:g.35658567G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P30808|Q5SZ71	Silent	SNP	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.L28	ENST00000357214.5	37	c.84	CCDS388.1	1																																																																																			SFPQ	-	NULL	ENSG00000116560		0.716	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFPQ	HGNC	protein_coding	OTTHUMT00000011984.4	11	0.00	0	G	NM_005066		35658567	35658567	-1	no_errors	ENST00000357214	ensembl	human	known	69_37n	silent	15	42.31	11	SNP	0.985	T
SH3TC2	79628	genome.wustl.edu	37	5	148421116	148421116	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr5:148421116C>T	ENST00000515425.1	-	6	695	c.594G>A	c.(592-594)ttG>ttA	p.L198L	SH3TC2_ENST00000512049.1_Silent_p.L191L|SH3TC2_ENST00000394358.2_Silent_p.L83L|SH3TC2_ENST00000538184.1_5'Flank	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	198					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAAAGTGTCAAGCATTCCC	0.527																																						dbGAP											0													108.0	93.0	98.0					5																	148421116		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.594G>A	5.37:g.148421116C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Silent	SNP	pfam_SH3_domain,pfam_TPR-1,superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.L198	ENST00000515425.1	37	c.594	CCDS4293.1	5																																																																																			SH3TC2	-	superfamily_SH3_domain	ENSG00000169247		0.527	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	HGNC	protein_coding	OTTHUMT00000252186.2	34	0.00	0	C	NM_024577		148421116	148421116	-1	no_errors	ENST00000515425	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	0.374	T
SH3TC2	79628	genome.wustl.edu	37	5	148421116	148421116	+	Silent	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr5:148421116C>T	ENST00000515425.1	-	6	695	c.594G>A	c.(592-594)ttG>ttA	p.L198L	SH3TC2_ENST00000512049.1_Silent_p.L191L|SH3TC2_ENST00000394358.2_Silent_p.L83L|SH3TC2_ENST00000538184.1_5'Flank	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	198					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAAAGTGTCAAGCATTCCC	0.527																																						dbGAP											0													108.0	93.0	98.0					5																	148421116		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.594G>A	5.37:g.148421116C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Silent	SNP	pfam_SH3_domain,pfam_TPR-1,superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.L198	ENST00000515425.1	37	c.594	CCDS4293.1	5																																																																																			SH3TC2	-	superfamily_SH3_domain	ENSG00000169247		0.527	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	HGNC	protein_coding	OTTHUMT00000252186.2	53	0.00	0	C	NM_024577		148421116	148421116	-1	no_errors	ENST00000515425	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	0.374	T
SIRPA	140885	genome.wustl.edu	37	20	1905491	1905491	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr20:1905491C>T	ENST00000358771.4	+	5	1321	c.1169C>T	c.(1168-1170)gCc>gTc	p.A390V	SIRPA_ENST00000400068.3_Missense_Mutation_p.A390V|SIRPA_ENST00000356025.3_Missense_Mutation_p.A390V	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	390					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CTGATGGCGGCCCTCTACCTC	0.537																																					GBM(155;1668 1920 5945 42733 48121)	dbGAP											0													211.0	161.0	178.0					20																	1905491		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.1169C>T	20.37:g.1905491C>T	ENSP00000351621:p.Ala390Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like	p.A390V	ENST00000358771.4	37	c.1169	CCDS13022.1	20	.	.	.	.	.	.	.	.	.	.	C	9.420	1.082689	0.20309	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.18338	2.22;2.22;2.22	4.99	3.06	0.35304	.	0.381134	0.22527	N	0.058897	T	0.09423	0.0232	N	0.24115	0.695	0.26503	N	0.97474	P;B;P	0.48294	0.717;0.087;0.908	B;B;B	0.41860	0.211;0.067;0.368	T	0.12502	-1.0545	10	0.09338	T	0.73	.	7.5868	0.27998	0.0:0.8088:0.0:0.1912	.	370;390;390	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	V	390	ENSP00000382941:A390V;ENSP00000348307:A390V;ENSP00000351621:A390V	ENSP00000348307:A390V	A	+	2	0	SIRPA	1853491	0.988000	0.35896	0.953000	0.39169	0.142000	0.21351	1.667000	0.37471	0.813000	0.34350	-0.229000	0.12294	GCC	SIRPA	-	NULL	ENSG00000198053		0.537	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIRPA	HGNC	protein_coding	OTTHUMT00000077568.2	101	0.00	0	C	NM_080792		1905491	1905491	+1	no_errors	ENST00000400068	ensembl	human	known	69_37n	missense	76	31.53	35	SNP	0.942	T
SIRPA	140885	genome.wustl.edu	37	20	1905491	1905491	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr20:1905491C>T	ENST00000358771.4	+	5	1321	c.1169C>T	c.(1168-1170)gCc>gTc	p.A390V	SIRPA_ENST00000400068.3_Missense_Mutation_p.A390V|SIRPA_ENST00000356025.3_Missense_Mutation_p.A390V	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	390					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CTGATGGCGGCCCTCTACCTC	0.537																																					GBM(155;1668 1920 5945 42733 48121)	dbGAP											0													211.0	161.0	178.0					20																	1905491		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.1169C>T	20.37:g.1905491C>T	ENSP00000351621:p.Ala390Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like	p.A390V	ENST00000358771.4	37	c.1169	CCDS13022.1	20	.	.	.	.	.	.	.	.	.	.	C	9.420	1.082689	0.20309	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.18338	2.22;2.22;2.22	4.99	3.06	0.35304	.	0.381134	0.22527	N	0.058897	T	0.09423	0.0232	N	0.24115	0.695	0.26503	N	0.97474	P;B;P	0.48294	0.717;0.087;0.908	B;B;B	0.41860	0.211;0.067;0.368	T	0.12502	-1.0545	10	0.09338	T	0.73	.	7.5868	0.27998	0.0:0.8088:0.0:0.1912	.	370;390;390	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	V	390	ENSP00000382941:A390V;ENSP00000348307:A390V;ENSP00000351621:A390V	ENSP00000348307:A390V	A	+	2	0	SIRPA	1853491	0.988000	0.35896	0.953000	0.39169	0.142000	0.21351	1.667000	0.37471	0.813000	0.34350	-0.229000	0.12294	GCC	SIRPA	-	NULL	ENSG00000198053		0.537	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIRPA	HGNC	protein_coding	OTTHUMT00000077568.2	158	0.00	0	C	NM_080792		1905491	1905491	+1	no_errors	ENST00000400068	ensembl	human	known	69_37n	missense	76	31.53	35	SNP	0.942	T
SLC25A43	203427	genome.wustl.edu	37	X	118540557	118540557	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chrX:118540557A>T	ENST00000217909.7	+	2	754	c.410A>T	c.(409-411)cAg>cTg	p.Q137L	SLC25A43_ENST00000336249.7_Missense_Mutation_p.Q137L|SLC25A43_ENST00000488158.1_3'UTR	NM_145305.2	NP_660348.2	Q8WUT9	S2543_HUMAN	solute carrier family 25, member 43	137					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	9						TTGATCATGCAGAACATACTG	0.493																																						dbGAP											0													119.0	105.0	110.0					X																	118540557		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019584	CCDS14577.1	Xq24	2013-05-22			ENSG00000077713	ENSG00000077713		"""Solute carriers"""	30557	protein-coding gene	gene with protein product		300641				16949250	Standard	NM_145305		Approved		uc004erd.3	Q8WUT9	OTTHUMG00000022272	ENST00000217909.7:c.410A>T	X.37:g.118540557A>T	ENSP00000217909:p.Gln137Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75854|Q8N9L5	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.Q137L	ENST00000217909.7	37	c.410	CCDS14577.1	X	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509264	0.64522	.	.	ENSG00000077713	ENST00000217909;ENST00000336249;ENST00000326714	T;T	0.80304	-1.36;-1.36	4.9	4.9	0.64082	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.88093	0.6344	M	0.70842	2.15	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.989	D	0.89137	0.3514	10	0.72032	D	0.01	.	12.8339	0.57761	1.0:0.0:0.0:0.0	.	137;137	B4E1P8;Q8WUT9	.;S2543_HUMAN	L	137;137;85	ENSP00000217909:Q137L;ENSP00000338628:Q137L	ENSP00000217909:Q137L	Q	+	2	0	SLC25A43	118424585	1.000000	0.71417	0.996000	0.52242	0.441000	0.31987	6.595000	0.74109	1.619000	0.50296	0.237000	0.17872	CAG	SLC25A43	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000077713		0.493	SLC25A43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A43	HGNC	protein_coding	OTTHUMT00000058028.1	54	0.00	0	A	NM_145305		118540557	118540557	+1	no_errors	ENST00000217909	ensembl	human	known	69_37n	missense	59	34.44	31	SNP	1.000	T
SLC25A43	203427	genome.wustl.edu	37	X	118540557	118540557	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chrX:118540557A>T	ENST00000217909.7	+	2	754	c.410A>T	c.(409-411)cAg>cTg	p.Q137L	SLC25A43_ENST00000336249.7_Missense_Mutation_p.Q137L|SLC25A43_ENST00000488158.1_3'UTR	NM_145305.2	NP_660348.2	Q8WUT9	S2543_HUMAN	solute carrier family 25, member 43	137					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	9						TTGATCATGCAGAACATACTG	0.493																																						dbGAP											0													119.0	105.0	110.0					X																	118540557		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019584	CCDS14577.1	Xq24	2013-05-22			ENSG00000077713	ENSG00000077713		"""Solute carriers"""	30557	protein-coding gene	gene with protein product		300641				16949250	Standard	NM_145305		Approved		uc004erd.3	Q8WUT9	OTTHUMG00000022272	ENST00000217909.7:c.410A>T	X.37:g.118540557A>T	ENSP00000217909:p.Gln137Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75854|Q8N9L5	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.Q137L	ENST00000217909.7	37	c.410	CCDS14577.1	X	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509264	0.64522	.	.	ENSG00000077713	ENST00000217909;ENST00000336249;ENST00000326714	T;T	0.80304	-1.36;-1.36	4.9	4.9	0.64082	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.88093	0.6344	M	0.70842	2.15	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.989	D	0.89137	0.3514	10	0.72032	D	0.01	.	12.8339	0.57761	1.0:0.0:0.0:0.0	.	137;137	B4E1P8;Q8WUT9	.;S2543_HUMAN	L	137;137;85	ENSP00000217909:Q137L;ENSP00000338628:Q137L	ENSP00000217909:Q137L	Q	+	2	0	SLC25A43	118424585	1.000000	0.71417	0.996000	0.52242	0.441000	0.31987	6.595000	0.74109	1.619000	0.50296	0.237000	0.17872	CAG	SLC25A43	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000077713		0.493	SLC25A43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A43	HGNC	protein_coding	OTTHUMT00000058028.1	97	0.00	0	A	NM_145305		118540557	118540557	+1	no_errors	ENST00000217909	ensembl	human	known	69_37n	missense	59	34.44	31	SNP	1.000	T
