#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48319379	48319379	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:48319379C>G	ENST00000435803.1	+	18	8612	c.8588C>G	c.(8587-8589)tCa>tGa	p.S2863*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2863					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AATGTCACATCAGAAAAAGAA	0.348																																						dbGAP											0													97.0	100.0	99.0					7																	48319379		1809	4074	5883	-	-	-	SO:0001587	stop_gained	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8588C>G	7.37:g.48319379C>G	ENSP00000411096:p.Ser2863*	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S2863*	ENST00000435803.1	37	c.8588	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	48	14.624520	0.99803	.	.	ENSG00000179869	ENST00000435803	.	.	.	5.16	1.22	0.21188	.	0.933889	0.08787	N	0.893805	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	8.0138	0.30368	0.0:0.6522:0.0:0.3478	.	.	.	.	X	2863	.	ENSP00000411096:S2863X	S	+	2	0	ABCA13	48289925	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.187000	0.09656	0.188000	0.20168	0.650000	0.86243	TCA	ABCA13	-	NULL	ENSG00000179869		0.348	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	32	0.00	0	C	NM_152701		48319379	48319379	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	nonsense	56	30.86	25	SNP	0.000	G
ABCA13	154664	genome.wustl.edu	37	7	48319379	48319379	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:48319379C>G	ENST00000435803.1	+	18	8612	c.8588C>G	c.(8587-8589)tCa>tGa	p.S2863*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2863					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AATGTCACATCAGAAAAAGAA	0.348																																						dbGAP											0													97.0	100.0	99.0					7																	48319379		1809	4074	5883	-	-	-	SO:0001587	stop_gained	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8588C>G	7.37:g.48319379C>G	ENSP00000411096:p.Ser2863*	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S2863*	ENST00000435803.1	37	c.8588	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	48	14.624520	0.99803	.	.	ENSG00000179869	ENST00000435803	.	.	.	5.16	1.22	0.21188	.	0.933889	0.08787	N	0.893805	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	8.0138	0.30368	0.0:0.6522:0.0:0.3478	.	.	.	.	X	2863	.	ENSP00000411096:S2863X	S	+	2	0	ABCA13	48289925	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.187000	0.09656	0.188000	0.20168	0.650000	0.86243	TCA	ABCA13	-	NULL	ENSG00000179869		0.348	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	46	0.00	0	C	NM_152701		48319379	48319379	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	nonsense	56	30.86	25	SNP	0.000	G
ADGB	79747	genome.wustl.edu	37	6	147062317	147062317	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:147062317C>G	ENST00000397944.3	+	25	3163	c.3087C>G	c.(3085-3087)atC>atG	p.I1029M	ADGB_ENST00000367493.3_Missense_Mutation_p.I448M	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1029					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						CACTTCCAATCTGTATCCTAC	0.348																																						dbGAP											0													178.0	143.0	154.0					6																	147062317		692	1591	2283	-	-	-	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.3087C>G	6.37:g.147062317C>G	ENSP00000381036:p.Ile1029Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.I1029M	ENST00000397944.3	37	c.3087		6	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547968	0.27652	.	.	ENSG00000118492	ENST00000397944;ENST00000367493;ENST00000367490	T;T	0.42513	1.53;0.97	4.58	2.79	0.32731	.	.	.	.	.	T	0.12475	0.0303	N	0.22421	0.69	0.27451	N	0.953436	P;P	0.40211	0.707;0.503	B;B	0.37198	0.195;0.243	T	0.04495	-1.0947	9	0.48119	T	0.1	.	9.0713	0.36493	0.1463:0.7755:0.0:0.0782	.	1029;78	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	M	1029;448;91	ENSP00000381036:I1029M;ENSP00000356460:I91M	ENSP00000356460:I91M	I	+	3	3	C6orf103	147104010	0.990000	0.36364	0.377000	0.26055	0.601000	0.36947	1.623000	0.37008	0.541000	0.28827	0.655000	0.94253	ATC	ADGB	-	NULL	ENSG00000118492		0.348	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	31	0.00	0	C	NM_024694		147062317	147062317	+1	no_errors	ENST00000397944	ensembl	human	known	69_37n	missense	69	10.39	8	SNP	0.975	G
ADGB	79747	genome.wustl.edu	37	6	147062317	147062317	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr6:147062317C>G	ENST00000397944.3	+	25	3163	c.3087C>G	c.(3085-3087)atC>atG	p.I1029M	ADGB_ENST00000367493.3_Missense_Mutation_p.I448M	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1029					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						CACTTCCAATCTGTATCCTAC	0.348																																						dbGAP											0													178.0	143.0	154.0					6																	147062317		692	1591	2283	-	-	-	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.3087C>G	6.37:g.147062317C>G	ENSP00000381036:p.Ile1029Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.I1029M	ENST00000397944.3	37	c.3087		6	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547968	0.27652	.	.	ENSG00000118492	ENST00000397944;ENST00000367493;ENST00000367490	T;T	0.42513	1.53;0.97	4.58	2.79	0.32731	.	.	.	.	.	T	0.12475	0.0303	N	0.22421	0.69	0.27451	N	0.953436	P;P	0.40211	0.707;0.503	B;B	0.37198	0.195;0.243	T	0.04495	-1.0947	9	0.48119	T	0.1	.	9.0713	0.36493	0.1463:0.7755:0.0:0.0782	.	1029;78	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	M	1029;448;91	ENSP00000381036:I1029M;ENSP00000356460:I91M	ENSP00000356460:I91M	I	+	3	3	C6orf103	147104010	0.990000	0.36364	0.377000	0.26055	0.601000	0.36947	1.623000	0.37008	0.541000	0.28827	0.655000	0.94253	ATC	ADGB	-	NULL	ENSG00000118492		0.348	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	48	0.00	0	C	NM_024694		147062317	147062317	+1	no_errors	ENST00000397944	ensembl	human	known	69_37n	missense	69	10.39	8	SNP	0.975	G
ANKLE2	23141	genome.wustl.edu	37	12	133312092	133312092	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:133312092C>T	ENST00000357997.5	-	9	1689	c.1600G>A	c.(1600-1602)Gat>Aat	p.D534N	ANKLE2_ENST00000542374.1_5'Flank|ANKLE2_ENST00000539605.1_Missense_Mutation_p.D472N|ANKLE2_ENST00000337516.5_Missense_Mutation_p.D534N	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	534					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		TTGCGAAAATCTTCTGCCTAT	0.527																																						dbGAP											0													98.0	100.0	99.0					12																	133312092		1956	4155	6111	-	-	-	SO:0001583	missense	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1600G>A	12.37:g.133312092C>T	ENSP00000350686:p.Asp534Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	pfam_LEM,superfamily_LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM	p.D534N	ENST00000357997.5	37	c.1600	CCDS41869.1	12	.	.	.	.	.	.	.	.	.	.	c	18.01	3.526806	0.64860	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000337516;ENST00000535036	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.24	4.35	0.52113	.	0.197925	0.52532	N	0.000068	T	0.58977	0.2160	L	0.39085	1.19	0.58432	D	0.999998	D;D	0.62365	0.985;0.991	P;P	0.61397	0.888;0.848	T	0.58335	-0.7654	10	0.40728	T	0.16	-17.2617	13.9886	0.64350	0.0:0.926:0.0:0.074	.	534;534	Q86XL3-2;Q86XL3	.;ANKL2_HUMAN	N	472;534;534;97	ENSP00000446268:D472N;ENSP00000350686:D534N;ENSP00000337651:D534N;ENSP00000437585:D97N	ENSP00000337651:D534N	D	-	1	0	ANKLE2	131822165	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.424000	0.66464	1.312000	0.45043	0.655000	0.94253	GAT	ANKLE2	-	NULL	ENSG00000176915		0.527	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1	25	0.00	0	C			133312092	133312092	-1	no_errors	ENST00000357997	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
ANKLE2	23141	genome.wustl.edu	37	12	133312092	133312092	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:133312092C>T	ENST00000357997.5	-	9	1689	c.1600G>A	c.(1600-1602)Gat>Aat	p.D534N	ANKLE2_ENST00000542374.1_5'Flank|ANKLE2_ENST00000539605.1_Missense_Mutation_p.D472N|ANKLE2_ENST00000337516.5_Missense_Mutation_p.D534N	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	534					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		TTGCGAAAATCTTCTGCCTAT	0.527																																						dbGAP											0													98.0	100.0	99.0					12																	133312092		1956	4155	6111	-	-	-	SO:0001583	missense	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1600G>A	12.37:g.133312092C>T	ENSP00000350686:p.Asp534Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	pfam_LEM,superfamily_LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM	p.D534N	ENST00000357997.5	37	c.1600	CCDS41869.1	12	.	.	.	.	.	.	.	.	.	.	c	18.01	3.526806	0.64860	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000337516;ENST00000535036	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.24	4.35	0.52113	.	0.197925	0.52532	N	0.000068	T	0.58977	0.2160	L	0.39085	1.19	0.58432	D	0.999998	D;D	0.62365	0.985;0.991	P;P	0.61397	0.888;0.848	T	0.58335	-0.7654	10	0.40728	T	0.16	-17.2617	13.9886	0.64350	0.0:0.926:0.0:0.074	.	534;534	Q86XL3-2;Q86XL3	.;ANKL2_HUMAN	N	472;534;534;97	ENSP00000446268:D472N;ENSP00000350686:D534N;ENSP00000337651:D534N;ENSP00000437585:D97N	ENSP00000337651:D534N	D	-	1	0	ANKLE2	131822165	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.424000	0.66464	1.312000	0.45043	0.655000	0.94253	GAT	ANKLE2	-	NULL	ENSG00000176915		0.527	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1	28	0.00	0	C			133312092	133312092	-1	no_errors	ENST00000357997	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
ANKRD36B	57730	genome.wustl.edu	37	2	98177150	98177150	+	RNA	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr2:98177150C>G	ENST00000443455.1	-	0	953							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		TAGGTCCCTCCTTTATTTCTG	0.353																																						dbGAP											0													91.0	97.0	95.0					2																	98177150		1053	2261	3314	-	-	-			0			AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98177150C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	SNP	-	NULL	ENST00000443455.1	37	NULL		2																																																																																			ANKRD36B	-	-	ENSG00000196912		0.353	ANKRD36B-003	KNOWN	basic	processed_transcript	ANKRD36B	HGNC	pseudogene	OTTHUMT00000328967.2	64	0.00	0	C	NM_025190		98177150	98177150	-1	no_errors	ENST00000419390	ensembl	human	known	69_37n	rna	92	20.00	23	SNP	0.006	G
ANKRD36B	57730	genome.wustl.edu	37	2	98177150	98177150	+	RNA	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:98177150C>G	ENST00000443455.1	-	0	953							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		TAGGTCCCTCCTTTATTTCTG	0.353																																						dbGAP											0													91.0	97.0	95.0					2																	98177150		1053	2261	3314	-	-	-			0			AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98177150C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	SNP	-	NULL	ENST00000443455.1	37	NULL		2																																																																																			ANKRD36B	-	-	ENSG00000196912		0.353	ANKRD36B-003	KNOWN	basic	processed_transcript	ANKRD36B	HGNC	pseudogene	OTTHUMT00000328967.2	89	0.00	0	C	NM_025190		98177150	98177150	-1	no_errors	ENST00000419390	ensembl	human	known	69_37n	rna	92	20.00	23	SNP	0.006	G
AQP12A	375318	genome.wustl.edu	37	2	241631539	241631539	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr2:241631539G>A	ENST00000337801.4	+	2	241	c.172G>A	c.(172-174)Gac>Aac	p.D58N	AQP12A_ENST00000429564.1_Missense_Mutation_p.D70N|AC011298.2_ENST00000407635.2_lincRNA	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	58						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CTTTGGGCCTGACCTGCTGCT	0.692																																						dbGAP											0													25.0	37.0	33.0					2																	241631539		2162	4266	6428	-	-	-	SO:0001583	missense	0			AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.172G>A	2.37:g.241631539G>A	ENSP00000337144:p.Asp58Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.D70N	ENST00000337801.4	37	c.208		2	.	.	.	.	.	.	.	.	.	.	.	14.64	2.595329	0.46318	.	.	ENSG00000184945	ENST00000337801;ENST00000429564;ENST00000420599	T;T	0.62105	0.05;0.05	2.43	2.43	0.29744	Aquaporin-like (1);	0.113396	0.64402	D	0.000015	T	0.73171	0.3553	M	0.72118	2.19	0.41798	D	0.989901	D	0.89917	1.0	D	0.97110	1.0	T	0.71059	-0.4702	10	0.25751	T	0.34	-10.7472	10.6008	0.45365	0.0:0.0:1.0:0.0	.	58	Q8IXF9	AQ12A_HUMAN	N	58;70;43	ENSP00000337144:D58N;ENSP00000405899:D70N	ENSP00000337144:D58N	D	+	1	0	AQP12A	241280212	1.000000	0.71417	0.805000	0.32314	0.231000	0.25187	7.483000	0.81158	1.382000	0.46385	0.186000	0.17326	GAC	AQP12A	-	superfamily_Aquaporin-like,pirsf_Aquaporin_11/12	ENSG00000184945		0.692	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	AQP12A	HGNC	protein_coding	OTTHUMT00000257185.2	69	0.00	0	G	NM_198998		241631539	241631539	+1	no_errors	ENST00000429564	ensembl	human	known	69_37n	missense	46	38.67	29	SNP	0.991	A
AQP12A	375318	genome.wustl.edu	37	2	241631539	241631539	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:241631539G>A	ENST00000337801.4	+	2	241	c.172G>A	c.(172-174)Gac>Aac	p.D58N	AQP12A_ENST00000429564.1_Missense_Mutation_p.D70N|AC011298.2_ENST00000407635.2_lincRNA	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	58						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CTTTGGGCCTGACCTGCTGCT	0.692																																						dbGAP											0													25.0	37.0	33.0					2																	241631539		2162	4266	6428	-	-	-	SO:0001583	missense	0			AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.172G>A	2.37:g.241631539G>A	ENSP00000337144:p.Asp58Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.D70N	ENST00000337801.4	37	c.208		2	.	.	.	.	.	.	.	.	.	.	.	14.64	2.595329	0.46318	.	.	ENSG00000184945	ENST00000337801;ENST00000429564;ENST00000420599	T;T	0.62105	0.05;0.05	2.43	2.43	0.29744	Aquaporin-like (1);	0.113396	0.64402	D	0.000015	T	0.73171	0.3553	M	0.72118	2.19	0.41798	D	0.989901	D	0.89917	1.0	D	0.97110	1.0	T	0.71059	-0.4702	10	0.25751	T	0.34	-10.7472	10.6008	0.45365	0.0:0.0:1.0:0.0	.	58	Q8IXF9	AQ12A_HUMAN	N	58;70;43	ENSP00000337144:D58N;ENSP00000405899:D70N	ENSP00000337144:D58N	D	+	1	0	AQP12A	241280212	1.000000	0.71417	0.805000	0.32314	0.231000	0.25187	7.483000	0.81158	1.382000	0.46385	0.186000	0.17326	GAC	AQP12A	-	superfamily_Aquaporin-like,pirsf_Aquaporin_11/12	ENSG00000184945		0.692	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	AQP12A	HGNC	protein_coding	OTTHUMT00000257185.2	48	0.00	0	G	NM_198998		241631539	241631539	+1	no_errors	ENST00000429564	ensembl	human	known	69_37n	missense	46	38.67	29	SNP	0.991	A
ARSH	347527	genome.wustl.edu	37	X	2933208	2933208	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:2933208C>T	ENST00000381130.2	+	4	538	c.538C>T	c.(538-540)Ctg>Ttg	p.L180L		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	180					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				GGTTCCTTTTCTGCTTCTCAT	0.522																																						dbGAP											0													173.0	108.0	130.0					X																	2933208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.538C>T	X.37:g.2933208C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L180	ENST00000381130.2	37	c.538	CCDS35198.1	X																																																																																			ARSH	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000205667		0.522	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSH	HGNC	protein_coding	OTTHUMT00000356489.1	85	0.00	0	C	NM_001011719		2933208	2933208	+1	no_errors	ENST00000381130	ensembl	human	known	69_37n	silent	194	15.65	36	SNP	0.001	T
ARSH	347527	genome.wustl.edu	37	X	2933208	2933208	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:2933208C>T	ENST00000381130.2	+	4	538	c.538C>T	c.(538-540)Ctg>Ttg	p.L180L		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	180					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				GGTTCCTTTTCTGCTTCTCAT	0.522																																						dbGAP											0													173.0	108.0	130.0					X																	2933208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.538C>T	X.37:g.2933208C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L180	ENST00000381130.2	37	c.538	CCDS35198.1	X																																																																																			ARSH	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000205667		0.522	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSH	HGNC	protein_coding	OTTHUMT00000356489.1	100	0.00	0	C	NM_001011719		2933208	2933208	+1	no_errors	ENST00000381130	ensembl	human	known	69_37n	silent	194	15.65	36	SNP	0.001	T
BPIFA1	51297	genome.wustl.edu	37	20	31825887	31825887	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr20:31825887G>A	ENST00000354297.4	+	3	258	c.187G>A	c.(187-189)Ggc>Agc	p.G63S	BPIFA1_ENST00000375422.2_Missense_Mutation_p.G63S|BPIFA1_ENST00000375413.4_Missense_Mutation_p.G63S	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	63					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										GCTGTCTGGGGGCCTGTTGGG	0.587																																						dbGAP											0													52.0	53.0	53.0					20																	31825887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.187G>A	20.37:g.31825887G>A	ENSP00000346251:p.Gly63Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	p.G63S	ENST00000354297.4	37	c.187	CCDS13217.1	20	.	.	.	.	.	.	.	.	.	.	G	12.51	1.961094	0.34565	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.05258	3.47;3.47;3.47	5.54	1.26	0.21427	.	0.967932	0.08570	N	0.926274	T	0.13970	0.0338	M	0.69823	2.125	0.09310	N	1	P	0.46859	0.885	P	0.51324	0.666	T	0.21381	-1.0247	10	0.38643	T	0.18	-0.2007	6.5461	0.22406	0.3938:0.0:0.6062:0.0	.	63	Q9NP55	BPIA1_HUMAN	S	63;63;63;49	ENSP00000364571:G63S;ENSP00000346251:G63S;ENSP00000364562:G63S	ENSP00000346251:G63S	G	+	1	0	BPIFA1	31289548	0.000000	0.05858	0.023000	0.16930	0.051000	0.14879	0.261000	0.18442	0.461000	0.27071	-0.140000	0.14226	GGC	BPIFA1	-	pfam_Lipid-bd_serum_glycop_N	ENSG00000198183		0.587	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	BPIFA1	HGNC	protein_coding	OTTHUMT00000078667.2	35	0.00	0	G	NM_130852		31825887	31825887	+1	no_errors	ENST00000354297	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	0.000	A
BPIFA1	51297	genome.wustl.edu	37	20	31825887	31825887	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr20:31825887G>A	ENST00000354297.4	+	3	258	c.187G>A	c.(187-189)Ggc>Agc	p.G63S	BPIFA1_ENST00000375422.2_Missense_Mutation_p.G63S|BPIFA1_ENST00000375413.4_Missense_Mutation_p.G63S	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	63					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										GCTGTCTGGGGGCCTGTTGGG	0.587																																						dbGAP											0													52.0	53.0	53.0					20																	31825887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.187G>A	20.37:g.31825887G>A	ENSP00000346251:p.Gly63Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	p.G63S	ENST00000354297.4	37	c.187	CCDS13217.1	20	.	.	.	.	.	.	.	.	.	.	G	12.51	1.961094	0.34565	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.05258	3.47;3.47;3.47	5.54	1.26	0.21427	.	0.967932	0.08570	N	0.926274	T	0.13970	0.0338	M	0.69823	2.125	0.09310	N	1	P	0.46859	0.885	P	0.51324	0.666	T	0.21381	-1.0247	10	0.38643	T	0.18	-0.2007	6.5461	0.22406	0.3938:0.0:0.6062:0.0	.	63	Q9NP55	BPIA1_HUMAN	S	63;63;63;49	ENSP00000364571:G63S;ENSP00000346251:G63S;ENSP00000364562:G63S	ENSP00000346251:G63S	G	+	1	0	BPIFA1	31289548	0.000000	0.05858	0.023000	0.16930	0.051000	0.14879	0.261000	0.18442	0.461000	0.27071	-0.140000	0.14226	GGC	BPIFA1	-	pfam_Lipid-bd_serum_glycop_N	ENSG00000198183		0.587	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	BPIFA1	HGNC	protein_coding	OTTHUMT00000078667.2	39	0.00	0	G	NM_130852		31825887	31825887	+1	no_errors	ENST00000354297	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	0.000	A
