#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB11	8647	genome.wustl.edu	37	2	169851868	169851868	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:169851868C>T	ENST00000263817.6	-	7	726	c.602G>A	c.(601-603)aGa>aAa	p.R201K		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	201	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CTCAGAGAATCTTGTATTCAG	0.308																																						dbGAP											0													88.0	84.0	85.0					2																	169851868		1826	4076	5902	-	-	-	SO:0001583	missense	0			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.602G>A	2.37:g.169851868C>T	ENSP00000263817:p.Arg201Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.R201K	ENST00000263817.6	37	c.602	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.290350	0.95546	.	.	ENSG00000073734	ENST00000263817	T	0.80214	-1.35	5.08	5.08	0.68730	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.218934	0.47852	D	0.000215	D	0.83866	0.5347	L	0.55990	1.75	0.80722	D	1	P	0.46512	0.879	P	0.50490	0.642	D	0.86061	0.1532	10	0.87932	D	0	-4.1082	18.5011	0.90880	0.0:1.0:0.0:0.0	.	201	O95342	ABCBB_HUMAN	K	201	ENSP00000263817:R201K	ENSP00000263817:R201K	R	-	2	0	ABCB11	169560114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.931000	0.63469	2.344000	0.79699	0.655000	0.94253	AGA	ABCB11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000073734		0.308	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	44	0.00	0	C	NM_003742		169851868	169851868	-1	no_errors	ENST00000263817	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	1.000	T
ACBD5	91452	genome.wustl.edu	37	10	27506953	27506953	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr10:27506953T>A	ENST00000375888.1	-	7	876	c.812A>T	c.(811-813)gAa>gTa	p.E271V	ACBD5_ENST00000375897.3_Intron|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000396271.3_Missense_Mutation_p.E262V|ACBD5_ENST00000375901.1_Missense_Mutation_p.E153V|ACBD5_ENST00000375905.4_Missense_Mutation_p.E227V			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	271					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CCCCAAGTTTTCATCAATGGG	0.408																																						dbGAP											0													149.0	137.0	141.0					10																	27506953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.812A>T	10.37:g.27506953T>A	ENSP00000365049:p.Glu271Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.E271V	ENST00000375888.1	37	c.812		10	.	.	.	.	.	.	.	.	.	.	T	7.574	0.667385	0.14710	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375888;ENST00000426079;ENST00000412279	D;T;T;T;T;T	0.84370	-1.84;2.17;1.43;2.43;2.16;1.86	5.33	2.85	0.33270	.	1.375830	0.04226	N	0.334411	D	0.82825	0.5121	L	0.47716	1.5	0.09310	N	1	B;B;B	0.28820	0.163;0.06;0.224	B;B;B	0.26969	0.075;0.021;0.021	T	0.68379	-0.5424	10	0.46703	T	0.11	-1.1027	12.2187	0.54420	0.0:0.0:0.426:0.574	.	262;260;271	Q5T8D3-3;B7Z2R7;Q5T8D3	.;.;ACBD5_HUMAN	V	268;262;227;153;271;280;238	ENSP00000379568:E262V;ENSP00000365070:E227V;ENSP00000365066:E153V;ENSP00000365049:E271V;ENSP00000401591:E280V;ENSP00000393398:E238V	ENSP00000365049:E271V	E	-	2	0	ACBD5	27546959	0.053000	0.20554	0.012000	0.15200	0.245000	0.25701	1.992000	0.40737	0.848000	0.35191	0.477000	0.44152	GAA	ACBD5	-	pirsf_M-assoc_diazepam-bd-inh	ENSG00000107897		0.408	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	HGNC	protein_coding	OTTHUMT00000047314.1	61	0.00	0	T	NM_145698		27506953	27506953	-1	no_errors	ENST00000375888	ensembl	human	known	69_37n	missense	114	22.97	34	SNP	0.013	A
ACOT11	26027	genome.wustl.edu	37	1	55074840	55074840	+	Intron	SNP	T	T	A	rs1617287	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:55074840T>A	ENST00000371316.3	+	15	1711				ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11						fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						CCCCAAGGACTCACATACAGT	0.612													T|||	1386	0.276757	0.0946	0.353	5008	,	,		16424	0.1825		0.5477	False		,,,				2504	0.2873				Ovarian(148;1440 1861 22015 32453 51933)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.1629+1099T>A	1.37:g.55074840T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	RNA	SNP	-	NULL	ENST00000371316.3	37	NULL	CCDS592.1	1																																																																																			ACOT11	-	-	ENSG00000162390		0.612	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	23	0.00	0	T	NM_015547		55074840	55074840	+1	no_errors	ENST00000481208	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.000	A
ACTA1	58	genome.wustl.edu	37	1	229567561	229567561	+	Silent	SNP	G	G	A	rs533868659		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:229567561G>A	ENST00000366684.3	-	6	999	c.897C>T	c.(895-897)aaC>aaT	p.N299N	ACTA1_ENST00000366683.2_Silent_p.N211N	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	299					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				CCGACATGACGTTGTTGGCAT	0.582																																						dbGAP											0													159.0	143.0	149.0					1																	229567561		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.897C>T	1.37:g.229567561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P02568|P99020|Q5T8M9	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.N299	ENST00000366684.3	37	c.897	CCDS1578.1	1																																																																																			ACTA1	-	pfam_Actin-like,smart_Actin-like	ENSG00000143632		0.582	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA1	HGNC	protein_coding	OTTHUMT00000092781.1	52	0.00	0	G	NM_001100		229567561	229567561	-1	no_errors	ENST00000366684	ensembl	human	known	69_37n	silent	108	20.00	27	SNP	0.967	A
AP2A2	161	genome.wustl.edu	37	11	972125	972125	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:972125G>A	ENST00000448903.2	+	4	484	c.343G>A	c.(343-345)Gcc>Acc	p.A115T	AP2A2_ENST00000534328.1_Missense_Mutation_p.A115T|AP2A2_ENST00000332231.5_Missense_Mutation_p.A115T	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	115					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		GATCAACAACGCCATCAAGAA	0.577																																						dbGAP											0													64.0	63.0	63.0					11																	972125		2076	4217	6293	-	-	-	SO:0001583	missense	0			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.343G>A	11.37:g.972125G>A	ENSP00000413234:p.Ala115Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75403|Q53ET1|Q96SI8	Splice_Site	SNP	-	e4+1	ENST00000448903.2	37	c.342+1	CCDS44512.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.35|14.35	2.507766|2.507766	0.44558|0.44558	.|.	.|.	ENSG00000183020|ENSG00000183020	ENST00000529125|ENST00000534328;ENST00000417081;ENST00000448903;ENST00000332231;ENST00000448757;ENST00000452310;ENST00000531548;ENST00000534485;ENST00000527024;ENST00000526753;ENST00000530801;ENST00000524559	.|T;T;T;T;T;T;T;T;T	.|0.23754	.|1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89;1.89	3.24|3.24	3.24|3.24	0.37175|0.37175	.|Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	.|0.138595	.|0.48286	.|D	.|0.000186	.|T	.|0.31009	.|0.0783	N|N	0.13327|0.13327	0.33|0.33	0.58432|0.58432	D|D	0.999995|0.999995	.|D;D	.|0.76494	.|0.999;0.994	.|D;P	.|0.67231	.|0.95;0.755	.|T	.|0.19257	.|-1.0311	.|10	.|0.36615	.|T	.|0.2	.|-10.0262	15.78|15.78	0.78252|0.78252	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|115;115	.|O94973-2;O94973	.|.;AP2A2_HUMAN	.|T	-1|115;115;115;115;115;115;121;105;109;39;39;39	.|ENSP00000436059:A115T;ENSP00000413234:A115T;ENSP00000327694:A115T;ENSP00000433498:A121T;ENSP00000435756:A105T;ENSP00000434563:A109T;ENSP00000435863:A39T;ENSP00000434553:A39T;ENSP00000434432:A39T	.|ENSP00000327694:A115T	.|A	+|+	.|1	.|0	AP2A2|AP2A2	962125|962125	1.000000|1.000000	0.71417|0.71417	0.960000|0.960000	0.40013|0.40013	0.529000|0.529000	0.34654|0.34654	9.596000|9.596000	0.98267|0.98267	2.131000|2.131000	0.65755|0.65755	0.655000|0.655000	0.94253|0.94253	.|GCC	AP2A2	-	-	ENSG00000183020		0.577	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	HGNC	protein_coding	OTTHUMT00000385431.2	155	0.00	0	G	NM_012305		972125	972125	+1	no_errors	ENST00000529125	ensembl	human	novel	69_37n	splice_site	172	21.97	49	SNP	1.000	A
ARSD	414	genome.wustl.edu	37	X	2825134	2825134	+	3'UTR	SNP	A	A	G	rs5939146	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chrX:2825134A>G	ENST00000381154.1	-	0	2035				ARSD-AS1_ENST00000414053.1_RNA	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ttccagcctgagggacagagc	0.522													N|||	851	0.22543	0.2436	0.0476	3775	,	,		13803	0.3175		0.0348	False		,,,				2504	0.1442					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.*178T>C	X.37:g.2825134A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UHJ8	RNA	SNP	-	NULL	ENST00000381154.1	37	NULL	CCDS35196.1	X																																																																																			ARSD	-	-	ENSG00000006756		0.522	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSD	HGNC	protein_coding	OTTHUMT00000055636.1	12	0.00	0	A			2825134	2825134	-1	no_errors	ENST00000495294	ensembl	human	known	69_37n	rna	10	50.00	10	SNP	0.007	G
BAI1	575	genome.wustl.edu	37	8	143566039	143566039	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr8:143566039T>A	ENST00000517894.1	+	13	3116	c.2222T>A	c.(2221-2223)cTg>cAg	p.L741Q	BAI1_ENST00000323289.5_Missense_Mutation_p.L741Q			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	741					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GCCAAGGAGCTGTTCCGGCTG	0.657																																						dbGAP											0													29.0	37.0	34.0					8																	143566039		2050	4195	6245	-	-	-	SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2222T>A	8.37:g.143566039T>A	ENSP00000430945:p.Leu741Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.L741Q	ENST00000517894.1	37	c.2222		8	.	.	.	.	.	.	.	.	.	.	T	22.0	4.226586	0.79576	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.39592	1.07;1.07	4.66	4.66	0.58398	.	0.097704	0.40222	U	0.001154	T	0.61924	0.2386	M	0.71036	2.16	0.53688	D	0.999975	D	0.76494	0.999	D	0.72625	0.978	T	0.66582	-0.5887	10	0.87932	D	0	.	12.9132	0.58190	0.0:0.0:0.0:1.0	.	741	E9PBK0	.	Q	741	ENSP00000430945:L741Q;ENSP00000313046:L741Q	ENSP00000313046:L741Q	L	+	2	0	BAI1	143563041	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.530000	0.81962	1.723000	0.51488	0.260000	0.18958	CTG	BAI1	-	pfam_DUF3497	ENSG00000181790		0.657	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	81	0.00	0	T	NM_001702		143566039	143566039	+1	no_errors	ENST00000323289	ensembl	human	known	69_37n	missense	100	39.39	65	SNP	1.000	A
BHMT2	23743	genome.wustl.edu	37	5	78384371	78384371	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr5:78384371C>G	ENST00000255192.3	+	8	1132	c.1066C>G	c.(1066-1068)Cct>Gct	p.P356A	BHMT2_ENST00000521567.1_Missense_Mutation_p.P292A|DMGDH_ENST00000520388.1_Intron	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	356					L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	ACCTTTCTGTCCTTCGCTGTC	0.428																																						dbGAP											0													60.0	61.0	61.0					5																	78384371		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.1066C>G	5.37:g.78384371C>G	ENSP00000255192:p.Pro356Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z516|Q9NXX7	Missense_Mutation	SNP	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT,pfscan_S_MeTrfase	p.P356A	ENST00000255192.3	37	c.1066	CCDS4045.1	5	.	.	.	.	.	.	.	.	.	.	C	16.14	3.040009	0.55003	.	.	ENSG00000132840	ENST00000255192;ENST00000521567	T;T	0.28454	1.61;1.61	5.15	5.15	0.70609	Homocysteine S-methyltransferase (2);	0.050104	0.85682	D	0.000000	T	0.35624	0.0938	M	0.75447	2.3	0.58432	D	0.999999	B;B	0.21452	0.014;0.056	B;B	0.18561	0.015;0.022	T	0.31364	-0.9946	10	0.11485	T	0.65	-11.6093	18.9898	0.92786	0.0:1.0:0.0:0.0	.	292;356	B7Z516;Q9H2M3	.;BHMT2_HUMAN	A	356;292	ENSP00000255192:P356A;ENSP00000430278:P292A	ENSP00000255192:P356A	P	+	1	0	BHMT2	78420127	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.805000	0.55575	2.571000	0.86741	0.650000	0.86243	CCT	BHMT2	-	superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT	ENSG00000132840		0.428	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHMT2	HGNC	protein_coding	OTTHUMT00000226962.2	36	0.00	0	C	NM_017614		78384371	78384371	+1	no_errors	ENST00000255192	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	1.000	G
C10orf85	404216	genome.wustl.edu	37	10	122357994	122357994	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr10:122357994G>T	ENST00000369071.2	+	1	274	c.172G>T	c.(172-174)Gca>Tca	p.A58S						chromosome 10 open reading frame 85																		CAGCTCAGGAGCAGGCCAGGA	0.582																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK094721		10q26.12	2013-09-20			ENSG00000177234	ENSG00000177234			31365	protein-coding gene	gene with protein product							Standard	NR_103717		Approved	FLJ37402, Em:AC023282.2		Q8N1V8	OTTHUMG00000019167	ENST00000369071.2:c.172G>T	10.37:g.122357994G>T	ENSP00000358067:p.Ala58Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A58S	ENST00000369071.2	37	c.172		10	.	.	.	.	.	.	.	.	.	.	G	8.177	0.793031	0.16327	.	.	ENSG00000177234	ENST00000369071	T	0.06768	3.26	0.878	0.878	0.19150	.	.	.	.	.	T	0.09774	0.0240	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30031	-0.9992	6	0.87932	D	0	.	5.0891	0.14698	0.0:0.0:1.0:0.0	.	.	.	.	S	58	ENSP00000358067:A58S	ENSP00000358067:A58S	A	+	1	0	C10orf85	122347984	0.017000	0.18338	0.015000	0.15790	0.005000	0.04900	1.172000	0.31908	0.780000	0.33566	0.467000	0.42956	GCA	C10orf85	-	NULL	ENSG00000177234		0.582	C10orf85-001	KNOWN	basic|appris_principal	protein_coding	C10orf85	HGNC	protein_coding	OTTHUMT00000050700.1	36	0.00	0	G			122357994	122357994	+1	no_errors	ENST00000369071	ensembl	human	known	69_37n	missense	12	58.62	17	SNP	0.017	T
COLCA1	399948	genome.wustl.edu	37	11	111169110	111169110	+	5'UTR	SNP	A	A	T	rs10244|rs11541731	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:111169110A>T	ENST00000532918.1	-	0	499				COLCA2_ENST00000398035.2_5'Flank|COLCA1_ENST00000355430.4_5'UTR|COLCA2_ENST00000526216.1_5'Flank|COLCA1_ENST00000540738.1_5'Flank|COLCA1_ENST00000526150.1_5'UTR			Q6ZS62	COLC1_HUMAN	colorectal cancer associated 1							integral component of membrane (GO:0016021)|membrane (GO:0016020)											AGGGGGAAAAAACTCAAACCT	0.373													A|||	256	0.0511182	0.0136	0.121	5008	,	,		18561	0.006		0.1203	False		,,,				2504	0.0276					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK127703		11q23.1	2013-08-22	2013-08-22	2013-08-22	ENSG00000196167	ENSG00000196167			33789	other	unknown	"""cancer susceptibility candidate 12"""	615693	"""chromosome 11 open reading frame 92"""	C11orf92			Standard	NR_034154		Approved	FLJ45803, CASC12	uc001pld.3	Q6ZS62	OTTHUMG00000166658	ENST00000532918.1:c.-1907T>A	11.37:g.111169110A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000532918.1	37	NULL		11																																																																																			C11orf92	-	-	ENSG00000196167		0.373	COLCA1-001	KNOWN	basic|appris_principal	protein_coding	C11orf92	HGNC	protein_coding	OTTHUMT00000390999.1	38	0.00	0	A			111169110	111169110	-1	no_errors	ENST00000526150	ensembl	human	putative	69_37n	rna	36	10.00	4	SNP	1.000	T