SLC38A10	124565	genome.wustl.edu	37	17	79226306	79226306	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:79226306G>A	ENST00000374759.3	-	13	2017	c.1634C>T	c.(1633-1635)tCa>tTa	p.S545L	SLC38A10_ENST00000288439.5_Missense_Mutation_p.S545L	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	545					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTCTCTTTCTGAGTCGGGCAG	0.627																																						dbGAP											0													47.0	53.0	51.0					17																	79226306		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.1634C>T	17.37:g.79226306G>A	ENSP00000363891:p.Ser545Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.S545L	ENST00000374759.3	37	c.1634	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327324	0.24080	.	.	ENSG00000157637	ENST00000374759;ENST00000288439	T;T	0.12465	2.94;2.68	3.78	0.374	0.16183	.	4.165410	0.00520	N	0.000185	T	0.14787	0.0357	L	0.58101	1.795	0.09310	N	1	B;B	0.15473	0.013;0.003	B;B	0.13407	0.009;0.004	T	0.22312	-1.0220	10	0.23302	T	0.38	0.3691	3.9215	0.09245	0.213:0.0:0.6023:0.1847	.	545;545	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	L	545	ENSP00000363891:S545L;ENSP00000288439:S545L	ENSP00000288439:S545L	S	-	2	0	SLC38A10	76840901	0.019000	0.18553	0.000000	0.03702	0.009000	0.06853	1.878000	0.39608	-0.076000	0.12775	0.450000	0.29827	TCA	SLC38A10	-	NULL	ENSG00000157637		0.627	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	25	0.00	0	G	NM_138570		79226306	79226306	-1	no_errors	ENST00000374759	ensembl	human	known	69_37n	missense	16	55.56	20	SNP	0.000	A
SLC38A10	124565	genome.wustl.edu	37	17	79226306	79226306	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:79226306G>A	ENST00000374759.3	-	13	2017	c.1634C>T	c.(1633-1635)tCa>tTa	p.S545L	SLC38A10_ENST00000288439.5_Missense_Mutation_p.S545L	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	545					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTCTCTTTCTGAGTCGGGCAG	0.627																																						dbGAP											0													47.0	53.0	51.0					17																	79226306		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.1634C>T	17.37:g.79226306G>A	ENSP00000363891:p.Ser545Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.S545L	ENST00000374759.3	37	c.1634	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327324	0.24080	.	.	ENSG00000157637	ENST00000374759;ENST00000288439	T;T	0.12465	2.94;2.68	3.78	0.374	0.16183	.	4.165410	0.00520	N	0.000185	T	0.14787	0.0357	L	0.58101	1.795	0.09310	N	1	B;B	0.15473	0.013;0.003	B;B	0.13407	0.009;0.004	T	0.22312	-1.0220	10	0.23302	T	0.38	0.3691	3.9215	0.09245	0.213:0.0:0.6023:0.1847	.	545;545	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	L	545	ENSP00000363891:S545L;ENSP00000288439:S545L	ENSP00000288439:S545L	S	-	2	0	SLC38A10	76840901	0.019000	0.18553	0.000000	0.03702	0.009000	0.06853	1.878000	0.39608	-0.076000	0.12775	0.450000	0.29827	TCA	SLC38A10	-	NULL	ENSG00000157637		0.627	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	51	0.00	0	G	NM_138570		79226306	79226306	-1	no_errors	ENST00000374759	ensembl	human	known	69_37n	missense	16	55.56	20	SNP	0.000	A
SLC4A5	57835	genome.wustl.edu	37	2	74459643	74459643	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:74459643C>G	ENST00000377634.4	-	24	3126	c.2727G>C	c.(2725-2727)gaG>gaC	p.E909D	RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.E909D|SLC4A5_ENST00000423644.1_Intron|SLC4A5_ENST00000394019.2_Missense_Mutation_p.E909D|SLC4A5_ENST00000359484.4_Missense_Mutation_p.E807D|SLC4A5_ENST00000483195.1_Intron|SLC4A5_ENST00000358683.4_Missense_Mutation_p.E807D|SLC4A5_ENST00000346834.4_Missense_Mutation_p.E909D|SLC4A5_ENST00000357822.5_Missense_Mutation_p.E909D					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TGGTCTCTGTCTCCATCTTGA	0.637																																						dbGAP											0													81.0	84.0	83.0					2																	74459643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.2727G>C	2.37:g.74459643C>G	ENSP00000366861:p.Glu909Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.E909D	ENST00000377634.4	37	c.2727	CCDS1936.1	2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436013	0.83885	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634	T;T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.25;-1.25;-1.34;-1.34;-1.34	5.04	4.1	0.47936	Bicarbonate transporter, C-terminal (1);	0.104545	0.64402	D	0.000004	D	0.85881	0.5800	M	0.67700	2.07	0.80722	D	1	D;P;P;D	0.53151	0.958;0.95;0.955;0.957	P;P;P;P	0.62089	0.749;0.898;0.896;0.891	D	0.86311	0.1686	10	0.72032	D	0.01	.	10.1269	0.42654	0.0:0.8933:0.0:0.1067	.	909;807;909;909	Q9BY07-4;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;S4A5_HUMAN;.	D	909;909;909;807;807;909;909;909	ENSP00000377587:E909D;ENSP00000251768:E909D;ENSP00000352461:E807D;ENSP00000351513:E807D;ENSP00000350475:E909D;ENSP00000366859:E909D;ENSP00000366861:E909D	ENSP00000251768:E909D	E	-	3	2	SLC4A5	74313151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.690000	0.61731	1.236000	0.43740	0.655000	0.94253	GAG	SLC4A5	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000188687		0.637	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A5	HGNC	protein_coding	OTTHUMT00000206583.3	31	0.00	0	C			74459643	74459643	-1	no_errors	ENST00000357822	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	G
SLC4A5	57835	genome.wustl.edu	37	2	74459643	74459643	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:74459643C>G	ENST00000377634.4	-	24	3126	c.2727G>C	c.(2725-2727)gaG>gaC	p.E909D	RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.E909D|SLC4A5_ENST00000423644.1_Intron|SLC4A5_ENST00000394019.2_Missense_Mutation_p.E909D|SLC4A5_ENST00000359484.4_Missense_Mutation_p.E807D|SLC4A5_ENST00000483195.1_Intron|SLC4A5_ENST00000358683.4_Missense_Mutation_p.E807D|SLC4A5_ENST00000346834.4_Missense_Mutation_p.E909D|SLC4A5_ENST00000357822.5_Missense_Mutation_p.E909D					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TGGTCTCTGTCTCCATCTTGA	0.637																																						dbGAP											0													81.0	84.0	83.0					2																	74459643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.2727G>C	2.37:g.74459643C>G	ENSP00000366861:p.Glu909Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.E909D	ENST00000377634.4	37	c.2727	CCDS1936.1	2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436013	0.83885	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634	T;T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.25;-1.25;-1.34;-1.34;-1.34	5.04	4.1	0.47936	Bicarbonate transporter, C-terminal (1);	0.104545	0.64402	D	0.000004	D	0.85881	0.5800	M	0.67700	2.07	0.80722	D	1	D;P;P;D	0.53151	0.958;0.95;0.955;0.957	P;P;P;P	0.62089	0.749;0.898;0.896;0.891	D	0.86311	0.1686	10	0.72032	D	0.01	.	10.1269	0.42654	0.0:0.8933:0.0:0.1067	.	909;807;909;909	Q9BY07-4;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;S4A5_HUMAN;.	D	909;909;909;807;807;909;909;909	ENSP00000377587:E909D;ENSP00000251768:E909D;ENSP00000352461:E807D;ENSP00000351513:E807D;ENSP00000350475:E909D;ENSP00000366859:E909D;ENSP00000366861:E909D	ENSP00000251768:E909D	E	-	3	2	SLC4A5	74313151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.690000	0.61731	1.236000	0.43740	0.655000	0.94253	GAG	SLC4A5	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000188687		0.637	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A5	HGNC	protein_coding	OTTHUMT00000206583.3	65	0.00	0	C			74459643	74459643	-1	no_errors	ENST00000357822	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	G
SLC4A8	9498	genome.wustl.edu	37	12	51888749	51888749	+	Silent	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr12:51888749C>G	ENST00000453097.2	+	21	3007	c.2790C>G	c.(2788-2790)ctC>ctG	p.L930L	SLC4A8_ENST00000358657.3_Silent_p.L957L	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		GTCTAAAGCTCTTTGGGATGC	0.488																																						dbGAP											0													138.0	120.0	126.0					12																	51888749		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.2790C>G	12.37:g.51888749C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.L930	ENST00000453097.2	37	c.2790	CCDS44890.1	12																																																																																			SLC4A8	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000050438		0.488	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	HGNC	protein_coding	OTTHUMT00000404356.1	58	0.00	0	C	NM_004858		51888749	51888749	+1	no_errors	ENST00000453097	ensembl	human	known	69_37n	silent	70	18.60	16	SNP	1.000	G
SLC4A8	9498	genome.wustl.edu	37	12	51888749	51888749	+	Silent	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr12:51888749C>G	ENST00000453097.2	+	21	3007	c.2790C>G	c.(2788-2790)ctC>ctG	p.L930L	SLC4A8_ENST00000358657.3_Silent_p.L957L	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		GTCTAAAGCTCTTTGGGATGC	0.488																																						dbGAP											0													138.0	120.0	126.0					12																	51888749		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.2790C>G	12.37:g.51888749C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.L930	ENST00000453097.2	37	c.2790	CCDS44890.1	12																																																																																			SLC4A8	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000050438		0.488	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	HGNC	protein_coding	OTTHUMT00000404356.1	82	0.00	0	C	NM_004858		51888749	51888749	+1	no_errors	ENST00000453097	ensembl	human	known	69_37n	silent	70	18.60	16	SNP	1.000	G