MFRP	83552	genome.wustl.edu	37	11	119213390	119213390	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr11:119213390C>T	ENST00000530681.1	-	11	1447	c.1303G>A	c.(1303-1305)Ggt>Agt	p.G435S	C1QTNF5_ENST00000525657.1_5'Flank|MFRP_ENST00000555262.1_Missense_Mutation_p.G435S|C1QTNF5_ENST00000445041.2_5'UTR|MFRP_ENST00000529147.1_5'Flank|MFRP_ENST00000360167.4_Silent_p.R359R|MFRP_ENST00000449574.2_Missense_Mutation_p.G435S|C1QTNF5_ENST00000528368.1_5'Flank	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	435	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		CACTGCACACCCTTACACCCT	0.637																																						dbGAP											0													116.0	105.0	109.0					11																	119213390		2199	4295	6494	-	-	-	SO:0001583	missense	0			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.1303G>A	11.37:g.119213390C>T	ENSP00000456533:p.Gly435Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Missense_Mutation	SNP	pfam_CUB,pfam_Frizzled_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,smart_Frizzled_dom,pfscan_CUB,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt	p.G435S	ENST00000530681.1	37	c.1303	CCDS8421.1	11	.	.	.	.	.	.	.	.	.	.	C	6.195	0.404122	0.11754	.	.	ENSG00000235718	ENST00000555262;ENST00000449574	D;D	0.94966	-3.57;-3.57	5.3	1.1	0.20463	.	1.143810	0.06193	N	0.681709	T	0.73055	0.3538	N	0.00099	-2.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.70651	-0.4813	10	0.06757	T	0.87	1.7323	4.729	0.12955	0.1463:0.5335:0.0:0.3201	.	435	Q9BY79	MFRP_HUMAN	S	435	ENSP00000450509:G435S;ENSP00000391664:G435S	ENSP00000391664:G435S	G	-	1	0	MFRP	118718600	0.004000	0.15560	0.001000	0.08648	0.972000	0.66771	1.089000	0.30890	0.171000	0.19730	0.561000	0.74099	GGT	MFRP	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000235718		0.637	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C1QTNF5	Clone_based_vega_gene	protein_coding	OTTHUMT00000415179.1	47	0.00	0	C	NM_031433		119213390	119213390	-1	no_errors	ENST00000449574	ensembl	human	known	69_37n	missense	15	50.00	15	SNP	0.013	T
MFRP	83552	genome.wustl.edu	37	11	119213390	119213390	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr11:119213390C>T	ENST00000530681.1	-	11	1447	c.1303G>A	c.(1303-1305)Ggt>Agt	p.G435S	C1QTNF5_ENST00000525657.1_5'Flank|MFRP_ENST00000555262.1_Missense_Mutation_p.G435S|C1QTNF5_ENST00000445041.2_5'UTR|MFRP_ENST00000529147.1_5'Flank|MFRP_ENST00000360167.4_Silent_p.R359R|MFRP_ENST00000449574.2_Missense_Mutation_p.G435S|C1QTNF5_ENST00000528368.1_5'Flank	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	435	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		CACTGCACACCCTTACACCCT	0.637																																						dbGAP											0													116.0	105.0	109.0					11																	119213390		2199	4295	6494	-	-	-	SO:0001583	missense	0			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.1303G>A	11.37:g.119213390C>T	ENSP00000456533:p.Gly435Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Missense_Mutation	SNP	pfam_CUB,pfam_Frizzled_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,smart_Frizzled_dom,pfscan_CUB,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt	p.G435S	ENST00000530681.1	37	c.1303	CCDS8421.1	11	.	.	.	.	.	.	.	.	.	.	C	6.195	0.404122	0.11754	.	.	ENSG00000235718	ENST00000555262;ENST00000449574	D;D	0.94966	-3.57;-3.57	5.3	1.1	0.20463	.	1.143810	0.06193	N	0.681709	T	0.73055	0.3538	N	0.00099	-2.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.70651	-0.4813	10	0.06757	T	0.87	1.7323	4.729	0.12955	0.1463:0.5335:0.0:0.3201	.	435	Q9BY79	MFRP_HUMAN	S	435	ENSP00000450509:G435S;ENSP00000391664:G435S	ENSP00000391664:G435S	G	-	1	0	MFRP	118718600	0.004000	0.15560	0.001000	0.08648	0.972000	0.66771	1.089000	0.30890	0.171000	0.19730	0.561000	0.74099	GGT	MFRP	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000235718		0.637	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C1QTNF5	Clone_based_vega_gene	protein_coding	OTTHUMT00000415179.1	23	0.00	0	C	NM_031433		119213390	119213390	-1	no_errors	ENST00000449574	ensembl	human	known	69_37n	missense	15	50.00	15	SNP	0.013	T
C1QTNF9B	387911	genome.wustl.edu	37	13	24471211	24471211	+	Intron	SNP	G	G	A	rs535719611		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr13:24471211G>A	ENST00000382140.2	-	3	46				C1QTNF9B_ENST00000382145.1_Intron|C1QTNF9B_ENST00000382057.3_5'Flank|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000382137.3_5'Flank|C1QTNF9B_ENST00000556521.1_5'Flank			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B							collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						CACAGCCTCCGTTCTGTGCAG	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20243	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.15-71C>T	13.37:g.24471211G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	RNA	SNP	-	NULL	ENST00000382140.2	37	NULL	CCDS31947.1	13																																																																																			C1QTNF9B-AS1	-	-	ENSG00000205861		0.552	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	C1QTNF9B-AS1	HGNC	protein_coding	OTTHUMT00000044162.3	20	0.00	0	G	NM_001007537		24471211	24471211	+1	no_errors	ENST00000417034	ensembl	human	known	69_37n	rna	28	42.86	21	SNP	0.000	A
C1QTNF9B	387911	genome.wustl.edu	37	13	24471211	24471211	+	Intron	SNP	G	G	A	rs535719611		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr13:24471211G>A	ENST00000382140.2	-	3	46				C1QTNF9B_ENST00000382145.1_Intron|C1QTNF9B_ENST00000382057.3_5'Flank|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000382137.3_5'Flank|C1QTNF9B_ENST00000556521.1_5'Flank			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B							collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						CACAGCCTCCGTTCTGTGCAG	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20243	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.15-71C>T	13.37:g.24471211G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	RNA	SNP	-	NULL	ENST00000382140.2	37	NULL	CCDS31947.1	13																																																																																			C1QTNF9B-AS1	-	-	ENSG00000205861		0.552	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	C1QTNF9B-AS1	HGNC	protein_coding	OTTHUMT00000044162.3	47	0.00	0	G	NM_001007537		24471211	24471211	+1	no_errors	ENST00000417034	ensembl	human	known	69_37n	rna	28	42.86	21	SNP	0.000	A
C5orf63	401207	genome.wustl.edu	37	5	126387573	126387573	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:126387573C>G	ENST00000606937.1	-	3	218				C5orf63_ENST00000296662.5_Missense_Mutation_p.D80H|C5orf63_ENST00000607731.1_Intron|C5orf63_ENST00000535381.1_Intron			A6NC05	YD286_HUMAN	chromosome 5 open reading frame 63						oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)				endometrium(1)	1						ACAGGAATATCAAATTTATAC	0.378																																						dbGAP											0													194.0	152.0	165.0					5																	126387573		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK126569	CCDS54895.1, CCDS54896.1	5q23.2	2014-05-30			ENSG00000164241	ENSG00000164241			40051	protein-coding gene	gene with protein product							Standard	NM_001164478		Approved	YDR286C, FLJ44606	uc021ydc.1	A6NC05	OTTHUMG00000163037	ENST00000606937.1:c.171+731G>C	5.37:g.126387573C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V557	Missense_Mutation	SNP	pfam_Glutaredoxin-like,superfamily_Thioredoxin-like_fold	p.D80H	ENST00000606937.1	37	c.238	CCDS54895.1	5	.	.	.	.	.	.	.	.	.	.	C	19.65	3.868089	0.72065	.	.	ENSG00000258953	ENST00000556512	.	.	.	5.61	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.82664	0.5086	M	0.88570	2.965	0.51482	D	0.999925	.	.	.	.	.	.	D	0.85774	0.1357	6	.	.	.	-29.7376	16.0271	0.80551	0.0:0.8651:0.1349:0.0	.	.	.	.	H	80	.	.	D	-	1	0	C5orf63	126415472	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.345000	0.79337	1.329000	0.45376	0.655000	0.94253	GAT	C5orf63	-	pfam_Glutaredoxin-like,superfamily_Thioredoxin-like_fold	ENSG00000164241		0.378	C5orf63-004	KNOWN	basic|CCDS	protein_coding	C5orf63	HGNC	protein_coding	OTTHUMT00000470210.1	18	0.00	0	C	NM_001164478		126387573	126387573	-1	no_errors	ENST00000296662	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	1.000	G
C5orf63	401207	genome.wustl.edu	37	5	126387573	126387573	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:126387573C>G	ENST00000606937.1	-	3	218				C5orf63_ENST00000296662.5_Missense_Mutation_p.D80H|C5orf63_ENST00000607731.1_Intron|C5orf63_ENST00000535381.1_Intron			A6NC05	YD286_HUMAN	chromosome 5 open reading frame 63						oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)				endometrium(1)	1						ACAGGAATATCAAATTTATAC	0.378																																						dbGAP											0													194.0	152.0	165.0					5																	126387573		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK126569	CCDS54895.1, CCDS54896.1	5q23.2	2014-05-30			ENSG00000164241	ENSG00000164241			40051	protein-coding gene	gene with protein product							Standard	NM_001164478		Approved	YDR286C, FLJ44606	uc021ydc.1	A6NC05	OTTHUMG00000163037	ENST00000606937.1:c.171+731G>C	5.37:g.126387573C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V557	Missense_Mutation	SNP	pfam_Glutaredoxin-like,superfamily_Thioredoxin-like_fold	p.D80H	ENST00000606937.1	37	c.238	CCDS54895.1	5	.	.	.	.	.	.	.	.	.	.	C	19.65	3.868089	0.72065	.	.	ENSG00000258953	ENST00000556512	.	.	.	5.61	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.82664	0.5086	M	0.88570	2.965	0.51482	D	0.999925	.	.	.	.	.	.	D	0.85774	0.1357	6	.	.	.	-29.7376	16.0271	0.80551	0.0:0.8651:0.1349:0.0	.	.	.	.	H	80	.	.	D	-	1	0	C5orf63	126415472	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.345000	0.79337	1.329000	0.45376	0.655000	0.94253	GAT	C5orf63	-	pfam_Glutaredoxin-like,superfamily_Thioredoxin-like_fold	ENSG00000164241		0.378	C5orf63-004	KNOWN	basic|CCDS	protein_coding	C5orf63	HGNC	protein_coding	OTTHUMT00000470210.1	29	0.00	0	C	NM_001164478		126387573	126387573	-1	no_errors	ENST00000296662	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	1.000	G
CEP350	9857	genome.wustl.edu	37	1	180063698	180063698	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:180063698G>A	ENST00000367607.3	+	34	8876	c.8458G>A	c.(8458-8460)Gaa>Aaa	p.E2820K	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2820					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTTAAGTTCTGAATTGGAAGA	0.403																																						dbGAP											0													78.0	81.0	80.0					1																	180063698		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.8458G>A	1.37:g.180063698G>A	ENSP00000356579:p.Glu2820Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.E2820K	ENST00000367607.3	37	c.8458	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031676	0.75504	.	.	ENSG00000135837	ENST00000367607;ENST00000417046	T	0.58060	0.36	5.61	5.61	0.85477	.	0.132116	0.33854	N	0.004486	T	0.68155	0.2970	M	0.63428	1.95	0.40310	D	0.978704	D;P	0.67145	0.996;0.935	P;P	0.62382	0.901;0.476	T	0.67647	-0.5617	9	.	.	.	.	17.795	0.88567	0.0:0.0:1.0:0.0	.	2820;2820	E7EU22;Q5VT06	.;CE350_HUMAN	K	2820;284	ENSP00000356579:E2820K	.	E	+	1	0	CEP350	178330321	1.000000	0.71417	0.986000	0.45419	0.875000	0.50365	3.556000	0.53734	2.632000	0.89209	0.591000	0.81541	GAA	CEP350	-	NULL	ENSG00000135837		0.403	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	25	0.00	0	G	NM_014810		180063698	180063698	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.985	A
CEP350	9857	genome.wustl.edu	37	1	180063698	180063698	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:180063698G>A	ENST00000367607.3	+	34	8876	c.8458G>A	c.(8458-8460)Gaa>Aaa	p.E2820K	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2820					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTTAAGTTCTGAATTGGAAGA	0.403																																						dbGAP											0													78.0	81.0	80.0					1																	180063698		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.8458G>A	1.37:g.180063698G>A	ENSP00000356579:p.Glu2820Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.E2820K	ENST00000367607.3	37	c.8458	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031676	0.75504	.	.	ENSG00000135837	ENST00000367607;ENST00000417046	T	0.58060	0.36	5.61	5.61	0.85477	.	0.132116	0.33854	N	0.004486	T	0.68155	0.2970	M	0.63428	1.95	0.40310	D	0.978704	D;P	0.67145	0.996;0.935	P;P	0.62382	0.901;0.476	T	0.67647	-0.5617	9	.	.	.	.	17.795	0.88567	0.0:0.0:1.0:0.0	.	2820;2820	E7EU22;Q5VT06	.;CE350_HUMAN	K	2820;284	ENSP00000356579:E2820K	.	E	+	1	0	CEP350	178330321	1.000000	0.71417	0.986000	0.45419	0.875000	0.50365	3.556000	0.53734	2.632000	0.89209	0.591000	0.81541	GAA	CEP350	-	NULL	ENSG00000135837		0.403	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	34	0.00	0	G	NM_014810		180063698	180063698	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.985	A
CKMT2	1160	genome.wustl.edu	37	5	80548572	80548572	+	Missense_Mutation	SNP	G	G	A	rs548849398		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:80548572G>A	ENST00000424301.2	+	4	449	c.211G>A	c.(211-213)Gcc>Acc	p.A71T	CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2_ENST00000437669.1_Missense_Mutation_p.A71T|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2_ENST00000254035.4_Missense_Mutation_p.A71T	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	71	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.A71T(2)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	CCTCACCCCCGCCATTTATGC	0.612													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19702	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	large_intestine(1)|lung(1)											110.0	94.0	100.0					5																	80548572		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.211G>A	5.37:g.80548572G>A	ENSP00000404203:p.Ala71Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.A71T	ENST00000424301.2	37	c.211	CCDS4053.1	5	.	.	.	.	.	.	.	.	.	.	G	15.64	2.892821	0.52121	.	.	ENSG00000131730	ENST00000254035;ENST00000511719;ENST00000437669;ENST00000424301;ENST00000505060	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	6.04	-3.38	0.04883	ATP:guanido phosphotransferase, N-terminal (4);	0.348813	0.34435	N	0.003966	T	0.49457	0.1558	L	0.52364	1.645	0.31991	N	0.604641	B	0.18863	0.031	B	0.14023	0.01	T	0.29610	-1.0006	10	0.62326	D	0.03	-0.2323	9.9591	0.41686	0.074:0.0:0.3595:0.5666	.	71	P17540	KCRS_HUMAN	T	71	ENSP00000254035:A71T;ENSP00000423264:A71T;ENSP00000410289:A71T;ENSP00000404203:A71T;ENSP00000427635:A71T	ENSP00000254035:A71T	A	+	1	0	CKMT2	80584328	0.801000	0.28930	0.002000	0.10522	0.949000	0.60115	1.225000	0.32551	-1.158000	0.02811	0.561000	0.74099	GCC	CKMT2	-	pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	ENSG00000131730		0.612	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CKMT2	HGNC	protein_coding	OTTHUMT00000369600.1	24	0.00	0	G	NM_001825		80548572	80548572	+1	no_errors	ENST00000254035	ensembl	human	known	69_37n	missense	21	43.24	16	SNP	0.056	A
CKMT2	1160	genome.wustl.edu	37	5	80548572	80548572	+	Missense_Mutation	SNP	G	G	A	rs548849398		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:80548572G>A	ENST00000424301.2	+	4	449	c.211G>A	c.(211-213)Gcc>Acc	p.A71T	CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2_ENST00000437669.1_Missense_Mutation_p.A71T|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2_ENST00000254035.4_Missense_Mutation_p.A71T	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	71	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.A71T(2)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	CCTCACCCCCGCCATTTATGC	0.612													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19702	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	large_intestine(1)|lung(1)											110.0	94.0	100.0					5																	80548572		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.211G>A	5.37:g.80548572G>A	ENSP00000404203:p.Ala71Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.A71T	ENST00000424301.2	37	c.211	CCDS4053.1	5	.	.	.	.	.	.	.	.	.	.	G	15.64	2.892821	0.52121	.	.	ENSG00000131730	ENST00000254035;ENST00000511719;ENST00000437669;ENST00000424301;ENST00000505060	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	6.04	-3.38	0.04883	ATP:guanido phosphotransferase, N-terminal (4);	0.348813	0.34435	N	0.003966	T	0.49457	0.1558	L	0.52364	1.645	0.31991	N	0.604641	B	0.18863	0.031	B	0.14023	0.01	T	0.29610	-1.0006	10	0.62326	D	0.03	-0.2323	9.9591	0.41686	0.074:0.0:0.3595:0.5666	.	71	P17540	KCRS_HUMAN	T	71	ENSP00000254035:A71T;ENSP00000423264:A71T;ENSP00000410289:A71T;ENSP00000404203:A71T;ENSP00000427635:A71T	ENSP00000254035:A71T	A	+	1	0	CKMT2	80584328	0.801000	0.28930	0.002000	0.10522	0.949000	0.60115	1.225000	0.32551	-1.158000	0.02811	0.561000	0.74099	GCC	CKMT2	-	pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	ENSG00000131730		0.612	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CKMT2	HGNC	protein_coding	OTTHUMT00000369600.1	18	0.00	0	G	NM_001825		80548572	80548572	+1	no_errors	ENST00000254035	ensembl	human	known	69_37n	missense	21	43.24	16	SNP	0.056	A
CPSF1	29894	genome.wustl.edu	37	8	145623698	145623698	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr8:145623698C>G	ENST00000349769.3	-	19	1982	c.1888G>C	c.(1888-1890)Gaa>Caa	p.E630Q	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	630					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CTACCTCCTTCCAGCAGGCGG	0.667																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													44.0	51.0	48.0					8																	145623698		2202	4300	6502	-	-	-	SO:0001583	missense	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1888G>C	8.37:g.145623698C>G	ENSP00000339353:p.Glu630Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AF0	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.E630Q	ENST00000349769.3	37	c.1888	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	C	12.89	2.072537	0.36566	.	.	ENSG00000071894	ENST00000349769	T	0.29655	1.56	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.22244	0.0536	N	0.21373	0.66	0.58432	D	0.999994	B	0.32968	0.392	B	0.33960	0.173	T	0.05468	-1.0883	10	0.18710	T	0.47	-20.2182	15.6639	0.77209	0.0:1.0:0.0:0.0	.	630	Q10570	CPSF1_HUMAN	Q	630	ENSP00000339353:E630Q	ENSP00000339353:E630Q	E	-	1	0	CPSF1	145594506	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	5.015000	0.64035	2.298000	0.77334	0.467000	0.42956	GAA	CPSF1	-	NULL	ENSG00000071894		0.667	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	106	0.00	0	C	NM_013291		145623698	145623698	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	missense	109	12.80	16	SNP	1.000	G