CCT3	7203	genome.wustl.edu	37	1	156280797	156280797	+	Missense_Mutation	SNP	G	G	T	rs540072195		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:156280797G>T	ENST00000295688.3	-	12	1625	c.1345C>A	c.(1345-1347)Cgt>Agt	p.R449S	CCT3_ENST00000368259.2_Missense_Mutation_p.R411S|CCT3_ENST00000368261.3_Missense_Mutation_p.R404S|CCT3_ENST00000472765.2_Missense_Mutation_p.R404S	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	449					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					ATCAGGGTACGAGGAATGACC	0.552																																						dbGAP											0													73.0	59.0	64.0					1																	156280797		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.1345C>A	1.37:g.156280797G>T	ENSP00000295688:p.Arg449Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.R449S	ENST00000295688.3	37	c.1345	CCDS1140.2	1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748872	0.69533	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.75	5.75	0.90469	.	0.052808	0.64402	D	0.000001	D	0.87884	0.6290	M	0.88450	2.955	0.58432	D	0.999996	P;P;P	0.50369	0.777;0.934;0.456	B;P;P	0.60886	0.404;0.88;0.595	D	0.89143	0.3518	10	0.62326	D	0.03	-5.2585	12.4287	0.55561	0.0:0.0:0.8324:0.1675	.	411;448;449	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	S	449;411;404;404	ENSP00000295688:R449S;ENSP00000357242:R411S;ENSP00000357244:R404S;ENSP00000431543:R404S	ENSP00000295688:R449S	R	-	1	0	CCT3	154547421	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	2.484000	0.45242	2.722000	0.93159	0.645000	0.84053	CGT	CCT3	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_gamma	ENSG00000163468		0.552	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	42	0.00	0	G	NM_005998		156280797	156280797	-1	no_errors	ENST00000295688	ensembl	human	known	69_37n	missense	55	19.12	13	SNP	0.999	T
CD274	29126	genome.wustl.edu	37	9	5465705	5465705	+	Intron	SNP	G	G	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr9:5465705G>T	ENST00000381577.3	+	5	876				CD274_ENST00000498261.1_Intron|CD274_ENST00000381573.4_Intron	NM_014143.3	NP_054862.1	Q9NZQ7	PD1L1_HUMAN	CD274 molecule						cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		TCTGCAAGGTGGTGCAAAGGC	0.498			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																	dbGAP		Dom	yes		9	9p24	29126	CD274 molecule		L	0																																										-	-	-	SO:0001627	intron_variant	0			AF177937	CCDS6464.1, CCDS59118.1	9p24.1	2014-01-30	2006-03-28	2005-02-25	ENSG00000120217	ENSG00000120217		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17635	protein-coding gene	gene with protein product	"""B7 homolog 1"""	605402	"""programmed cell death 1 ligand 1"", ""CD274 antigen"""	PDCD1LG1		11015443, 10581077	Standard	NM_014143		Approved	B7-H, B7H1, PD-L1, PDL1, B7-H1	uc003zje.3	Q9NZQ7	OTTHUMG00000019503	ENST00000381577.3:c.790+99G>T	9.37:g.5465705G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBA2|B4DU27|Q14CJ2|Q2V8D5|Q66RK1|Q6WEX4|Q9NUZ5	RNA	SNP	-	NULL	ENST00000381577.3	37	NULL	CCDS6464.1	9																																																																																			CD274	-	-	ENSG00000120217		0.498	CD274-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD274	HGNC	protein_coding	OTTHUMT00000051631.2	14	0.00	0	G	NM_014143		5465705	5465705	+1	no_errors	ENST00000492923	ensembl	human	known	69_37n	rna	16	23.81	5	SNP	0.000	T
CDK17	5128	genome.wustl.edu	37	12	96679861	96679861	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr12:96679861G>A	ENST00000261211.3	-	13	1885	c.1282C>T	c.(1282-1284)Cca>Tca	p.P428S	CDK17_ENST00000542666.1_Missense_Mutation_p.P375S|CDK17_ENST00000543119.2_Missense_Mutation_p.P428S	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	428	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						TTATATTTTGGAAAGTTGTAG	0.318																																						dbGAP											0													162.0	183.0	176.0					12																	96679861		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.1282C>T	12.37:g.96679861G>A	ENSP00000261211:p.Pro428Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P428S	ENST00000261211.3	37	c.1282	CCDS9061.1	12	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033252	0.75504	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666	T;T;T	0.41400	1.0;1.0;1.0	5.72	5.72	0.89469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68016	0.2955	M	0.84948	2.725	0.80722	D	1	D;D	0.56968	0.978;0.978	P;P	0.61132	0.884;0.822	T	0.72218	-0.4357	10	0.72032	D	0.01	-13.0513	19.8937	0.96942	0.0:0.0:1.0:0.0	.	428;428	A8K1U6;Q00537	.;CDK17_HUMAN	S	428;428;375	ENSP00000261211:P428S;ENSP00000444459:P428S;ENSP00000442926:P375S	ENSP00000261211:P428S	P	-	1	0	CDK17	95203992	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.760000	0.85248	2.716000	0.92895	0.650000	0.86243	CCA	CDK17	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000059758		0.318	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK17	HGNC	protein_coding	OTTHUMT00000408751.1	34	0.00	0	G	NM_002595		96679861	96679861	-1	no_errors	ENST00000261211	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	A
CEACAM4	1089	genome.wustl.edu	37	19	42132011	42132011	+	Missense_Mutation	SNP	C	C	T	rs200115429		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr19:42132011C>T	ENST00000221954.2	-	2	498	c.388G>A	c.(388-390)Gac>Aac	p.D130N	CEACAM4_ENST00000600925.1_Missense_Mutation_p.D130N	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	130	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						TGGTCAGAGTCGTAACTGGCA	0.532																																						dbGAP											0													200.0	167.0	178.0					19																	42132011		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.388G>A	19.37:g.42132011C>T	ENSP00000221954:p.Asp130Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q03715|Q7LDZ7	Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.D130N	ENST00000221954.2	37	c.388	CCDS33033.1	19	.	.	.	.	.	.	.	.	.	.	C	5.077	0.199931	0.09652	.	.	ENSG00000105352	ENST00000221954	T	0.66280	-0.2	1.82	-3.64	0.04515	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37156	0.0993	N	0.02751	-0.505	0.09310	N	1	D;D	0.65815	0.995;0.979	P;P	0.51297	0.665;0.602	T	0.30621	-0.9972	9	0.22706	T	0.39	.	4.1572	0.10266	0.0:0.2247:0.3481:0.4271	.	130;130	E7EMX3;O75871	.;CEAM4_HUMAN	N	130	ENSP00000221954:D130N	ENSP00000221954:D130N	D	-	1	0	CEACAM4	46823851	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.129000	0.03244	-1.737000	0.01350	0.313000	0.20887	GAC	CEACAM4	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000105352		0.532	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM4	HGNC	protein_coding	OTTHUMT00000321148.1	74	0.00	0	C	NM_001817		42132011	42132011	-1	no_errors	ENST00000221954	ensembl	human	known	69_37n	missense	56	49.55	55	SNP	0.000	T
CELF1	10658	genome.wustl.edu	37	11	47494725	47494725	+	Silent	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:47494725G>A	ENST00000358597.3	-	11	1247	c.1248C>T	c.(1246-1248)gaC>gaT	p.D416D	CELF1_ENST00000310513.5_Silent_p.D412D|CELF1_ENST00000361904.3_Silent_p.D413D|CELF1_ENST00000395292.2_Silent_p.D413D|CELF1_ENST00000395290.2_Silent_p.D415D|CELF1_ENST00000532048.1_Silent_p.D442D|CELF1_ENST00000531165.1_Silent_p.D444D|CELF1_ENST00000539455.1_5'UTR			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	416	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						TCTGCAGCAGGTCCTGATCAC	0.473																																					Pancreas(163;1949 1966 9906 43218 43785)	dbGAP											0													113.0	98.0	103.0					11																	47494725		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.1248C>T	11.37:g.47494725G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D442	ENST00000358597.3	37	c.1326	CCDS31482.1	11																																																																																			CELF1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000149187		0.473	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF1	HGNC	protein_coding	OTTHUMT00000398352.1	50	0.00	0	G	NM_006560		47494725	47494725	-1	no_errors	ENST00000532048	ensembl	human	known	69_37n	silent	59	20.27	15	SNP	1.000	A
CHST2	9435	genome.wustl.edu	37	3	142840236	142840236	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:142840236T>C	ENST00000309575.3	+	2	1962	c.578T>C	c.(577-579)cTc>cCc	p.L193P		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	193					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						GTGTTCTTTCTCTACGAGCCA	0.602																																						dbGAP											0													55.0	68.0	64.0					3																	142840236		2200	4300	6500	-	-	-	SO:0001583	missense	0			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.578T>C	3.37:g.142840236T>C	ENSP00000307911:p.Leu193Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.L193P	ENST00000309575.3	37	c.578	CCDS3129.1	3	.	.	.	.	.	.	.	.	.	.	T	21.5	4.153821	0.78114	.	.	ENSG00000175040	ENST00000309575	D	0.97404	-4.37	4.45	4.45	0.53987	Sulfotransferase domain (1);	0.000000	0.56097	U	0.000025	D	0.98554	0.9517	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99552	1.0966	10	0.72032	D	0.01	-0.9316	13.8553	0.63522	0.0:0.0:0.0:1.0	.	193	Q9Y4C5	CHST2_HUMAN	P	193	ENSP00000307911:L193P	ENSP00000307911:L193P	L	+	2	0	CHST2	144322926	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.521000	0.81832	1.859000	0.53934	0.334000	0.21626	CTC	CHST2	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	ENSG00000175040		0.602	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST2	HGNC	protein_coding	OTTHUMT00000354850.1	60	0.00	0	T	NM_004267		142840236	142840236	+1	no_errors	ENST00000309575	ensembl	human	known	69_37n	missense	40	36.92	24	SNP	1.000	C
CIB4	130106	genome.wustl.edu	37	2	26846282	26846282	+	Intron	SNP	T	T	C	rs1615551	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:26846282T>C	ENST00000288861.4	-	3	240				CIB4_ENST00000405346.3_5'UTR	NM_001029881.1	NP_001025052.1	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4								calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCCACCTACTTTTAGGATTT	0.353													T|||	1269	0.253395	0.0855	0.3228	5008	,	,		13942	0.0228		0.5328	False		,,,				2504	0.3814					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS33160.1	2p23.3	2013-01-10			ENSG00000157884	ENSG00000157884		"""EF-hand domain containing"""	33703	protein-coding gene	gene with protein product		610646				15574431	Standard	NM_001029881		Approved		uc002rhm.3	A0PJX0	OTTHUMG00000151993	ENST00000288861.4:c.186+5995A>G	2.37:g.26846282T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU18	Silent	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.K64	ENST00000288861.4	37	c.192	CCDS33160.1	2																																																																																			CIB4	-	NULL	ENSG00000157884		0.353	CIB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIB4	HGNC	protein_coding	OTTHUMT00000324709.1	28	0.00	0	T			26846282	26846282	-1	no_errors	ENST00000405346	ensembl	human	putative	69_37n	silent	29	14.71	5	SNP	0.001	C
CMYA5	202333	genome.wustl.edu	37	5	79095233	79095234	+	Missense_Mutation	DNP	GT	GT	TG			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G|T	G|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr5:79095233_79095234GT>TG	ENST00000446378.2	+	13	12035_12036	c.12004_12005GT>TG	c.(12004-12006)GTg>TGg	p.V4002W	CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	4002	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGATGTTCATGTGACTGAGCGT	0.436																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	Exception_encountered	5.37:g.79095233_79095234delinsTG	ENSP00000394770:p.Val4002Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.V4002L|p.V4002G	ENST00000446378.2	37	c.12004|c.12005	CCDS47238.1	5																																																																																			CMYA5	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY	ENSG00000164309		0.436	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	62	0.00	0	G|T	NM_153610		79095233|79095234	79095233|79095234	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	68	29.90|29.17	29|28	SNP	0.993|1.000	T|G
CNTN4	152330	genome.wustl.edu	37	3	3085388	3085388	+	Splice_Site	SNP	A	A	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:3085388A>G	ENST00000397461.1	+	22	3195	c.2811A>G	c.(2809-2811)aaA>aaG	p.K937K	CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000427331.1_Splice_Site_p.K937K|CNTN4_ENST00000418658.1_Splice_Site_p.K937K|CNTN4_ENST00000448906.2_Splice_Site_p.K609K|CNTN4_ENST00000358480.3_Splice_Site_p.K718K|CNTN4_ENST00000397459.2_Splice_Site_p.K609K	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	937	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		AAGGATACAAAGTAGGTAATT	0.433																																						dbGAP											0													54.0	54.0	54.0					3																	3085388		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2811+1A>G	3.37:g.3085388A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAX3|Q8IX14|Q8TC35	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.K937	ENST00000397461.1	37	c.2811	CCDS43041.1	3																																																																																			CNTN4	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144619		0.433	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	49	0.00	0	A		Silent	3085388	3085388	+1	no_errors	ENST00000397461	ensembl	human	known	69_37n	silent	28	49.09	27	SNP	1.000	G
CWF19L1	55280	genome.wustl.edu	37	10	101993082	101993082	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr10:101993082C>T	ENST00000354105.4	-	14	1605	c.1519G>A	c.(1519-1521)Gac>Aac	p.D507N	CWF19L1_ENST00000478047.1_5'UTR|CWF19L1_ENST00000370379.1_Missense_Mutation_p.D222N|RP11-316M21.6_ENST00000444359.1_RNA	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	507							catalytic activity (GO:0003824)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		TGCCTCCAGTCAGACTTATCA	0.493																																						dbGAP											0													91.0	90.0	90.0					10																	101993082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.1519G>A	10.37:g.101993082C>T	ENSP00000326411:p.Asp507Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Missense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.D507N	ENST00000354105.4	37	c.1519	CCDS7489.1	10	.	.	.	.	.	.	.	.	.	.	C	19.90	3.913475	0.72983	.	.	ENSG00000095485	ENST00000354105;ENST00000370379	T;T	0.29917	1.55;1.55	5.48	5.48	0.80851	Histidine triad motif (1);Cwf19-like protein, C-terminal domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	L	0.41027	1.25	0.80722	D	1	P;D;D	0.63880	0.603;0.989;0.993	B;P;D	0.65573	0.283;0.766;0.936	T	0.07927	-1.0747	10	0.13470	T	0.59	-14.7753	16.8568	0.86008	0.0:1.0:0.0:0.0	.	211;370;507	Q69YN2-2;Q69YN2-3;Q69YN2	.;.;C19L1_HUMAN	N	507;222	ENSP00000326411:D507N;ENSP00000359405:D222N	ENSP00000326411:D507N	D	-	1	0	CWF19L1	101983072	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	5.455000	0.66658	2.556000	0.86216	0.561000	0.74099	GAC	CWF19L1	-	pfam_Cwf19-like_C_dom-2	ENSG00000095485		0.493	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L1	HGNC	protein_coding		56	0.00	0	C	NM_018294		101993082	101993082	-1	no_errors	ENST00000354105	ensembl	human	known	69_37n	missense	37	53.75	43	SNP	1.000	T
CYP2U1	113612	genome.wustl.edu	37	4	108866300	108866300	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr4:108866300C>T	ENST00000332884.6	+	2	940	c.665C>T	c.(664-666)tCc>tTc	p.S222F	RP11-286E11.1_ENST00000513071.1_RNA|CYP2U1_ENST00000508453.1_Missense_Mutation_p.S13F	NM_183075.2	NP_898898.1	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U, polypeptide 1	222					arachidonic acid metabolic process (GO:0019369)|cell death (GO:0008219)|omega-hydroxylase P450 pathway (GO:0097267)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|large_intestine(2)|lung(4)|skin(2)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		TGCCCTTTCTCCATCATCAGC	0.433																																						dbGAP											0													134.0	129.0	131.0					4																	108866300		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012027	CCDS34047.1	4q25	2012-11-23			ENSG00000155016	ENSG00000155016		"""Cytochrome P450s"""	20582	protein-coding gene	gene with protein product	"""spastic paraplegia 49"""	610670				14975754, 14660610	Standard	XM_005262717		Approved	SPG49	uc003hyp.3	Q7Z449	OTTHUMG00000161084	ENST00000332884.6:c.665C>T	4.37:g.108866300C>T	ENSP00000333212:p.Ser222Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMV7|Q96EQ6	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B,prints_Cyt_P450_E_grp-I_CYP2D-like	p.S222F	ENST00000332884.6	37	c.665	CCDS34047.1	4	.	.	.	.	.	.	.	.	.	.	C	13.14	2.148559	0.37923	.	.	ENSG00000155016	ENST00000332884;ENST00000424249;ENST00000508453	T;T	0.67865	-0.29;-0.29	5.63	4.79	0.61399	.	0.338958	0.35067	N	0.003467	T	0.36744	0.0978	N	0.03903	-0.33	0.27505	N	0.951878	B	0.09022	0.002	B	0.19946	0.027	T	0.29027	-1.0025	10	0.02654	T	1	.	9.1183	0.36771	0.1458:0.7803:0.0:0.0739	.	222	Q7Z449	CP2U1_HUMAN	F	222;179;13	ENSP00000333212:S222F;ENSP00000423667:S13F	ENSP00000333212:S222F	S	+	2	0	CYP2U1	109085749	0.256000	0.24012	0.970000	0.41538	0.631000	0.37964	2.922000	0.48860	1.375000	0.46248	0.655000	0.94253	TCC	CYP2U1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000155016		0.433	CYP2U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2U1	HGNC	protein_coding	OTTHUMT00000363691.2	55	0.00	0	C	NM_183075		108866300	108866300	+1	no_errors	ENST00000332884	ensembl	human	known	69_37n	missense	38	34.48	20	SNP	0.997	T