SMG6	23293	genome.wustl.edu	37	17	1990895	1990895	+	Intron	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:1990895C>T	ENST00000263073.6	-	14	3408				SMG6_ENST00000354901.4_Intron|SMG6_ENST00000536871.2_Intron|SMG6_ENST00000544865.1_Intron|SMG6_ENST00000573166.1_5'UTR|RP11-667K14.5_ENST00000571815.1_RNA	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCTTGGGGTGCCTGGTCCTGG	0.527																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.3358-1700G>A	17.37:g.1990895C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	RNA	SNP	-	NULL	ENST00000263073.6	37	NULL	CCDS11016.1	17																																																																																			SMG6	-	-	ENSG00000070366		0.527	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	9	0.00	0	C			1990895	1990895	-1	no_errors	ENST00000573166	ensembl	human	known	69_37n	rna	8	52.94	9	SNP	0.058	T
SMG6	23293	genome.wustl.edu	37	17	1990895	1990895	+	Intron	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:1990895C>T	ENST00000263073.6	-	14	3408				SMG6_ENST00000354901.4_Intron|SMG6_ENST00000536871.2_Intron|SMG6_ENST00000544865.1_Intron|SMG6_ENST00000573166.1_5'UTR|RP11-667K14.5_ENST00000571815.1_RNA	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCTTGGGGTGCCTGGTCCTGG	0.527																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.3358-1700G>A	17.37:g.1990895C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	RNA	SNP	-	NULL	ENST00000263073.6	37	NULL	CCDS11016.1	17																																																																																			SMG6	-	-	ENSG00000070366		0.527	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	21	0.00	0	C			1990895	1990895	-1	no_errors	ENST00000573166	ensembl	human	known	69_37n	rna	8	52.94	9	SNP	0.058	T
SNORD3D	780854	genome.wustl.edu	37	17	19015727	19015727	+	lincRNA	SNP	G	G	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:19015727G>A	ENST00000362793.1	-	0	432									small nucleolar RNA, C/D box 3D																		CCATCAAGAAGGAAAAaccac	0.547																																						dbGAP											0													9.0	17.0	15.0					17																	19015727		838	1964	2802	-	-	-			0					17p11.2	2013-09-05			ENSG00000199663				33192	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006882		Approved	U3-4					17.37:g.19015727G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000362793.1	37	NULL		17																																																																																			RP11-160E2.6	-	-	ENSG00000262202		0.547	SNORD3D-201	KNOWN	basic	snoRNA	SNORD3D	Clone_based_vega_gene	lincRNA		16	0.00	0	G	NR_006882		19015727	19015727	-1	no_errors	ENST00000573866	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.040	A
SPTA1	6708	genome.wustl.edu	37	1	158592829	158592829	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:158592829C>T	ENST00000368147.4	-	43	6244	c.6064G>A	c.(6064-6066)Gaa>Aaa	p.E2022K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2022					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCCGAGGCTTCCAGCAACTGT	0.468																																						dbGAP											0													202.0	202.0	202.0					1																	158592829		1929	4130	6059	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6064G>A	1.37:g.158592829C>T	ENSP00000357129:p.Glu2022Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E2022K	ENST00000368147.4	37	c.6064	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	6.821	0.520697	0.13005	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51817	0.69;0.69	4.78	4.78	0.61160	.	.	.	.	.	T	0.32346	0.0826	L	0.60455	1.87	0.36600	D	0.874615	B	0.14805	0.011	B	0.18561	0.022	T	0.15435	-1.0437	9	0.32370	T	0.25	.	16.5446	0.84426	0.0:1.0:0.0:0.0	.	2022	P02549	SPTA1_HUMAN	K	2022;2019	ENSP00000357130:E2022K;ENSP00000357129:E2019K	ENSP00000357129:E2019K	E	-	1	0	SPTA1	156859453	1.000000	0.71417	0.997000	0.53966	0.113000	0.19764	2.935000	0.48963	2.481000	0.83766	0.655000	0.94253	GAA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	40	0.00	0	C	NM_003126		158592829	158592829	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	19	57.45	27	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158592829	158592829	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:158592829C>T	ENST00000368147.4	-	43	6244	c.6064G>A	c.(6064-6066)Gaa>Aaa	p.E2022K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2022					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCCGAGGCTTCCAGCAACTGT	0.468																																						dbGAP											0													202.0	202.0	202.0					1																	158592829		1929	4130	6059	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6064G>A	1.37:g.158592829C>T	ENSP00000357129:p.Glu2022Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E2022K	ENST00000368147.4	37	c.6064	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	6.821	0.520697	0.13005	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51817	0.69;0.69	4.78	4.78	0.61160	.	.	.	.	.	T	0.32346	0.0826	L	0.60455	1.87	0.36600	D	0.874615	B	0.14805	0.011	B	0.18561	0.022	T	0.15435	-1.0437	9	0.32370	T	0.25	.	16.5446	0.84426	0.0:1.0:0.0:0.0	.	2022	P02549	SPTA1_HUMAN	K	2022;2019	ENSP00000357130:E2022K;ENSP00000357129:E2019K	ENSP00000357129:E2019K	E	-	1	0	SPTA1	156859453	1.000000	0.71417	0.997000	0.53966	0.113000	0.19764	2.935000	0.48963	2.481000	0.83766	0.655000	0.94253	GAA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	64	0.00	0	C	NM_003126		158592829	158592829	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	19	57.45	27	SNP	1.000	T
SYNM	23336	genome.wustl.edu	37	15	99670771	99670771	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr15:99670771delG	ENST00000560674.1	+	4	1817	c.1348delG	c.(1348-1350)gggfs	p.G450fs	SYNM_ENST00000328642.7_Frame_Shift_Del_p.G735fs|SYNM_ENST00000561323.1_3'UTR|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000336292.6_Frame_Shift_Del_p.G735fs			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	736	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						CGGCCTGAAAGGGAGGGAGGG	0.542																																					Pancreas(125;1071 1762 21750 40003 40381)	dbGAP											0													46.0	50.0	49.0					15																	99670771		2037	4173	6210	-	-	-	SO:0001589	frameshift_variant	0			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.1348delG	15.37:g.99670771delG	ENSP00000453040:p.Gly450fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Frame_Shift_Del	DEL	pfam_F	p.R736fs	ENST00000560674.1	37	c.2203		15																																																																																			SYNM	-	NULL	ENSG00000182253		0.542	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	HGNC	protein_coding	OTTHUMT00000415698.2	23	0.00	0	G	NM_145728		99670771	99670771	+1	no_errors	ENST00000336292	ensembl	human	known	69_37n	frame_shift_del	10	71.74	33	DEL	0.998	-
SYNM	23336	genome.wustl.edu	37	15	99670771	99670771	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr15:99670771delG	ENST00000560674.1	+	4	1817	c.1348delG	c.(1348-1350)gggfs	p.G450fs	SYNM_ENST00000328642.7_Frame_Shift_Del_p.G735fs|SYNM_ENST00000561323.1_3'UTR|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000336292.6_Frame_Shift_Del_p.G735fs			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	736	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						CGGCCTGAAAGGGAGGGAGGG	0.542																																					Pancreas(125;1071 1762 21750 40003 40381)	dbGAP											0													46.0	50.0	49.0					15																	99670771		2037	4173	6210	-	-	-	SO:0001589	frameshift_variant	0			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.1348delG	15.37:g.99670771delG	ENSP00000453040:p.Gly450fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Frame_Shift_Del	DEL	pfam_F	p.R736fs	ENST00000560674.1	37	c.2203		15																																																																																			SYNM	-	NULL	ENSG00000182253		0.542	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	HGNC	protein_coding	OTTHUMT00000415698.2	51	0.00	0	G	NM_145728		99670771	99670771	+1	no_errors	ENST00000336292	ensembl	human	known	69_37n	frame_shift_del	10	71.74	33	DEL	0.998	-
TANK	10010	genome.wustl.edu	37	2	162087687	162087687	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:162087687C>G	ENST00000392749.2	+	7	965	c.726C>G	c.(724-726)gaC>gaG	p.D242E	AC009299.2_ENST00000445372.1_RNA|AC009299.2_ENST00000421122.2_RNA|TANK_ENST00000405852.1_Missense_Mutation_p.D242E|TANK_ENST00000259075.2_Missense_Mutation_p.D242E|TANK_ENST00000406287.1_Intron|TANK_ENST00000402568.1_Intron	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	242					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						TGGACAATGACTCAACTTTCT	0.443																																						dbGAP											0													137.0	137.0	137.0					2																	162087687		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.726C>G	2.37:g.162087687C>G	ENSP00000376505:p.Asp242Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	NULL	p.D242E	ENST00000392749.2	37	c.726	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352486	0.61293	.	.	ENSG00000136560	ENST00000259075;ENST00000392749;ENST00000405852;ENST00000437623	T;T;T;T	0.37915	1.58;1.58;1.19;1.17	5.58	3.68	0.42216	.	0.094151	0.64402	N	0.000001	T	0.53029	0.1771	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.49978	-0.8881	10	0.49607	T	0.09	-6.1211	9.9721	0.41761	0.1363:0.7892:0.0:0.0744	.	242	Q92844	TANK_HUMAN	E	242;242;242;133	ENSP00000259075:D242E;ENSP00000376505:D242E;ENSP00000385487:D242E;ENSP00000412556:D133E	ENSP00000259075:D242E	D	+	3	2	TANK	161795933	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	0.692000	0.25482	0.728000	0.32382	0.591000	0.81541	GAC	TANK	-	NULL	ENSG00000136560		0.443	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1	15	0.00	0	C	NM_133484		162087687	162087687	+1	no_errors	ENST00000259075	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	G
TAS1R2	80834	genome.wustl.edu	37	1	19166499	19166499	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr1:19166499G>C	ENST00000375371.3	-	6	2135	c.2114C>G	c.(2113-2115)aCc>aGc	p.T705S		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	705					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AGTACGGGTGGTGGGACTGAG	0.562																																						dbGAP											0													126.0	132.0	130.0					1																	19166499		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.2114C>G	1.37:g.19166499G>C	ENSP00000364520:p.Thr705Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.T705S	ENST00000375371.3	37	c.2114	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.384600	0.25031	.	.	ENSG00000179002	ENST00000375371	D	0.87887	-2.31	4.85	2.97	0.34412	GPCR, family 3, C-terminal (2);	0.277119	0.25355	N	0.031272	D	0.87585	0.6214	M	0.78637	2.42	0.23598	N	0.997327	P	0.46578	0.88	P	0.51550	0.673	T	0.76526	-0.2927	10	0.07325	T	0.83	.	8.8457	0.35168	0.1774:0.0:0.8226:0.0	.	705	Q8TE23	TS1R2_HUMAN	S	705	ENSP00000364520:T705S	ENSP00000364520:T705S	T	-	2	0	TAS1R2	19039086	1.000000	0.71417	0.058000	0.19502	0.431000	0.31685	5.480000	0.66820	0.468000	0.27243	0.561000	0.74099	ACC	TAS1R2	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000179002		0.562	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	86	0.00	0	G			19166499	19166499	-1	no_errors	ENST00000375371	ensembl	human	novel	69_37n	missense	69	33.65	35	SNP	0.974	C