CPSF1	29894	genome.wustl.edu	37	8	145623698	145623698	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr8:145623698C>G	ENST00000349769.3	-	19	1982	c.1888G>C	c.(1888-1890)Gaa>Caa	p.E630Q	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	630					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CTACCTCCTTCCAGCAGGCGG	0.667																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													44.0	51.0	48.0					8																	145623698		2202	4300	6502	-	-	-	SO:0001583	missense	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1888G>C	8.37:g.145623698C>G	ENSP00000339353:p.Glu630Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AF0	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.E630Q	ENST00000349769.3	37	c.1888	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	C	12.89	2.072537	0.36566	.	.	ENSG00000071894	ENST00000349769	T	0.29655	1.56	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.22244	0.0536	N	0.21373	0.66	0.58432	D	0.999994	B	0.32968	0.392	B	0.33960	0.173	T	0.05468	-1.0883	10	0.18710	T	0.47	-20.2182	15.6639	0.77209	0.0:1.0:0.0:0.0	.	630	Q10570	CPSF1_HUMAN	Q	630	ENSP00000339353:E630Q	ENSP00000339353:E630Q	E	-	1	0	CPSF1	145594506	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	5.015000	0.64035	2.298000	0.77334	0.467000	0.42956	GAA	CPSF1	-	NULL	ENSG00000071894		0.667	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	51	0.00	0	C	NM_013291		145623698	145623698	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	missense	109	12.80	16	SNP	1.000	G
CRYBG3	131544	genome.wustl.edu	37	3	97541104	97541104	+	Missense_Mutation	SNP	C	C	A	rs147018918	byFrequency	TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr3:97541104C>A	ENST00000419587.2	+	1	221	c.54C>A	c.(52-54)ttC>ttA	p.F18L				Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	18							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TCTCCCGGTTCTTCGCTCCCC	0.706													C|||	99	0.0197684	0.0703	0.0072	5008	,	,		10796	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000419587.2:c.54C>A	3.37:g.97541104C>A	ENSP00000391551:p.Phe18Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	NULL	p.F18L	ENST00000419587.2	37	c.54		3	38	0.0173992673992674	35	0.07113821138211382	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	15.67	2.901127	0.52227	.	.	ENSG00000233280	ENST00000419587	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	T	0.01695	0.0054	N	0.08118	0	.	.	.	B	0.15141	0.012	B	0.15052	0.012	T	0.07121	-1.0789	7	0.02654	T	1	.	12.0521	0.53513	0.0:1.0:0.0:0.0	.	18	B4DLE8	.	L	18	.	ENSP00000391551:F18L	F	+	3	2	AC110491.1	99023794	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.479000	0.53165	1.848000	0.53677	0.555000	0.69702	TTC	AC110491.1	-	NULL	ENSG00000233280		0.706	CRYBG3-001	PUTATIVE	mRNA_end_NF|cds_end_NF|basic|appris_principal	protein_coding	CRYBG3	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000469328.1	10	0.00	0	C	NM_153605		97541104	97541104	+1	no_stop_codon	ENST00000419587	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	1.000	A
CTBP2	1488	genome.wustl.edu	37	10	126681266	126681266	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr10:126681266G>A	ENST00000337195.5	-	10	1554	c.1155C>T	c.(1153-1155)taC>taT	p.Y385Y	CTBP2_ENST00000411419.2_Silent_p.Y385Y|CTBP2_ENST00000531469.1_Silent_p.Y385Y|CTBP2_ENST00000494626.2_Silent_p.Y385Y|CTBP2_ENST00000334808.6_Silent_p.Y453Y|CTBP2_ENST00000309035.6_Silent_p.Y925Y	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	385					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TTTCTCACCTGTATGTGGCAC	0.507											OREG0020609	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													57.0	51.0	53.0					10																	126681266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.1155C>T	10.37:g.126681266G>A		Somatic	1551	WXS	Illumina GAIIx	Phase_IV	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.Y925	ENST00000337195.5	37	c.2775	CCDS7643.1	10																																																																																			CTBP2	-	NULL	ENSG00000175029		0.507	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3	39	0.00	0	G	NM_001083914		126681266	126681266	-1	no_errors	ENST00000309035	ensembl	human	known	69_37n	silent	63	19.23	15	SNP	1.000	A
CTBP2	1488	genome.wustl.edu	37	10	126681266	126681266	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr10:126681266G>A	ENST00000337195.5	-	10	1554	c.1155C>T	c.(1153-1155)taC>taT	p.Y385Y	CTBP2_ENST00000411419.2_Silent_p.Y385Y|CTBP2_ENST00000531469.1_Silent_p.Y385Y|CTBP2_ENST00000494626.2_Silent_p.Y385Y|CTBP2_ENST00000334808.6_Silent_p.Y453Y|CTBP2_ENST00000309035.6_Silent_p.Y925Y	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	385					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TTTCTCACCTGTATGTGGCAC	0.507											OREG0020609	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													57.0	51.0	53.0					10																	126681266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.1155C>T	10.37:g.126681266G>A		Somatic	1551	WXS	Illumina GAIIx	Phase_IV	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.Y925	ENST00000337195.5	37	c.2775	CCDS7643.1	10																																																																																			CTBP2	-	NULL	ENSG00000175029		0.507	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3	37	0.00	0	G	NM_001083914		126681266	126681266	-1	no_errors	ENST00000309035	ensembl	human	known	69_37n	silent	63	19.23	15	SNP	1.000	A
CTSL3P	392360	genome.wustl.edu	37	9	90387899	90387899	+	RNA	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr9:90387899G>A	ENST00000354530.2	+	0	70					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)	p.A24T(1)									GGCCATGAACGCCTTTGGAGA	0.453																																						dbGAP											1	Substitution - Missense(1)	lung(1)											133.0	125.0	128.0					9																	90387899		2203	4300	6503	-	-	-			0			AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90387899G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000354530.2	37	NULL		9																																																																																			CTSL3	-	-	ENSG00000188029		0.453	CTSL3P-002	KNOWN	basic	processed_transcript	CTSL3	HGNC	pseudogene	OTTHUMT00000356542.1	202	0.00	0	G	NR_027917		90387899	90387899	+1	no_errors	ENST00000354530	ensembl	human	known	69_37n	rna	136	35.38	75	SNP	0.996	A
CTSL3P	392360	genome.wustl.edu	37	9	90387899	90387899	+	RNA	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr9:90387899G>A	ENST00000354530.2	+	0	70					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)	p.A24T(1)									GGCCATGAACGCCTTTGGAGA	0.453																																						dbGAP											1	Substitution - Missense(1)	lung(1)											133.0	125.0	128.0					9																	90387899		2203	4300	6503	-	-	-			0			AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90387899G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000354530.2	37	NULL		9																																																																																			CTSL3	-	-	ENSG00000188029		0.453	CTSL3P-002	KNOWN	basic	processed_transcript	CTSL3	HGNC	pseudogene	OTTHUMT00000356542.1	124	0.00	0	G	NR_027917		90387899	90387899	+1	no_errors	ENST00000354530	ensembl	human	known	69_37n	rna	136	35.38	75	SNP	0.996	A
DDX49	54555	genome.wustl.edu	37	19	19035754	19035754	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:19035754C>T	ENST00000247003.4	+	9	1060	c.993C>T	c.(991-993)atC>atT	p.I331I	DDX49_ENST00000599156.1_3'UTR|DDX49_ENST00000438170.2_Missense_Mutation_p.S234F|AC002985.3_ENST00000596918.1_Intron	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	331	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			TCCCCAAGATCTACATCCACC	0.652																																						dbGAP											0													63.0	58.0	60.0					19																	19035754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.993C>T	19.37:g.19035754C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S234F	ENST00000247003.4	37	c.701	CCDS12390.1	19	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850220	0.32699	.	.	ENSG00000105671	ENST00000438170	T	0.08984	3.03	4.77	3.74	0.42951	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.29105	N	0.881223	.	.	.	.	.	.	T	0.02417	-1.1162	6	0.87932	D	0	-26.6539	11.8715	0.52523	0.0:0.9151:0.0:0.0849	.	.	.	.	F	234	ENSP00000395377:S234F	ENSP00000395377:S234F	S	+	2	0	DDX49	18896754	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.076000	0.30729	1.019000	0.39547	0.561000	0.74099	TCT	DDX49	-	smart_Helicase_C,pfscan_Helicase_C	ENSG00000105671		0.652	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX49	HGNC	protein_coding	OTTHUMT00000464593.1	49	0.00	0	C	NM_019070		19035754	19035754	+1	no_errors	ENST00000438170	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	T
DDX49	54555	genome.wustl.edu	37	19	19035754	19035754	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr19:19035754C>T	ENST00000247003.4	+	9	1060	c.993C>T	c.(991-993)atC>atT	p.I331I	DDX49_ENST00000599156.1_3'UTR|DDX49_ENST00000438170.2_Missense_Mutation_p.S234F|AC002985.3_ENST00000596918.1_Intron	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	331	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			TCCCCAAGATCTACATCCACC	0.652																																						dbGAP											0													63.0	58.0	60.0					19																	19035754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.993C>T	19.37:g.19035754C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S234F	ENST00000247003.4	37	c.701	CCDS12390.1	19	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850220	0.32699	.	.	ENSG00000105671	ENST00000438170	T	0.08984	3.03	4.77	3.74	0.42951	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.29105	N	0.881223	.	.	.	.	.	.	T	0.02417	-1.1162	6	0.87932	D	0	-26.6539	11.8715	0.52523	0.0:0.9151:0.0:0.0849	.	.	.	.	F	234	ENSP00000395377:S234F	ENSP00000395377:S234F	S	+	2	0	DDX49	18896754	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.076000	0.30729	1.019000	0.39547	0.561000	0.74099	TCT	DDX49	-	smart_Helicase_C,pfscan_Helicase_C	ENSG00000105671		0.652	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX49	HGNC	protein_coding	OTTHUMT00000464593.1	42	0.00	0	C	NM_019070		19035754	19035754	+1	no_errors	ENST00000438170	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	T
DDX51	317781	genome.wustl.edu	37	12	132626138	132626138	+	Missense_Mutation	SNP	G	G	A	rs200735214	byFrequency	TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:132626138G>A	ENST00000397333.3	-	7	1047	c.1009C>T	c.(1009-1011)Cgc>Tgc	p.R337C	NOC4L_ENST00000330579.1_5'Flank	NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	337	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.R337C(1)		endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		GCCAAGCAGCGGTACCCATCA	0.622																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											36.0	47.0	43.0					12																	132626138		2114	4227	6341	-	-	-	SO:0001583	missense	0			BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1009C>T	12.37:g.132626138G>A	ENSP00000380495:p.Arg337Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R337C	ENST00000397333.3	37	c.1009	CCDS41865.1	12	.	.	.	.	.	.	.	.	.	.	G	8.550	0.875361	0.17395	.	.	ENSG00000185163	ENST00000397333	T	0.15718	2.4	4.83	2.57	0.30868	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.288297	0.40144	N	0.001162	T	0.15696	0.0378	L	0.59967	1.855	0.45747	D	0.998643	B	0.24533	0.105	B	0.24155	0.051	T	0.04650	-1.0936	10	0.34782	T	0.22	-11.8206	7.3611	0.26748	0.3091:0.0:0.6909:0.0	.	337	Q8N8A6	DDX51_HUMAN	C	337	ENSP00000380495:R337C	ENSP00000380495:R337C	R	-	1	0	DDX51	131192091	1.000000	0.71417	0.999000	0.59377	0.237000	0.25408	1.874000	0.39568	0.990000	0.38787	0.591000	0.81541	CGC	DDX51	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000185163		0.622	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX51	HGNC	protein_coding	OTTHUMT00000398978.1	29	0.00	0	G	NM_175066		132626138	132626138	-1	no_errors	ENST00000397333	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	0.990	A
DDX51	317781	genome.wustl.edu	37	12	132626138	132626138	+	Missense_Mutation	SNP	G	G	A	rs200735214	byFrequency	TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:132626138G>A	ENST00000397333.3	-	7	1047	c.1009C>T	c.(1009-1011)Cgc>Tgc	p.R337C	NOC4L_ENST00000330579.1_5'Flank	NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	337	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.R337C(1)		endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		GCCAAGCAGCGGTACCCATCA	0.622																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											36.0	47.0	43.0					12																	132626138		2114	4227	6341	-	-	-	SO:0001583	missense	0			BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1009C>T	12.37:g.132626138G>A	ENSP00000380495:p.Arg337Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R337C	ENST00000397333.3	37	c.1009	CCDS41865.1	12	.	.	.	.	.	.	.	.	.	.	G	8.550	0.875361	0.17395	.	.	ENSG00000185163	ENST00000397333	T	0.15718	2.4	4.83	2.57	0.30868	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.288297	0.40144	N	0.001162	T	0.15696	0.0378	L	0.59967	1.855	0.45747	D	0.998643	B	0.24533	0.105	B	0.24155	0.051	T	0.04650	-1.0936	10	0.34782	T	0.22	-11.8206	7.3611	0.26748	0.3091:0.0:0.6909:0.0	.	337	Q8N8A6	DDX51_HUMAN	C	337	ENSP00000380495:R337C	ENSP00000380495:R337C	R	-	1	0	DDX51	131192091	1.000000	0.71417	0.999000	0.59377	0.237000	0.25408	1.874000	0.39568	0.990000	0.38787	0.591000	0.81541	CGC	DDX51	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000185163		0.622	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX51	HGNC	protein_coding	OTTHUMT00000398978.1	27	0.00	0	G	NM_175066		132626138	132626138	-1	no_errors	ENST00000397333	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	0.990	A
DIAPH1	1729	genome.wustl.edu	37	5	140960344	140960344	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:140960344G>A	ENST00000398557.4	-	8	931	c.791C>T	c.(790-792)tCt>tTt	p.S264F	DIAPH1_ENST00000518047.1_Missense_Mutation_p.S255F|DIAPH1_ENST00000389057.5_Missense_Mutation_p.S255F|DIAPH1_ENST00000389054.3_Missense_Mutation_p.S264F|DIAPH1_ENST00000520569.1_Missense_Mutation_p.S210F|DIAPH1_ENST00000398566.3_Missense_Mutation_p.S255F|DIAPH1_ENST00000253811.6_Missense_Mutation_p.S264F|DIAPH1_ENST00000398562.2_Missense_Mutation_p.S255F	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	264	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAAAGAGCAGAAAGCAGCTT	0.418																																						dbGAP											0													112.0	108.0	109.0					5																	140960344		1923	4141	6064	-	-	-	SO:0001583	missense	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.791C>T	5.37:g.140960344G>A	ENSP00000381565:p.Ser264Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,superfamily_tRNA-bd_arm,smart_Actin-bd_FH2/DRF_autoreg	p.S264F	ENST00000398557.4	37	c.791	CCDS43374.1	5	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983460	0.93044	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047	D;D;D;D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62	5.69	5.69	0.88448	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.64402	D	0.000002	D	0.95095	0.8411	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95205	0.8320	10	0.87932	D	0	.	18.5725	0.91140	0.0:0.0:1.0:0.0	.	255;264	E9PEZ2;O60610	.;DIAP1_HUMAN	F	264;210;255;255;255;264;264;255	ENSP00000373706:S264F;ENSP00000429282:S210F;ENSP00000381570:S255F;ENSP00000373709:S255F;ENSP00000381572:S255F;ENSP00000381565:S264F;ENSP00000253811:S264F;ENSP00000428268:S255F	ENSP00000253811:S264F	S	-	2	0	DIAPH1	140940528	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.177000	0.94849	2.685000	0.91497	0.555000	0.69702	TCT	DIAPH1	-	pfam_Drf_GTPase-bd,superfamily_ARM-type_fold	ENSG00000131504		0.418	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		36	0.00	0	G	NM_005219		140960344	140960344	-1	no_errors	ENST00000253811	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	A
DIAPH1	1729	genome.wustl.edu	37	5	140960344	140960344	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:140960344G>A	ENST00000398557.4	-	8	931	c.791C>T	c.(790-792)tCt>tTt	p.S264F	DIAPH1_ENST00000518047.1_Missense_Mutation_p.S255F|DIAPH1_ENST00000389057.5_Missense_Mutation_p.S255F|DIAPH1_ENST00000389054.3_Missense_Mutation_p.S264F|DIAPH1_ENST00000520569.1_Missense_Mutation_p.S210F|DIAPH1_ENST00000398566.3_Missense_Mutation_p.S255F|DIAPH1_ENST00000253811.6_Missense_Mutation_p.S264F|DIAPH1_ENST00000398562.2_Missense_Mutation_p.S255F	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	264	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAAAGAGCAGAAAGCAGCTT	0.418																																						dbGAP											0													112.0	108.0	109.0					5																	140960344		1923	4141	6064	-	-	-	SO:0001583	missense	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.791C>T	5.37:g.140960344G>A	ENSP00000381565:p.Ser264Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,superfamily_tRNA-bd_arm,smart_Actin-bd_FH2/DRF_autoreg	p.S264F	ENST00000398557.4	37	c.791	CCDS43374.1	5	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983460	0.93044	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047	D;D;D;D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62	5.69	5.69	0.88448	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.64402	D	0.000002	D	0.95095	0.8411	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95205	0.8320	10	0.87932	D	0	.	18.5725	0.91140	0.0:0.0:1.0:0.0	.	255;264	E9PEZ2;O60610	.;DIAP1_HUMAN	F	264;210;255;255;255;264;264;255	ENSP00000373706:S264F;ENSP00000429282:S210F;ENSP00000381570:S255F;ENSP00000373709:S255F;ENSP00000381572:S255F;ENSP00000381565:S264F;ENSP00000253811:S264F;ENSP00000428268:S255F	ENSP00000253811:S264F	S	-	2	0	DIAPH1	140940528	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.177000	0.94849	2.685000	0.91497	0.555000	0.69702	TCT	DIAPH1	-	pfam_Drf_GTPase-bd,superfamily_ARM-type_fold	ENSG00000131504		0.418	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		34	0.00	0	G	NM_005219		140960344	140960344	-1	no_errors	ENST00000253811	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	A
DOPEY2	9980	genome.wustl.edu	37	21	37661476	37661476	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr21:37661476C>A	ENST00000399151.3	+	35	6572	c.6487C>A	c.(6487-6489)Cca>Aca	p.P2163T		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2163					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCTTTCTTTTCCACCTGACAA	0.408																																						dbGAP											0													94.0	88.0	90.0					21																	37661476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6487C>A	21.37:g.37661476C>A	ENSP00000382104:p.Pro2163Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.P2163T	ENST00000399151.3	37	c.6487	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518743	0.44763	.	.	ENSG00000142197	ENST00000399151	T	0.46063	0.88	5.77	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.67795	0.2931	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73395	-0.3996	10	0.59425	D	0.04	-30.0157	14.5017	0.67727	0.0:0.9291:0.0:0.0709	.	2156;2163	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	T	2163	ENSP00000382104:P2163T	ENSP00000382104:P2163T	P	+	1	0	DOPEY2	36583346	1.000000	0.71417	0.080000	0.20451	0.009000	0.06853	7.283000	0.78640	1.445000	0.47624	-0.140000	0.14226	CCA	DOPEY2	-	NULL	ENSG00000142197		0.408	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	52	0.00	0	C	NM_005128		37661476	37661476	+1	no_errors	ENST00000399151	ensembl	human	known	69_37n	missense	45	41.56	32	SNP	1.000	A