DPM1	8813	genome.wustl.edu	37	20	49562449	49562449	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr20:49562449T>C	ENST00000371588.5	-	4	333	c.307A>G	c.(307-309)Att>Gtt	p.I103V	DPM1_ENST00000371583.5_Missense_Mutation_p.I103V|RP5-914P20.5_ENST00000558899.2_RNA|DPM1_ENST00000466152.1_5'UTR|DPM1_ENST00000371582.4_Missense_Mutation_p.I103V	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit	103					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						ATTCCATGAATATATGCAGTT	0.323																																						dbGAP											0													104.0	97.0	100.0					20																	49562449		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742	ENST00000371588.5:c.307A>G	20.37:g.49562449T>C	ENSP00000360644:p.Ile103Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.I103V	ENST00000371588.5	37	c.307	CCDS13434.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.294|8.294	0.818350|0.818350	0.16607|0.16607	.|.	.|.	ENSG00000000419|ENSG00000000419	ENST00000371588;ENST00000371582;ENST00000449701;ENST00000371583;ENST00000413082|ENST00000371584	T;T;T;T|T	0.59083|0.59224	0.29;0.29;0.29;0.29|0.28	5.92|5.92	5.92|5.92	0.95590|0.95590	Glycosyl transferase, family 2 (1);|.	0.051988|.	0.85682|.	D|.	0.000000|.	T|T	0.42743|0.42743	0.1216|0.1216	N|N	0.11845|0.11845	0.185|0.185	0.43054|0.43054	D|D	0.994669|0.994669	B|.	0.06786|.	0.001|.	B|.	0.11329|.	0.006|.	T|T	0.41645|0.41645	-0.9497|-0.9497	9|6	.|.	.|.	.|.	-18.7206|-18.7206	10.3922|10.3922	0.44179|0.44179	0.0:0.0733:0.0:0.9267|0.0:0.0733:0.0:0.9267	.|.	103|.	O60762|.	DPM1_HUMAN|.	V|C	103|102	ENSP00000360644:I103V;ENSP00000360638:I103V;ENSP00000360639:I103V;ENSP00000394921:I103V|ENSP00000360640:Y102C	.|.	I|Y	-|-	1|2	0|0	DPM1|DPM1	48995856|48995856	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	3.685000|3.685000	0.54678|0.54678	2.266000|2.266000	0.75297|0.75297	0.533000|0.533000	0.62120|0.62120	ATT|TAT	DPM1	-	pfam_Glyco_trans_2	ENSG00000000419		0.323	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPM1	HGNC	protein_coding	OTTHUMT00000079716.1	20	0.00	0	T	NM_003859		49562449	49562449	-1	no_errors	ENST00000371582	ensembl	human	known	69_37n	missense	15	76.56	49	SNP	1.000	C
DSCR4	10281	genome.wustl.edu	37	21	39492422	39492422	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr21:39492422C>G	ENST00000328264.3	-	2	313	c.209G>C	c.(208-210)gGa>gCa	p.G70A	DSCR8_ENST00000400477.3_5'Flank|DSCR8_ENST00000357704.4_5'Flank|DSCR4_ENST00000398948.1_Missense_Mutation_p.G70A	NM_005867.2	NP_005858.1	P56555	DSCR4_HUMAN	Down syndrome critical region gene 4	70										large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	6						gctggcaagtccagaatccgt	0.363																																						dbGAP											0													46.0	52.0	50.0					21																	39492422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000099	CCDS33554.1	21q22.2	2012-04-19			ENSG00000184029	ENSG00000184029			3045	protein-coding gene	gene with protein product		604829				9455479	Standard	NM_005867		Approved	DCRB	uc002ywp.3	P56555	OTTHUMG00000086673	ENST00000328264.3:c.209G>C	21.37:g.39492422C>G	ENSP00000328676:p.Gly70Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VB31	Missense_Mutation	SNP	NULL	p.G70A	ENST00000328264.3	37	c.209	CCDS33554.1	21	.	.	.	.	.	.	.	.	.	.	C	9.221	1.033362	0.19590	.	.	ENSG00000184029	ENST00000398948;ENST00000328264	.	.	.	1.45	-2.91	0.05631	.	.	.	.	.	T	0.19967	0.0480	.	.	.	0.09310	N	1	B	0.30686	0.29	B	0.20384	0.029	T	0.12091	-1.0561	7	0.87932	D	0	.	3.0263	0.06092	0.0:0.2965:0.2365:0.467	.	70	P56555	DSCR4_HUMAN	A	70	.	ENSP00000328676:G70A	G	-	2	0	DSCR4	38414292	0.000000	0.05858	0.000000	0.03702	0.252000	0.25951	-0.935000	0.03950	-0.999000	0.03442	0.313000	0.20887	GGA	DSCR4	-	NULL	ENSG00000184029		0.363	DSCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DSCR4	HGNC	protein_coding	OTTHUMT00000194834.1	56	0.00	0	C	NM_005867		39492422	39492422	-1	no_errors	ENST00000328264	ensembl	human	known	69_37n	missense	193	12.27	27	SNP	0.000	G
ECD	11319	genome.wustl.edu	37	10	74914034	74914034	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr10:74914034C>T	ENST00000372979.4	-	6	969	c.763G>A	c.(763-765)Gaa>Aaa	p.E255K	ECD_ENST00000430082.2_Missense_Mutation_p.E255K|ECD_ENST00000454759.2_Missense_Mutation_p.E255K|ECD_ENST00000610256.1_5'Flank	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	255					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					ATTCGTGTTTCAGGCAAGAAT	0.408																																						dbGAP											0													64.0	60.0	62.0					10																	74914034		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.763G>A	10.37:g.74914034C>T	ENSP00000362070:p.Glu255Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JX46|E9PAW8	Missense_Mutation	SNP	pfam_SGT1	p.E255K	ENST00000372979.4	37	c.763	CCDS7321.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.124961	0.94429	.	.	ENSG00000122882	ENST00000372979;ENST00000430082;ENST00000454759;ENST00000453402	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.2	5.2	0.72013	.	0.198167	0.52532	D	0.000070	T	0.35128	0.0921	M	0.68728	2.09	0.58432	D	0.999995	D;P;P	0.53151	0.958;0.931;0.928	P;P;P	0.54174	0.744;0.661;0.608	T	0.07009	-1.0795	10	0.15066	T	0.55	-11.3505	16.2256	0.82288	0.0:1.0:0.0:0.0	.	255;255;255	E9PAW8;C9JX46;O95905	.;.;SGT1_HUMAN	K	255;255;255;181	ENSP00000362070:E255K;ENSP00000401566:E255K;ENSP00000395786:E255K;ENSP00000391367:E181K	ENSP00000362070:E255K	E	-	1	0	ECD	74584040	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.451000	0.60047	2.404000	0.81709	0.650000	0.86243	GAA	ECD	-	pfam_SGT1	ENSG00000122882		0.408	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECD	HGNC	protein_coding	OTTHUMT00000048606.1	59	0.00	0	C	NM_007265		74914034	74914034	-1	no_errors	ENST00000430082	ensembl	human	known	69_37n	missense	90	13.46	14	SNP	1.000	T
EEF1A2	1917	genome.wustl.edu	37	20	62121849	62121849	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr20:62121849C>A	ENST00000298049.7	-	5	1082	c.1012G>T	c.(1012-1014)Gct>Tct	p.A338S	EEF1A2_ENST00000217182.3_Missense_Mutation_p.A338S			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	338					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GTGAACTGAGCAGCCTCCTGC	0.667																																						dbGAP											0													39.0	41.0	40.0					20																	62121849		2192	4284	6476	-	-	-	SO:0001583	missense	0			AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.1012G>T	20.37:g.62121849C>A	ENSP00000298049:p.Ala338Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EF1A_euk/arc	p.A338S	ENST00000298049.7	37	c.1012	CCDS13522.1	20	.	.	.	.	.	.	.	.	.	.	C	16.48	3.134809	0.56828	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.41758	0.99;0.99	3.82	3.82	0.43975	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.131649	0.51477	D	0.000086	T	0.38612	0.1047	L	0.45352	1.415	0.51233	D	0.999916	B;B	0.02656	0.0;0.0	B;B	0.20184	0.002;0.028	T	0.36817	-0.9732	10	0.54805	T	0.06	-0.7563	16.0768	0.80974	0.0:1.0:0.0:0.0	.	314;338	Q59GP5;Q05639	.;EF1A2_HUMAN	S	338	ENSP00000298049:A338S;ENSP00000217182:A338S	ENSP00000217182:A338S	A	-	1	0	EEF1A2	61592293	1.000000	0.71417	0.980000	0.43619	0.804000	0.45430	5.772000	0.68889	1.847000	0.53656	0.556000	0.70494	GCT	EEF1A2	-	pfam_Transl_elong_EFTu/EF1A_C,superfamily_Transl_elong_EF1A/Init_IF2_C,tigrfam_Transl_elong_EF1A_euk/arc	ENSG00000101210		0.667	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A2	HGNC	protein_coding	OTTHUMT00000080495.1	93	0.00	0	C	NM_001958		62121849	62121849	-1	no_errors	ENST00000217182	ensembl	human	known	69_37n	missense	322	13.21	49	SNP	0.999	A
ELOVL4	6785	genome.wustl.edu	37	6	80629179	80629179	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr6:80629179C>A	ENST00000369816.4	-	5	927	c.627G>T	c.(625-627)caG>caT	p.Q209H		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	209					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)			central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	AAAGATATTTCTGAATCCATG	0.348																																						dbGAP											0													98.0	93.0	95.0					6																	80629179		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.627G>T	6.37:g.80629179C>A	ENSP00000358831:p.Gln209His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.Q209H	ENST00000369816.4	37	c.627	CCDS4992.1	6	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707310	0.30322	.	.	ENSG00000118402	ENST00000369816	T	0.22134	1.97	5.81	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.13586	0.0329	M	0.62154	1.92	0.58432	D	0.999999	B	0.14805	0.011	B	0.23716	0.048	T	0.02813	-1.1107	10	0.42905	T	0.14	-13.2018	14.1474	0.65360	0.0:0.9283:0.0:0.0717	.	209	Q9GZR5	ELOV4_HUMAN	H	209	ENSP00000358831:Q209H	ENSP00000358831:Q209H	Q	-	3	2	ELOVL4	80685898	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	2.060000	0.41394	1.475000	0.48197	-0.157000	0.13467	CAG	ELOVL4	-	pfam_GNS1_SUR4	ENSG00000118402		0.348	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL4	HGNC	protein_coding	OTTHUMT00000041315.1	34	0.00	0	C			80629179	80629179	-1	no_errors	ENST00000369816	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	1.000	A
EZH1	2145	genome.wustl.edu	37	17	40855784	40855784	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr17:40855784G>A	ENST00000428826.2	-	19	2193	c.2072C>T	c.(2071-2073)tCa>tTa	p.S691L	EZH1_ENST00000590783.1_5'Flank|EZH1_ENST00000435174.1_Missense_Mutation_p.S552L|EZH1_ENST00000415827.2_Missense_Mutation_p.S682L|EZH1_ENST00000590078.1_Missense_Mutation_p.S621L|EZH1_ENST00000592743.1_Missense_Mutation_p.S691L|EZH1_ENST00000585893.1_Missense_Mutation_p.S651L			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	691	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		GGGATTCACTGAATGATTTGC	0.428																																						dbGAP											0													178.0	145.0	156.0					17																	40855784		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.2072C>T	17.37:g.40855784G>A	ENSP00000404658:p.Ser691Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	pfam_SET_dom,pfam_EZH2_WD-Binding,superfamily_Homeodomain-like,smart_SANT/Myb,smart_SET_dom,pfscan_SET_dom	p.S691L	ENST00000428826.2	37	c.2072	CCDS32659.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.855492	0.97030	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	D;D	0.89415	-2.51;-2.51	5.45	5.45	0.79879	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.96500	0.8858	H	0.96365	3.81	0.80722	D	1	D;D;D;D;D	0.63880	0.966;0.993;0.969;0.987;0.975	D;D;D;D;D	0.69824	0.91;0.959;0.943;0.943;0.966	D	0.97240	0.9890	10	0.87932	D	0	.	19.4844	0.95024	0.0:0.0:1.0:0.0	.	552;651;697;621;691	Q92800-5;Q92800-3;Q92800-2;Q92800-4;Q92800	.;.;.;.;EZH1_HUMAN	L	694;691;651;552	ENSP00000404658:S691L;ENSP00000404071:S552L	ENSP00000264646:S694L	S	-	2	0	EZH1	38109310	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	9.657000	0.98554	2.838000	0.97847	0.563000	0.77884	TCA	EZH1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000108799		0.428	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EZH1	HGNC	protein_coding	OTTHUMT00000452347.1	32	0.00	0	G	NM_001991		40855784	40855784	-1	no_errors	ENST00000428826	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	A
F5	2153	genome.wustl.edu	37	1	169487737	169487737	+	Silent	SNP	C	C	A	rs200435082		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:169487737C>A	ENST00000367797.3	-	23	6459	c.6258G>T	c.(6256-6258)tcG>tcT	p.S2086S	F5_ENST00000367796.3_Silent_p.S2091S	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2086	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	ATTTCTTAAACGAAGAAGCTG	0.453																																						dbGAP											0													165.0	160.0	162.0					1																	169487737		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6258G>T	1.37:g.169487737C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S2091	ENST00000367797.3	37	c.6273	CCDS1281.1	1																																																																																			F5	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000198734		0.453	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	67	0.00	0	C	NM_000130		169487737	169487737	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	silent	85	44.81	69	SNP	0.066	A
FCGBP	8857	genome.wustl.edu	37	19	40421281	40421281	+	Silent	SNP	G	G	A	rs373203794		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr19:40421281G>A	ENST00000221347.6	-	5	2647	c.2640C>T	c.(2638-2640)ttC>ttT	p.F880F		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	880	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCATGAAGTCGAAGCGCCGGC	0.672																																						dbGAP											0													30.0	30.0	30.0					19																	40421281		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2640C>T	19.37:g.40421281G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.F880	ENST00000221347.6	37	c.2640	CCDS12546.1	19																																																																																			FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.672	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	88	0.00	0	G	NM_003890		40421281	40421281	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	88	48.84	84	SNP	0.052	A
FERMT3	83706	genome.wustl.edu	37	11	63988103	63988103	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:63988103G>A	ENST00000279227.5	+	12	1614	c.1519G>A	c.(1519-1521)Gtt>Att	p.V507I	FERMT3_ENST00000345728.5_Missense_Mutation_p.V503I	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	507	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						CTACGGCCTCGTTGCCCCCCG	0.657																																						dbGAP											0													15.0	14.0	15.0					11																	63988103		2201	4292	6493	-	-	-	SO:0001583	missense	0			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1519G>A	11.37:g.63988103G>A	ENSP00000279227:p.Val507Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	pfam_FERM_central,pfam_Pleckstrin_homology,superfamily_FERM_central,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V507I	ENST00000279227.5	37	c.1519	CCDS8060.1	11	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805208	0.70682	.	.	ENSG00000149781	ENST00000345728;ENST00000279227	T;T	0.79653	-1.29;-1.29	4.21	4.21	0.49690	Band 4.1 domain (1);FERM central domain (2);	0.000000	0.64402	D	0.000001	D	0.84848	0.5563	L	0.41824	1.3	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79108	0.98;0.992	D	0.84786	0.0776	10	0.42905	T	0.14	-24.683	15.8625	0.79035	0.0:0.0:1.0:0.0	.	503;507	Q86UX7-2;Q86UX7	.;URP2_HUMAN	I	503;507	ENSP00000339950:V503I;ENSP00000279227:V507I	ENSP00000279227:V507I	V	+	1	0	FERMT3	63744679	1.000000	0.71417	0.075000	0.20258	0.450000	0.32258	6.024000	0.70857	2.348000	0.79779	0.491000	0.48974	GTT	FERMT3	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain	ENSG00000149781		0.657	FERMT3-001	KNOWN	basic|CCDS	protein_coding	FERMT3	HGNC	protein_coding	OTTHUMT00000396297.1	86	0.00	0	G	NM_031471		63988103	63988103	+1	no_errors	ENST00000279227	ensembl	human	known	69_37n	missense	98	10.91	12	SNP	0.990	A