TAS1R2	80834	genome.wustl.edu	37	1	19166499	19166499	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr1:19166499G>C	ENST00000375371.3	-	6	2135	c.2114C>G	c.(2113-2115)aCc>aGc	p.T705S		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	705					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AGTACGGGTGGTGGGACTGAG	0.562																																						dbGAP											0													126.0	132.0	130.0					1																	19166499		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.2114C>G	1.37:g.19166499G>C	ENSP00000364520:p.Thr705Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.T705S	ENST00000375371.3	37	c.2114	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.384600	0.25031	.	.	ENSG00000179002	ENST00000375371	D	0.87887	-2.31	4.85	2.97	0.34412	GPCR, family 3, C-terminal (2);	0.277119	0.25355	N	0.031272	D	0.87585	0.6214	M	0.78637	2.42	0.23598	N	0.997327	P	0.46578	0.88	P	0.51550	0.673	T	0.76526	-0.2927	10	0.07325	T	0.83	.	8.8457	0.35168	0.1774:0.0:0.8226:0.0	.	705	Q8TE23	TS1R2_HUMAN	S	705	ENSP00000364520:T705S	ENSP00000364520:T705S	T	-	2	0	TAS1R2	19039086	1.000000	0.71417	0.058000	0.19502	0.431000	0.31685	5.480000	0.66820	0.468000	0.27243	0.561000	0.74099	ACC	TAS1R2	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000179002		0.562	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	198	0.00	0	G			19166499	19166499	-1	no_errors	ENST00000375371	ensembl	human	novel	69_37n	missense	69	33.65	35	SNP	0.974	C
TMEM140	55281	genome.wustl.edu	37	7	134849503	134849503	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr7:134849503G>C	ENST00000275767.3	+	2	533	c.310G>C	c.(310-312)Gcc>Ccc	p.A104P	C7orf49_ENST00000459937.1_Intron	NM_018295.3	NP_060765.4	Q9NV12	TM140_HUMAN	transmembrane protein 140	104						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)	5						TCTCCTCCTAGCCCAGTGCAA	0.677																																						dbGAP											0													52.0	48.0	50.0					7																	134849503		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001862	CCDS5837.1	7q33	2006-03-17			ENSG00000146859	ENSG00000146859			21870	protein-coding gene	gene with protein product							Standard	NM_018295		Approved	FLJ11000	uc003vsi.3	Q9NV12	OTTHUMG00000155413	ENST00000275767.3:c.310G>C	7.37:g.134849503G>C	ENSP00000275767:p.Ala104Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1P9|Q8WUC3	Missense_Mutation	SNP	NULL	p.A104P	ENST00000275767.3	37	c.310	CCDS5837.1	7	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284204	0.40394	.	.	ENSG00000146859	ENST00000275767	T	0.26223	1.75	5.28	4.38	0.52667	.	0.378995	0.22782	N	0.055714	T	0.44414	0.1292	M	0.62723	1.935	0.28886	N	0.894108	D	0.76494	0.999	D	0.66979	0.948	T	0.38499	-0.9658	10	0.66056	D	0.02	-12.6058	10.695	0.45894	0.0:0.0:0.6522:0.3478	.	104	Q9NV12	TM140_HUMAN	P	104	ENSP00000275767:A104P	ENSP00000275767:A104P	A	+	1	0	TMEM140	134500043	0.045000	0.20229	0.946000	0.38457	0.039000	0.13416	0.769000	0.26604	1.415000	0.47037	0.655000	0.94253	GCC	TMEM140	-	NULL	ENSG00000146859		0.677	TMEM140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM140	HGNC	protein_coding	OTTHUMT00000340017.2	60	0.00	0	G	NM_018295		134849503	134849503	+1	no_errors	ENST00000275767	ensembl	human	known	69_37n	missense	18	73.53	50	SNP	0.977	C
TMEM140	55281	genome.wustl.edu	37	7	134849503	134849503	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr7:134849503G>C	ENST00000275767.3	+	2	533	c.310G>C	c.(310-312)Gcc>Ccc	p.A104P	C7orf49_ENST00000459937.1_Intron	NM_018295.3	NP_060765.4	Q9NV12	TM140_HUMAN	transmembrane protein 140	104						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)	5						TCTCCTCCTAGCCCAGTGCAA	0.677																																						dbGAP											0													52.0	48.0	50.0					7																	134849503		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001862	CCDS5837.1	7q33	2006-03-17			ENSG00000146859	ENSG00000146859			21870	protein-coding gene	gene with protein product							Standard	NM_018295		Approved	FLJ11000	uc003vsi.3	Q9NV12	OTTHUMG00000155413	ENST00000275767.3:c.310G>C	7.37:g.134849503G>C	ENSP00000275767:p.Ala104Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1P9|Q8WUC3	Missense_Mutation	SNP	NULL	p.A104P	ENST00000275767.3	37	c.310	CCDS5837.1	7	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284204	0.40394	.	.	ENSG00000146859	ENST00000275767	T	0.26223	1.75	5.28	4.38	0.52667	.	0.378995	0.22782	N	0.055714	T	0.44414	0.1292	M	0.62723	1.935	0.28886	N	0.894108	D	0.76494	0.999	D	0.66979	0.948	T	0.38499	-0.9658	10	0.66056	D	0.02	-12.6058	10.695	0.45894	0.0:0.0:0.6522:0.3478	.	104	Q9NV12	TM140_HUMAN	P	104	ENSP00000275767:A104P	ENSP00000275767:A104P	A	+	1	0	TMEM140	134500043	0.045000	0.20229	0.946000	0.38457	0.039000	0.13416	0.769000	0.26604	1.415000	0.47037	0.655000	0.94253	GCC	TMEM140	-	NULL	ENSG00000146859		0.677	TMEM140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM140	HGNC	protein_coding	OTTHUMT00000340017.2	66	0.00	0	G	NM_018295		134849503	134849503	+1	no_errors	ENST00000275767	ensembl	human	known	69_37n	missense	18	73.53	50	SNP	0.977	C
TNFRSF10D	8793	genome.wustl.edu	37	8	23005964	23005965	+	Frame_Shift_Del	DEL	TG	TG	-	rs61756240		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr8:23005964_23005965delTG	ENST00000312584.3	-	3	450_451	c.356_357delCA	c.(355-357)acafs	p.T119fs		NM_003840.4	NP_003831.2	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain	119					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		ATTTACAAACTGTACATAGCAG	0.495																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF029761	CCDS6038.1	8p21	2006-02-22			ENSG00000173530	ENSG00000173530		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11907	protein-coding gene	gene with protein product		603614				9382840, 9537512	Standard	NM_003840		Approved	DcR2, TRUNDD, TRAILR4, CD264	uc003xcz.2	Q9UBN6	OTTHUMG00000097845	ENST00000312584.3:c.356_357delCA	8.37:g.23005964_23005965delTG	ENSP00000310263:p.Thr119fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8W0|Q9Y6Q4	Frame_Shift_Del	DEL	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_10	p.T119fs	ENST00000312584.3	37	c.357_356	CCDS6038.1	8																																																																																			TNFRSF10D	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000173530		0.495	TNFRSF10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF10D	HGNC	protein_coding	OTTHUMT00000215135.1	31	0.00	0	TG			23005964	23005965	-1	no_errors	ENST00000312584	ensembl	human	known	69_37n	frame_shift_del	41	36.23	25	DEL	0.000:0.000	-
TNFRSF10D	8793	genome.wustl.edu	37	8	23005964	23005965	+	Frame_Shift_Del	DEL	TG	TG	-	rs61756240		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr8:23005964_23005965delTG	ENST00000312584.3	-	3	450_451	c.356_357delCA	c.(355-357)acafs	p.T119fs		NM_003840.4	NP_003831.2	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain	119					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		ATTTACAAACTGTACATAGCAG	0.495																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF029761	CCDS6038.1	8p21	2006-02-22			ENSG00000173530	ENSG00000173530		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11907	protein-coding gene	gene with protein product		603614				9382840, 9537512	Standard	NM_003840		Approved	DcR2, TRUNDD, TRAILR4, CD264	uc003xcz.2	Q9UBN6	OTTHUMG00000097845	ENST00000312584.3:c.356_357delCA	8.37:g.23005964_23005965delTG	ENSP00000310263:p.Thr119fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8W0|Q9Y6Q4	Frame_Shift_Del	DEL	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_10	p.T119fs	ENST00000312584.3	37	c.357_356	CCDS6038.1	8																																																																																			TNFRSF10D	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000173530		0.495	TNFRSF10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF10D	HGNC	protein_coding	OTTHUMT00000215135.1	71	0.00	0	TG			23005964	23005965	-1	no_errors	ENST00000312584	ensembl	human	known	69_37n	frame_shift_del	41	36.23	25	DEL	0.000:0.000	-
TP53	7157	genome.wustl.edu	37	17	7577156	7577156	+	Splice_Site	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:7577156C>A	ENST00000269305.4	-	8	972		c.e8-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(25)|p.0?(8)|p.E258fs*71(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TAGATTACCACTACTCAGGAT	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	34	Unknown(25)|Whole gene deletion(8)|Deletion - Frameshift(1)	lung(7)|upper_aerodigestive_tract(6)|urinary_tract(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|stomach(2)|central_nervous_system(2)|oesophagus(2)|large_intestine(1)|breast(1)|ovary(1)											39.0	35.0	36.0					17																	7577156		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.783-1G>T	17.37:g.7577156C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e7-1	ENST00000269305.4	37	c.783-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889808	0.52014	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.446	0.75232	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517881	1.000000	0.71417	0.988000	0.46212	0.068000	0.16541	6.325000	0.72901	2.509000	0.84616	0.462000	0.41574	.	TP53	-	-	ENSG00000141510		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	18	0.00	0	C	NM_000546	Intron	7577156	7577156	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	14	65.85	27	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577156	7577156	+	Splice_Site	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:7577156C>A	ENST00000269305.4	-	8	972		c.e8-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(25)|p.0?(8)|p.E258fs*71(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TAGATTACCACTACTCAGGAT	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	34	Unknown(25)|Whole gene deletion(8)|Deletion - Frameshift(1)	lung(7)|upper_aerodigestive_tract(6)|urinary_tract(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|stomach(2)|central_nervous_system(2)|oesophagus(2)|large_intestine(1)|breast(1)|ovary(1)											39.0	35.0	36.0					17																	7577156		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.783-1G>T	17.37:g.7577156C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e7-1	ENST00000269305.4	37	c.783-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889808	0.52014	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.446	0.75232	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517881	1.000000	0.71417	0.988000	0.46212	0.068000	0.16541	6.325000	0.72901	2.509000	0.84616	0.462000	0.41574	.	TP53	-	-	ENSG00000141510		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	47	0.00	0	C	NM_000546	Intron	7577156	7577156	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	14	65.85	27	SNP	1.000	A