DOPEY2	9980	genome.wustl.edu	37	21	37661476	37661476	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr21:37661476C>A	ENST00000399151.3	+	35	6572	c.6487C>A	c.(6487-6489)Cca>Aca	p.P2163T		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2163					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCTTTCTTTTCCACCTGACAA	0.408																																						dbGAP											0													94.0	88.0	90.0					21																	37661476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6487C>A	21.37:g.37661476C>A	ENSP00000382104:p.Pro2163Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.P2163T	ENST00000399151.3	37	c.6487	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518743	0.44763	.	.	ENSG00000142197	ENST00000399151	T	0.46063	0.88	5.77	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.67795	0.2931	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73395	-0.3996	10	0.59425	D	0.04	-30.0157	14.5017	0.67727	0.0:0.9291:0.0:0.0709	.	2156;2163	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	T	2163	ENSP00000382104:P2163T	ENSP00000382104:P2163T	P	+	1	0	DOPEY2	36583346	1.000000	0.71417	0.080000	0.20451	0.009000	0.06853	7.283000	0.78640	1.445000	0.47624	-0.140000	0.14226	CCA	DOPEY2	-	NULL	ENSG00000142197		0.408	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	80	0.00	0	C	NM_005128		37661476	37661476	+1	no_errors	ENST00000399151	ensembl	human	known	69_37n	missense	45	41.56	32	SNP	1.000	A
DSPP	1834	genome.wustl.edu	37	4	88537123	88537123	+	Silent	SNP	C	C	T	rs372453629	byFrequency	TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr4:88537123C>T	ENST00000282478.7	+	4	3342	c.3309C>T	c.(3307-3309)agC>agT	p.S1103S	DSPP_ENST00000399271.1_Silent_p.S1103S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1103	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagcgacagcagcg	0.547													c|||	2714	0.541933	0.5439	0.6254	5008	,	,		13665	0.5903		0.5467	False		,,,				2504	0.4254					dbGAP											0													12.0	19.0	17.0					4																	88537123		1097	2123	3220	-	-	-	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3309C>T	4.37:g.88537123C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUI0|O95815	Silent	SNP	NULL	p.S1103	ENST00000282478.7	37	c.3309	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	9	0.00	0	C	NM_014208		88537123	88537123	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	silent	3	70.00	7	SNP	0.989	T
EBF4	57593	genome.wustl.edu	37	20	2688646	2688646	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr20:2688646C>T	ENST00000609451.1	+	5	540	c.468C>T	c.(466-468)ctC>ctT	p.L156L	EBF4_ENST00000380648.4_Silent_p.L152L			Q9BQW3	COE4_HUMAN	early B-cell factor 4	156					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GAGTGCTGCTCACCCATGAGA	0.617																																						dbGAP											0													155.0	137.0	142.0					20																	2688646		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.468C>T	20.37:g.2688646C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Silent	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	p.L256	ENST00000609451.1	37	c.768		20																																																																																			EBF4	-	NULL	ENSG00000088881		0.617	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	EBF4	HGNC	protein_coding	OTTHUMT00000471930.1	98	0.00	0	C	XM_938882		2688646	2688646	+1	no_errors	ENST00000449079	ensembl	human	known	69_37n	silent	148	18.23	33	SNP	1.000	T
EBF4	57593	genome.wustl.edu	37	20	2688646	2688646	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr20:2688646C>T	ENST00000609451.1	+	5	540	c.468C>T	c.(466-468)ctC>ctT	p.L156L	EBF4_ENST00000380648.4_Silent_p.L152L			Q9BQW3	COE4_HUMAN	early B-cell factor 4	156					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GAGTGCTGCTCACCCATGAGA	0.617																																						dbGAP											0													155.0	137.0	142.0					20																	2688646		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.468C>T	20.37:g.2688646C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Silent	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	p.L256	ENST00000609451.1	37	c.768		20																																																																																			EBF4	-	NULL	ENSG00000088881		0.617	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	EBF4	HGNC	protein_coding	OTTHUMT00000471930.1	72	0.00	0	C	XM_938882		2688646	2688646	+1	no_errors	ENST00000449079	ensembl	human	known	69_37n	silent	148	18.23	33	SNP	1.000	T
EIF4H	7458	genome.wustl.edu	37	7	73588725	73588725	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:73588725C>T	ENST00000265753.8	+	1	151	c.12C>T	c.(10-12)ttC>ttT	p.F4F	EIF4H_ENST00000353999.6_Silent_p.F4F	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	4					cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						TGGCGGACTTCGACACCTACG	0.731																																						dbGAP											0													23.0	22.0	22.0					7																	73588725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.12C>T	7.37:g.73588725C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3R1|D3DXF6|D3DXF8	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F4	ENST00000265753.8	37	c.12	CCDS5564.1	7																																																																																			EIF4H	-	NULL	ENSG00000106682		0.731	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4H	HGNC	protein_coding	OTTHUMT00000252375.2	60	0.00	0	C	NM_022170		73588725	73588725	+1	no_errors	ENST00000265753	ensembl	human	known	69_37n	silent	75	21.05	20	SNP	1.000	T
EIF4H	7458	genome.wustl.edu	37	7	73588725	73588725	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:73588725C>T	ENST00000265753.8	+	1	151	c.12C>T	c.(10-12)ttC>ttT	p.F4F	EIF4H_ENST00000353999.6_Silent_p.F4F	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	4					cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						TGGCGGACTTCGACACCTACG	0.731																																						dbGAP											0													23.0	22.0	22.0					7																	73588725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.12C>T	7.37:g.73588725C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3R1|D3DXF6|D3DXF8	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F4	ENST00000265753.8	37	c.12	CCDS5564.1	7																																																																																			EIF4H	-	NULL	ENSG00000106682		0.731	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4H	HGNC	protein_coding	OTTHUMT00000252375.2	37	0.00	0	C	NM_022170		73588725	73588725	+1	no_errors	ENST00000265753	ensembl	human	known	69_37n	silent	75	21.05	20	SNP	1.000	T
ELOVL7	79993	genome.wustl.edu	37	5	60060094	60060094	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:60060094G>A	ENST00000508821.1	-	7	773	c.459C>T	c.(457-459)atC>atT	p.I153I	ELOVL7_ENST00000505959.1_Silent_p.I140I|ELOVL7_ENST00000438340.1_Silent_p.I153I|ELOVL7_ENST00000425382.1_Silent_p.I153I	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	153					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				TCCACGGCATGATGGTATGAT	0.353																																						dbGAP											0													85.0	82.0	83.0					5																	60060094		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.459C>T	5.37:g.60060094G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q589T3|Q9H5D0|Q9NT66	Silent	SNP	pfam_GNS1_SUR4	p.I153	ENST00000508821.1	37	c.459	CCDS34164.1	5																																																																																			ELOVL7	-	pfam_GNS1_SUR4	ENSG00000164181		0.353	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL7	HGNC	protein_coding	OTTHUMT00000368195.1	34	0.00	0	G			60060094	60060094	-1	no_errors	ENST00000425382	ensembl	human	known	69_37n	silent	42	23.64	13	SNP	1.000	A
ELOVL7	79993	genome.wustl.edu	37	5	60060094	60060094	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:60060094G>A	ENST00000508821.1	-	7	773	c.459C>T	c.(457-459)atC>atT	p.I153I	ELOVL7_ENST00000505959.1_Silent_p.I140I|ELOVL7_ENST00000438340.1_Silent_p.I153I|ELOVL7_ENST00000425382.1_Silent_p.I153I	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	153					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				TCCACGGCATGATGGTATGAT	0.353																																						dbGAP											0													85.0	82.0	83.0					5																	60060094		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.459C>T	5.37:g.60060094G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q589T3|Q9H5D0|Q9NT66	Silent	SNP	pfam_GNS1_SUR4	p.I153	ENST00000508821.1	37	c.459	CCDS34164.1	5																																																																																			ELOVL7	-	pfam_GNS1_SUR4	ENSG00000164181		0.353	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL7	HGNC	protein_coding	OTTHUMT00000368195.1	31	0.00	0	G			60060094	60060094	-1	no_errors	ENST00000425382	ensembl	human	known	69_37n	silent	42	23.64	13	SNP	1.000	A
EMC2	9694	genome.wustl.edu	37	8	109455893	109455893	+	Silent	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr8:109455893G>T	ENST00000220853.3	+	1	41	c.6G>T	c.(4-6)gcG>gcT	p.A2A		NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	2						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											GGAAGATGGCGAAGGTCTCAG	0.607																																						dbGAP											0													47.0	36.0	40.0					8																	109455893		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.6G>T	8.37:g.109455893G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUE1	Silent	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A2	ENST00000220853.3	37	c.6	CCDS6309.1	8																																																																																			EMC2	-	NULL	ENSG00000104412		0.607	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC2	HGNC	protein_coding	OTTHUMT00000380717.1	43	0.00	0	G	NM_014673		109455893	109455893	+1	no_errors	ENST00000220853	ensembl	human	known	69_37n	silent	50	16.67	10	SNP	1.000	T
EMC2	9694	genome.wustl.edu	37	8	109455893	109455893	+	Silent	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr8:109455893G>T	ENST00000220853.3	+	1	41	c.6G>T	c.(4-6)gcG>gcT	p.A2A		NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	2						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											GGAAGATGGCGAAGGTCTCAG	0.607																																						dbGAP											0													47.0	36.0	40.0					8																	109455893		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.6G>T	8.37:g.109455893G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUE1	Silent	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A2	ENST00000220853.3	37	c.6	CCDS6309.1	8																																																																																			EMC2	-	NULL	ENSG00000104412		0.607	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC2	HGNC	protein_coding	OTTHUMT00000380717.1	43	0.00	0	G	NM_014673		109455893	109455893	+1	no_errors	ENST00000220853	ensembl	human	known	69_37n	silent	50	16.67	10	SNP	1.000	T
EPC2	26122	genome.wustl.edu	37	2	149539235	149539235	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr2:149539235G>A	ENST00000258484.6	+	11	1777	c.1743G>A	c.(1741-1743)gaG>gaA	p.E581E		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	581					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		TCACAGAAGAGCAGTTTCAGA	0.398																																						dbGAP											0													89.0	88.0	88.0					2																	149539235		1980	4170	6150	-	-	-	SO:0001819	synonymous_variant	0			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.1743G>A	2.37:g.149539235G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Silent	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.E581	ENST00000258484.6	37	c.1743	CCDS46422.1	2																																																																																			EPC2	-	pfam_Enhancer_polycomb_C	ENSG00000135999		0.398	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPC2	HGNC	protein_coding	OTTHUMT00000332278.1	27	0.00	0	G	NM_015630		149539235	149539235	+1	no_errors	ENST00000258484	ensembl	human	known	69_37n	silent	32	39.62	21	SNP	1.000	A
EPC2	26122	genome.wustl.edu	37	2	149539235	149539235	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:149539235G>A	ENST00000258484.6	+	11	1777	c.1743G>A	c.(1741-1743)gaG>gaA	p.E581E		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	581					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		TCACAGAAGAGCAGTTTCAGA	0.398																																						dbGAP											0													89.0	88.0	88.0					2																	149539235		1980	4170	6150	-	-	-	SO:0001819	synonymous_variant	0			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.1743G>A	2.37:g.149539235G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Silent	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.E581	ENST00000258484.6	37	c.1743	CCDS46422.1	2																																																																																			EPC2	-	pfam_Enhancer_polycomb_C	ENSG00000135999		0.398	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPC2	HGNC	protein_coding	OTTHUMT00000332278.1	30	0.00	0	G	NM_015630		149539235	149539235	+1	no_errors	ENST00000258484	ensembl	human	known	69_37n	silent	32	39.62	21	SNP	1.000	A
EPHB4	2050	genome.wustl.edu	37	7	100416233	100416233	+	Missense_Mutation	SNP	C	C	T	rs146064780		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:100416233C>T	ENST00000358173.3	-	7	1799	c.1331G>A	c.(1330-1332)cGg>cAg	p.R444Q	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000360620.3_Missense_Mutation_p.R444Q|EPHB4_ENST00000477446.1_5'UTR	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	444	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGGTGAGGACCGCGTCACCCG	0.562																																					GBM(200;2113 3072 25865 52728)	dbGAP											0													57.0	50.0	52.0					7																	100416233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1331G>A	7.37:g.100416233C>T	ENSP00000350896:p.Arg444Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.R444Q	ENST00000358173.3	37	c.1331	CCDS5706.1	7	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027825	0.54790	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.56941	0.43;0.43	5.49	5.49	0.81192	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.270585	0.26196	N	0.025763	T	0.38054	0.1026	N	0.20483	0.58	0.35292	D	0.782285	B;B;P	0.42039	0.411;0.119;0.769	B;B;B	0.35899	0.158;0.076;0.213	T	0.52381	-0.8583	10	0.40728	T	0.16	.	16.8538	0.86000	0.0:1.0:0.0:0.0	.	444;444;444	B5A970;Q96L35;P54760	.;.;EPHB4_HUMAN	Q	444	ENSP00000353833:R444Q;ENSP00000350896:R444Q	ENSP00000350896:R444Q	R	-	2	0	EPHB4	100254169	0.002000	0.14202	0.956000	0.39512	0.690000	0.40134	0.992000	0.29667	2.586000	0.87340	0.655000	0.94253	CGG	EPHB4	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196411		0.562	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB4	HGNC	protein_coding	OTTHUMT00000347222.1	48	0.00	0	C	NM_004444		100416233	100416233	-1	no_errors	ENST00000358173	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	0.710	T
EPHB4	2050	genome.wustl.edu	37	7	100416233	100416233	+	Missense_Mutation	SNP	C	C	T	rs146064780		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:100416233C>T	ENST00000358173.3	-	7	1799	c.1331G>A	c.(1330-1332)cGg>cAg	p.R444Q	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000360620.3_Missense_Mutation_p.R444Q|EPHB4_ENST00000477446.1_5'UTR	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	444	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGGTGAGGACCGCGTCACCCG	0.562																																					GBM(200;2113 3072 25865 52728)	dbGAP											0													57.0	50.0	52.0					7																	100416233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1331G>A	7.37:g.100416233C>T	ENSP00000350896:p.Arg444Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.R444Q	ENST00000358173.3	37	c.1331	CCDS5706.1	7	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027825	0.54790	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.56941	0.43;0.43	5.49	5.49	0.81192	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.270585	0.26196	N	0.025763	T	0.38054	0.1026	N	0.20483	0.58	0.35292	D	0.782285	B;B;P	0.42039	0.411;0.119;0.769	B;B;B	0.35899	0.158;0.076;0.213	T	0.52381	-0.8583	10	0.40728	T	0.16	.	16.8538	0.86000	0.0:1.0:0.0:0.0	.	444;444;444	B5A970;Q96L35;P54760	.;.;EPHB4_HUMAN	Q	444	ENSP00000353833:R444Q;ENSP00000350896:R444Q	ENSP00000350896:R444Q	R	-	2	0	EPHB4	100254169	0.002000	0.14202	0.956000	0.39512	0.690000	0.40134	0.992000	0.29667	2.586000	0.87340	0.655000	0.94253	CGG	EPHB4	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196411		0.562	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB4	HGNC	protein_coding	OTTHUMT00000347222.1	26	0.00	0	C	NM_004444		100416233	100416233	-1	no_errors	ENST00000358173	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	0.710	T
ERBB3	2065	genome.wustl.edu	37	12	56478957	56478957	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:56478957A>T	ENST00000267101.3	+	3	853	c.413A>T	c.(412-414)cAg>cTg	p.Q138L	ERBB3_ENST00000415288.2_Missense_Mutation_p.Q79L|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000411731.2_Missense_Mutation_p.Q138L	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	138					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CGCTTGACTCAGCTCACCGGT	0.562																																						dbGAP											0													144.0	130.0	135.0					12																	56478957		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.413A>T	12.37:g.56478957A>T	ENSP00000267101:p.Gln138Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q138L	ENST00000267101.3	37	c.413	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	A	17.66	3.445250	0.63178	.	.	ENSG00000065361	ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	D;D;T;D;D	0.82344	-1.6;-1.6;-1.29;-1.6;-1.6	5.6	5.6	0.85130	EGF receptor, L domain (1);	0.093245	0.46442	D	0.000291	T	0.81959	0.4933	L	0.38175	1.15	0.80722	D	1	B;D	0.56521	0.308;0.976	B;P	0.51516	0.156;0.672	T	0.81195	-0.1043	9	.	.	.	.	14.7672	0.69648	1.0:0.0:0.0:0.0	.	138;138	P21860;P21860-2	ERBB3_HUMAN;.	L	79;138;138;138;79;79	ENSP00000449138:Q79L;ENSP00000267101:Q138L;ENSP00000415753:Q138L;ENSP00000449713:Q79L;ENSP00000408340:Q79L	.	Q	+	2	0	ERBB3	54765224	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	4.852000	0.62904	2.125000	0.65367	0.533000	0.62120	CAG	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000065361		0.562	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	85	0.00	0	A			56478957	56478957	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	63	30.77	28	SNP	1.000	T