FREM2	341640	genome.wustl.edu	37	13	39264280	39264280	+	Silent	SNP	C	C	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr13:39264280C>A	ENST00000280481.7	+	1	3015	c.2799C>A	c.(2797-2799)gtC>gtA	p.V933V		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	933					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GAGTAAATGTCCGGCCAGTGG	0.493																																						dbGAP											0													71.0	61.0	64.0					13																	39264280		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2799C>A	13.37:g.39264280C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.V933	ENST00000280481.7	37	c.2799	CCDS31960.1	13																																																																																			FREM2	-	NULL	ENSG00000150893		0.493	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	35	0.00	0	C	NM_207361		39264280	39264280	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	silent	24	52.00	26	SNP	0.127	A
GFAP	2670	genome.wustl.edu	37	17	42987611	42987611	+	Intron	SNP	C	C	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr17:42987611C>A	ENST00000253408.5	-	7	1237				GFAP_ENST00000588735.1_Intron|GFAP_ENST00000435360.2_Missense_Mutation_p.D397Y	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein						astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				TTTTCCCCGTCTTTGGTGCTT	0.473																																						dbGAP											0													319.0	273.0	287.0					17																	42987611		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.1171+371G>T	17.37:g.42987611C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Missense_Mutation	SNP	pfam_F	p.D397Y	ENST00000253408.5	37	c.1189	CCDS11491.1	17	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471445	0.43942	.	.	ENSG00000131095	ENST00000435360	D	0.84370	-1.84	4.78	4.78	0.61160	.	.	.	.	.	T	0.70369	0.3216	N	0.08118	0	0.80722	D	1	B	0.25521	0.128	B	0.22152	0.038	T	0.65455	-0.6164	9	0.22706	T	0.39	.	13.6287	0.62183	0.0:1.0:0.0:0.0	.	397	E9PAX3	.	Y	397	ENSP00000403962:D397Y	ENSP00000403962:D397Y	D	-	1	0	GFAP	40343137	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.682000	0.37628	2.937000	0.99478	0.650000	0.86243	GAC	GFAP	-	NULL	ENSG00000131095		0.473	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFAP	HGNC	protein_coding	OTTHUMT00000448701.1	39	0.00	0	C	NM_002055		42987611	42987611	-1	no_errors	ENST00000435360	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	1.000	A
GGA1	26088	genome.wustl.edu	37	22	38005244	38005244	+	Intron	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr22:38005244G>A	ENST00000343632.4	+	1	429				GGA1_ENST00000325180.8_Intron|GGA1_ENST00000337437.4_Intron|GGA1_ENST00000414350.3_Intron|GGA1_ENST00000405147.3_Intron|GGA1_ENST00000381756.5_Intron|GGA1_ENST00000406772.1_5'UTR	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1						intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					GTAGCGGCCCGGGGAAGGAGC	0.672																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.43+334G>A	22.37:g.38005244G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	RNA	SNP	-	NULL	ENST00000343632.4	37	NULL	CCDS13951.1	22																																																																																			GGA1	-	-	ENSG00000100083		0.672	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA1	HGNC	protein_coding	OTTHUMT00000075873.3	10	0.00	0	G	NM_013365		38005244	38005244	+1	no_errors	ENST00000484804	ensembl	human	known	69_37n	rna	12	36.84	7	SNP	0.000	A
GIGYF2	26058	genome.wustl.edu	37	2	233680382	233680382	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:233680382G>T	ENST00000409547.1	+	21	2454	c.2143G>T	c.(2143-2145)Gac>Tac	p.D715Y	GIGYF2_ENST00000409451.3_Missense_Mutation_p.D736Y|GIGYF2_ENST00000409480.1_Missense_Mutation_p.D737Y|GIGYF2_ENST00000452341.2_Missense_Mutation_p.D546Y|GIGYF2_ENST00000409196.3_Missense_Mutation_p.D709Y|GIGYF2_ENST00000373566.3_Missense_Mutation_p.D737Y|GIGYF2_ENST00000373563.4_Missense_Mutation_p.D715Y	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	715	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TCTTCCTCTGGACACCACGAC	0.488																																						dbGAP											0													205.0	170.0	182.0					2																	233680382		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2143G>T	2.37:g.233680382G>T	ENSP00000386537:p.Asp715Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.D737Y	ENST00000409547.1	37	c.2209	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731849	0.69189	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T;T	0.75260	-0.75;-0.76;-0.75;-0.76;-0.92;-0.75;-0.75;-0.91;-0.63	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.85691	0.5755	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.91635	0.998;0.999;0.927;0.996	D	0.86857	0.2027	10	0.72032	D	0.01	-19.356	18.9247	0.92540	0.0:0.0:1.0:0.0	.	546;736;715;709	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	Y	737;658;715;737;715;715;658;709;736;709;546	ENSP00000362667:D737Y;ENSP00000362664:D715Y;ENSP00000386765:D737Y;ENSP00000386537:D715Y;ENSP00000404195:D658Y;ENSP00000387070:D709Y;ENSP00000387170:D736Y;ENSP00000410297:D709Y;ENSP00000411505:D546Y	ENSP00000362664:D715Y	D	+	1	0	GIGYF2	233388626	1.000000	0.71417	0.989000	0.46669	0.318000	0.28184	7.632000	0.83247	2.467000	0.83353	0.650000	0.86243	GAC	GIGYF2	-	NULL	ENSG00000204120		0.488	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2	203	0.00	0	G	NM_001103146		233680382	233680382	+1	no_errors	ENST00000373566	ensembl	human	known	69_37n	missense	233	26.27	83	SNP	1.000	T
GON4L	54856	genome.wustl.edu	37	1	155792255	155792256	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:155792255_155792256delTT	ENST00000368331.1	-	4	757_758	c.709_710delAA	c.(709-711)aatfs	p.N237fs	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Frame_Shift_Del_p.N237fs|GON4L_ENST00000271883.5_Frame_Shift_Del_p.N237fs|GON4L_ENST00000361040.5_Frame_Shift_Del_p.N237fs	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	237					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ACTTTCTTCATTGTCTTGTTCT	0.406																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.709_710delAA	1.37:g.155792255_155792256delTT	ENSP00000357315:p.Asn237fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Frame_Shift_Del	DEL	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.N237fs	ENST00000368331.1	37	c.710_709		1																																																																																			GON4L	-	NULL	ENSG00000116580		0.406	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		38	0.00	0	TT	NM_032292		155792255	155792256	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	frame_shift_del	51	45.37	49	DEL	0.000:0.002	-
GON4L	54856	genome.wustl.edu	37	1	155823536	155823536	+	Silent	SNP	T	T	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:155823536T>C	ENST00000368331.1	-	2	84	c.36A>G	c.(34-36)acA>acG	p.T12T	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Silent_p.T12T|GON4L_ENST00000271883.5_Silent_p.T12T|GON4L_ENST00000361040.5_Silent_p.T12T	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	12					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTAGGGACTCTGTCACTGTAG	0.388																																						dbGAP											0													102.0	93.0	96.0					1																	155823536		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.36A>G	1.37:g.155823536T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.T12	ENST00000368331.1	37	c.36		1																																																																																			GON4L	-	NULL	ENSG00000116580		0.388	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		98	0.00	0	T	NM_032292		155823536	155823536	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	silent	180	15.89	34	SNP	0.000	C
GPR142	350383	genome.wustl.edu	37	17	72365633	72365633	+	Silent	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr17:72365633G>A	ENST00000335666.4	+	2	318	c.270G>A	c.(268-270)ggG>ggA	p.G90G		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	90						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						AGGATCCTGGGGCAAACAACC	0.627																																						dbGAP											0													53.0	42.0	46.0					17																	72365633		2190	4279	6469	-	-	-	SO:0001819	synonymous_variant	0			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.270G>A	17.37:g.72365633G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4CYJ8|Q86SL3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.G90	ENST00000335666.4	37	c.270	CCDS11698.1	17																																																																																			GPR142	-	NULL	ENSG00000257008		0.627	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR142	HGNC	protein_coding	OTTHUMT00000442545.1	65	0.00	0	G	NM_181790		72365633	72365633	+1	no_errors	ENST00000335666	ensembl	human	known	69_37n	silent	72	50.34	73	SNP	0.000	A
GPR55	9290	genome.wustl.edu	37	2	231775322	231775322	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:231775322C>T	ENST00000392040.1	-	2	548	c.356G>A	c.(355-357)cGg>cAg	p.R119Q	GPR55_ENST00000392039.2_Missense_Mutation_p.R119Q|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	119					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GGCCAAGAACCGGTCCATGCT	0.592																																						dbGAP											0													62.0	45.0	50.0					2																	231775322		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.356G>A	2.37:g.231775322C>T	ENSP00000375894:p.Arg119Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N580	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.R119Q	ENST00000392040.1	37	c.356	CCDS2480.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.551930	0.96501	.	.	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	D;D;D	0.97161	-4.27;-4.27;-4.27	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98915	0.9632	H	0.94345	3.525	0.47547	D	0.999459	D	0.89917	1.0	D	0.97110	1.0	D	0.99605	1.0979	10	0.87932	D	0	-26.4684	17.2336	0.86991	0.0:1.0:0.0:0.0	.	119	Q9Y2T6	GPR55_HUMAN	Q	119	ENSP00000375894:R119Q;ENSP00000375893:R119Q;ENSP00000412768:R119Q	ENSP00000375893:R119Q	R	-	2	0	GPR55	231483566	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.818000	0.86416	2.660000	0.90430	0.655000	0.94253	CGG	GPR55	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000135898		0.592	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR55	HGNC	protein_coding	OTTHUMT00000332618.1	48	0.00	0	C	NM_005683		231775322	231775322	-1	no_errors	ENST00000392039	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	1.000	T
IGSF10	285313	genome.wustl.edu	37	3	151163264	151163264	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:151163264A>T	ENST00000282466.3	-	4	4504	c.4505T>A	c.(4504-4506)gTg>gAg	p.V1502E		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1502					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGCTTGACCACTGTATTTGT	0.493																																						dbGAP											0													95.0	92.0	93.0					3																	151163264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4505T>A	3.37:g.151163264A>T	ENSP00000282466:p.Val1502Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V1502E	ENST00000282466.3	37	c.4505	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	A	12.59	1.984357	0.35036	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.69306	-0.39	5.86	-5.17	0.02849	.	1.451030	0.04464	N	0.374871	T	0.37265	0.0997	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.23048	-1.0199	10	0.08599	T	0.76	.	0.6915	0.00892	0.2187:0.3069:0.1555:0.3189	.	1502	Q6WRI0	IGS10_HUMAN	E	1502;129	ENSP00000282466:V1502E	ENSP00000282466:V1502E	V	-	2	0	IGSF10	152645954	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.784000	0.26816	-0.415000	0.07484	-0.256000	0.11100	GTG	IGSF10	-	NULL	ENSG00000152580		0.493	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	61	0.00	0	A	NM_178822		151163264	151163264	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	missense	41	36.92	24	SNP	0.000	T
IGSF22	283284	genome.wustl.edu	37	11	18739611	18739611	+	Silent	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:18739611G>A	ENST00000513874.1	-	9	979	c.840C>T	c.(838-840)tcC>tcT	p.S280S	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	280	Ig-like 2.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						ACTTGCCCAGGGAGTACTGGA	0.537																																						dbGAP											0													143.0	137.0	139.0					11																	18739611		2095	4212	6307	-	-	-	SO:0001819	synonymous_variant	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.840C>T	11.37:g.18739611G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNA0|D6RGV7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S280	ENST00000513874.1	37	c.840	CCDS41625.2	11																																																																																			IGSF22	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000179057		0.537	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	68	0.00	0	G	NM_173588		18739611	18739611	-1	no_errors	ENST00000513874	ensembl	human	known	69_37n	silent	43	52.22	47	SNP	1.000	A
IVL	3713	genome.wustl.edu	37	1	152882383	152882383	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:152882383C>T	ENST00000368764.3	+	2	174	c.110C>T	c.(109-111)cCa>cTa	p.P37L	IVL_ENST00000392667.2_5'UTR			P07476	INVO_HUMAN	involucrin	37					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ATGAAACAGCCAACTCCACTG	0.557																																						dbGAP											0													100.0	88.0	92.0					1																	152882383		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.110C>T	1.37:g.152882383C>T	ENSP00000357753:p.Pro37Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.P37L	ENST00000368764.3	37	c.110	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.296159	0.23650	.	.	ENSG00000163207	ENST00000368764	T	0.10573	2.86	4.77	4.77	0.60923	Involucrin, N-terminal (1);	.	.	.	.	T	0.21881	0.0527	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.00202	-1.1925	9	0.72032	D	0.01	-0.3681	13.4714	0.61283	0.0:1.0:0.0:0.0	.	37	P07476	INVO_HUMAN	L	37	ENSP00000357753:P37L	ENSP00000357753:P37L	P	+	2	0	IVL	151149007	0.028000	0.19301	0.017000	0.16124	0.050000	0.14768	2.148000	0.42235	2.640000	0.89533	0.561000	0.74099	CCA	IVL	-	pfam_Involucrin_N	ENSG00000163207		0.557	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	36	0.00	0	C	NM_005547		152882383	152882383	+1	no_errors	ENST00000368764	ensembl	human	known	69_37n	missense	94	14.55	16	SNP	0.023	T
KIDINS220	57498	genome.wustl.edu	37	2	8943114	8943114	+	Silent	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:8943114C>T	ENST00000256707.3	-	8	928	c.747G>A	c.(745-747)acG>acA	p.T249T	KIDINS220_ENST00000319688.5_Silent_p.T250T|KIDINS220_ENST00000418530.1_Silent_p.T207T|KIDINS220_ENST00000427284.1_Silent_p.T249T|KIDINS220_ENST00000473731.1_Silent_p.T249T	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	249					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GCACAATCTCCGTATGTCCCT	0.403																																						dbGAP											0													136.0	130.0	132.0					2																	8943114		2001	4173	6174	-	-	-	SO:0001819	synonymous_variant	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.747G>A	2.37:g.8943114C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T249	ENST00000256707.3	37	c.747	CCDS42650.1	2																																																																																			KIDINS220	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000134313		0.403	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	66	0.00	0	C	NM_020738		8943114	8943114	-1	no_errors	ENST00000256707	ensembl	human	known	69_37n	silent	71	39.32	46	SNP	0.114	T