TRPM5	29850	genome.wustl.edu	37	11	2434134	2434134	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr11:2434134G>C	ENST00000155858.6	-	15	2213	c.2205C>G	c.(2203-2205)ttC>ttG	p.F735L	TRPM5_ENST00000452833.1_Missense_Mutation_p.F737L|TRPM5_ENST00000533060.1_Missense_Mutation_p.F735L|TRPM5_ENST00000528453.1_Missense_Mutation_p.F735L	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CGTTCCCCAGGAACACAGTCA	0.662																																					NSCLC(1;49 61 17205 18850 43201)	dbGAP											0													48.0	43.0	44.0					11																	2434134		2187	4293	6480	-	-	-	SO:0001583	missense	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2205C>G	11.37:g.2434134G>C	ENSP00000155858:p.Phe735Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.F737L	ENST00000155858.6	37	c.2211	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537586	0.65085	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86	4.12	1.16	0.20824	.	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.87180	2.865	0.49130	D	0.99975	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.984	T	0.82585	-0.0384	10	0.87932	D	0	-15.834	7.8138	0.29247	0.3976:0.0:0.6024:0.0	.	735;737;735	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	L	729;735;737;735;735;735	ENSP00000434383:F729L;ENSP00000155858:F735L;ENSP00000387965:F737L;ENSP00000434121:F735L;ENSP00000436809:F735L	ENSP00000155858:F735L	F	-	3	2	TRPM5	2390710	1.000000	0.71417	0.998000	0.56505	0.730000	0.41778	1.494000	0.35616	0.026000	0.15269	-0.657000	0.03884	TTC	TRPM5	-	NULL	ENSG00000070985		0.662	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	31	0.00	0	G	NM_014555		2434134	2434134	-1	no_errors	ENST00000452833	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	1.000	C
TRPM5	29850	genome.wustl.edu	37	11	2434134	2434134	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr11:2434134G>C	ENST00000155858.6	-	15	2213	c.2205C>G	c.(2203-2205)ttC>ttG	p.F735L	TRPM5_ENST00000452833.1_Missense_Mutation_p.F737L|TRPM5_ENST00000533060.1_Missense_Mutation_p.F735L|TRPM5_ENST00000528453.1_Missense_Mutation_p.F735L	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CGTTCCCCAGGAACACAGTCA	0.662																																					NSCLC(1;49 61 17205 18850 43201)	dbGAP											0													48.0	43.0	44.0					11																	2434134		2187	4293	6480	-	-	-	SO:0001583	missense	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2205C>G	11.37:g.2434134G>C	ENSP00000155858:p.Phe735Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.F737L	ENST00000155858.6	37	c.2211	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537586	0.65085	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86	4.12	1.16	0.20824	.	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.87180	2.865	0.49130	D	0.99975	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.984	T	0.82585	-0.0384	10	0.87932	D	0	-15.834	7.8138	0.29247	0.3976:0.0:0.6024:0.0	.	735;737;735	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	L	729;735;737;735;735;735	ENSP00000434383:F729L;ENSP00000155858:F735L;ENSP00000387965:F737L;ENSP00000434121:F735L;ENSP00000436809:F735L	ENSP00000155858:F735L	F	-	3	2	TRPM5	2390710	1.000000	0.71417	0.998000	0.56505	0.730000	0.41778	1.494000	0.35616	0.026000	0.15269	-0.657000	0.03884	TTC	TRPM5	-	NULL	ENSG00000070985		0.662	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	69	0.00	0	G	NM_014555		2434134	2434134	-1	no_errors	ENST00000452833	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	1.000	C
TYRP1	7306	genome.wustl.edu	37	9	12708043	12708043	+	Silent	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr9:12708043A>G	ENST00000388918.5	+	7	1437	c.1308A>G	c.(1306-1308)agA>agG	p.R436R	TYRP1_ENST00000381137.2_Silent_p.R145R|TYRP1_ENST00000473504.1_3'UTR|RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381136.2_Silent_p.R146R	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	436					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GACATAATAGACAATACAACA	0.353									Oculocutaneous Albinism																													dbGAP											0													64.0	63.0	64.0					9																	12708043		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.1308A>G	9.37:g.12708043A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P78468|P78469|Q13721|Q15679	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.R436	ENST00000388918.5	37	c.1308	CCDS34990.1	9																																																																																			TYRP1	-	superfamily_Unchr_di-copper_centre	ENSG00000107165		0.353	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRP1	HGNC	protein_coding	OTTHUMT00000055502.3	37	0.00	0	A	NM_000550		12708043	12708043	+1	no_errors	ENST00000388918	ensembl	human	known	69_37n	silent	73	21.51	20	SNP	0.996	G
TYRP1	7306	genome.wustl.edu	37	9	12708043	12708043	+	Silent	SNP	A	A	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr9:12708043A>G	ENST00000388918.5	+	7	1437	c.1308A>G	c.(1306-1308)agA>agG	p.R436R	TYRP1_ENST00000381137.2_Silent_p.R145R|TYRP1_ENST00000473504.1_3'UTR|RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381136.2_Silent_p.R146R	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	436					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GACATAATAGACAATACAACA	0.353									Oculocutaneous Albinism																													dbGAP											0													64.0	63.0	64.0					9																	12708043		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.1308A>G	9.37:g.12708043A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P78468|P78469|Q13721|Q15679	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.R436	ENST00000388918.5	37	c.1308	CCDS34990.1	9																																																																																			TYRP1	-	superfamily_Unchr_di-copper_centre	ENSG00000107165		0.353	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRP1	HGNC	protein_coding	OTTHUMT00000055502.3	71	0.00	0	A	NM_000550		12708043	12708043	+1	no_errors	ENST00000388918	ensembl	human	known	69_37n	silent	73	21.51	20	SNP	0.996	G
UBE3A	7337	genome.wustl.edu	37	15	25585358	25585358	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr15:25585358A>T	ENST00000397954.2	-	10	2380	c.2381T>A	c.(2380-2382)gTt>gAt	p.V794D	SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000566215.1_Missense_Mutation_p.V771D|UBE3A_ENST00000232165.3_Missense_Mutation_p.V791D|UBE3A_ENST00000438097.1_Missense_Mutation_p.V771D|UBE3A_ENST00000428984.2_Missense_Mutation_p.V771D|SNHG14_ENST00000452731.1_RNA			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	794	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		AAATGAATGAACGATTTCCCA	0.358																																						dbGAP											0													88.0	85.0	86.0					15																	25585358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.2381T>A	15.37:g.25585358A>T	ENSP00000381045:p.Val794Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	p.V794D	ENST00000397954.2	37	c.2381	CCDS45192.1	15	.	.	.	.	.	.	.	.	.	.	A	25.7	4.662834	0.88251	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	5.51	5.51	0.81932	HECT (4);	0.063724	0.64402	D	0.000009	D	0.84857	0.5565	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	0.994;1.0	P;D	0.75484	0.822;0.986	D	0.90677	0.4602	10	0.87932	D	0	.	15.6208	0.76805	1.0:0.0:0.0:0.0	.	791;794	Q05086-3;Q05086	.;UBE3A_HUMAN	D	791;791;794;771;771	ENSP00000232165:V791D;ENSP00000381045:V794D;ENSP00000411258:V771D;ENSP00000401265:V771D	ENSP00000232165:V791D	V	-	2	0	UBE3A	23136451	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.076000	0.62316	0.482000	0.46254	GTT	UBE3A	-	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	ENSG00000114062		0.358	UBE3A-003	KNOWN	basic|CCDS	protein_coding	UBE3A	HGNC	protein_coding	OTTHUMT00000434203.1	35	0.00	0	A	NM_000462		25585358	25585358	-1	no_errors	ENST00000397954	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210782505	210782505	+	Silent	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr2:210782505C>G	ENST00000439458.1	+	31	4916	c.4836C>G	c.(4834-4836)gcC>gcG	p.A1612A	UNC80_ENST00000272845.6_Silent_p.A1607A	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1612					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CTCTAGCTGCCATGTTCCTGC	0.498																																						dbGAP											0													75.0	59.0	64.0					2																	210782505		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4836C>G	2.37:g.210782505C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	NULL	p.A1612	ENST00000439458.1	37	c.4836	CCDS46504.1	2																																																																																			UNC80	-	NULL	ENSG00000144406		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		38	0.00	0	C	NM_182587		210782505	210782505	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	silent	48	32.39	23	SNP	1.000	G