ERBB3	2065	genome.wustl.edu	37	12	56478957	56478957	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:56478957A>T	ENST00000267101.3	+	3	853	c.413A>T	c.(412-414)cAg>cTg	p.Q138L	ERBB3_ENST00000415288.2_Missense_Mutation_p.Q79L|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000411731.2_Missense_Mutation_p.Q138L	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	138					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CGCTTGACTCAGCTCACCGGT	0.562																																						dbGAP											0													144.0	130.0	135.0					12																	56478957		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.413A>T	12.37:g.56478957A>T	ENSP00000267101:p.Gln138Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q138L	ENST00000267101.3	37	c.413	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	A	17.66	3.445250	0.63178	.	.	ENSG00000065361	ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	D;D;T;D;D	0.82344	-1.6;-1.6;-1.29;-1.6;-1.6	5.6	5.6	0.85130	EGF receptor, L domain (1);	0.093245	0.46442	D	0.000291	T	0.81959	0.4933	L	0.38175	1.15	0.80722	D	1	B;D	0.56521	0.308;0.976	B;P	0.51516	0.156;0.672	T	0.81195	-0.1043	9	.	.	.	.	14.7672	0.69648	1.0:0.0:0.0:0.0	.	138;138	P21860;P21860-2	ERBB3_HUMAN;.	L	79;138;138;138;79;79	ENSP00000449138:Q79L;ENSP00000267101:Q138L;ENSP00000415753:Q138L;ENSP00000449713:Q79L;ENSP00000408340:Q79L	.	Q	+	2	0	ERBB3	54765224	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	4.852000	0.62904	2.125000	0.65367	0.533000	0.62120	CAG	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000065361		0.562	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	53	0.00	0	A			56478957	56478957	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	63	30.77	28	SNP	1.000	T
EPYC	1833	genome.wustl.edu	37	12	91371965	91371965	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:91371965C>G	ENST00000261172.3	-	3	332	c.240G>C	c.(238-240)caG>caC	p.Q80H		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	80					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						CTTCCTCTTCCTGGGCCTTCT	0.498											OREG0022019	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													102.0	104.0	103.0					12																	91371965		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.240G>C	12.37:g.91371965C>G	ENSP00000261172:p.Gln80His	Somatic	1282	WXS	Illumina GAIIx	Phase_IV	A8K3M7|Q8NEJ5	Missense_Mutation	SNP	pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.Q80H	ENST00000261172.3	37	c.240	CCDS31870.1	12	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.466640	0.01053	.	.	ENSG00000083782	ENST00000261172;ENST00000551767	T;T	0.67698	0.4;-0.28	2.97	-2.07	0.07276	.	0.341661	0.35235	N	0.003352	T	0.41143	0.1146	N	0.14661	0.345	0.09310	N	1	B	0.28512	0.214	B	0.25759	0.063	T	0.22173	-1.0224	10	0.49607	T	0.09	.	7.2238	0.26003	0.0:0.3982:0.0:0.6018	.	80	Q99645	EPYC_HUMAN	H	80	ENSP00000261172:Q80H;ENSP00000448272:Q80H	ENSP00000261172:Q80H	Q	-	3	2	EPYC	89896096	0.005000	0.15991	0.001000	0.08648	0.164000	0.22412	-0.434000	0.06939	-0.553000	0.06158	0.555000	0.69702	CAG	EPYC	-	NULL	ENSG00000083782		0.498	EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPYC	HGNC	protein_coding	OTTHUMT00000407146.2	33	0.00	0	C	NM_004950		91371965	91371965	-1	no_errors	ENST00000261172	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	0.002	G
EPYC	1833	genome.wustl.edu	37	12	91371965	91371965	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:91371965C>G	ENST00000261172.3	-	3	332	c.240G>C	c.(238-240)caG>caC	p.Q80H		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	80					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						CTTCCTCTTCCTGGGCCTTCT	0.498											OREG0022019	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													102.0	104.0	103.0					12																	91371965		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.240G>C	12.37:g.91371965C>G	ENSP00000261172:p.Gln80His	Somatic	1282	WXS	Illumina GAIIx	Phase_IV	A8K3M7|Q8NEJ5	Missense_Mutation	SNP	pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.Q80H	ENST00000261172.3	37	c.240	CCDS31870.1	12	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.466640	0.01053	.	.	ENSG00000083782	ENST00000261172;ENST00000551767	T;T	0.67698	0.4;-0.28	2.97	-2.07	0.07276	.	0.341661	0.35235	N	0.003352	T	0.41143	0.1146	N	0.14661	0.345	0.09310	N	1	B	0.28512	0.214	B	0.25759	0.063	T	0.22173	-1.0224	10	0.49607	T	0.09	.	7.2238	0.26003	0.0:0.3982:0.0:0.6018	.	80	Q99645	EPYC_HUMAN	H	80	ENSP00000261172:Q80H;ENSP00000448272:Q80H	ENSP00000261172:Q80H	Q	-	3	2	EPYC	89896096	0.005000	0.15991	0.001000	0.08648	0.164000	0.22412	-0.434000	0.06939	-0.553000	0.06158	0.555000	0.69702	CAG	EPYC	-	NULL	ENSG00000083782		0.498	EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPYC	HGNC	protein_coding	OTTHUMT00000407146.2	50	0.00	0	C	NM_004950		91371965	91371965	-1	no_errors	ENST00000261172	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	0.002	G
FAM228B	375190	genome.wustl.edu	37	2	24362275	24362275	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:24362275G>A	ENST00000584973.1	+	3	200	c.111G>A	c.(109-111)gaG>gaA	p.E37E	FAM228B_ENST00000420135.2_Silent_p.E132E|FAM228B_ENST00000407625.1_Silent_p.E132E																							ATCCAAAAGAGTATGATCCCT	0.338																																						dbGAP											0													240.0	193.0	207.0					2																	24362275		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000584973.1:c.111G>A	2.37:g.24362275G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.E132	ENST00000584973.1	37	c.396		2																																																																																			FAM228B	-	NULL	ENSG00000219626		0.338	RP11-507M3.1-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	FAM228B	HGNC	protein_coding	OTTHUMT00000443615.1	78	0.00	0	G			24362275	24362275	+1	no_errors	ENST00000420135	ensembl	human	known	69_37n	silent	50	28.57	20	SNP	0.999	A
FAM27A	548321	genome.wustl.edu	37	9	45727956	45727956	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr9:45727956G>C	ENST00000377531.3	+	2	298	c.161G>C	c.(160-162)aGa>aCa	p.R54T				Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member A	54										pancreas(1)	1						ATCCACGCCAGAGAAGATGCT	0.522																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					9p11.2	2012-11-29			ENSG00000182368				19729	protein-coding gene	gene with protein product							Standard			Approved	bA7G23.5, FAM27A1	uc004adn.4	Q5VT28	OTTHUMG00000013310	ENST00000377531.3:c.161G>C	9.37:g.45727956G>C	ENSP00000366754:p.Arg54Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R54T	ENST00000377531.3	37	c.161		9	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.657689	0.00779	.	.	ENSG00000182368	ENST00000377531	.	.	.	0.122	-0.245	0.13027	.	.	.	.	.	T	0.28764	0.0713	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29882	-0.9997	4	0.54805	T	0.06	.	.	.	.	.	.	.	.	T	54	.	ENSP00000366754:R54T	R	+	2	0	FAM27A	45617952	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-1.392000	0.02523	-1.191000	0.02695	-1.184000	0.01707	AGA	FAM27A	-	NULL	ENSG00000182368		0.522	FAM27A-001	KNOWN	basic|appris_principal	protein_coding	FAM27A	HGNC	protein_coding	OTTHUMT00000037100.1	20	0.00	0	G	XM_499145		45727956	45727956	+1	no_errors	ENST00000377531	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	0.001	C
FAM27A	548321	genome.wustl.edu	37	9	45727956	45727956	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr9:45727956G>C	ENST00000377531.3	+	2	298	c.161G>C	c.(160-162)aGa>aCa	p.R54T				Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member A	54										pancreas(1)	1						ATCCACGCCAGAGAAGATGCT	0.522																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					9p11.2	2012-11-29			ENSG00000182368				19729	protein-coding gene	gene with protein product							Standard			Approved	bA7G23.5, FAM27A1	uc004adn.4	Q5VT28	OTTHUMG00000013310	ENST00000377531.3:c.161G>C	9.37:g.45727956G>C	ENSP00000366754:p.Arg54Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R54T	ENST00000377531.3	37	c.161		9	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.657689	0.00779	.	.	ENSG00000182368	ENST00000377531	.	.	.	0.122	-0.245	0.13027	.	.	.	.	.	T	0.28764	0.0713	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29882	-0.9997	4	0.54805	T	0.06	.	.	.	.	.	.	.	.	T	54	.	ENSP00000366754:R54T	R	+	2	0	FAM27A	45617952	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-1.392000	0.02523	-1.191000	0.02695	-1.184000	0.01707	AGA	FAM27A	-	NULL	ENSG00000182368		0.522	FAM27A-001	KNOWN	basic|appris_principal	protein_coding	FAM27A	HGNC	protein_coding	OTTHUMT00000037100.1	27	0.00	0	G	XM_499145		45727956	45727956	+1	no_errors	ENST00000377531	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	0.001	C
FAM90A26	100287045	genome.wustl.edu	37	4	9176201	9176201	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr4:9176201C>T	ENST00000512047.1	+	6	885	c.351C>T	c.(349-351)ctC>ctT	p.L117L	FAM90A26_ENST00000432515.1_Silent_p.L117L					family with sequence similarity 90, member A26																		GGAAGGCTCTCCTCCACATAT	0.552																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					4p16.1	2013-03-06	2013-03-06	2013-03-06	ENSG00000229924	ENSG00000229924			43746	other	unknown			"""family with sequence similarity 90, member A26, pseudogene"""	FAM90A26P			Standard	NG_032089		Approved				OTTHUMG00000160151	ENST00000512047.1:c.351C>T	4.37:g.9176201C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_Znf_CCHC	p.L117	ENST00000512047.1	37	c.351		4																																																																																			FAM90A26P	-	NULL	ENSG00000229924		0.552	FAM90A26-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	FAM90A26P	HGNC	protein_coding	OTTHUMT00000359419.1	14	0.00	0	C	NG_032089		9176201	9176201	+1	no_errors	ENST00000432515	ensembl	human	known	69_37n	silent	3	62.50	5	SNP	0.001	T
FBN2	2201	genome.wustl.edu	37	5	127644944	127644944	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:127644944C>T	ENST00000508053.1	-	47	6322	c.5348G>A	c.(5347-5349)gGa>gAa	p.G1783E	FBN2_ENST00000262464.4_Missense_Mutation_p.G1783E			P35556	FBN2_HUMAN	fibrillin 2	1783	TB 7.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTTACCTGTTCCTGGAGTTGG	0.453																																						dbGAP											0													191.0	142.0	159.0					5																	127644944		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5348G>A	5.37:g.127644944C>T	ENSP00000424571:p.Gly1783Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G1783E	ENST00000508053.1	37	c.5348	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214913	0.58452	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.93488	-3.23;-3.23	4.85	4.85	0.62838	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.53938	D	0.000051	D	0.93096	0.7802	M	0.72576	2.205	0.41006	D	0.984966	P	0.42078	0.77	P	0.46144	0.505	D	0.90978	0.4825	10	0.06099	T	0.92	.	18.5273	0.90976	0.0:1.0:0.0:0.0	.	1783	P35556	FBN2_HUMAN	E	1783	ENSP00000262464:G1783E;ENSP00000424571:G1783E	ENSP00000262464:G1783E	G	-	2	0	FBN2	127672843	1.000000	0.71417	0.998000	0.56505	0.569000	0.35902	1.591000	0.36665	2.681000	0.91329	0.650000	0.86243	GGA	FBN2	-	pirsf_Fibrillin,pfam_TB_dom,superfamily_TB_dom	ENSG00000138829		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	48	0.00	0	C	NM_001999		127644944	127644944	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	58	34.09	30	SNP	1.000	T
FBN2	2201	genome.wustl.edu	37	5	127644944	127644944	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:127644944C>T	ENST00000508053.1	-	47	6322	c.5348G>A	c.(5347-5349)gGa>gAa	p.G1783E	FBN2_ENST00000262464.4_Missense_Mutation_p.G1783E			P35556	FBN2_HUMAN	fibrillin 2	1783	TB 7.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTTACCTGTTCCTGGAGTTGG	0.453																																						dbGAP											0													191.0	142.0	159.0					5																	127644944		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5348G>A	5.37:g.127644944C>T	ENSP00000424571:p.Gly1783Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G1783E	ENST00000508053.1	37	c.5348	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214913	0.58452	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.93488	-3.23;-3.23	4.85	4.85	0.62838	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.53938	D	0.000051	D	0.93096	0.7802	M	0.72576	2.205	0.41006	D	0.984966	P	0.42078	0.77	P	0.46144	0.505	D	0.90978	0.4825	10	0.06099	T	0.92	.	18.5273	0.90976	0.0:1.0:0.0:0.0	.	1783	P35556	FBN2_HUMAN	E	1783	ENSP00000262464:G1783E;ENSP00000424571:G1783E	ENSP00000262464:G1783E	G	-	2	0	FBN2	127672843	1.000000	0.71417	0.998000	0.56505	0.569000	0.35902	1.591000	0.36665	2.681000	0.91329	0.650000	0.86243	GGA	FBN2	-	pirsf_Fibrillin,pfam_TB_dom,superfamily_TB_dom	ENSG00000138829		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	48	0.00	0	C	NM_001999		127644944	127644944	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	58	34.09	30	SNP	1.000	T
FBN2	2201	genome.wustl.edu	37	5	127644963	127644963	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:127644963C>T	ENST00000508053.1	-	47	6303	c.5329G>A	c.(5329-5331)Gaa>Aaa	p.E1777K	FBN2_ENST00000262464.4_Missense_Mutation_p.E1777K			P35556	FBN2_HUMAN	fibrillin 2	1777	TB 7.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGGCATGGTTCACAAGGTTTG	0.453																																						dbGAP											0													196.0	148.0	164.0					5																	127644963		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5329G>A	5.37:g.127644963C>T	ENSP00000424571:p.Glu1777Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.E1777K	ENST00000508053.1	37	c.5329	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.161602	0.94727	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.95885	-3.84;-3.84	4.85	4.85	0.62838	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.56097	D	0.000034	D	0.97222	0.9092	M	0.84082	2.675	0.54753	D	0.999987	D	0.62365	0.991	P	0.57425	0.82	D	0.96915	0.9670	10	0.45353	T	0.12	.	18.5273	0.90976	0.0:1.0:0.0:0.0	.	1777	P35556	FBN2_HUMAN	K	1777	ENSP00000262464:E1777K;ENSP00000424571:E1777K	ENSP00000262464:E1777K	E	-	1	0	FBN2	127672862	1.000000	0.71417	0.998000	0.56505	0.620000	0.37586	5.805000	0.69143	2.681000	0.91329	0.650000	0.86243	GAA	FBN2	-	pirsf_Fibrillin,pfam_TB_dom,superfamily_TB_dom	ENSG00000138829		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	49	0.00	0	C	NM_001999		127644963	127644963	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	54	35.71	30	SNP	1.000	T
FBN2	2201	genome.wustl.edu	37	5	127644963	127644963	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:127644963C>T	ENST00000508053.1	-	47	6303	c.5329G>A	c.(5329-5331)Gaa>Aaa	p.E1777K	FBN2_ENST00000262464.4_Missense_Mutation_p.E1777K			P35556	FBN2_HUMAN	fibrillin 2	1777	TB 7.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGGCATGGTTCACAAGGTTTG	0.453																																						dbGAP											0													196.0	148.0	164.0					5																	127644963		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5329G>A	5.37:g.127644963C>T	ENSP00000424571:p.Glu1777Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.E1777K	ENST00000508053.1	37	c.5329	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.161602	0.94727	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.95885	-3.84;-3.84	4.85	4.85	0.62838	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.56097	D	0.000034	D	0.97222	0.9092	M	0.84082	2.675	0.54753	D	0.999987	D	0.62365	0.991	P	0.57425	0.82	D	0.96915	0.9670	10	0.45353	T	0.12	.	18.5273	0.90976	0.0:1.0:0.0:0.0	.	1777	P35556	FBN2_HUMAN	K	1777	ENSP00000262464:E1777K;ENSP00000424571:E1777K	ENSP00000262464:E1777K	E	-	1	0	FBN2	127672862	1.000000	0.71417	0.998000	0.56505	0.620000	0.37586	5.805000	0.69143	2.681000	0.91329	0.650000	0.86243	GAA	FBN2	-	pirsf_Fibrillin,pfam_TB_dom,superfamily_TB_dom	ENSG00000138829		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	49	0.00	0	C	NM_001999		127644963	127644963	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	54	35.71	30	SNP	1.000	T
FBN2	2201	genome.wustl.edu	37	5	127645092	127645092	+	Splice_Site	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:127645092C>G	ENST00000508053.1	-	47	6175		c.e47-1		FBN2_ENST00000262464.4_Splice_Site			P35556	FBN2_HUMAN	fibrillin 2						anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTTCTCATGTCTATATAAAGA	0.378																																						dbGAP											0													59.0	60.0	60.0					5																	127645092		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5201-1G>C	5.37:g.127645092C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Splice_Site	SNP	-	e41-1	ENST00000508053.1	37	c.5201-1	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467709	0.84533	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5273	0.90976	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBN2	127672991	1.000000	0.71417	0.997000	0.53966	0.938000	0.57974	7.548000	0.82154	2.681000	0.91329	0.650000	0.86243	.	FBN2	-	-	ENSG00000138829		0.378	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	19	0.00	0	C	NM_001999	Intron	127645092	127645092	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	splice_site	14	41.67	10	SNP	1.000	G
FBN2	2201	genome.wustl.edu	37	5	127645092	127645092	+	Splice_Site	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:127645092C>G	ENST00000508053.1	-	47	6175		c.e47-1		FBN2_ENST00000262464.4_Splice_Site			P35556	FBN2_HUMAN	fibrillin 2						anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTTCTCATGTCTATATAAAGA	0.378																																						dbGAP											0													59.0	60.0	60.0					5																	127645092		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5201-1G>C	5.37:g.127645092C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Splice_Site	SNP	-	e41-1	ENST00000508053.1	37	c.5201-1	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467709	0.84533	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5273	0.90976	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBN2	127672991	1.000000	0.71417	0.997000	0.53966	0.938000	0.57974	7.548000	0.82154	2.681000	0.91329	0.650000	0.86243	.	FBN2	-	-	ENSG00000138829		0.378	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	24	0.00	0	C	NM_001999	Intron	127645092	127645092	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	splice_site	14	41.67	10	SNP	1.000	G
FHOD1	29109	genome.wustl.edu	37	16	67281298	67281298	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr16:67281298C>A	ENST00000258201.4	-	1	263	c.16G>T	c.(16-18)Gac>Tac	p.D6Y	SLC9A5_ENST00000299798.11_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	6					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TCCCCGCGGTCTTCCCCGCCC	0.677																																						dbGAP											0													33.0	32.0	32.0					16																	67281298		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.16G>T	16.37:g.67281298C>A	ENSP00000258201:p.Asp6Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.D6Y	ENST00000258201.4	37	c.16	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861925	0.32884	.	.	ENSG00000135723	ENST00000258201	T	0.39056	1.1	5.63	4.68	0.58851	.	0.248625	0.27901	N	0.017387	T	0.29458	0.0734	N	0.14661	0.345	0.22701	N	0.998833	B	0.31790	0.34	B	0.39419	0.299	T	0.24261	-1.0165	10	0.72032	D	0.01	.	6.9669	0.24627	0.1407:0.7106:0.0:0.1487	.	6	Q9Y613	FHOD1_HUMAN	Y	6	ENSP00000258201:D6Y	ENSP00000258201:D6Y	D	-	1	0	FHOD1	65838799	0.974000	0.33945	0.705000	0.30386	0.212000	0.24457	2.189000	0.42621	1.384000	0.46424	-0.254000	0.11334	GAC	FHOD1	-	NULL	ENSG00000135723		0.677	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	55	0.00	0	C			67281298	67281298	-1	no_errors	ENST00000258201	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	0.003	A