KIF17	57576	genome.wustl.edu	37	1	20998492	20998492	+	Silent	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:20998492G>A	ENST00000247986.2	-	12	2971	c.2661C>T	c.(2659-2661)gaC>gaT	p.D887D	KIF17_ENST00000375044.1_Silent_p.D787D|KIF17_ENST00000400463.3_Silent_p.D887D|KIF17_ENST00000490034.1_5'UTR			Q9P2E2	KIF17_HUMAN	kinesin family member 17	887					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CGTTATCTTCGTCCCAGCAGG	0.582																																						dbGAP											0													123.0	112.0	116.0					1																	20998492		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2661C>T	1.37:g.20998492G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D887	ENST00000247986.2	37	c.2661	CCDS213.1	1																																																																																			KIF17	-	NULL	ENSG00000117245		0.582	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	125	0.00	0	G	NM_020816		20998492	20998492	-1	no_errors	ENST00000247986	ensembl	human	known	69_37n	silent	98	35.29	54	SNP	0.899	A
LEKR1	389170	genome.wustl.edu	37	3	156544156	156544156	+	5'UTR	SNP	C	C	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:156544156C>G	ENST00000470811.1	+	0	61				LEKR1_ENST00000489350.1_3'UTR|LEKR1_ENST00000477399.1_5'UTR|LEKR1_ENST00000491763.1_5'UTR|LEKR1_ENST00000483177.1_5'UTR|LEKR1_ENST00000498839.1_5'UTR|LEKR1_ENST00000356539.4_5'UTR			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1											breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CCGTCCTAGTCGAAGTCGAGG	0.682																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.-1275C>G	3.37:g.156544156C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000470811.1	37	NULL		3																																																																																			RP11-6F2.7	-	-	ENSG00000197980		0.682	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	Clone_based_vega_gene	protein_coding	OTTHUMT00000351625.3	81	0.00	0	C	NM_001004316		156544156	156544156	+1	no_errors	ENST00000489350	ensembl	human	known	69_37n	rna	54	36.47	31	SNP	0.000	G
LEPR	3953	genome.wustl.edu	37	1	66088677	66088678	+	Intron	INS	-	-	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:66088677_66088678insT	ENST00000349533.6	+	19	2858				LEPR_ENST00000371058.1_Intron|LEPR_ENST00000371060.3_Intron|LEPR_ENST00000344610.8_Intron|LEPR_ENST00000371059.3_Intron|LEPR_ENST00000406510.3_Intron	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor						negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TGCTTTTTCAATTTTTTTTAAC	0.317																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2673+13->T	1.37:g.66088685_66088685dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHL5	RNA	INS	-	NULL	ENST00000349533.6	37	NULL	CCDS631.1	1																																																																																			LEPR	-	-	ENSG00000116678		0.317	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	46	0.00	0	-	NM_002303		66088677	66088678	+1	no_errors	ENST00000471762	ensembl	human	known	69_37n	rna	31	42.59	23	INS	0.000:0.001	T
LGR6	59352	genome.wustl.edu	37	1	202287564	202287564	+	Silent	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:202287564C>T	ENST00000367278.3	+	18	2222	c.2133C>T	c.(2131-2133)taC>taT	p.Y711Y	LGR6_ENST00000255432.7_Silent_p.Y659Y|LGR6_ENST00000439764.2_Silent_p.Y572Y	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	711					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						TGGGAGAATACGGGGCCTCCC	0.687																																						dbGAP											0													28.0	29.0	28.0					1																	202287564		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.2133C>T	1.37:g.202287564C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Silent	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y711	ENST00000367278.3	37	c.2133	CCDS30971.1	1																																																																																			LGR6	-	pfam_7TM_GPCR_Rhodpsn,prints_Gphrmn_rcpt	ENSG00000133067		0.687	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR6	HGNC	protein_coding	OTTHUMT00000099143.1	49	0.00	0	C	NM_021636		202287564	202287564	+1	no_errors	ENST00000367278	ensembl	human	known	69_37n	silent	113	15.67	21	SNP	0.572	T
LMCD1	29995	genome.wustl.edu	37	3	8578971	8578971	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:8578971T>C	ENST00000157600.3	+	3	464	c.232T>C	c.(232-234)Tat>Cat	p.Y78H	LMCD1-AS1_ENST00000439407.1_RNA|LMCD1_ENST00000454244.1_Missense_Mutation_p.Y5H|LMCD1_ENST00000535732.1_Missense_Mutation_p.Y78H|LMCD1_ENST00000397386.3_Intron	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	78					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		GGACTCCAAGTATTCCACCCT	0.507																																						dbGAP											0													99.0	95.0	96.0					3																	8578971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.232T>C	3.37:g.8578971T>C	ENSP00000157600:p.Tyr78His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG80	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.Y78H	ENST00000157600.3	37	c.232	CCDS33688.1	3	.	.	.	.	.	.	.	.	.	.	T	20.5	3.997116	0.74818	.	.	ENSG00000071282	ENST00000157600;ENST00000415597;ENST00000535732;ENST00000454244;ENST00000426878	T;D;T;T;T	0.86865	0.79;-2.18;-1.2;0.68;-1.2	5.51	4.35	0.52113	.	0.095173	0.45867	N	0.000329	D	0.91928	0.7444	M	0.80422	2.495	0.80722	D	1	D;D	0.71674	0.998;0.966	D;P	0.63381	0.914;0.641	D	0.91618	0.5308	10	0.66056	D	0.02	-7.7917	10.4466	0.44497	0.0:0.0775:0.0:0.9225	.	78;78	F5GX84;Q9NZU5	.;LMCD1_HUMAN	H	78;84;78;5;35	ENSP00000157600:Y78H;ENSP00000400555:Y84H;ENSP00000441100:Y78H;ENSP00000396515:Y5H;ENSP00000411222:Y35H	ENSP00000157600:Y78H	Y	+	1	0	LMCD1	8553971	1.000000	0.71417	0.982000	0.44146	0.847000	0.48162	4.764000	0.62264	0.908000	0.36671	-0.290000	0.09829	TAT	LMCD1	-	NULL	ENSG00000071282		0.507	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMCD1	HGNC	protein_coding	OTTHUMT00000337854.1	35	0.00	0	T	NM_014583		8578971	8578971	+1	no_errors	ENST00000157600	ensembl	human	known	69_37n	missense	34	37.04	20	SNP	1.000	C
LIPH	200879	genome.wustl.edu	37	3	185229372	185229372	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:185229372C>T	ENST00000296252.4	-	9	1349	c.1208G>A	c.(1207-1209)gGc>gAc	p.G403D	LIPH_ENST00000424591.2_Missense_Mutation_p.G369D	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	403					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GTACCTTGGGCCTATTAGAGA	0.438																																						dbGAP											0													115.0	112.0	113.0					3																	185229372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.1208G>A	3.37:g.185229372C>T	ENSP00000296252:p.Gly403Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IBA7|Q8TEC7	Missense_Mutation	SNP	pfam_Lipase_N,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.G403D	ENST00000296252.4	37	c.1208	CCDS3272.1	3	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802621	0.50315	.	.	ENSG00000163898	ENST00000296252;ENST00000424591;ENST00000435679	D;D	0.88277	-2.36;-2.15	5.4	5.4	0.78164	.	0.168384	0.52532	D	0.000063	D	0.93278	0.7858	M	0.73598	2.24	0.54753	D	0.99998	D;P	0.71674	0.998;0.913	D;P	0.63113	0.911;0.564	D	0.91313	0.5076	10	0.26408	T	0.33	-20.2221	18.102	0.89508	0.0:1.0:0.0:0.0	.	369;403	A2IBA6;Q8WWY8	.;LIPH_HUMAN	D	403;369;47	ENSP00000296252:G403D;ENSP00000396384:G369D	ENSP00000296252:G403D	G	-	2	0	LIPH	186712066	1.000000	0.71417	0.950000	0.38849	0.110000	0.19582	4.295000	0.59049	2.689000	0.91719	0.563000	0.77884	GGC	LIPH	-	superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH	ENSG00000163898		0.438	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPH	HGNC	protein_coding	OTTHUMT00000345153.1	59	0.00	0	C			185229372	185229372	-1	no_errors	ENST00000296252	ensembl	human	known	69_37n	missense	57	30.95	26	SNP	1.000	T
LRRC37A11P	342666	genome.wustl.edu	37	17	37188547	37188547	+	RNA	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr17:37188547G>A	ENST00000425901.2	+	0	2389					NR_033753.2				leucine rich repeat containing 37, member A11, pseudogene																		CAGAGGAACAGAAGGCCTCCA	0.502																																						dbGAP											0																																										-	-	-			0					17q12	2013-05-14			ENSG00000214553	ENSG00000214553			43815	pseudogene	pseudogene							Standard	NR_033753		Approved		uc002hrd.1		OTTHUMG00000133184		17.37:g.37188547G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425901.2	37	NULL		17																																																																																			LRRC37A11P	-	-	ENSG00000214553		0.502	LRRC37A11P-002	KNOWN	basic	processed_transcript	LRRC37A11P	HGNC	pseudogene	OTTHUMT00000444105.1	194	0.00	0	G	NR_033753		37188547	37188547	+1	no_errors	ENST00000425901	ensembl	human	known	69_37n	rna	1015	19.03	239	SNP	0.013	A
LRRC37A11P	342666	genome.wustl.edu	37	17	37190468	37190468	+	RNA	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr17:37190468G>A	ENST00000425901.2	+	0	2578					NR_033753.2				leucine rich repeat containing 37, member A11, pseudogene																		AAGATGTATGGAAAGCATACA	0.343																																						dbGAP											0																																										-	-	-			0					17q12	2013-05-14			ENSG00000214553	ENSG00000214553			43815	pseudogene	pseudogene							Standard	NR_033753		Approved		uc002hrd.1		OTTHUMG00000133184		17.37:g.37190468G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425901.2	37	NULL		17																																																																																			LRRC37A11P	-	-	ENSG00000214553		0.343	LRRC37A11P-002	KNOWN	basic	processed_transcript	LRRC37A11P	HGNC	pseudogene	OTTHUMT00000444105.1	194	0.00	0	G	NR_033753		37190468	37190468	+1	no_errors	ENST00000425901	ensembl	human	known	69_37n	rna	811	18.41	183	SNP	0.045	A
LRRTM4	80059	genome.wustl.edu	37	2	77746565	77746565	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:77746565T>G	ENST00000409093.1	-	3	766	c.430A>C	c.(430-432)Aag>Cag	p.K144Q	LRRTM4_ENST00000409282.1_Missense_Mutation_p.K145Q|LRRTM4_ENST00000409911.1_Missense_Mutation_p.K145Q|LRRTM4_ENST00000409088.3_Missense_Mutation_p.K144Q|LRRTM4_ENST00000409884.1_Missense_Mutation_p.K144Q			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	144					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GTCTGAAGCTTATTGTAGGAG	0.373																																						dbGAP											0													93.0	84.0	87.0					2																	77746565		1848	4085	5933	-	-	-	SO:0001583	missense	0			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.430A>C	2.37:g.77746565T>G	ENSP00000386357:p.Lys144Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K145Q	ENST00000409093.1	37	c.433	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	T	0.806	-0.753860	0.03041	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.04551	3.6;3.6;3.6;3.6;3.6	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.04452	0.0122	N	0.21373	0.66	0.58432	D	0.999996	B;B;B	0.29766	0.106;0.086;0.256	B;B;B	0.35931	0.214;0.136;0.214	T	0.18304	-1.0341	10	0.02654	T	1	.	14.7331	0.69397	0.0:0.0:0.0:1.0	.	145;144;144	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	Q	145;144;144;144;145	ENSP00000387228:K145Q;ENSP00000387297:K144Q;ENSP00000386357:K144Q;ENSP00000386236:K144Q;ENSP00000386286:K145Q	ENSP00000386236:K144Q	K	-	1	0	LRRTM4	77600073	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.186000	0.72026	2.159000	0.67721	0.533000	0.62120	AAG	LRRTM4	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000176204		0.373	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	HGNC	protein_coding	OTTHUMT00000328225.1	63	0.00	0	T	NM_024993		77746565	77746565	-1	no_errors	ENST00000409911	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	1.000	G
LRRTM1	347730	genome.wustl.edu	37	2	80530244	80530244	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:80530244G>C	ENST00000295057.3	-	2	1357	c.701C>G	c.(700-702)tCc>tGc	p.S234C	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.S234C|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000466387.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	234					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CGAGTGCAGGGAGATGAGGCG	0.592										HNSCC(69;0.2)																												dbGAP											0													102.0	99.0	100.0					2																	80530244		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.701C>G	2.37:g.80530244G>C	ENSP00000295057:p.Ser234Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S234C	ENST00000295057.3	37	c.701	CCDS1966.1	2	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115803	0.56505	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	D;D	0.81821	-1.54;-1.54	5.26	5.26	0.73747	.	0.070455	0.64402	U	0.000018	D	0.86112	0.5855	L	0.55481	1.735	0.80722	D	1	D	0.71674	0.998	P	0.60345	0.873	D	0.85241	0.1038	9	.	.	.	.	18.8459	0.92205	0.0:0.0:1.0:0.0	.	234	Q86UE6	LRRT1_HUMAN	C	234	ENSP00000295057:S234C;ENSP00000386646:S234C	.	S	-	2	0	LRRTM1	80383755	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.872000	0.87187	2.416000	0.81992	0.655000	0.94253	TCC	LRRTM1	-	NULL	ENSG00000162951		0.592	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM1	HGNC	protein_coding	OTTHUMT00000313614.1	110	0.00	0	G	NM_178839		80530244	80530244	-1	no_errors	ENST00000295057	ensembl	human	known	69_37n	missense	139	21.35	38	SNP	1.000	C
LTBP4	8425	genome.wustl.edu	37	19	41115529	41115529	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr19:41115529C>G	ENST00000308370.7	+	13	1721	c.1721C>G	c.(1720-1722)tCt>tGt	p.S574C	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000204005.9_Missense_Mutation_p.S537C|RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000396819.3_Missense_Mutation_p.S507C|LTBP4_ENST00000545697.1_Missense_Mutation_p.S27C	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	574	Cys-rich.|EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTTGCGACTCTGGCTTCCGG	0.697																																						dbGAP											0													23.0	29.0	27.0					19																	41115529		2127	4239	6366	-	-	-	SO:0001583	missense	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1721C>G	19.37:g.41115529C>G	ENSP00000311905:p.Ser574Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.S574C	ENST00000308370.7	37	c.1721		19	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521472	0.64747	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	4.7	4.7	0.59300	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.481786	0.15463	U	0.261044	D	0.90793	0.7109	M	0.78637	2.42	0.58432	D	0.999991	D;P;P	0.58620	0.983;0.953;0.953	P;B;B	0.49637	0.617;0.41;0.41	D	0.90880	0.4753	10	0.59425	D	0.04	.	11.1165	0.48264	0.0:0.8124:0.1876:0.0	.	507;574;537	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	C	537;27;574;507	ENSP00000204005:S537C;ENSP00000441054:S27C;ENSP00000311905:S574C;ENSP00000380031:S507C	ENSP00000204005:S537C	S	+	2	0	LTBP4	45807369	0.001000	0.12720	0.196000	0.23383	0.920000	0.55202	0.956000	0.29202	2.147000	0.66899	0.484000	0.47621	TCT	LTBP4	-	smart_EGF-like,smart_EGF-like_Ca-bd	ENSG00000090006		0.697	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		70	0.00	0	C	NM_003573		41115529	41115529	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	missense	82	27.43	31	SNP	0.438	G
LTF	4057	genome.wustl.edu	37	3	46497446	46497446	+	Silent	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:46497446G>A	ENST00000231751.4	-	4	634	c.339C>T	c.(337-339)gcC>gcT	p.A113A	LTF_ENST00000417439.1_Silent_p.A113A|LTF_ENST00000426532.2_Silent_p.A69A	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	113	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		CCACAGCCACGGCATAATAGT	0.532																																						dbGAP											0													47.0	45.0	46.0					3																	46497446		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.339C>T	3.37:g.46497446G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Silent	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.A113	ENST00000231751.4	37	c.339	CCDS33747.1	3																																																																																			LTF	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	ENSG00000012223		0.532	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LTF	HGNC	protein_coding	OTTHUMT00000343951.2	56	0.00	0	G	NM_002343		46497446	46497446	-1	no_errors	ENST00000231751	ensembl	human	known	69_37n	silent	61	10.14	7	SNP	0.602	A