UNC80	285175	genome.wustl.edu	37	2	210782505	210782505	+	Silent	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr2:210782505C>G	ENST00000439458.1	+	31	4916	c.4836C>G	c.(4834-4836)gcC>gcG	p.A1612A	UNC80_ENST00000272845.6_Silent_p.A1607A	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1612					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CTCTAGCTGCCATGTTCCTGC	0.498																																						dbGAP											0													75.0	59.0	64.0					2																	210782505		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4836C>G	2.37:g.210782505C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	NULL	p.A1612	ENST00000439458.1	37	c.4836	CCDS46504.1	2																																																																																			UNC80	-	NULL	ENSG00000144406		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		68	0.00	0	C	NM_182587		210782505	210782505	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	silent	48	32.39	23	SNP	1.000	G
WDR13	64743	genome.wustl.edu	37	X	48459020	48459020	+	Intron	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chrX:48459020G>T	ENST00000218056.5	+	5	1336				WDR13_ENST00000376729.5_Intron	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13							cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CTGTGGTCAGGCTCCAGGACA	0.602																																						dbGAP											0													47.0	31.0	37.0					X																	48459020		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.831+6G>T	X.37:g.48459020G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	RNA	SNP	-	NULL	ENST00000218056.5	37	NULL	CCDS14302.1	X																																																																																			WDR13	-	-	ENSG00000101940		0.602	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	74	0.00	0	G			48459020	48459020	+1	no_errors	ENST00000482760	ensembl	human	known	69_37n	rna	72	33.03	36	SNP	0.994	T
WDR13	64743	genome.wustl.edu	37	X	48459020	48459020	+	Intron	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chrX:48459020G>T	ENST00000218056.5	+	5	1336				WDR13_ENST00000376729.5_Intron	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13							cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CTGTGGTCAGGCTCCAGGACA	0.602																																						dbGAP											0													47.0	31.0	37.0					X																	48459020		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.831+6G>T	X.37:g.48459020G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	RNA	SNP	-	NULL	ENST00000218056.5	37	NULL	CCDS14302.1	X																																																																																			WDR13	-	-	ENSG00000101940		0.602	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	92	0.00	0	G			48459020	48459020	+1	no_errors	ENST00000482760	ensembl	human	known	69_37n	rna	72	33.03	36	SNP	0.994	T
WSB1	26118	genome.wustl.edu	37	17	25621392	25621392	+	5'UTR	SNP	G	G	A	rs555516977		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr17:25621392G>A	ENST00000262394.2	+	0	287				WSB1_ENST00000583193.1_5'UTR|WSB1_ENST00000348811.2_5'UTR|WSB1_ENST00000427287.2_5'UTR|WSB1_ENST00000581185.1_5'UTR|MIR4522_ENST00000584932.1_RNA|WSB1_ENST00000579733.1_5'UTR|WSB1_ENST00000578312.1_3'UTR	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GGTCCGCATCGTATTCCCGGA	0.642																																						dbGAP											0													101.0	95.0	97.0					17																	25621392		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.-30G>A	17.37:g.25621392G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	RNA	SNP	-	NULL	ENST00000262394.2	37	NULL	CCDS11220.1	17																																																																																			WSB1	-	-	ENSG00000109046		0.642	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSB1	HGNC	protein_coding	OTTHUMT00000255391.4	35	0.00	0	G	NM_015626		25621392	25621392	+1	no_errors	ENST00000578312	ensembl	human	known	69_37n	rna	28	54.10	33	SNP	0.215	A
WSB1	26118	genome.wustl.edu	37	17	25621392	25621392	+	5'UTR	SNP	G	G	A	rs555516977		TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr17:25621392G>A	ENST00000262394.2	+	0	287				WSB1_ENST00000583193.1_5'UTR|WSB1_ENST00000348811.2_5'UTR|WSB1_ENST00000427287.2_5'UTR|WSB1_ENST00000581185.1_5'UTR|MIR4522_ENST00000584932.1_RNA|WSB1_ENST00000579733.1_5'UTR|WSB1_ENST00000578312.1_3'UTR	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GGTCCGCATCGTATTCCCGGA	0.642																																						dbGAP											0													101.0	95.0	97.0					17																	25621392		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.-30G>A	17.37:g.25621392G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	RNA	SNP	-	NULL	ENST00000262394.2	37	NULL	CCDS11220.1	17																																																																																			WSB1	-	-	ENSG00000109046		0.642	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSB1	HGNC	protein_coding	OTTHUMT00000255391.4	73	0.00	0	G	NM_015626		25621392	25621392	+1	no_errors	ENST00000578312	ensembl	human	known	69_37n	rna	28	54.10	33	SNP	0.215	A
XRN1	54464	genome.wustl.edu	37	3	142095339	142095339	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr3:142095339C>G	ENST00000264951.4	-	24	2930	c.2813G>C	c.(2812-2814)gGa>gCa	p.G938A	XRN1_ENST00000392981.2_Missense_Mutation_p.G938A	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	938					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						AGATCCTCTTCCAATAAAAAT	0.313																																						dbGAP											0													35.0	36.0	36.0					3																	142095339		2199	4298	6497	-	-	-	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2813G>C	3.37:g.142095339C>G	ENSP00000264951:p.Gly938Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.G938A	ENST00000264951.4	37	c.2813	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530276	0.27387	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.27890	1.64;1.64	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.27205	0.0667	L	0.37897	1.145	0.80722	D	1	B;B;B	0.24882	0.11;0.113;0.069	B;B;B	0.30251	0.039;0.113;0.053	T	0.07635	-1.0762	10	0.06365	T	0.9	-19.8262	19.4474	0.94852	0.0:1.0:0.0:0.0	.	799;938;938	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	A	938	ENSP00000264951:G938A;ENSP00000376707:G938A	ENSP00000264951:G938A	G	-	2	0	XRN1	143578029	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.614000	0.88457	0.591000	0.81541	GGA	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.313	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	50	0.00	0	C	NM_019001		142095339	142095339	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	missense	70	13.58	11	SNP	1.000	G
XRN1	54464	genome.wustl.edu	37	3	142095339	142095339	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr3:142095339C>G	ENST00000264951.4	-	24	2930	c.2813G>C	c.(2812-2814)gGa>gCa	p.G938A	XRN1_ENST00000392981.2_Missense_Mutation_p.G938A	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	938					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						AGATCCTCTTCCAATAAAAAT	0.313																																						dbGAP											0													35.0	36.0	36.0					3																	142095339		2199	4298	6497	-	-	-	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2813G>C	3.37:g.142095339C>G	ENSP00000264951:p.Gly938Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.G938A	ENST00000264951.4	37	c.2813	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530276	0.27387	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.27890	1.64;1.64	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.27205	0.0667	L	0.37897	1.145	0.80722	D	1	B;B;B	0.24882	0.11;0.113;0.069	B;B;B	0.30251	0.039;0.113;0.053	T	0.07635	-1.0762	10	0.06365	T	0.9	-19.8262	19.4474	0.94852	0.0:1.0:0.0:0.0	.	799;938;938	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	A	938	ENSP00000264951:G938A;ENSP00000376707:G938A	ENSP00000264951:G938A	G	-	2	0	XRN1	143578029	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.614000	0.88457	0.591000	0.81541	GGA	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.313	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	95	0.00	0	C	NM_019001		142095339	142095339	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	missense	70	13.58	11	SNP	1.000	G
ZFPM2	23414	genome.wustl.edu	37	8	106815176	106815176	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr8:106815176G>T	ENST00000407775.2	+	8	3116	c.2866G>T	c.(2866-2868)Gaa>Taa	p.E956*	RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000520492.1_Nonsense_Mutation_p.E824*|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Nonsense_Mutation_p.E824*|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Nonsense_Mutation_p.E687*|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	956					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TGCTACAAAAGAAGAAAACAG	0.443																																						dbGAP											0													32.0	30.0	30.0					8																	106815176		1847	4094	5941	-	-	-	SO:0001587	stop_gained	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2866G>T	8.37:g.106815176G>T	ENSP00000384179:p.Glu956*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E956*	ENST00000407775.2	37	c.2866	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	38	7.122179	0.98077	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	.	.	.	5.76	5.76	0.90799	.	0.147064	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.9617	0.97254	0.0:0.0:1.0:0.0	.	.	.	.	X	956;824;824;687	.	ENSP00000367733:E687X	E	+	1	0	ZFPM2	106884352	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.869000	0.99810	2.722000	0.93159	0.650000	0.86243	GAA	ZFPM2	-	NULL	ENSG00000169946		0.443	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	19	0.00	0	G			106815176	106815176	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	nonsense	28	24.32	9	SNP	1.000	T