FHOD1	29109	genome.wustl.edu	37	16	67281298	67281298	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr16:67281298C>A	ENST00000258201.4	-	1	263	c.16G>T	c.(16-18)Gac>Tac	p.D6Y	SLC9A5_ENST00000299798.11_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	6					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TCCCCGCGGTCTTCCCCGCCC	0.677																																						dbGAP											0													33.0	32.0	32.0					16																	67281298		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.16G>T	16.37:g.67281298C>A	ENSP00000258201:p.Asp6Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.D6Y	ENST00000258201.4	37	c.16	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861925	0.32884	.	.	ENSG00000135723	ENST00000258201	T	0.39056	1.1	5.63	4.68	0.58851	.	0.248625	0.27901	N	0.017387	T	0.29458	0.0734	N	0.14661	0.345	0.22701	N	0.998833	B	0.31790	0.34	B	0.39419	0.299	T	0.24261	-1.0165	10	0.72032	D	0.01	.	6.9669	0.24627	0.1407:0.7106:0.0:0.1487	.	6	Q9Y613	FHOD1_HUMAN	Y	6	ENSP00000258201:D6Y	ENSP00000258201:D6Y	D	-	1	0	FHOD1	65838799	0.974000	0.33945	0.705000	0.30386	0.212000	0.24457	2.189000	0.42621	1.384000	0.46424	-0.254000	0.11334	GAC	FHOD1	-	NULL	ENSG00000135723		0.677	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	45	0.00	0	C			67281298	67281298	-1	no_errors	ENST00000258201	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	0.003	A
GABRG3	2567	genome.wustl.edu	37	15	27725920	27725920	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr15:27725920G>A	ENST00000333743.6	+	6	953	c.699G>A	c.(697-699)gtG>gtA	p.V233V	RP11-100M12.3_ENST00000556642.1_RNA|GABRG3_ENST00000555083.1_Silent_p.V233V	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	233					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGAAATCGTGACAACGTCTG	0.438																																					NSCLC(114;800 1656 7410 37729 45293)	dbGAP											0													52.0	52.0	52.0					15																	27725920		1890	4129	6019	-	-	-	SO:0001819	synonymous_variant	0				CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.699G>A	15.37:g.27725920G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V594|Q9HD46|Q9NYT2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V233	ENST00000333743.6	37	c.699	CCDS45195.1	15																																																																																			GABRG3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000182256		0.438	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	HGNC	protein_coding	OTTHUMT00000103584.2	20	0.00	0	G			27725920	27725920	+1	no_errors	ENST00000333743	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	1.000	A
GABRG3	2567	genome.wustl.edu	37	15	27725920	27725920	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr15:27725920G>A	ENST00000333743.6	+	6	953	c.699G>A	c.(697-699)gtG>gtA	p.V233V	RP11-100M12.3_ENST00000556642.1_RNA|GABRG3_ENST00000555083.1_Silent_p.V233V	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	233					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGAAATCGTGACAACGTCTG	0.438																																					NSCLC(114;800 1656 7410 37729 45293)	dbGAP											0													52.0	52.0	52.0					15																	27725920		1890	4129	6019	-	-	-	SO:0001819	synonymous_variant	0				CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.699G>A	15.37:g.27725920G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V594|Q9HD46|Q9NYT2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V233	ENST00000333743.6	37	c.699	CCDS45195.1	15																																																																																			GABRG3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000182256		0.438	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	HGNC	protein_coding	OTTHUMT00000103584.2	29	0.00	0	G			27725920	27725920	+1	no_errors	ENST00000333743	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	1.000	A
GNPTAB	79158	genome.wustl.edu	37	12	102224414	102224414	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:102224414G>A	ENST00000299314.7	-	1	302	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	GNPTAB_ENST00000549940.1_Silent_p.L14L|GNPTAB_ENST00000549165.1_Silent_p.L14L|GNPTAB_ENST00000392919.4_Silent_p.L14L	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	14					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						CTGTGGGACAGGCAGGTATAG	0.667																																						dbGAP											0													98.0	76.0	83.0					12																	102224414		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.40C>T	12.37:g.102224414G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Silent	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_HAND_2,pfscan_Notch_dom	p.L14	ENST00000299314.7	37	c.40	CCDS9088.1	12																																																																																			GNPTAB	-	NULL	ENSG00000111670		0.667	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	97	0.00	0	G			102224414	102224414	-1	no_errors	ENST00000299314	ensembl	human	known	69_37n	silent	91	31.06	41	SNP	1.000	A
GNPTAB	79158	genome.wustl.edu	37	12	102224414	102224414	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:102224414G>A	ENST00000299314.7	-	1	302	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	GNPTAB_ENST00000549940.1_Silent_p.L14L|GNPTAB_ENST00000549165.1_Silent_p.L14L|GNPTAB_ENST00000392919.4_Silent_p.L14L	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	14					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						CTGTGGGACAGGCAGGTATAG	0.667																																						dbGAP											0													98.0	76.0	83.0					12																	102224414		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.40C>T	12.37:g.102224414G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Silent	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_HAND_2,pfscan_Notch_dom	p.L14	ENST00000299314.7	37	c.40	CCDS9088.1	12																																																																																			GNPTAB	-	NULL	ENSG00000111670		0.667	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	61	0.00	0	G			102224414	102224414	-1	no_errors	ENST00000299314	ensembl	human	known	69_37n	silent	91	31.06	41	SNP	1.000	A
GPR141	353345	genome.wustl.edu	37	7	37780043	37780043	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:37780043G>A	ENST00000447769.1	+	4	337	c.48G>A	c.(46-48)gtG>gtA	p.V16V	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.V16V|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ATCCTATAGTGACACCCCACT	0.488																																						dbGAP											0													170.0	175.0	174.0					7																	37780043		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.48G>A	7.37:g.37780043G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V16	ENST00000447769.1	37	c.48	CCDS5451.1	7																																																																																			GPR141	-	NULL	ENSG00000187037		0.488	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	35	0.00	0	G	NM_181791		37780043	37780043	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	silent	72	27.27	27	SNP	0.017	A
GPR141	353345	genome.wustl.edu	37	7	37780043	37780043	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:37780043G>A	ENST00000447769.1	+	4	337	c.48G>A	c.(46-48)gtG>gtA	p.V16V	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.V16V|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ATCCTATAGTGACACCCCACT	0.488																																						dbGAP											0													170.0	175.0	174.0					7																	37780043		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.48G>A	7.37:g.37780043G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V16	ENST00000447769.1	37	c.48	CCDS5451.1	7																																																																																			GPR141	-	NULL	ENSG00000187037		0.488	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	49	0.00	0	G	NM_181791		37780043	37780043	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	silent	72	27.27	27	SNP	0.017	A
GPR141	353345	genome.wustl.edu	37	7	37780196	37780196	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:37780196G>A	ENST00000447769.1	+	4	490	c.201G>A	c.(199-201)ctG>ctA	p.L67L	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.L67L|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTTTCTGCTGACAGTGCCAT	0.493																																						dbGAP											0													98.0	89.0	92.0					7																	37780196		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.201G>A	7.37:g.37780196G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L67	ENST00000447769.1	37	c.201	CCDS5451.1	7																																																																																			GPR141	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.493	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	59	0.00	0	G	NM_181791		37780196	37780196	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	silent	65	23.26	20	SNP	0.999	A
GPR141	353345	genome.wustl.edu	37	7	37780196	37780196	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:37780196G>A	ENST00000447769.1	+	4	490	c.201G>A	c.(199-201)ctG>ctA	p.L67L	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.L67L|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTTTCTGCTGACAGTGCCAT	0.493																																						dbGAP											0													98.0	89.0	92.0					7																	37780196		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.201G>A	7.37:g.37780196G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L67	ENST00000447769.1	37	c.201	CCDS5451.1	7																																																																																			GPR141	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.493	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	53	0.00	0	G	NM_181791		37780196	37780196	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	silent	65	23.26	20	SNP	0.999	A
GPR141	353345	genome.wustl.edu	37	7	37780202	37780202	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:37780202G>A	ENST00000447769.1	+	4	496	c.207G>A	c.(205-207)gtG>gtA	p.V69V	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.V69V|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGCTGACAGTGCCATTTCGCT	0.493																																						dbGAP											0													100.0	89.0	92.0					7																	37780202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.207G>A	7.37:g.37780202G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V69	ENST00000447769.1	37	c.207	CCDS5451.1	7																																																																																			GPR141	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.493	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	58	0.00	0	G	NM_181791		37780202	37780202	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	silent	66	23.26	20	SNP	1.000	A
GPR141	353345	genome.wustl.edu	37	7	37780202	37780202	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:37780202G>A	ENST00000447769.1	+	4	496	c.207G>A	c.(205-207)gtG>gtA	p.V69V	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.V69V|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGCTGACAGTGCCATTTCGCT	0.493																																						dbGAP											0													100.0	89.0	92.0					7																	37780202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.207G>A	7.37:g.37780202G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V69	ENST00000447769.1	37	c.207	CCDS5451.1	7																																																																																			GPR141	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.493	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	52	0.00	0	G	NM_181791		37780202	37780202	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	silent	66	23.26	20	SNP	1.000	A
GPR141	353345	genome.wustl.edu	37	7	37780232	37780232	+	Missense_Mutation	SNP	G	G	C	rs35825764		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:37780232G>C	ENST00000447769.1	+	4	526	c.237G>C	c.(235-237)aaG>aaC	p.K79N	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.K79N|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCATCAAGAAGACTTGGATGT	0.507																																						dbGAP											0													98.0	83.0	88.0					7																	37780232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.237G>C	7.37:g.37780232G>C	ENSP00000390410:p.Lys79Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K79N	ENST00000447769.1	37	c.237	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	3.447	-0.112728	0.06881	.	.	ENSG00000187037	ENST00000450180;ENST00000447769;ENST00000334425	T;T;T	0.36878	1.23;1.23;1.23	5.27	-2.09	0.07232	GPCR, rhodopsin-like superfamily (1);	2.113260	0.01744	N	0.029550	T	0.23846	0.0577	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.15549	-1.0433	10	0.23302	T	0.38	-0.355	8.3157	0.32100	0.2518:0.3367:0.4115:0.0	.	79	Q7Z602	GP141_HUMAN	N	79	ENSP00000396300:K79N;ENSP00000390410:K79N;ENSP00000334540:K79N	ENSP00000334540:K79N	K	+	3	2	GPR141	37746757	0.000000	0.05858	0.000000	0.03702	0.725000	0.41563	-0.583000	0.05807	-0.229000	0.09854	0.650000	0.86243	AAG	GPR141	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.507	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	56	0.00	0	G	NM_181791		37780232	37780232	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	0.000	C
GPR141	353345	genome.wustl.edu	37	7	37780232	37780232	+	Missense_Mutation	SNP	G	G	C	rs35825764		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:37780232G>C	ENST00000447769.1	+	4	526	c.237G>C	c.(235-237)aaG>aaC	p.K79N	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.K79N|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCATCAAGAAGACTTGGATGT	0.507																																						dbGAP											0													98.0	83.0	88.0					7																	37780232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.237G>C	7.37:g.37780232G>C	ENSP00000390410:p.Lys79Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K79N	ENST00000447769.1	37	c.237	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	3.447	-0.112728	0.06881	.	.	ENSG00000187037	ENST00000450180;ENST00000447769;ENST00000334425	T;T;T	0.36878	1.23;1.23;1.23	5.27	-2.09	0.07232	GPCR, rhodopsin-like superfamily (1);	2.113260	0.01744	N	0.029550	T	0.23846	0.0577	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.15549	-1.0433	10	0.23302	T	0.38	-0.355	8.3157	0.32100	0.2518:0.3367:0.4115:0.0	.	79	Q7Z602	GP141_HUMAN	N	79	ENSP00000396300:K79N;ENSP00000390410:K79N;ENSP00000334540:K79N	ENSP00000334540:K79N	K	+	3	2	GPR141	37746757	0.000000	0.05858	0.000000	0.03702	0.725000	0.41563	-0.583000	0.05807	-0.229000	0.09854	0.650000	0.86243	AAG	GPR141	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.507	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	49	0.00	0	G	NM_181791		37780232	37780232	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	0.000	C
GPR141	353345	genome.wustl.edu	37	7	37780359	37780359	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:37780359G>T	ENST00000447769.1	+	4	653	c.364G>T	c.(364-366)Gac>Tac	p.D122Y	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.D122Y|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CAAGTGCAAAGACAAAGTGGA	0.488																																						dbGAP											0													145.0	138.0	141.0					7																	37780359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.364G>T	7.37:g.37780359G>T	ENSP00000390410:p.Asp122Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.D122Y	ENST00000447769.1	37	c.364	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238159	0.39598	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.36878	1.23;1.23	5.06	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.405184	0.27349	N	0.019774	T	0.55130	0.1901	M	0.67953	2.075	0.80722	D	1	D	0.65815	0.995	D	0.66497	0.944	T	0.59037	-0.7529	10	0.72032	D	0.01	-13.1276	12.7174	0.57123	0.0814:0.0:0.9186:0.0	.	122	Q7Z602	GP141_HUMAN	Y	122	ENSP00000390410:D122Y;ENSP00000334540:D122Y	ENSP00000334540:D122Y	D	+	1	0	GPR141	37746884	1.000000	0.71417	0.880000	0.34516	0.974000	0.67602	3.063000	0.49978	1.274000	0.44362	0.650000	0.86243	GAC	GPR141	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.488	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	51	0.00	0	G	NM_181791		37780359	37780359	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	71	21.11	19	SNP	0.828	T
GPR141	353345	genome.wustl.edu	37	7	37780359	37780359	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:37780359G>T	ENST00000447769.1	+	4	653	c.364G>T	c.(364-366)Gac>Tac	p.D122Y	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.D122Y|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CAAGTGCAAAGACAAAGTGGA	0.488																																						dbGAP											0													145.0	138.0	141.0					7																	37780359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.364G>T	7.37:g.37780359G>T	ENSP00000390410:p.Asp122Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.D122Y	ENST00000447769.1	37	c.364	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238159	0.39598	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.36878	1.23;1.23	5.06	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.405184	0.27349	N	0.019774	T	0.55130	0.1901	M	0.67953	2.075	0.80722	D	1	D	0.65815	0.995	D	0.66497	0.944	T	0.59037	-0.7529	10	0.72032	D	0.01	-13.1276	12.7174	0.57123	0.0814:0.0:0.9186:0.0	.	122	Q7Z602	GP141_HUMAN	Y	122	ENSP00000390410:D122Y;ENSP00000334540:D122Y	ENSP00000334540:D122Y	D	+	1	0	GPR141	37746884	1.000000	0.71417	0.880000	0.34516	0.974000	0.67602	3.063000	0.49978	1.274000	0.44362	0.650000	0.86243	GAC	GPR141	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.488	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	52	0.00	0	G	NM_181791		37780359	37780359	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	71	21.11	19	SNP	0.828	T
GPR141	353345	genome.wustl.edu	37	7	37780730	37780730	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:37780730G>C	ENST00000447769.1	+	4	1024	c.735G>C	c.(733-735)agG>agC	p.R245S	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.R245S|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGTTCTTTAGGATCTATTACT	0.408																																						dbGAP											0													180.0	174.0	176.0					7																	37780730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.735G>C	7.37:g.37780730G>C	ENSP00000390410:p.Arg245Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R245S	ENST00000447769.1	37	c.735	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280820	0.59758	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.37235	1.21;1.21	5.2	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.55000	0.1893	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.53858	-0.8379	10	0.66056	D	0.02	-24.6053	8.4344	0.32778	0.309:0.0:0.691:0.0	.	245	Q7Z602	GP141_HUMAN	S	245	ENSP00000390410:R245S;ENSP00000334540:R245S	ENSP00000334540:R245S	R	+	3	2	GPR141	37747255	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	1.292000	0.33342	0.469000	0.27268	0.655000	0.94253	AGG	GPR141	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.408	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	53	0.00	0	G	NM_181791		37780730	37780730	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	87	23.01	26	SNP	0.998	C