MOSPD2	158747	genome.wustl.edu	37	X	14934369	14934369	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chrX:14934369G>C	ENST00000380492.3	+	13	1325	c.1237G>C	c.(1237-1239)Gaa>Caa	p.E413Q	MOSPD2_ENST00000482354.1_Missense_Mutation_p.E413Q|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	413	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					TGCAGAAATGGAACAGTCATC	0.433																																						dbGAP											0													160.0	153.0	155.0					X																	14934369		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.1237G>C	X.37:g.14934369G>C	ENSP00000369860:p.Glu413Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3H2|Q8NA83	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_Major_sperm,superfamily_CRAL-TRIO_dom,superfamily_PapD-like,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_Major_sperm	p.E413Q	ENST00000380492.3	37	c.1237	CCDS14162.1	X	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625327	0.87560	.	.	ENSG00000130150	ENST00000380492	T	0.64260	-0.09	5.91	5.91	0.95273	PapD-like (2);	0.110125	0.64402	D	0.000008	T	0.72334	0.3447	L	0.58428	1.81	0.80722	D	1	D	0.53745	0.962	P	0.54965	0.765	T	0.70414	-0.4878	10	0.39692	T	0.17	.	18.8391	0.92174	0.0:0.0:1.0:0.0	.	413	Q8NHP6	MSPD2_HUMAN	Q	413	ENSP00000369860:E413Q	ENSP00000369860:E413Q	E	+	1	0	MOSPD2	14844290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.064000	0.93933	2.495000	0.84180	0.600000	0.82982	GAA	MOSPD2	-	pfam_Major_sperm,superfamily_PapD-like,pfscan_Major_sperm	ENSG00000130150		0.433	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	HGNC	protein_coding	OTTHUMT00000055837.1	40	0.00	0	G	NM_152581		14934369	14934369	+1	no_errors	ENST00000380492	ensembl	human	known	69_37n	missense	28	33.33	14	SNP	1.000	C
MYT1L	23040	genome.wustl.edu	37	2	1820060	1820060	+	Intron	SNP	T	T	C	rs4645032	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:1820060T>C	ENST00000399161.2	-	22	3828				MYT1L_ENST00000428368.2_Intron|MYT1L_ENST00000407844.1_Intron|MYT1L_ENST00000471668.1_5'UTR	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TGAGCTACGCTGTATGGATTA	0.493													T|||	3039	0.606829	0.6641	0.6888	5008	,	,		15780	0.4236		0.5547	False		,,,				2504	0.7137					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3081-7121A>G	2.37:g.1820060T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	RNA	SNP	-	NULL	ENST00000399161.2	37	NULL		2																																																																																			MYT1L	-	-	ENSG00000186487		0.493	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	47	0.00	0	T	NM_015025		1820060	1820060	-1	no_errors	ENST00000471668	ensembl	human	known	69_37n	rna	77	10.47	9	SNP	0.001	C
NCOA5	57727	genome.wustl.edu	37	20	44695747	44695747	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr20:44695747A>C	ENST00000290231.6	-	5	740	c.576T>G	c.(574-576)ttT>ttG	p.F192L		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				TTTCGGCATCAAAGCGTCTCT	0.443																																						dbGAP											0													112.0	105.0	107.0					20																	44695747		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.576T>G	20.37:g.44695747A>C	ENSP00000290231:p.Phe192Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	superfamily_Anticodon-bd	p.F192L	ENST00000290231.6	37	c.576	CCDS13392.1	20	.	.	.	.	.	.	.	.	.	.	A	16.37	3.105381	0.56291	.	.	ENSG00000124160	ENST00000290231;ENST00000372291	T	0.41758	0.99	5.4	3.12	0.35913	.	0.157735	0.64402	D	0.000017	T	0.28034	0.0691	L	0.29908	0.895	0.38569	D	0.949895	B;B	0.33807	0.426;0.102	B;B	0.35278	0.199;0.036	T	0.08411	-1.0723	10	0.17832	T	0.49	0.542	9.4085	0.38477	0.8526:0.0:0.1474:0.0	.	192;87	Q9HCD5;Q5JY17	NCOA5_HUMAN;.	L	192;87	ENSP00000290231:F192L	ENSP00000290231:F192L	F	-	3	2	NCOA5	44129154	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	2.174000	0.42482	1.067000	0.40740	-0.256000	0.11100	TTT	NCOA5	-	NULL	ENSG00000124160		0.443	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA5	HGNC	protein_coding	OTTHUMT00000079559.1	47	0.00	0	A	NM_020967		44695747	44695747	-1	no_errors	ENST00000290231	ensembl	human	known	69_37n	missense	115	20.14	29	SNP	1.000	C
OR8H1	219469	genome.wustl.edu	37	11	56058069	56058069	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:56058069delA	ENST00000313022.2	-	1	497	c.470delT	c.(469-471)gtcfs	p.V157fs		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					AACCACATTGACAAAGGAGTT	0.458																																						dbGAP											0													84.0	79.0	80.0					11																	56058069		2201	4296	6497	-	-	-	SO:0001589	frameshift_variant	0			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.470delT	11.37:g.56058069delA	ENSP00000323595:p.Val157fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNI7|Q6IFC5	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V157fs	ENST00000313022.2	37	c.470	CCDS31526.1	11																																																																																			OR8H1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181693		0.458	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	HGNC	protein_coding	OTTHUMT00000370019.1	87	0.00	0	A	NM_001005199		56058069	56058069	-1	no_errors	ENST00000313022	ensembl	human	known	69_37n	frame_shift_del	58	25.00	20	DEL	0.001	-
PARP1	142	genome.wustl.edu	37	1	226562032	226562032	+	Silent	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:226562032C>T	ENST00000366794.5	-	14	2108	c.1965G>A	c.(1963-1965)ctG>ctA	p.L655L		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	655					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GATTTACTGTCAGCTTCTTCA	0.473								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														dbGAP											0													145.0	125.0	131.0					1																	226562032		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1965G>A	1.37:g.226562032C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANJ4|Q8IUZ9	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_Znf_PARP,pfam_PADR1,pfam_WGR_domain,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_WGR_domain,pirsf_NAD_ADPRT,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.L655	ENST00000366794.5	37	c.1965	CCDS1554.1	1																																																																																			PARP1	-	pirsf_NAD_ADPRT	ENSG00000143799		0.473	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	76	0.00	0	C	NM_001618		226562032	226562032	-1	no_errors	ENST00000366794	ensembl	human	known	69_37n	silent	108	20.00	27	SNP	1.000	T
PCDHA11	56138	genome.wustl.edu	37	5	140250555	140250555	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr5:140250555G>A	ENST00000398640.2	+	1	1867	c.1867G>A	c.(1867-1869)Gtg>Atg	p.V623M	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	623	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGTTCCGCGTGGGGCTGTA	0.652																																						dbGAP											0													47.0	56.0	53.0					5																	140250555		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1867G>A	5.37:g.140250555G>A	ENSP00000381636:p.Val623Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN58|O75279	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V623M	ENST00000398640.2	37	c.1867	CCDS47284.1	5	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291501	0.40494	.	.	ENSG00000249158	ENST00000398640	T	0.59502	0.26	4.78	2.95	0.34219	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.71134	0.3304	M	0.77103	2.36	0.24245	N	0.995345	D;D	0.89917	1.0;0.996	D;D	0.71414	0.973;0.921	T	0.58387	-0.7645	9	0.87932	D	0	.	5.8244	0.18546	0.315:0.0:0.685:0.0	.	623;623	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	M	623	ENSP00000381636:V623M	ENSP00000381636:V623M	V	+	1	0	PCDHA11	140230739	0.836000	0.29430	1.000000	0.80357	0.545000	0.35147	1.445000	0.35079	2.213000	0.71641	0.556000	0.70494	GTG	PCDHA11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000249158		0.652	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA11	HGNC	protein_coding	OTTHUMT00000372885.2	143	0.00	0	G	NM_018902		140250555	140250555	+1	no_errors	ENST00000398640	ensembl	human	known	69_37n	missense	120	35.83	67	SNP	1.000	A
PCDHB6	56130	genome.wustl.edu	37	5	140531179	140531179	+	Silent	SNP	C	C	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr5:140531179C>A	ENST00000231136.1	+	1	1341	c.1341C>A	c.(1339-1341)ccC>ccA	p.P447P	PCDHB6_ENST00000543635.1_Silent_p.P311P	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	447	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAACGTCCCCGCCTTCACCC	0.567																																						dbGAP											0													102.0	107.0	105.0					5																	140531179		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1341C>A	5.37:g.140531179C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8R9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P447	ENST00000231136.1	37	c.1341	CCDS4248.1	5																																																																																			PCDHB6	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000113211		0.567	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	122	0.00	0	C	NM_018939		140531179	140531179	+1	no_errors	ENST00000231136	ensembl	human	known	69_37n	silent	113	31.10	51	SNP	0.000	A
PDE1C	5137	genome.wustl.edu	37	7	31917594	31917594	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr7:31917594C>A	ENST00000396191.1	-	5	936	c.481G>T	c.(481-483)Gag>Tag	p.E161*	PDE1C_ENST00000321453.7_Nonsense_Mutation_p.E161*|PDE1C_ENST00000396182.2_Nonsense_Mutation_p.E161*|PDE1C_ENST00000396193.1_Nonsense_Mutation_p.E221*|PDE1C_ENST00000396184.3_Nonsense_Mutation_p.E161*	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	161					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TTTAATGCCTCAATAACAGCT	0.328																																						dbGAP											0													123.0	116.0	118.0					7																	31917594		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.481G>T	7.37:g.31917594C>A	ENSP00000379494:p.Glu161*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPC6|E9PE92|Q14124|Q8NB10	Nonsense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.E161*	ENST00000396191.1	37	c.481	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	C	39	7.632716	0.98403	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	.	.	.	5.36	5.36	0.76844	.	0.207947	0.48767	D	0.000174	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	19.0315	0.92959	0.0:1.0:0.0:0.0	.	.	.	.	X	221;161;161;161;161	.	ENSP00000318105:E161X	E	-	1	0	PDE1C	31884119	0.991000	0.36638	1.000000	0.80357	0.990000	0.78478	2.130000	0.42064	2.669000	0.90835	0.585000	0.79938	GAG	PDE1C	-	NULL	ENSG00000154678		0.328	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	47	0.00	0	C			31917594	31917594	-1	no_errors	ENST00000321453	ensembl	human	known	69_37n	nonsense	80	18.18	18	SNP	1.000	A
PDILT	204474	genome.wustl.edu	37	16	20387447	20387447	+	Silent	SNP	G	G	A	rs530716772		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr16:20387447G>A	ENST00000302451.4	-	4	734	c.486C>T	c.(484-486)agC>agT	p.S162S		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	162					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						CCACCTGCTCGCTGCTGTTGA	0.488																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.486C>T	16.37:g.20387447G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVQ5	Silent	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.S162	ENST00000302451.4	37	c.486	CCDS10584.1	16																																																																																			PDILT	-	superfamily_Thioredoxin-like_fold	ENSG00000169340		0.488	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	HGNC	protein_coding	OTTHUMT00000254332.1	91	0.00	0	G	NM_174924		20387447	20387447	-1	no_errors	ENST00000302451	ensembl	human	known	69_37n	silent	161	17.77	35	SNP	0.000	A
PHLDB1	23187	genome.wustl.edu	37	11	118509627	118509627	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:118509627G>C	ENST00000361417.2	+	12	2965	c.2554G>C	c.(2554-2556)Gac>Cac	p.D852H	PHLDB1_ENST00000527898.1_5'UTR|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000524713.1_5'Flank|AP002954.3_ENST00000530198.1_RNA|PHLDB1_ENST00000356063.5_Missense_Mutation_p.D852H	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	852										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GGCCATCCTGGACAGTCAGGC	0.622																																						dbGAP											0													28.0	26.0	26.0					11																	118509627		2200	4295	6495	-	-	-	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2554G>C	11.37:g.118509627G>C	ENSP00000354498:p.Asp852His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D852H	ENST00000361417.2	37	c.2554	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934254	0.73442	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063	T;T	0.42131	0.98;0.98	4.22	4.22	0.49857	.	0.171164	0.49916	D	0.000132	T	0.47600	0.1454	L	0.29908	0.895	0.80722	D	1	P;P;P;P	0.44195	0.736;0.828;0.755;0.694	B;P;B;B	0.53988	0.332;0.739;0.247;0.347	T	0.53479	-0.8433	10	0.72032	D	0.01	-26.0245	16.7699	0.85534	0.0:0.0:1.0:0.0	.	596;852;852;852	Q5W9G0;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	H	852;611;216;852	ENSP00000354498:D852H;ENSP00000348359:D852H	ENSP00000348359:D852H	D	+	1	0	PHLDB1	118014837	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	5.704000	0.68347	2.171000	0.68590	0.563000	0.77884	GAC	PHLDB1	-	NULL	ENSG00000019144		0.622	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	72	0.00	0	G	NM_015157		118509627	118509627	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	missense	89	34.56	47	SNP	1.000	C
PHLDB1	23187	genome.wustl.edu	37	11	118509911	118509911	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:118509911G>C	ENST00000361417.2	+	13	3089	c.2678G>C	c.(2677-2679)aGa>aCa	p.R893T	PHLDB1_ENST00000527898.1_5'UTR|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000524713.1_5'Flank|AP002954.3_ENST00000530198.1_RNA|PHLDB1_ENST00000356063.5_Missense_Mutation_p.R893T	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	893								p.R893K(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CTGGAAAGGAGATACCACTCA	0.582																																						dbGAP											1	Substitution - Missense(1)	lung(1)											98.0	86.0	90.0					11																	118509911		2200	4295	6495	-	-	-	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2678G>C	11.37:g.118509911G>C	ENSP00000354498:p.Arg893Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R893T	ENST00000361417.2	37	c.2678	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313316	0.60414	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063	T;T	0.43294	0.95;0.95	4.53	2.64	0.31445	.	0.403857	0.25383	N	0.031080	T	0.52996	0.1769	L	0.61218	1.895	0.80722	D	1	P;D;D;P	0.58620	0.788;0.983;0.96;0.859	B;P;P;B	0.61800	0.304;0.894;0.672;0.366	T	0.49624	-0.8920	10	0.59425	D	0.04	-0.7574	7.5756	0.27933	0.2677:0.0:0.7323:0.0	.	637;893;893;893	Q5W9G0;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	T	893;652;257;893	ENSP00000354498:R893T;ENSP00000348359:R893T	ENSP00000348359:R893T	R	+	2	0	PHLDB1	118015121	1.000000	0.71417	0.970000	0.41538	0.763000	0.43281	7.523000	0.81856	0.367000	0.24454	0.558000	0.71614	AGA	PHLDB1	-	NULL	ENSG00000019144		0.582	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	41	0.00	0	G	NM_015157		118509911	118509911	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	0.994	C