ZFPM2	23414	genome.wustl.edu	37	8	106815176	106815176	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr8:106815176G>T	ENST00000407775.2	+	8	3116	c.2866G>T	c.(2866-2868)Gaa>Taa	p.E956*	RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000520492.1_Nonsense_Mutation_p.E824*|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Nonsense_Mutation_p.E824*|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Nonsense_Mutation_p.E687*|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	956					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TGCTACAAAAGAAGAAAACAG	0.443																																						dbGAP											0													32.0	30.0	30.0					8																	106815176		1847	4094	5941	-	-	-	SO:0001587	stop_gained	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2866G>T	8.37:g.106815176G>T	ENSP00000384179:p.Glu956*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E956*	ENST00000407775.2	37	c.2866	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	38	7.122179	0.98077	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	.	.	.	5.76	5.76	0.90799	.	0.147064	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.9617	0.97254	0.0:0.0:1.0:0.0	.	.	.	.	X	956;824;824;687	.	ENSP00000367733:E687X	E	+	1	0	ZFPM2	106884352	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.869000	0.99810	2.722000	0.93159	0.650000	0.86243	GAA	ZFPM2	-	NULL	ENSG00000169946		0.443	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	58	0.00	0	G			106815176	106815176	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	nonsense	28	24.32	9	SNP	1.000	T
ZNF17	7565	genome.wustl.edu	37	19	57931914	57931914	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:57931914C>T	ENST00000601808.1	+	3	1267	c.1054C>T	c.(1054-1056)Cac>Tac	p.H352Y	AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000307658.7_Missense_Mutation_p.H354Y	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TCAGAAAGTTCACACTGGAGA	0.403																																					Melanoma(149;1637 1853 29914 42869 44988)	dbGAP											0													82.0	86.0	85.0					19																	57931914		2193	4298	6491	-	-	-	SO:0001583	missense	0			X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.1054C>T	19.37:g.57931914C>T	ENSP00000471905:p.His352Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H352Y	ENST00000601808.1	37	c.1054	CCDS42636.1	19	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435574	0.62955	.	.	ENSG00000186272	ENST00000307658	.	.	.	1.4	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81108	0.4754	H	0.96048	3.76	0.32050	N	0.597111	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	T	0.82884	-0.0236	8	0.87932	D	0	.	10.3946	0.44192	0.0:1.0:0.0:0.0	.	354;352	P17021-2;P17021	.;ZNF17_HUMAN	Y	352	.	ENSP00000302455:H352Y	H	+	1	0	ZNF17	62623726	0.774000	0.28592	0.046000	0.18839	0.894000	0.52154	4.061000	0.57485	1.069000	0.40788	0.585000	0.79938	CAC	ZNF17	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186272		0.403	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF17	HGNC	protein_coding	OTTHUMT00000466384.1	54	0.00	0	C	NM_006959		57931914	57931914	+1	no_errors	ENST00000307658	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	0.995	T
ZNF17	7565	genome.wustl.edu	37	19	57931914	57931914	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:57931914C>T	ENST00000601808.1	+	3	1267	c.1054C>T	c.(1054-1056)Cac>Tac	p.H352Y	AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000307658.7_Missense_Mutation_p.H354Y	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TCAGAAAGTTCACACTGGAGA	0.403																																					Melanoma(149;1637 1853 29914 42869 44988)	dbGAP											0													82.0	86.0	85.0					19																	57931914		2193	4298	6491	-	-	-	SO:0001583	missense	0			X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.1054C>T	19.37:g.57931914C>T	ENSP00000471905:p.His352Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H352Y	ENST00000601808.1	37	c.1054	CCDS42636.1	19	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435574	0.62955	.	.	ENSG00000186272	ENST00000307658	.	.	.	1.4	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81108	0.4754	H	0.96048	3.76	0.32050	N	0.597111	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	T	0.82884	-0.0236	8	0.87932	D	0	.	10.3946	0.44192	0.0:1.0:0.0:0.0	.	354;352	P17021-2;P17021	.;ZNF17_HUMAN	Y	352	.	ENSP00000302455:H352Y	H	+	1	0	ZNF17	62623726	0.774000	0.28592	0.046000	0.18839	0.894000	0.52154	4.061000	0.57485	1.069000	0.40788	0.585000	0.79938	CAC	ZNF17	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186272		0.403	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF17	HGNC	protein_coding	OTTHUMT00000466384.1	83	0.00	0	C	NM_006959		57931914	57931914	+1	no_errors	ENST00000307658	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	0.995	T
ZNF462	58499	genome.wustl.edu	37	9	109686591	109686591	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr9:109686591C>T	ENST00000277225.5	+	3	687	c.398C>T	c.(397-399)gCt>gTt	p.A133V	ZNF462_ENST00000457913.1_Missense_Mutation_p.A133V			Q96JM2	ZN462_HUMAN	zinc finger protein 462	133					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTCCATGGAGCTCAAGCTGAA	0.433																																						dbGAP											0													62.0	62.0	62.0					9																	109686591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.398C>T	9.37:g.109686591C>T	ENSP00000277225:p.Ala133Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A133V	ENST00000277225.5	37	c.398	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111235	0.56398	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.05258	3.47;3.91	5.67	5.67	0.87782	Zinc finger, C2H2 (1);	0.285267	0.39274	N	0.001408	T	0.06416	0.0165	L	0.27053	0.805	0.80722	D	1	B	0.23377	0.084	B	0.20184	0.028	T	0.44982	-0.9292	9	.	.	.	.	17.9445	0.89035	0.0:1.0:0.0:0.0	.	133	Q96JM2	ZN462_HUMAN	V	133	ENSP00000277225:A133V;ENSP00000414570:A133V	.	A	+	2	0	ZNF462	108726412	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.427000	0.44740	2.683000	0.91414	0.551000	0.68910	GCT	ZNF462	-	pfscan_Znf_C2H2	ENSG00000148143		0.433	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	28	0.00	0	C	NM_021224		109686591	109686591	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	0.996	T
ZNF462	58499	genome.wustl.edu	37	9	109686591	109686591	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr9:109686591C>T	ENST00000277225.5	+	3	687	c.398C>T	c.(397-399)gCt>gTt	p.A133V	ZNF462_ENST00000457913.1_Missense_Mutation_p.A133V			Q96JM2	ZN462_HUMAN	zinc finger protein 462	133					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTCCATGGAGCTCAAGCTGAA	0.433																																						dbGAP											0													62.0	62.0	62.0					9																	109686591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.398C>T	9.37:g.109686591C>T	ENSP00000277225:p.Ala133Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A133V	ENST00000277225.5	37	c.398	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111235	0.56398	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.05258	3.47;3.91	5.67	5.67	0.87782	Zinc finger, C2H2 (1);	0.285267	0.39274	N	0.001408	T	0.06416	0.0165	L	0.27053	0.805	0.80722	D	1	B	0.23377	0.084	B	0.20184	0.028	T	0.44982	-0.9292	9	.	.	.	.	17.9445	0.89035	0.0:1.0:0.0:0.0	.	133	Q96JM2	ZN462_HUMAN	V	133	ENSP00000277225:A133V;ENSP00000414570:A133V	.	A	+	2	0	ZNF462	108726412	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.427000	0.44740	2.683000	0.91414	0.551000	0.68910	GCT	ZNF462	-	pfscan_Znf_C2H2	ENSG00000148143		0.433	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	39	0.00	0	C	NM_021224		109686591	109686591	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	0.996	T
ZNF541	84215	genome.wustl.edu	37	19	48024498	48024498	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:48024498C>T	ENST00000391901.3	-	15	4023	c.4024G>A	c.(4024-4026)Ggc>Agc	p.G1342S	ZNF541_ENST00000448976.1_Missense_Mutation_p.G1084S|ZNF541_ENST00000314121.4_Missense_Mutation_p.G1361S			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	1342					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						TGCAGGGGGCCGATGTCAGCT	0.652																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.4024G>A	19.37:g.48024498C>T	ENSP00000375770:p.Gly1342Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDK8	Missense_Mutation	SNP	pfam_ELM2_dom,pfam_Znf_C2H2,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.G1361S	ENST00000391901.3	37	c.4081		19	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930600	0.34096	.	.	ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976	T;T;T	0.15952	2.47;2.41;2.38	5.96	2.74	0.32292	.	0.121922	0.38005	N	0.001844	T	0.09291	0.0229	N	0.19112	0.55	0.09310	N	1	P;P;P	0.40515	0.597;0.719;0.499	B;B;B	0.36922	0.068;0.236;0.102	T	0.21861	-1.0233	9	.	.	.	-26.4952	7.9167	0.29822	0.0:0.6849:0.0:0.3151	.	1361;1084;1342	Q9H0D2;Q9H0D2-2;Q9H0D2-3	ZN541_HUMAN;.;.	S	1342;1361;1084	ENSP00000375770:G1342S;ENSP00000313258:G1361S;ENSP00000410847:G1084S	.	G	-	1	0	ZNF541	52716310	0.524000	0.26282	0.020000	0.16555	0.555000	0.35460	1.569000	0.36428	0.439000	0.26476	0.655000	0.94253	GGC	ZNF541	-	NULL	ENSG00000118156		0.652	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	42	0.00	0	C	NM_032255		48024498	48024498	-1	no_errors	ENST00000314121	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	0.063	T
ZNF541	84215	genome.wustl.edu	37	19	48024498	48024498	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:48024498C>T	ENST00000391901.3	-	15	4023	c.4024G>A	c.(4024-4026)Ggc>Agc	p.G1342S	ZNF541_ENST00000448976.1_Missense_Mutation_p.G1084S|ZNF541_ENST00000314121.4_Missense_Mutation_p.G1361S			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	1342					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						TGCAGGGGGCCGATGTCAGCT	0.652																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.4024G>A	19.37:g.48024498C>T	ENSP00000375770:p.Gly1342Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDK8	Missense_Mutation	SNP	pfam_ELM2_dom,pfam_Znf_C2H2,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.G1361S	ENST00000391901.3	37	c.4081		19	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930600	0.34096	.	.	ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976	T;T;T	0.15952	2.47;2.41;2.38	5.96	2.74	0.32292	.	0.121922	0.38005	N	0.001844	T	0.09291	0.0229	N	0.19112	0.55	0.09310	N	1	P;P;P	0.40515	0.597;0.719;0.499	B;B;B	0.36922	0.068;0.236;0.102	T	0.21861	-1.0233	9	.	.	.	-26.4952	7.9167	0.29822	0.0:0.6849:0.0:0.3151	.	1361;1084;1342	Q9H0D2;Q9H0D2-2;Q9H0D2-3	ZN541_HUMAN;.;.	S	1342;1361;1084	ENSP00000375770:G1342S;ENSP00000313258:G1361S;ENSP00000410847:G1084S	.	G	-	1	0	ZNF541	52716310	0.524000	0.26282	0.020000	0.16555	0.555000	0.35460	1.569000	0.36428	0.439000	0.26476	0.655000	0.94253	GGC	ZNF541	-	NULL	ENSG00000118156		0.652	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	67	0.00	0	C	NM_032255		48024498	48024498	-1	no_errors	ENST00000314121	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	0.063	T