GPR141	353345	genome.wustl.edu	37	7	37780730	37780730	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:37780730G>C	ENST00000447769.1	+	4	1024	c.735G>C	c.(733-735)agG>agC	p.R245S	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.R245S|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGTTCTTTAGGATCTATTACT	0.408																																						dbGAP											0													180.0	174.0	176.0					7																	37780730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.735G>C	7.37:g.37780730G>C	ENSP00000390410:p.Arg245Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R245S	ENST00000447769.1	37	c.735	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280820	0.59758	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.37235	1.21;1.21	5.2	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.55000	0.1893	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.53858	-0.8379	10	0.66056	D	0.02	-24.6053	8.4344	0.32778	0.309:0.0:0.691:0.0	.	245	Q7Z602	GP141_HUMAN	S	245	ENSP00000390410:R245S;ENSP00000334540:R245S	ENSP00000334540:R245S	R	+	3	2	GPR141	37747255	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	1.292000	0.33342	0.469000	0.27268	0.655000	0.94253	AGG	GPR141	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187037		0.408	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	83	0.00	0	G	NM_181791		37780730	37780730	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	87	23.01	26	SNP	0.998	C
GPR141	353345	genome.wustl.edu	37	7	37780877	37780877	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:37780877G>C	ENST00000447769.1	+	4	1171	c.882G>C	c.(880-882)aaG>aaC	p.K294N	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.K294N|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTAAGCAAAAGATAATTGGCT	0.368																																						dbGAP											0													88.0	87.0	87.0					7																	37780877		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.882G>C	7.37:g.37780877G>C	ENSP00000390410:p.Lys294Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K294N	ENST00000447769.1	37	c.882	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065875	0.36470	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.37584	1.19;1.19	5.2	4.27	0.50696	.	0.326797	0.28036	N	0.016848	T	0.26991	0.0661	L	0.51422	1.61	0.80722	D	1	B	0.29627	0.252	B	0.26614	0.071	T	0.05321	-1.0892	10	0.26408	T	0.33	-9.4871	6.162	0.20370	0.0884:0.0:0.6322:0.2794	.	294	Q7Z602	GP141_HUMAN	N	294	ENSP00000390410:K294N;ENSP00000334540:K294N	ENSP00000334540:K294N	K	+	3	2	GPR141	37747402	0.979000	0.34478	1.000000	0.80357	0.979000	0.70002	0.159000	0.16442	2.882000	0.98803	0.655000	0.94253	AAG	GPR141	-	NULL	ENSG00000187037		0.368	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	32	0.00	0	G	NM_181791		37780877	37780877	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	0.998	C
GPR141	353345	genome.wustl.edu	37	7	37780877	37780877	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:37780877G>C	ENST00000447769.1	+	4	1171	c.882G>C	c.(880-882)aaG>aaC	p.K294N	GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.K294N|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTAAGCAAAAGATAATTGGCT	0.368																																						dbGAP											0													88.0	87.0	87.0					7																	37780877		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.882G>C	7.37:g.37780877G>C	ENSP00000390410:p.Lys294Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K294N	ENST00000447769.1	37	c.882	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065875	0.36470	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.37584	1.19;1.19	5.2	4.27	0.50696	.	0.326797	0.28036	N	0.016848	T	0.26991	0.0661	L	0.51422	1.61	0.80722	D	1	B	0.29627	0.252	B	0.26614	0.071	T	0.05321	-1.0892	10	0.26408	T	0.33	-9.4871	6.162	0.20370	0.0884:0.0:0.6322:0.2794	.	294	Q7Z602	GP141_HUMAN	N	294	ENSP00000390410:K294N;ENSP00000334540:K294N	ENSP00000334540:K294N	K	+	3	2	GPR141	37747402	0.979000	0.34478	1.000000	0.80357	0.979000	0.70002	0.159000	0.16442	2.882000	0.98803	0.655000	0.94253	AAG	GPR141	-	NULL	ENSG00000187037		0.368	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	62	0.00	0	G	NM_181791		37780877	37780877	+1	no_errors	ENST00000334425	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	0.998	C
HACE1	57531	genome.wustl.edu	37	6	105239459	105239459	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:105239459G>A	ENST00000262903.4	-	11	1270	c.994C>T	c.(994-996)Cga>Tga	p.R332*	HACE1_ENST00000369125.2_Nonsense_Mutation_p.R332*	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	332					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GGACCAATTCGAAAGACGTGA	0.373																																						dbGAP											0													150.0	146.0	148.0					6																	105239459		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.994C>T	6.37:g.105239459G>A	ENSP00000262903:p.Arg332*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Nonsense_Mutation	SNP	pfam_HECT,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT,prints_Ankyrin_rpt	p.R332*	ENST00000262903.4	37	c.994	CCDS5050.1	6	.	.	.	.	.	.	.	.	.	.	G	40	8.069308	0.98638	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	.	.	.	5.69	5.69	0.88448	.	0.227290	0.46442	D	0.000283	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8148	0.96562	0.0:0.0:1.0:0.0	.	.	.	.	X	332	.	ENSP00000262903:R332X	R	-	1	2	HACE1	105346152	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.368000	0.73104	2.687000	0.91594	0.650000	0.86243	CGA	HACE1	-	NULL	ENSG00000085382		0.373	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	38	0.00	0	G	XM_045095		105239459	105239459	-1	no_errors	ENST00000262903	ensembl	human	known	69_37n	nonsense	51	27.14	19	SNP	1.000	A
HACE1	57531	genome.wustl.edu	37	6	105239459	105239459	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr6:105239459G>A	ENST00000262903.4	-	11	1270	c.994C>T	c.(994-996)Cga>Tga	p.R332*	HACE1_ENST00000369125.2_Nonsense_Mutation_p.R332*	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	332					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GGACCAATTCGAAAGACGTGA	0.373																																						dbGAP											0													150.0	146.0	148.0					6																	105239459		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.994C>T	6.37:g.105239459G>A	ENSP00000262903:p.Arg332*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Nonsense_Mutation	SNP	pfam_HECT,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT,prints_Ankyrin_rpt	p.R332*	ENST00000262903.4	37	c.994	CCDS5050.1	6	.	.	.	.	.	.	.	.	.	.	G	40	8.069308	0.98638	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	.	.	.	5.69	5.69	0.88448	.	0.227290	0.46442	D	0.000283	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8148	0.96562	0.0:0.0:1.0:0.0	.	.	.	.	X	332	.	ENSP00000262903:R332X	R	-	1	2	HACE1	105346152	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.368000	0.73104	2.687000	0.91594	0.650000	0.86243	CGA	HACE1	-	NULL	ENSG00000085382		0.373	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	50	0.00	0	G	XM_045095		105239459	105239459	-1	no_errors	ENST00000262903	ensembl	human	known	69_37n	nonsense	51	27.14	19	SNP	1.000	A
HMCN1	83872	genome.wustl.edu	37	1	186010160	186010160	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:186010160C>T	ENST00000271588.4	+	40	6425	c.6196C>T	c.(6196-6198)Cga>Tga	p.R2066*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.R2066*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2066	Ig-like C2-type 18.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCTGGTGGTCGAATCCTAGC	0.438																																						dbGAP											0													160.0	146.0	151.0					1																	186010160		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6196C>T	1.37:g.186010160C>T	ENSP00000271588:p.Arg2066*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.R2066*	ENST00000271588.4	37	c.6196	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	49	14.996150	0.99818	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.52	4.53	0.55603	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7169	0.85399	0.1381:0.8619:0.0:0.0	.	.	.	.	X	2066	.	ENSP00000271588:R2066X	R	+	1	2	HMCN1	184276783	0.895000	0.30542	1.000000	0.80357	0.990000	0.78478	1.806000	0.38892	2.582000	0.87167	0.585000	0.79938	CGA	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.438	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	69	0.00	0	C	NM_031935		186010160	186010160	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	nonsense	78	44.44	64	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186010160	186010160	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:186010160C>T	ENST00000271588.4	+	40	6425	c.6196C>T	c.(6196-6198)Cga>Tga	p.R2066*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.R2066*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2066	Ig-like C2-type 18.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCTGGTGGTCGAATCCTAGC	0.438																																						dbGAP											0													160.0	146.0	151.0					1																	186010160		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6196C>T	1.37:g.186010160C>T	ENSP00000271588:p.Arg2066*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.R2066*	ENST00000271588.4	37	c.6196	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	49	14.996150	0.99818	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.52	4.53	0.55603	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7169	0.85399	0.1381:0.8619:0.0:0.0	.	.	.	.	X	2066	.	ENSP00000271588:R2066X	R	+	1	2	HMCN1	184276783	0.895000	0.30542	1.000000	0.80357	0.990000	0.78478	1.806000	0.38892	2.582000	0.87167	0.585000	0.79938	CGA	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.438	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	67	0.00	0	C	NM_031935		186010160	186010160	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	nonsense	78	44.44	64	SNP	1.000	T
IGFN1	91156	genome.wustl.edu	37	1	201196213	201196213	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:201196213G>A	ENST00000335211.4	+	23	11120	c.10990G>A	c.(10990-10992)Gac>Aac	p.D3664N	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1207						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTACAGCACTGACCTGCTGGG	0.652																																						dbGAP											0													71.0	48.0	55.0					1																	201196213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10990G>A	1.37:g.201196213G>A	ENSP00000334714:p.Asp3664Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D3664N	ENST00000335211.4	37	c.10990	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	G	1.246	-0.619917	0.03636	.	.	ENSG00000163395	ENST00000335211	T	0.65732	-0.17	5.06	2.14	0.27477	.	0.115963	0.56097	N	0.000024	T	0.43255	0.1239	N	0.02865	-0.47	0.45161	D	0.998175	B	0.26400	0.148	B	0.42087	0.375	T	0.34625	-0.9821	10	0.52906	T	0.07	.	7.2076	0.25915	0.381:0.0:0.619:0.0	.	3664	F8WAI1	.	N	3664	ENSP00000334714:D3664N	ENSP00000334714:D3664N	D	+	1	0	IGFN1	199462836	0.936000	0.31750	0.009000	0.14445	0.014000	0.08584	1.765000	0.38481	0.173000	0.19788	0.561000	0.74099	GAC	IGFN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000163395		0.652	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		53	0.00	0	G	NM_178275		201196213	201196213	+1	no_errors	ENST00000335211	ensembl	human	known	69_37n	missense	51	30.14	22	SNP	0.133	A
IGFN1	91156	genome.wustl.edu	37	1	201196213	201196213	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:201196213G>A	ENST00000335211.4	+	23	11120	c.10990G>A	c.(10990-10992)Gac>Aac	p.D3664N	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1207						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTACAGCACTGACCTGCTGGG	0.652																																						dbGAP											0													71.0	48.0	55.0					1																	201196213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10990G>A	1.37:g.201196213G>A	ENSP00000334714:p.Asp3664Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D3664N	ENST00000335211.4	37	c.10990	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	G	1.246	-0.619917	0.03636	.	.	ENSG00000163395	ENST00000335211	T	0.65732	-0.17	5.06	2.14	0.27477	.	0.115963	0.56097	N	0.000024	T	0.43255	0.1239	N	0.02865	-0.47	0.45161	D	0.998175	B	0.26400	0.148	B	0.42087	0.375	T	0.34625	-0.9821	10	0.52906	T	0.07	.	7.2076	0.25915	0.381:0.0:0.619:0.0	.	3664	F8WAI1	.	N	3664	ENSP00000334714:D3664N	ENSP00000334714:D3664N	D	+	1	0	IGFN1	199462836	0.936000	0.31750	0.009000	0.14445	0.014000	0.08584	1.765000	0.38481	0.173000	0.19788	0.561000	0.74099	GAC	IGFN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000163395		0.652	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		27	0.00	0	G	NM_178275		201196213	201196213	+1	no_errors	ENST00000335211	ensembl	human	known	69_37n	missense	51	30.14	22	SNP	0.133	A
IGSF10	285313	genome.wustl.edu	37	3	151155623	151155623	+	Silent	SNP	T	T	C	rs139571185		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr3:151155623T>C	ENST00000282466.3	-	6	6725	c.6726A>G	c.(6724-6726)acA>acG	p.T2242T	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2242	Ig-like C2-type 9.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGTTCTGTTTGTATACAGAC	0.438																																						dbGAP											0													108.0	97.0	101.0					3																	151155623		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6726A>G	3.37:g.151155623T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.T2242	ENST00000282466.3	37	c.6726	CCDS3160.1	3																																																																																			IGSF10	-	pfscan_Ig-like	ENSG00000152580		0.438	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	35	0.00	0	T	NM_178822		151155623	151155623	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	silent	60	21.05	16	SNP	0.000	C
IGSF10	285313	genome.wustl.edu	37	3	151155623	151155623	+	Silent	SNP	T	T	C	rs139571185		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr3:151155623T>C	ENST00000282466.3	-	6	6725	c.6726A>G	c.(6724-6726)acA>acG	p.T2242T	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2242	Ig-like C2-type 9.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGTTCTGTTTGTATACAGAC	0.438																																						dbGAP											0													108.0	97.0	101.0					3																	151155623		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6726A>G	3.37:g.151155623T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.T2242	ENST00000282466.3	37	c.6726	CCDS3160.1	3																																																																																			IGSF10	-	pfscan_Ig-like	ENSG00000152580		0.438	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	58	0.00	0	T	NM_178822		151155623	151155623	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	silent	60	21.05	16	SNP	0.000	C
IK	3550	genome.wustl.edu	37	5	140038686	140038686	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:140038686C>G	ENST00000417647.2	+	12	1252	c.1113C>G	c.(1111-1113)gaC>gaG	p.D371E		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	371	17 X 2 AA tandem repeats of R-[ED].				cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gagagcgggaccgagagagag	0.542																																						dbGAP											0													69.0	87.0	81.0					5																	140038686		2155	4270	6425	-	-	-	SO:0001583	missense	0			BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.1113C>G	5.37:g.140038686C>G	ENSP00000396301:p.Asp371Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPD8	Missense_Mutation	SNP	pfam_RED_N,pfam_RED_C	p.D371E	ENST00000417647.2	37	c.1113	CCDS47280.1	5	.	.	.	.	.	.	.	.	.	.	C	8.592	0.884837	0.17540	.	.	ENSG00000113141	ENST00000417647	T	0.33438	1.41	4.93	2.03	0.26663	.	0.857165	0.10035	N	0.724279	T	0.09113	0.0225	N	0.02916	-0.46	0.25300	N	0.989281	B	0.02656	0.0	B	0.01281	0.0	T	0.37596	-0.9699	10	0.02654	T	1	.	1.764	0.02998	0.2826:0.419:0.1305:0.1679	.	371	Q13123	RED_HUMAN	E	371	ENSP00000396301:D371E	ENSP00000396301:D371E	D	+	3	2	IK	140018870	0.512000	0.26186	0.947000	0.38551	0.918000	0.54935	-0.065000	0.11617	0.549000	0.28973	0.655000	0.94253	GAC	IK	-	NULL	ENSG00000113141		0.542	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	HGNC	protein_coding	OTTHUMT00000372897.1	41	0.00	0	C	NM_006083		140038686	140038686	+1	no_errors	ENST00000417647	ensembl	human	known	69_37n	missense	43	30.65	19	SNP	0.973	G
IK	3550	genome.wustl.edu	37	5	140038686	140038686	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:140038686C>G	ENST00000417647.2	+	12	1252	c.1113C>G	c.(1111-1113)gaC>gaG	p.D371E		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	371	17 X 2 AA tandem repeats of R-[ED].				cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gagagcgggaccgagagagag	0.542																																						dbGAP											0													69.0	87.0	81.0					5																	140038686		2155	4270	6425	-	-	-	SO:0001583	missense	0			BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.1113C>G	5.37:g.140038686C>G	ENSP00000396301:p.Asp371Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPD8	Missense_Mutation	SNP	pfam_RED_N,pfam_RED_C	p.D371E	ENST00000417647.2	37	c.1113	CCDS47280.1	5	.	.	.	.	.	.	.	.	.	.	C	8.592	0.884837	0.17540	.	.	ENSG00000113141	ENST00000417647	T	0.33438	1.41	4.93	2.03	0.26663	.	0.857165	0.10035	N	0.724279	T	0.09113	0.0225	N	0.02916	-0.46	0.25300	N	0.989281	B	0.02656	0.0	B	0.01281	0.0	T	0.37596	-0.9699	10	0.02654	T	1	.	1.764	0.02998	0.2826:0.419:0.1305:0.1679	.	371	Q13123	RED_HUMAN	E	371	ENSP00000396301:D371E	ENSP00000396301:D371E	D	+	3	2	IK	140018870	0.512000	0.26186	0.947000	0.38551	0.918000	0.54935	-0.065000	0.11617	0.549000	0.28973	0.655000	0.94253	GAC	IK	-	NULL	ENSG00000113141		0.542	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	HGNC	protein_coding	OTTHUMT00000372897.1	34	0.00	0	C	NM_006083		140038686	140038686	+1	no_errors	ENST00000417647	ensembl	human	known	69_37n	missense	43	30.65	19	SNP	0.973	G
INSR	3643	genome.wustl.edu	37	19	7117096	7117096	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:7117096G>A	ENST00000302850.5	-	22	4262	c.4120C>T	c.(4120-4122)Ctg>Ttg	p.L1374L	INSR_ENST00000341500.5_Silent_p.L1362L	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1374					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGCAAGGTCAGAATCCGCCCG	0.587																																						dbGAP											0													129.0	112.0	117.0					19																	7117096		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.4120C>T	19.37:g.7117096G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.L1374	ENST00000302850.5	37	c.4120	CCDS12176.1	19																																																																																			INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt	ENSG00000171105		0.587	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	40	0.00	0	G			7117096	7117096	-1	no_errors	ENST00000302850	ensembl	human	known	69_37n	silent	44	10.20	5	SNP	1.000	A