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	52	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	19	70.77	46	SNP	1.000	A
PRKACG	5568	genome.wustl.edu	37	9	71628481	71628481	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr9:71628481G>C	ENST00000377276.2	-	1	558	c.528C>G	c.(526-528)gaC>gaG	p.D176E		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AGCCCTGCTGGTCGATGAGGA	0.632																																					Esophageal Squamous(110;2236 2623 32146)	dbGAP											0													41.0	39.0	40.0					9																	71628481		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.528C>G	9.37:g.71628481G>C	ENSP00000366488:p.Asp176Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60850|Q5VZ02|Q86YI1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D176E	ENST00000377276.2	37	c.528	CCDS6625.1	9	.	.	.	.	.	.	.	.	.	.	G	16.10	3.028443	0.54790	.	.	ENSG00000165059	ENST00000377276	T	0.10960	2.82	1.6	0.636	0.17729	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.32444	U	0.006098	T	0.23532	0.0569	M	0.77616	2.38	0.25920	N	0.983126	P	0.48998	0.918	P	0.59948	0.866	T	0.01648	-1.1304	10	0.87932	D	0	.	5.605	0.17374	0.2124:0.0:0.7876:0.0	.	176	P22612	KAPCG_HUMAN	E	176	ENSP00000366488:D176E	ENSP00000366488:D176E	D	-	3	2	PRKACG	70818301	0.995000	0.38212	0.012000	0.15200	0.032000	0.12392	0.288000	0.18939	0.867000	0.35654	0.467000	0.42956	GAC	PRKACG	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000165059		0.632	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACG	HGNC	protein_coding	OTTHUMT00000052559.1	50	0.00	0	G			71628481	71628481	-1	no_errors	ENST00000377276	ensembl	human	known	69_37n	missense	44	42.11	32	SNP	1.000	C
PRKCA	5578	genome.wustl.edu	37	17	64731690	64731690	+	Silent	SNP	C	C	T	rs541892161		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr17:64731690C>T	ENST00000413366.3	+	10	1166	c.1140C>T	c.(1138-1140)gaC>gaT	p.D380D		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	380	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	AGGATGATGACGTGGAGTGCA	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		21641	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													238.0	193.0	208.0					17																	64731690		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1140C>T	17.37:g.64731690C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5BU22|Q15137|Q32M72|Q96RE4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.D380	ENST00000413366.3	37	c.1140	CCDS11664.1	17																																																																																			PRKCA	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000154229		0.517	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	HGNC	protein_coding	OTTHUMT00000446976.1	105	0.00	0	C			64731690	64731690	+1	no_errors	ENST00000413366	ensembl	human	known	69_37n	silent	114	22.97	34	SNP	0.655	T
PWWP2A	114825	genome.wustl.edu	37	5	159520690	159520690	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr5:159520690C>G	ENST00000307063.7	-	2	1001	c.967G>C	c.(967-969)Gat>Cat	p.D323H	PWWP2A_ENST00000456329.3_Missense_Mutation_p.D323H|PWWP2A_ENST00000523662.1_Missense_Mutation_p.D323H	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	323										kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTACATTTATCACACAGAACT	0.358																																						dbGAP											0													123.0	110.0	114.0					5																	159520690		1829	4095	5924	-	-	-	SO:0001583	missense	0				CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.967G>C	5.37:g.159520690C>G	ENSP00000305151:p.Asp323His	Somatic		WXS	Illumina GAIIx	Phase_IV	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	pfam_PWWP,smart_PWWP,pfscan_PWWP	p.D323H	ENST00000307063.7	37	c.967	CCDS47332.1	5	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884118	0.51908	.	.	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	T;T;T	0.40756	1.02;1.02;1.02	5.27	4.39	0.52855	.	0.098794	0.64402	D	0.000002	T	0.55657	0.1934	L	0.43152	1.355	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76575	0.936;0.988;0.988	T	0.59177	-0.7503	10	0.87932	D	0	-14.8781	13.5719	0.61851	0.0:0.9238:0.0:0.0762	.	323;323;323	Q96N64;G5EA07;Q96N64-2	PWP2A_HUMAN;.;.	H	323	ENSP00000390462:D323H;ENSP00000428143:D323H;ENSP00000305151:D323H	ENSP00000305151:D323H	D	-	1	0	PWWP2A	159453268	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.715000	0.84713	1.352000	0.45808	0.563000	0.77884	GAT	PWWP2A	-	NULL	ENSG00000170234		0.358	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PWWP2A	HGNC	protein_coding	OTTHUMT00000374092.1	70	0.00	0	C			159520690	159520690	-1	no_errors	ENST00000307063	ensembl	human	known	69_37n	missense	86	11.34	11	SNP	1.000	G
RHD	6007	genome.wustl.edu	37	1	25634205	25634205	+	Intron	SNP	G	G	A	rs2257611	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:25634205G>A	ENST00000328664.4	+	7	1228				RHD_ENST00000417538.2_Intron|RHD_ENST00000342055.5_Missense_Mutation_p.V381M|RHD_ENST00000423253.1_Intron|RHD_ENST00000568195.1_Intron|RHD_ENST00000423810.2_Missense_Mutation_p.V381M|RHD_ENST00000454452.2_Intron|RHD_ENST00000357542.4_Intron	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen							integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCGTTTGGACGTGTCTCAGAG	0.483													G|||	925	0.184704	0.1558	0.2579	5008	,	,		14367	0.1984		0.2276	False		,,,				2504	0.1135					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.1073+985G>A	1.37:g.25634205G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like,prints_RhesusRHD	p.V381M	ENST00000328664.4	37	c.1141	CCDS262.1	1	442	0.20238095238095238	73	0.1483739837398374	72	0.19889502762430938	123	0.21503496503496503	174	0.22955145118733508	G	11.02	1.516433	0.27123	.	.	ENSG00000187010	ENST00000342055;ENST00000423810	T;T	0.23754	1.89;1.98	0.987	0.987	0.19790	.	0.775048	0.11899	N	0.518767	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	D;D	0.64830	0.994;0.988	B;B	0.38616	0.277;0.171	T	0.38200	-0.9672	8	0.35671	T	0.21	-0.9461	5.3579	0.16071	0.0:0.0:1.0:0.0	rs2257611;rs2257611	381;381	Q5XLS9;E7EVW1	.;.	M	381	ENSP00000339577:V381M;ENSP00000399640:V381M	ENSP00000339577:V381M	V	+	1	0	RHD	25506792	0.006000	0.16342	0.008000	0.14137	0.075000	0.17131	1.016000	0.29976	0.829000	0.34733	0.184000	0.17185	GTG	RHD	-	NULL	ENSG00000187010		0.483	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHD	HGNC	protein_coding	OTTHUMT00000009660.5	79	0.00	0	G	NM_016124		25634205	25634205	+1	no_errors	ENST00000342055	ensembl	human	putative	69_37n	missense	19	17.39	4	SNP	0.009	A
RP1L1	94137	genome.wustl.edu	37	8	10480628	10480628	+	Silent	SNP	G	G	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr8:10480628G>T	ENST00000382483.3	-	2	307	c.84C>A	c.(82-84)acC>acA	p.T28T	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	28					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCGTGACCTTGGTGACCGAGG	0.647																																						dbGAP											0													36.0	40.0	39.0					8																	10480628		2031	4175	6206	-	-	-	SO:0001819	synonymous_variant	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.84C>A	8.37:g.10480628G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.T28	ENST00000382483.3	37	c.84	CCDS43708.1	8																																																																																			RP1L1	-	superfamily_Doublecortin_dom	ENSG00000183638		0.647	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	24	0.00	0	G			10480628	10480628	-1	no_errors	ENST00000382483	ensembl	human	known	69_37n	silent	29	34.09	15	SNP	0.998	T
SDHAP1	255812	genome.wustl.edu	37	3	195712586	195712586	+	RNA	SNP	C	C	T	rs112366622	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:195712586C>T	ENST00000427841.1	-	0	250					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		AAATGCAGCTCGCAAAGCCGG	0.493													N|||	476	0.0950479	0.0061	0.0922	5008	,	,		20516	0.0238		0.1412	False		,,,				2504	0.2434				Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195712586C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.493	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	99	1.00	1	C			195712586	195712586	-1	no_errors	ENST00000413474	ensembl	human	known	69_37n	rna	31	13.89	5	SNP	1.000	T
SEPP1	6414	genome.wustl.edu	37	5	42808293	42808293	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr5:42808293G>C	ENST00000514985.1	-	2	419	c.163C>G	c.(163-165)Ctt>Gtt	p.L55V	CTD-2325A15.5_ENST00000606056.1_RNA|SEPP1_ENST00000506577.1_Missense_Mutation_p.L55V|SEPP1_ENST00000511224.1_Missense_Mutation_p.L55V|SEPP1_ENST00000509276.1_5'UTR|SEPP1_ENST00000507920.1_Missense_Mutation_p.L55V	NM_005410.2	NP_005401.3	P49908	SEPP1_HUMAN	selenoprotein P, plasma, 1	55					brain development (GO:0007420)|growth (GO:0040007)|locomotory behavior (GO:0007626)|post-embryonic development (GO:0009791)|response to oxidative stress (GO:0006979)|selenium compound metabolic process (GO:0001887)|sexual reproduction (GO:0019953)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	selenium binding (GO:0008430)			kidney(10)|large_intestine(1)|lung(4)	15						CTGGCTTGAAGAAGAGCAACC	0.453																																						dbGAP											0													87.0	88.0	87.0					5																	42808293		1929	4141	6070	-	-	-	SO:0001583	missense	0			BC040075	CCDS43311.1	5q31	2012-03-01				ENSG00000250722			10751	protein-coding gene	gene with protein product		601484				8421687	Standard	NM_001085486		Approved	SeP	uc011cpu.2	P49908		ENST00000514985.1:c.163C>G	5.37:g.42808293G>C	ENSP00000420939:p.Leu55Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PD59|Q6PI43|Q6PI87|Q6PJF9	Missense_Mutation	SNP	pfam_Selenoprotein-P_N,pfam_SelP_C	p.L55V	ENST00000514985.1	37	c.163	CCDS43311.1	5	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288260	0.80803	.	.	ENSG00000250722	ENST00000514985;ENST00000511224;ENST00000506577;ENST00000514218;ENST00000510965	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.38	5.38	0.77491	.	0.000000	0.43110	U	0.000614	T	0.68769	0.3037	M	0.77820	2.39	0.40516	D	0.980781	.	.	.	.	.	.	T	0.73509	-0.3960	8	0.72032	D	0.01	.	19.1336	0.93417	0.0:0.0:1.0:0.0	.	.	.	.	V	55	ENSP00000420939:L55V;ENSP00000427671:L55V;ENSP00000425915:L55V;ENSP00000421626:L55V;ENSP00000427414:L55V	ENSP00000425915:L55V	L	-	1	0	SEPP1	42844050	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.072000	0.64389	2.515000	0.84797	0.650000	0.86243	CTT	SEPP1	-	pfam_Selenoprotein-P_N	ENSG00000250722		0.453	SEPP1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	SEPP1	HGNC	protein_coding	OTTHUMT00000367483.1	81	0.00	0	G	NM_005410		42808293	42808293	-1	pseudogene	ENST00000506577	ensembl	human	known	69_37n	missense	125	12.59	18	SNP	1.000	C
SHANK2	22941	genome.wustl.edu	37	11	70709531	70709531	+	Intron	SNP	C	C	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:70709531C>A	ENST00000338508.4	-	17	1177				SHANK2-AS3_ENST00000307548.2_RNA			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CTGCTCGGTGCCCTGGGACGC	0.622																																						dbGAP											0													46.0	51.0	49.0					11																	70709531		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000338508.4:c.1177+33074G>T	11.37:g.70709531C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	RNA	SNP	-	NULL	ENST00000338508.4	37	NULL		11																																																																																			SHANK2-AS3	-	-	ENSG00000171671		0.622	SHANK2-201	KNOWN	basic|appris_principal	protein_coding	SHANK2-AS3	HGNC	protein_coding		54	0.00	0	C	NM_012309		70709531	70709531	+1	no_errors	ENST00000307548	ensembl	human	known	69_37n	rna	61	32.97	30	SNP	0.001	A
SLC24A4	123041	genome.wustl.edu	37	14	92790284	92790284	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr14:92790284C>G	ENST00000532405.1	+	1	336	c.110C>G	c.(109-111)tCc>tGc	p.S37C	SLC24A4_ENST00000531433.1_Missense_Mutation_p.S37C|SLC24A4_ENST00000298877.1_Missense_Mutation_p.S20C|SLC24A4_ENST00000351924.5_Missense_Mutation_p.S20C|SLC24A4_ENST00000393265.2_Intron			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	37					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		TGCTGTGCGTCCGGCCTCTTC	0.682																																					NSCLC(10;315 435 10383 28450 38798)	dbGAP											0													50.0	50.0	50.0					14																	92790284		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.110C>G	14.37:g.92790284C>G	ENSP00000431840:p.Ser37Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.S37C	ENST00000532405.1	37	c.110	CCDS9903.2	14	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737720	0.69304	.	.	ENSG00000140090	ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924	T;T;T;T	0.69806	0.02;0.01;-0.43;-0.42	4.61	4.61	0.57282	.	0.068553	0.64402	D	0.000012	T	0.62527	0.2435	L	0.29908	0.895	0.38520	D	0.948705	P;D	0.55172	0.921;0.97	P;P	0.50378	0.639;0.592	T	0.64622	-0.6364	10	0.33141	T	0.24	.	14.379	0.66900	0.0:1.0:0.0:0.0	.	37;37	Q8NFF2-3;Q8NFF2	.;NCKX4_HUMAN	C	37;37;20;20	ENSP00000433302:S37C;ENSP00000431840:S37C;ENSP00000298877:S20C;ENSP00000337789:S20C	ENSP00000298877:S20C	S	+	2	0	SLC24A4	91860037	0.753000	0.28349	0.996000	0.52242	0.981000	0.71138	2.317000	0.43770	2.120000	0.65058	0.462000	0.41574	TCC	SLC24A4	-	NULL	ENSG00000140090		0.682	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	HGNC	protein_coding	OTTHUMT00000395240.1	166	0.00	0	C	NM_153646		92790284	92790284	+1	no_errors	ENST00000532405	ensembl	human	known	69_37n	missense	177	26.14	63	SNP	0.995	G
SPHKAP	80309	genome.wustl.edu	37	2	228882097	228882097	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:228882097C>T	ENST00000392056.3	-	7	3519	c.3473G>A	c.(3472-3474)aGc>aAc	p.S1158N	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S1158N	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1158						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GTTCAGAATGCTGCTGGCGTT	0.507																																						dbGAP											0													74.0	65.0	68.0					2																	228882097		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3473G>A	2.37:g.228882097C>T	ENSP00000375909:p.Ser1158Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.S1158N	ENST00000392056.3	37	c.3473	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	10.95	1.496969	0.26861	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.41758	0.99;0.99	5.57	4.64	0.57946	.	0.111722	0.85682	D	0.000000	T	0.19005	0.0456	N	0.11560	0.145	0.40369	D	0.979324	B;P;P	0.38535	0.058;0.635;0.566	B;B;B	0.31946	0.022;0.081;0.138	T	0.03945	-1.0990	10	0.28530	T	0.3	.	7.9975	0.30277	0.0:0.717:0.1398:0.1432	.	189;1158;1158	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	N	1158	ENSP00000375909:S1158N;ENSP00000339886:S1158N	ENSP00000339886:S1158N	S	-	2	0	SPHKAP	228590341	0.994000	0.37717	1.000000	0.80357	0.855000	0.48748	0.320000	0.19540	2.785000	0.95823	0.655000	0.94253	AGC	SPHKAP	-	NULL	ENSG00000153820		0.507	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	16	0.00	0	C	NM_030623		228882097	228882097	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	1.000	T
SPHKAP	80309	genome.wustl.edu	37	2	228883414	228883414	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:228883414A>G	ENST00000392056.3	-	7	2202	c.2156T>C	c.(2155-2157)tTc>tCc	p.F719S	SPHKAP_ENST00000344657.5_Missense_Mutation_p.F719S	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	719				F -> S (in Ref. 1; CAH18152). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTTGAACGTGAAGCATATCAC	0.418																																						dbGAP											0													197.0	177.0	184.0					2																	228883414		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2156T>C	2.37:g.228883414A>G	ENSP00000375909:p.Phe719Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.F719S	ENST00000392056.3	37	c.2156	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399587	0.42512	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.16196	2.37;2.36	5.81	2.0	0.26442	.	0.430817	0.29631	N	0.011608	T	0.12390	0.0301	L	0.39898	1.24	0.44694	D	0.997681	B;P	0.36974	0.221;0.576	B;B	0.33620	0.017;0.167	T	0.06881	-1.0802	10	0.52906	T	0.07	.	8.1208	0.30969	0.6807:0.253:0.0663:0.0	.	719;719	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	S	719	ENSP00000375909:F719S;ENSP00000339886:F719S	ENSP00000339886:F719S	F	-	2	0	SPHKAP	228591658	1.000000	0.71417	0.911000	0.35937	0.980000	0.70556	3.179000	0.50887	0.157000	0.19338	0.533000	0.62120	TTC	SPHKAP	-	NULL	ENSG00000153820		0.418	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	53	0.00	0	A	NM_030623		228883414	228883414	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	0.999	G