ZNF541	84215	genome.wustl.edu	37	19	48043463	48043463	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:48043463C>A	ENST00000391901.3	-	5	2591	c.2592G>T	c.(2590-2592)tgG>tgT	p.W864C	ZNF541_ENST00000448976.1_Missense_Mutation_p.W864C|ZNF541_ENST00000487275.1_5'UTR|ZNF541_ENST00000314121.4_Missense_Mutation_p.W864C			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	864					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						GAGGTGACGGCCACTGGTCGC	0.562																																						dbGAP											0													81.0	80.0	80.0					19																	48043463		692	1591	2283	-	-	-	SO:0001583	missense	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.2592G>T	19.37:g.48043463C>A	ENSP00000375770:p.Trp864Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDK8	Missense_Mutation	SNP	pfam_ELM2_dom,pfam_Znf_C2H2,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.W864C	ENST00000391901.3	37	c.2592		19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.22|19.22	3.786553|3.786553	0.70337|0.70337	.|.	.|.	ENSG00000118156|ENSG00000118156	ENST00000263351|ENST00000391901;ENST00000314121;ENST00000448976	.|T;T;T	.|0.33438	.|1.41;1.41;1.41	5.4|5.4	5.4|5.4	0.78164|0.78164	.|Zinc finger, C2H2 (1);	.|0.000000	.|0.52532	.|D	.|0.000067	T|T	0.45935|0.45935	0.1367|0.1367	L|L	0.34521|0.34521	1.04|1.04	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.997;0.999;0.999	T|T	0.37572|0.37572	-0.9700|-0.9700	5|10	.|0.72032	.|D	.|0.01	-28.8935|-28.8935	16.1922|16.1922	0.82000|0.82000	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|864;864;864	.|Q9H0D2;Q9H0D2-2;Q9H0D2-3	.|ZN541_HUMAN;.;.	V|C	455|864	.|ENSP00000375770:W864C;ENSP00000313258:W864C;ENSP00000410847:W864C	.|ENSP00000313258:W864C	G|W	-|-	2|3	0|0	ZNF541|ZNF541	52735275|52735275	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	4.411000|4.411000	0.59781|0.59781	2.813000|2.813000	0.96785|0.96785	0.561000|0.561000	0.74099|0.74099	GGC|TGG	ZNF541	-	pfscan_Znf_C2H2	ENSG00000118156		0.562	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	65	0.00	0	C	NM_032255		48043463	48043463	-1	no_errors	ENST00000314121	ensembl	human	known	69_37n	missense	66	29.79	28	SNP	1.000	A
ZNF541	84215	genome.wustl.edu	37	19	48043463	48043463	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:48043463C>A	ENST00000391901.3	-	5	2591	c.2592G>T	c.(2590-2592)tgG>tgT	p.W864C	ZNF541_ENST00000448976.1_Missense_Mutation_p.W864C|ZNF541_ENST00000487275.1_5'UTR|ZNF541_ENST00000314121.4_Missense_Mutation_p.W864C			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	864					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						GAGGTGACGGCCACTGGTCGC	0.562																																						dbGAP											0													81.0	80.0	80.0					19																	48043463		692	1591	2283	-	-	-	SO:0001583	missense	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.2592G>T	19.37:g.48043463C>A	ENSP00000375770:p.Trp864Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDK8	Missense_Mutation	SNP	pfam_ELM2_dom,pfam_Znf_C2H2,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.W864C	ENST00000391901.3	37	c.2592		19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.22|19.22	3.786553|3.786553	0.70337|0.70337	.|.	.|.	ENSG00000118156|ENSG00000118156	ENST00000263351|ENST00000391901;ENST00000314121;ENST00000448976	.|T;T;T	.|0.33438	.|1.41;1.41;1.41	5.4|5.4	5.4|5.4	0.78164|0.78164	.|Zinc finger, C2H2 (1);	.|0.000000	.|0.52532	.|D	.|0.000067	T|T	0.45935|0.45935	0.1367|0.1367	L|L	0.34521|0.34521	1.04|1.04	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.997;0.999;0.999	T|T	0.37572|0.37572	-0.9700|-0.9700	5|10	.|0.72032	.|D	.|0.01	-28.8935|-28.8935	16.1922|16.1922	0.82000|0.82000	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|864;864;864	.|Q9H0D2;Q9H0D2-2;Q9H0D2-3	.|ZN541_HUMAN;.;.	V|C	455|864	.|ENSP00000375770:W864C;ENSP00000313258:W864C;ENSP00000410847:W864C	.|ENSP00000313258:W864C	G|W	-|-	2|3	0|0	ZNF541|ZNF541	52735275|52735275	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	4.411000|4.411000	0.59781|0.59781	2.813000|2.813000	0.96785|0.96785	0.561000|0.561000	0.74099|0.74099	GGC|TGG	ZNF541	-	pfscan_Znf_C2H2	ENSG00000118156		0.562	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	102	0.00	0	C	NM_032255		48043463	48043463	-1	no_errors	ENST00000314121	ensembl	human	known	69_37n	missense	66	29.79	28	SNP	1.000	A
ZNF99	7652	genome.wustl.edu	37	19	22952765	22952765	+	Intron	SNP	T	T	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:22952765T>A	ENST00000596209.1	-	2	94				ZNF99_ENST00000397104.3_Missense_Mutation_p.K7I	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TCTTGTACATTTTTCAGACCA	0.274																																						dbGAP											0													67.0	68.0	68.0					19																	22952765		1817	4062	5879	-	-	-	SO:0001627	intron_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.4-639A>T	19.37:g.22952765T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K7I	ENST00000596209.1	37	c.20	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	t	6.475	0.455878	0.12283	.	.	ENSG00000213973	ENST00000397104	T	0.06449	3.3	0.461	0.461	0.16689	.	.	.	.	.	T	0.05273	0.0140	N	0.14661	0.345	0.09310	N	1	P	0.50156	0.932	P	0.47573	0.55	T	0.41215	-0.9521	8	0.52906	T	0.07	.	.	.	.	.	7	A8MXY4	ZNF99_HUMAN	I	7	ENSP00000380293:K7I	ENSP00000380293:K7I	K	-	2	0	ZNF99	22744605	0.001000	0.12720	0.017000	0.16124	0.013000	0.08279	-0.547000	0.06055	0.426000	0.26116	0.248000	0.18094	AAA	ZNF99	-	NULL	ENSG00000213973		0.274	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	27	0.00	0	T	XM_065124		22952765	22952765	-1	no_errors	ENST00000397104	ensembl	human	known	69_37n	missense	38	37.70	23	SNP	0.020	A
ZNF99	7652	genome.wustl.edu	37	19	22952765	22952765	+	Intron	SNP	T	T	A			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:22952765T>A	ENST00000596209.1	-	2	94				ZNF99_ENST00000397104.3_Missense_Mutation_p.K7I	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TCTTGTACATTTTTCAGACCA	0.274																																						dbGAP											0													67.0	68.0	68.0					19																	22952765		1817	4062	5879	-	-	-	SO:0001627	intron_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.4-639A>T	19.37:g.22952765T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K7I	ENST00000596209.1	37	c.20	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	t	6.475	0.455878	0.12283	.	.	ENSG00000213973	ENST00000397104	T	0.06449	3.3	0.461	0.461	0.16689	.	.	.	.	.	T	0.05273	0.0140	N	0.14661	0.345	0.09310	N	1	P	0.50156	0.932	P	0.47573	0.55	T	0.41215	-0.9521	8	0.52906	T	0.07	.	.	.	.	.	7	A8MXY4	ZNF99_HUMAN	I	7	ENSP00000380293:K7I	ENSP00000380293:K7I	K	-	2	0	ZNF99	22744605	0.001000	0.12720	0.017000	0.16124	0.013000	0.08279	-0.547000	0.06055	0.426000	0.26116	0.248000	0.18094	AAA	ZNF99	-	NULL	ENSG00000213973		0.274	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	74	0.00	0	T	XM_065124		22952765	22952765	-1	no_errors	ENST00000397104	ensembl	human	known	69_37n	missense	38	37.70	23	SNP	0.020	A
ZNF582	147948	genome.wustl.edu	37	19	56896446	56896446	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	15e93d8f-1db4-4cf1-99dd-81d3fd90a898	g.chr19:56896446C>G	ENST00000301310.4	-	5	498	c.340G>C	c.(340-342)Gag>Cag	p.E114Q	ZNF582_ENST00000586929.1_Missense_Mutation_p.E114Q|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		CTTGAACACTCAAGACCATAA	0.403																																					Ovarian(183;1887 2032 4349 30507 51343)	dbGAP											0													168.0	161.0	163.0					19																	56896446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.340G>C	19.37:g.56896446C>G	ENSP00000301310:p.Glu114Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E114Q	ENST00000301310.4	37	c.340	CCDS33121.1	19	.	.	.	.	.	.	.	.	.	.	C	10.98	1.503602	0.26949	.	.	ENSG00000018869	ENST00000301310	T	0.06068	3.35	5.31	3.19	0.36642	.	0.708276	0.11623	N	0.545620	T	0.05181	0.0138	N	0.25426	0.745	0.09310	N	1	B;B	0.33694	0.421;0.421	B;B	0.29942	0.109;0.109	T	0.39860	-0.9593	10	0.38643	T	0.18	.	9.5569	0.39343	0.0:0.8331:0.0:0.1669	.	114;145	Q96NG8;B4DQZ9	ZN582_HUMAN;.	Q	114	ENSP00000301310:E114Q	ENSP00000301310:E114Q	E	-	1	0	ZNF582	61588258	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	0.089000	0.15002	0.735000	0.32537	0.591000	0.81541	GAG	ZNF582	-	NULL	ENSG00000018869		0.403	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	52	0.00	0	C	NM_144690		56896446	56896446	-1	no_errors	ENST00000301310	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	0.003	G
ZNF582	147948	genome.wustl.edu	37	19	56896446	56896446	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SE-01A-11D-A25Q-09	TCGA-A7-A4SE-11A-61D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e477299-592b-4018-bd17-0c2a646c7672	5a3f2e8d-3fb3-472d-8ac2-e4983a438de9	g.chr19:56896446C>G	ENST00000301310.4	-	5	498	c.340G>C	c.(340-342)Gag>Cag	p.E114Q	ZNF582_ENST00000586929.1_Missense_Mutation_p.E114Q|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		CTTGAACACTCAAGACCATAA	0.403																																					Ovarian(183;1887 2032 4349 30507 51343)	dbGAP											0													168.0	161.0	163.0					19																	56896446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.340G>C	19.37:g.56896446C>G	ENSP00000301310:p.Glu114Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E114Q	ENST00000301310.4	37	c.340	CCDS33121.1	19	.	.	.	.	.	.	.	.	.	.	C	10.98	1.503602	0.26949	.	.	ENSG00000018869	ENST00000301310	T	0.06068	3.35	5.31	3.19	0.36642	.	0.708276	0.11623	N	0.545620	T	0.05181	0.0138	N	0.25426	0.745	0.09310	N	1	B;B	0.33694	0.421;0.421	B;B	0.29942	0.109;0.109	T	0.39860	-0.9593	10	0.38643	T	0.18	.	9.5569	0.39343	0.0:0.8331:0.0:0.1669	.	114;145	Q96NG8;B4DQZ9	ZN582_HUMAN;.	Q	114	ENSP00000301310:E114Q	ENSP00000301310:E114Q	E	-	1	0	ZNF582	61588258	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	0.089000	0.15002	0.735000	0.32537	0.591000	0.81541	GAG	ZNF582	-	NULL	ENSG00000018869		0.403	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	99	0.00	0	C	NM_144690		56896446	56896446	-1	no_errors	ENST00000301310	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	0.003	G