NCL	4691	genome.wustl.edu	37	2	232320618	232320618	+	Intron	SNP	G	G	A			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:232320618G>A	ENST00000322723.4	-	12	2073				SNORA75_ENST00000384158.1_RNA|SNORD20_ENST00000384550.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin						angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		AACTGCCACTGATAGACAGAA	0.418																																						dbGAP											0													69.0	69.0	69.0					2																	232320618		876	1991	2867	-	-	-	SO:0001627	intron_variant	0				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.1832+102C>T	2.37:g.232320618G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	RNA	SNP	-	NULL	ENST00000322723.4	37	NULL	CCDS33397.1	2																																																																																			SNORA75	-	-	ENSG00000206885		0.418	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA75	HGNC	protein_coding	OTTHUMT00000332731.1	34	0.00	0	G	NM_005381		232320618	232320618	-1	no_errors	ENST00000384158	ensembl	human	known	69_37n	rna	50	30.56	22	SNP	0.000	A
SRP68	6730	genome.wustl.edu	37	17	74042252	74042252	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr17:74042252G>C	ENST00000307877.2	-	11	1327	c.1166C>G	c.(1165-1167)tCa>tGa	p.S389*	SRP68_ENST00000542536.2_5'UTR|SRP68_ENST00000602720.1_Nonsense_Mutation_p.S50*|SRP68_ENST00000539137.1_Nonsense_Mutation_p.S351*|SRP68_ENST00000355113.5_Nonsense_Mutation_p.S288*	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	389					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						GATTGCCGTTGATAGCTTGAT	0.547																																						dbGAP											0													158.0	147.0	151.0					17																	74042252		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.1166C>G	17.37:g.74042252G>C	ENSP00000312066:p.Ser389*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Nonsense_Mutation	SNP	NULL	p.S389*	ENST00000307877.2	37	c.1166	CCDS11738.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.493776	0.97612	.	.	ENSG00000167881	ENST00000411758;ENST00000539137;ENST00000542536;ENST00000307877;ENST00000304220;ENST00000355113	.	.	.	5.96	5.96	0.96718	.	0.099352	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-11.4196	19.4101	0.94667	0.0:0.0:1.0:0.0	.	.	.	.	X	129;351;50;389;358;288	.	ENSP00000307756:S358X	S	-	2	0	SRP68	71553847	1.000000	0.71417	0.970000	0.41538	0.991000	0.79684	6.730000	0.74780	2.832000	0.97577	0.655000	0.94253	TCA	SRP68	-	NULL	ENSG00000167881		0.547	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP68	HGNC	protein_coding	OTTHUMT00000449487.1	79	0.00	0	G	NM_014230		74042252	74042252	-1	no_errors	ENST00000307877	ensembl	human	known	69_37n	nonsense	55	27.63	21	SNP	0.998	C
STAG1	10274	genome.wustl.edu	37	3	136059362	136059362	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr3:136059362C>T	ENST00000383202.2	-	32	3899	c.3643G>A	c.(3643-3645)Gaa>Aaa	p.E1215K	STAG1_ENST00000434713.2_Missense_Mutation_p.E955K|STAG1_ENST00000236698.5_Missense_Mutation_p.E1178K|STAG1_ENST00000536929.1_Missense_Mutation_p.E799K	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1215					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TCCTCAAATTCTTCATTCATA	0.398																																						dbGAP											0													132.0	122.0	125.0					3																	136059362		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.3643G>A	3.37:g.136059362C>T	ENSP00000372689:p.Glu1215Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00539|Q6P275	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.E1215K	ENST00000383202.2	37	c.3643	CCDS3090.1	3	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851543	0.91355	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.33216	1.82;1.69;1.78;1.42	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.41305	0.1153	L	0.59436	1.845	0.80722	D	1	P;P	0.45428	0.858;0.858	P;P	0.46389	0.515;0.515	T	0.02743	-1.1116	10	0.26408	T	0.33	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	1178;1215	Q6P275;Q8WVM7	.;STAG1_HUMAN	K	1215;1178;955;799	ENSP00000372689:E1215K;ENSP00000236698:E1178K;ENSP00000404396:E955K;ENSP00000445787:E799K	ENSP00000236698:E1178K	E	-	1	0	STAG1	137542052	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.089000	0.71384	2.882000	0.98803	0.655000	0.94253	GAA	STAG1	-	NULL	ENSG00000118007		0.398	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	36	0.00	0	C	NM_005862		136059362	136059362	-1	no_errors	ENST00000383202	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	1.000	T
TEX36	387718	genome.wustl.edu	37	10	127344640	127344640	+	Silent	SNP	T	T	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr10:127344640T>C	ENST00000368821.3	-	4	544	c.390A>G	c.(388-390)gtA>gtG	p.V130V		NM_001128202.1	NP_001121674.1	Q5VZQ5	TEX36_HUMAN	testis expressed 36	130																	CTTCTTTATATACGTATGATA	0.378																																						dbGAP											0													167.0	145.0	151.0					10																	127344640		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44493.1	10q26.13	2012-08-13	2012-08-13	2012-08-13	ENSG00000175018	ENSG00000175018			31653	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 122"""	C10orf122			Standard	NM_001128202		Approved	bA383C5.1	uc001lik.4	Q5VZQ5	OTTHUMG00000019229	ENST00000368821.3:c.390A>G	10.37:g.127344640T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P5T8	Silent	SNP	NULL	p.V130	ENST00000368821.3	37	c.390	CCDS44493.1	10																																																																																			TEX36	-	NULL	ENSG00000175018		0.378	TEX36-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TEX36	HGNC	protein_coding	OTTHUMT00000050915.1	61	0.00	0	T	NM_001128202		127344640	127344640	-1	no_errors	ENST00000368821	ensembl	human	known	69_37n	silent	86	10.42	10	SNP	0.000	C
TPCN2	219931	genome.wustl.edu	37	11	68821648	68821648	+	Intron	SNP	G	G	C	rs12285715	byFrequency	TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr11:68821648G>C	ENST00000294309.3	+	2	275				TPCN2_ENST00000542467.1_Intron	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CGACTGACTGGGTCCAAGGCC	0.637													G|||	1295	0.258586	0.1241	0.1801	5008	,	,		15547	0.2093		0.3012	False		,,,				2504	0.5031					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.174+83G>C	11.37:g.68821648G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NT82	RNA	SNP	-	NULL	ENST00000294309.3	37	NULL	CCDS8189.1	11																																																																																			TPCN2	-	-	ENSG00000162341		0.637	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	HGNC	protein_coding	OTTHUMT00000396878.2	26	0.00	0	G	NM_139075		68821648	68821648	+1	no_errors	ENST00000534832	ensembl	human	putative	69_37n	rna	35	14.63	6	SNP	0.180	C
TRPM8	79054	genome.wustl.edu	37	2	234891789	234891789	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr2:234891789G>C	ENST00000324695.4	+	20	2722	c.2682G>C	c.(2680-2682)caG>caC	p.Q894H	TRPM8_ENST00000433712.2_Missense_Mutation_p.Q472H	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	894					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	AGAATGAGCAGCGCTGGAGGT	0.572																																						dbGAP											0													193.0	168.0	176.0					2																	234891789		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2682G>C	2.37:g.234891789G>C	ENSP00000323926:p.Gln894His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.Q894H	ENST00000324695.4	37	c.2682	CCDS33407.1	2	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983357	0.35036	.	.	ENSG00000144481	ENST00000324695;ENST00000433712;ENST00000456930	D;D;D	0.98362	-4.89;-4.89;-4.89	5.69	-7.55	0.01327	Ion transport (1);	0.518379	0.19051	N	0.124051	D	0.87493	0.6191	N	0.02391	-0.57	0.22378	N	0.999154	B;B	0.12013	0.005;0.0	B;B	0.20577	0.03;0.001	D	0.85394	0.1127	10	0.19590	T	0.45	-2.8894	1.6018	0.02675	0.2385:0.3555:0.2069:0.199	.	472;894	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	H	894;472;155	ENSP00000323926:Q894H;ENSP00000404423:Q472H;ENSP00000414198:Q155H	ENSP00000323926:Q894H	Q	+	3	2	TRPM8	234556528	0.001000	0.12720	0.856000	0.33681	0.980000	0.70556	-1.405000	0.02492	-1.029000	0.03317	-1.069000	0.02264	CAG	TRPM8	-	pfam_Ion_trans_dom	ENSG00000144481		0.572	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	HGNC	protein_coding	OTTHUMT00000131005.4	60	0.00	0	G	NM_024080		234891789	234891789	+1	no_errors	ENST00000324695	ensembl	human	known	69_37n	missense	100	25.37	34	SNP	0.356	C
TUBA3C	7278	genome.wustl.edu	37	13	19751148	19751148	+	Silent	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr13:19751148C>T	ENST00000400113.3	-	4	1079	c.975G>A	c.(973-975)ccG>ccA	p.P325P		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	325					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TGACATCTTTCGGGACCACAT	0.547																																						dbGAP											0													158.0	130.0	139.0					13																	19751148		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.975G>A	13.37:g.19751148C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.P325	ENST00000400113.3	37	c.975	CCDS9284.1	13																																																																																			TUBA3C	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Beta_tubulin	ENSG00000198033		0.547	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	158	0.00	0	C	NM_006001		19751148	19751148	-1	no_errors	ENST00000400113	ensembl	human	known	69_37n	silent	59	68.95	131	SNP	1.000	T
UBR1	197131	genome.wustl.edu	37	15	43360113	43360113	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr15:43360113T>C	ENST00000290650.4	-	6	859	c.781A>G	c.(781-783)Act>Gct	p.T261A	UBR1_ENST00000382177.2_Missense_Mutation_p.T261A	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	261					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TCAATGGCAGTGGTATGCAAC	0.463																																						dbGAP											0													112.0	101.0	105.0					15																	43360113		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.781A>G	15.37:g.43360113T>C	ENSP00000290650:p.Thr261Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.T261A	ENST00000290650.4	37	c.781	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	T	14.85	2.659912	0.47572	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.72051	0.2;-0.62	5.73	4.61	0.57282	Adaptor protein ClpS, core (1);Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (2);	0.167414	0.50627	D	0.000109	T	0.56093	0.1962	L	0.33245	0.995	0.35156	D	0.770186	B;B	0.28026	0.198;0.122	B;B	0.28011	0.085;0.064	T	0.59306	-0.7479	10	0.13108	T	0.6	-4.082	11.1494	0.48449	0.0:0.0717:0.0:0.9283	.	261;261	B4DYL2;Q8IWV7	.;UBR1_HUMAN	A	261	ENSP00000290650:T261A;ENSP00000371612:T261A	ENSP00000290650:T261A	T	-	1	0	UBR1	41147405	0.998000	0.40836	0.998000	0.56505	0.992000	0.81027	2.617000	0.46385	2.171000	0.68590	0.528000	0.53228	ACT	UBR1	-	pfam_ClpS_core,superfamily_Ribosomal_L7/12_C/ClpS-like	ENSG00000159459		0.463	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	39	0.00	0	T	NM_174916		43360113	43360113	-1	no_errors	ENST00000290650	ensembl	human	known	69_37n	missense	40	42.25	30	SNP	0.777	C
ZBTB7B	51043	genome.wustl.edu	37	1	154988894	154988894	+	Silent	SNP	C	C	A	rs372384734		TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr1:154988894C>A	ENST00000368426.3	+	4	1490	c.1353C>A	c.(1351-1353)ggC>ggA	p.G451G	ZBTB7B_ENST00000417934.2_Silent_p.G485G|ZBTB7B_ENST00000292176.2_Silent_p.G451G|ZBTB7B_ENST00000535420.1_Silent_p.G451G	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	451					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACCTCAAAGGCCAGAACTGCC	0.662																																						dbGAP											0													82.0	72.0	75.0					1																	154988894		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.1353C>A	1.37:g.154988894C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G485	ENST00000368426.3	37	c.1455	CCDS1081.1	1																																																																																			ZBTB7B	-	pfscan_Znf_C2H2	ENSG00000160685		0.662	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB7B	HGNC	protein_coding	OTTHUMT00000091083.1	59	0.00	0	C	NM_015872		154988894	154988894	+1	no_errors	ENST00000417934	ensembl	human	known	69_37n	silent	132	13.07	20	SNP	1.000	A
ZMYM3	9203	genome.wustl.edu	37	X	70467295	70467295	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chrX:70467295C>G	ENST00000353904.2	-	13	2401	c.2214G>C	c.(2212-2214)caG>caC	p.Q738H	ZMYM3_ENST00000373984.3_Missense_Mutation_p.Q740H|ZMYM3_ENST00000373988.1_Missense_Mutation_p.Q740H|ZMYM3_ENST00000373998.1_Missense_Mutation_p.Q738H|ZMYM3_ENST00000314425.5_Missense_Mutation_p.Q738H|ZMYM3_ENST00000489332.1_5'UTR	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	738					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					AATGACGGATCTGCCCACGCC	0.587																																						dbGAP											0													63.0	48.0	53.0					X																	70467295		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.2214G>C	X.37:g.70467295C>G	ENSP00000343909:p.Gln738His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.Q740H	ENST00000353904.2	37	c.2220	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	c	13.79	2.341722	0.41498	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	T;T;T;T;T	0.44482	1.5;0.92;1.5;1.5;1.5	5.16	1.22	0.21188	TRASH (1);Zinc finger, MYM-type (1);	0.176598	0.39615	N	0.001305	T	0.18841	0.0452	N	0.08118	0	0.35975	D	0.835619	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.05451	-1.0884	10	0.41790	T	0.15	-12.3027	5.4654	0.16639	0.0:0.4428:0.1365:0.4207	.	738;738	Q14202-2;Q14202	.;ZMYM3_HUMAN	H	738;738;738;740;740	ENSP00000322845:Q738H;ENSP00000363110:Q738H;ENSP00000343909:Q738H;ENSP00000363096:Q740H;ENSP00000363100:Q740H	ENSP00000322845:Q738H	Q	-	3	2	ZMYM3	70384020	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.362000	0.34148	0.200000	0.20447	-0.295000	0.09555	CAG	ZMYM3	-	pfam_Znf_MYM,smart_TRASH	ENSG00000147130		0.587	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	39	0.00	0	C	NM_201599		70467295	70467295	-1	no_errors	ENST00000373988	ensembl	human	known	69_37n	missense	74	10.84	9	SNP	1.000	G
ZNF536	9745	genome.wustl.edu	37	19	30935417	30935417	+	Silent	SNP	C	C	T			TCGA-A7-A4SF-01A-11D-A25Q-09	TCGA-A7-A4SF-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd6babb0-c2bb-4a12-b522-448f993e86f0	7b28f197-a6a1-4649-a37e-fd1b63fe3a57	g.chr19:30935417C>T	ENST00000355537.3	+	2	1095	c.948C>T	c.(946-948)atC>atT	p.I316I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	316					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGGAGCTCATCAGCCACGTGG	0.652																																						dbGAP											0													85.0	95.0	92.0					19																	30935417		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.948C>T	19.37:g.30935417C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I316	ENST00000355537.3	37	c.948	CCDS32984.1	19																																																																																			ZNF536	-	smart_Znf_C2H2-like	ENSG00000198597		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	59	0.00	0	C	NM_014717		30935417	30935417	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	silent	91	29.46	38	SNP	1.000	T