ITPK1	3705	genome.wustl.edu	37	14	93534384	93534384	+	Intron	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr14:93534384G>A	ENST00000267615.6	-	3	294				ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000555495.1_Intron|ITPK1-AS1_ENST00000553639.1_RNA|ITPK1_ENST00000556603.2_Intron			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase						blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TCTCCACACTGAAACAATGTA	0.348																																						dbGAP											0													14.0	12.0	13.0					14																	93534384		692	1584	2276	-	-	-	SO:0001627	intron_variant	0			U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.120+8555C>T	14.37:g.93534384G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTL6|Q9H2E7	RNA	SNP	-	NULL	ENST00000267615.6	37	NULL	CCDS9907.1	14																																																																																			ITPK1-AS1	-	-	ENSG00000258730		0.348	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1-AS1	HGNC	protein_coding	OTTHUMT00000412421.2	15	0.00	0	G	NM_014216		93534384	93534384	+1	no_errors	ENST00000553639	ensembl	human	known	69_37n	rna	19	42.42	14	SNP	0.000	A
ITPK1	3705	genome.wustl.edu	37	14	93534384	93534384	+	Intron	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr14:93534384G>A	ENST00000267615.6	-	3	294				ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000555495.1_Intron|ITPK1-AS1_ENST00000553639.1_RNA|ITPK1_ENST00000556603.2_Intron			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase						blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TCTCCACACTGAAACAATGTA	0.348																																						dbGAP											0													14.0	12.0	13.0					14																	93534384		692	1584	2276	-	-	-	SO:0001627	intron_variant	0			U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.120+8555C>T	14.37:g.93534384G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTL6|Q9H2E7	RNA	SNP	-	NULL	ENST00000267615.6	37	NULL	CCDS9907.1	14																																																																																			ITPK1-AS1	-	-	ENSG00000258730		0.348	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1-AS1	HGNC	protein_coding	OTTHUMT00000412421.2	27	0.00	0	G	NM_014216		93534384	93534384	+1	no_errors	ENST00000553639	ensembl	human	known	69_37n	rna	19	42.42	14	SNP	0.000	A
JMJD1C	221037	genome.wustl.edu	37	10	64958450	64958451	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr10:64958450_64958451insAT	ENST00000399262.2	-	12	5531_5532	c.5313_5314insAT	c.(5311-5316)gatggtfs	p.G1772fs	JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Frame_Shift_Ins_p.G1553fs|JMJD1C_ENST00000542921.1_Frame_Shift_Ins_p.G1590fs	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1772					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GAAGAGAAACCATCTATTCTAA	0.297																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5312_5313dupAT	10.37:g.64958451_64958452dupAT	ENSP00000382204:p.Gly1772fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Frame_Shift_Ins	INS	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.G1771fs	ENST00000399262.2	37	c.5314_5313	CCDS41532.1	10																																																																																			JMJD1C	-	NULL	ENSG00000171988		0.297	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	28	0.00	0	-	NM_004241		64958450	64958451	-1	no_errors	ENST00000399262	ensembl	human	known	69_37n	frame_shift_ins	18	21.74	5	INS	1.000:1.000	AT
JMJD1C	221037	genome.wustl.edu	37	10	64958450	64958451	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr10:64958450_64958451insAT	ENST00000399262.2	-	12	5531_5532	c.5313_5314insAT	c.(5311-5316)gatggtfs	p.G1772fs	JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Frame_Shift_Ins_p.G1553fs|JMJD1C_ENST00000542921.1_Frame_Shift_Ins_p.G1590fs	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1772					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GAAGAGAAACCATCTATTCTAA	0.297																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5312_5313dupAT	10.37:g.64958451_64958452dupAT	ENSP00000382204:p.Gly1772fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Frame_Shift_Ins	INS	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.G1771fs	ENST00000399262.2	37	c.5314_5313	CCDS41532.1	10																																																																																			JMJD1C	-	NULL	ENSG00000171988		0.297	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	33	0.00	0	-	NM_004241		64958450	64958451	-1	no_errors	ENST00000399262	ensembl	human	known	69_37n	frame_shift_ins	18	21.74	5	INS	1.000:1.000	AT
KANSL3	55683	genome.wustl.edu	37	2	97302708	97302708	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr2:97302708G>A	ENST00000431828.1	-	2	241	c.165C>T	c.(163-165)cgC>cgT	p.R55R	KANSL3_ENST00000441706.2_5'UTR|KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000435669.1_5'UTR|KANSL3_ENST00000599854.1_5'UTR|KANSL3_ENST00000440133.1_5'UTR			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	55					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGCGGGTGGGGCGGGCACTAC	0.572																																						dbGAP											0													41.0	36.0	38.0					2																	97302708		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.165C>T	2.37:g.97302708G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Silent	SNP	NULL	p.R55	ENST00000431828.1	37	c.165	CCDS46361.1	2																																																																																			KANSL3	-	NULL	ENSG00000114982		0.572	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	KANSL3	HGNC	protein_coding	OTTHUMT00000339040.2	44	0.00	0	G	NM_017991		97302708	97302708	-1	no_errors	ENST00000431828	ensembl	human	known	69_37n	silent	37	41.27	26	SNP	0.999	A
KANSL3	55683	genome.wustl.edu	37	2	97302708	97302708	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:97302708G>A	ENST00000431828.1	-	2	241	c.165C>T	c.(163-165)cgC>cgT	p.R55R	KANSL3_ENST00000441706.2_5'UTR|KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000435669.1_5'UTR|KANSL3_ENST00000599854.1_5'UTR|KANSL3_ENST00000440133.1_5'UTR			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	55					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGCGGGTGGGGCGGGCACTAC	0.572																																						dbGAP											0													41.0	36.0	38.0					2																	97302708		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.165C>T	2.37:g.97302708G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Silent	SNP	NULL	p.R55	ENST00000431828.1	37	c.165	CCDS46361.1	2																																																																																			KANSL3	-	NULL	ENSG00000114982		0.572	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	KANSL3	HGNC	protein_coding	OTTHUMT00000339040.2	31	0.00	0	G	NM_017991		97302708	97302708	-1	no_errors	ENST00000431828	ensembl	human	known	69_37n	silent	37	41.27	26	SNP	0.999	A
KCNH1	3756	genome.wustl.edu	37	1	210857193	210857193	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:210857193G>T	ENST00000271751.4	-	11	2427	c.2400C>A	c.(2398-2400)ttC>ttA	p.F800L	KCNH1_ENST00000367007.4_Missense_Mutation_p.F773L			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	800					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		AGGCTGCCTGGAAGGATACGG	0.667																																						dbGAP											0													55.0	55.0	55.0					1																	210857193		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2400C>A	1.37:g.210857193G>T	ENSP00000271751:p.Phe800Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.F800L	ENST00000271751.4	37	c.2400	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	G	2.626	-0.287392	0.05605	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98666	-5.02;-5.06	4.57	3.66	0.41972	.	0.609454	0.18279	N	0.146082	D	0.95617	0.8575	L	0.44542	1.39	0.27904	N	0.938856	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	D	0.86525	0.1818	10	0.06757	T	0.87	.	9.4488	0.38714	0.2303:0.0:0.7697:0.0	.	773;800	Q14CL3;O95259	.;KCNH1_HUMAN	L	800;773	ENSP00000271751:F800L;ENSP00000355974:F773L	ENSP00000271751:F800L	F	-	3	2	KCNH1	208923816	0.319000	0.24607	0.918000	0.36340	0.531000	0.34715	-0.059000	0.11731	0.923000	0.37045	0.561000	0.74099	TTC	KCNH1	-	NULL	ENSG00000143473		0.667	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	78	0.00	0	G	NM_002238		210857193	210857193	-1	no_errors	ENST00000271751	ensembl	human	known	69_37n	missense	98	16.95	20	SNP	0.893	T
KCNH1	3756	genome.wustl.edu	37	1	210857193	210857193	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:210857193G>T	ENST00000271751.4	-	11	2427	c.2400C>A	c.(2398-2400)ttC>ttA	p.F800L	KCNH1_ENST00000367007.4_Missense_Mutation_p.F773L			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	800					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		AGGCTGCCTGGAAGGATACGG	0.667																																						dbGAP											0													55.0	55.0	55.0					1																	210857193		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2400C>A	1.37:g.210857193G>T	ENSP00000271751:p.Phe800Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.F800L	ENST00000271751.4	37	c.2400	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	G	2.626	-0.287392	0.05605	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98666	-5.02;-5.06	4.57	3.66	0.41972	.	0.609454	0.18279	N	0.146082	D	0.95617	0.8575	L	0.44542	1.39	0.27904	N	0.938856	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	D	0.86525	0.1818	10	0.06757	T	0.87	.	9.4488	0.38714	0.2303:0.0:0.7697:0.0	.	773;800	Q14CL3;O95259	.;KCNH1_HUMAN	L	800;773	ENSP00000271751:F800L;ENSP00000355974:F773L	ENSP00000271751:F800L	F	-	3	2	KCNH1	208923816	0.319000	0.24607	0.918000	0.36340	0.531000	0.34715	-0.059000	0.11731	0.923000	0.37045	0.561000	0.74099	TTC	KCNH1	-	NULL	ENSG00000143473		0.667	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	44	0.00	0	G	NM_002238		210857193	210857193	-1	no_errors	ENST00000271751	ensembl	human	known	69_37n	missense	98	16.95	20	SNP	0.893	T
KDM5C	8242	genome.wustl.edu	37	X	53225218	53225218	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:53225218G>A	ENST00000375401.3	-	20	3532	c.3000C>T	c.(2998-3000)gcC>gcT	p.A1000A	KDM5C_ENST00000375379.3_Silent_p.A1000A|KDM5C_ENST00000452825.3_Silent_p.A933A|KDM5C_ENST00000375383.3_Silent_p.A959A|KDM5C_ENST00000404049.3_Silent_p.A999A	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1000					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CCTCAAGTGTGGCTGGTGGAT	0.537			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													121.0	87.0	99.0					X																	53225218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3000C>T	X.37:g.53225218G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.A1000	ENST00000375401.3	37	c.3000	CCDS14351.1	X																																																																																			KDM5C	-	pfam_Lys_sp_deMease_like_dom	ENSG00000126012		0.537	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	101	0.96	1	G	NM_004187		53225218	53225218	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	silent	97	30.71	43	SNP	1.000	A
KDM5C	8242	genome.wustl.edu	37	X	53225218	53225218	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:53225218G>A	ENST00000375401.3	-	20	3532	c.3000C>T	c.(2998-3000)gcC>gcT	p.A1000A	KDM5C_ENST00000375379.3_Silent_p.A1000A|KDM5C_ENST00000452825.3_Silent_p.A933A|KDM5C_ENST00000375383.3_Silent_p.A959A|KDM5C_ENST00000404049.3_Silent_p.A999A	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1000					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CCTCAAGTGTGGCTGGTGGAT	0.537			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													121.0	87.0	99.0					X																	53225218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3000C>T	X.37:g.53225218G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.A1000	ENST00000375401.3	37	c.3000	CCDS14351.1	X																																																																																			KDM5C	-	pfam_Lys_sp_deMease_like_dom	ENSG00000126012		0.537	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	83	0.00	0	G	NM_004187		53225218	53225218	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	silent	97	30.71	43	SNP	1.000	A
ICE1	23379	genome.wustl.edu	37	5	5464182	5464182	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:5464182C>T	ENST00000296564.7	+	13	4957	c.4735C>T	c.(4735-4737)Cat>Tat	p.H1579Y		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1579					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGTTGAAACTCATCAGAGTGA	0.378																																						dbGAP											0													41.0	40.0	40.0					5																	5464182		1836	4093	5929	-	-	-	SO:0001583	missense	0																														ENST00000296564.7:c.4735C>T	5.37:g.5464182C>T	ENSP00000296564:p.His1579Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.H1579Y	ENST00000296564.7	37	c.4735	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482946	0.44147	.	.	ENSG00000164151	ENST00000296564	T	0.10477	2.87	5.05	0.482	0.16815	.	.	.	.	.	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	1	P	0.39352	0.669	B	0.31547	0.132	T	0.39840	-0.9594	9	0.25106	T	0.35	0.457	5.7785	0.18294	0.2809:0.486:0.2331:0.0	.	1579	Q9Y2F5	K0947_HUMAN	Y	1579	ENSP00000296564:H1579Y	ENSP00000296564:H1579Y	H	+	1	0	KIAA0947	5517182	0.000000	0.05858	0.000000	0.03702	0.741000	0.42261	-0.036000	0.12185	0.057000	0.16193	0.460000	0.39030	CAT	KIAA0947	-	NULL	ENSG00000164151		0.378	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	17	0.00	0	C			5464182	5464182	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	0.000	T
ICE1	23379	genome.wustl.edu	37	5	5464182	5464182	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:5464182C>T	ENST00000296564.7	+	13	4957	c.4735C>T	c.(4735-4737)Cat>Tat	p.H1579Y		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1579					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGTTGAAACTCATCAGAGTGA	0.378																																						dbGAP											0													41.0	40.0	40.0					5																	5464182		1836	4093	5929	-	-	-	SO:0001583	missense	0																														ENST00000296564.7:c.4735C>T	5.37:g.5464182C>T	ENSP00000296564:p.His1579Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.H1579Y	ENST00000296564.7	37	c.4735	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482946	0.44147	.	.	ENSG00000164151	ENST00000296564	T	0.10477	2.87	5.05	0.482	0.16815	.	.	.	.	.	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	1	P	0.39352	0.669	B	0.31547	0.132	T	0.39840	-0.9594	9	0.25106	T	0.35	0.457	5.7785	0.18294	0.2809:0.486:0.2331:0.0	.	1579	Q9Y2F5	K0947_HUMAN	Y	1579	ENSP00000296564:H1579Y	ENSP00000296564:H1579Y	H	+	1	0	KIAA0947	5517182	0.000000	0.05858	0.000000	0.03702	0.741000	0.42261	-0.036000	0.12185	0.057000	0.16193	0.460000	0.39030	CAT	KIAA0947	-	NULL	ENSG00000164151		0.378	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	23	0.00	0	C			5464182	5464182	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	0.000	T
KIF13A	63971	genome.wustl.edu	37	6	17834206	17834206	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:17834206C>T	ENST00000259711.6	-	12	1357	c.1252G>A	c.(1252-1254)Gaa>Aaa	p.E418K	KIF13A_ENST00000378826.2_Missense_Mutation_p.E418K|KIF13A_ENST00000378814.5_Missense_Mutation_p.E418K|KIF13A_ENST00000378816.5_Missense_Mutation_p.E418K|KIF13A_ENST00000378843.2_Missense_Mutation_p.E418K	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	418					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E418K(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GCTATCTCTTCTGTTTTTCTC	0.393																																						dbGAP											1	Substitution - Missense(1)	skin(1)											152.0	139.0	143.0					6																	17834206		1838	4092	5930	-	-	-	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1252G>A	6.37:g.17834206C>T	ENSP00000259711:p.Glu418Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E418K	ENST00000259711.6	37	c.1252	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.512032	0.96402	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T	0.75477	-0.92;-0.94;-0.93;-0.92;-0.93	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.86318	0.5904	M	0.82517	2.595	0.80722	D	1	D;D;D;P;D	0.89917	1.0;0.986;0.998;0.85;0.998	D;P;D;P;D	0.80764	0.987;0.771;0.994;0.574;0.994	D	0.87551	0.2465	10	0.87932	D	0	.	19.6718	0.95914	0.0:1.0:0.0:0.0	.	389;418;418;418;418	E7ER65;Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;.;KI13A_HUMAN;.	K	418	ENSP00000368091:E418K;ENSP00000259711:E418K;ENSP00000368103:E418K;ENSP00000368120:E418K;ENSP00000368093:E418K	ENSP00000259711:E418K	E	-	1	0	KIF13A	17942185	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.639000	0.89480	0.557000	0.71058	GAA	KIF13A	-	NULL	ENSG00000137177		0.393	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	57	0.00	0	C			17834206	17834206	-1	no_errors	ENST00000259711	ensembl	human	known	69_37n	missense	96	12.73	14	SNP	1.000	T
KIF13A	63971	genome.wustl.edu	37	6	17834206	17834206	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr6:17834206C>T	ENST00000259711.6	-	12	1357	c.1252G>A	c.(1252-1254)Gaa>Aaa	p.E418K	KIF13A_ENST00000378826.2_Missense_Mutation_p.E418K|KIF13A_ENST00000378814.5_Missense_Mutation_p.E418K|KIF13A_ENST00000378816.5_Missense_Mutation_p.E418K|KIF13A_ENST00000378843.2_Missense_Mutation_p.E418K	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	418					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E418K(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GCTATCTCTTCTGTTTTTCTC	0.393																																						dbGAP											1	Substitution - Missense(1)	skin(1)											152.0	139.0	143.0					6																	17834206		1838	4092	5930	-	-	-	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1252G>A	6.37:g.17834206C>T	ENSP00000259711:p.Glu418Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E418K	ENST00000259711.6	37	c.1252	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.512032	0.96402	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T	0.75477	-0.92;-0.94;-0.93;-0.92;-0.93	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.86318	0.5904	M	0.82517	2.595	0.80722	D	1	D;D;D;P;D	0.89917	1.0;0.986;0.998;0.85;0.998	D;P;D;P;D	0.80764	0.987;0.771;0.994;0.574;0.994	D	0.87551	0.2465	10	0.87932	D	0	.	19.6718	0.95914	0.0:1.0:0.0:0.0	.	389;418;418;418;418	E7ER65;Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;.;KI13A_HUMAN;.	K	418	ENSP00000368091:E418K;ENSP00000259711:E418K;ENSP00000368103:E418K;ENSP00000368120:E418K;ENSP00000368093:E418K	ENSP00000259711:E418K	E	-	1	0	KIF13A	17942185	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.639000	0.89480	0.557000	0.71058	GAA	KIF13A	-	NULL	ENSG00000137177		0.393	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	55	0.00	0	C			17834206	17834206	-1	no_errors	ENST00000259711	ensembl	human	known	69_37n	missense	96	12.73	14	SNP	1.000	T
KLRF2	100431172	genome.wustl.edu	37	12	10048338	10048338	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:10048338G>T	ENST00000535540.1	+	6	637	c.530G>T	c.(529-531)gGa>gTa	p.G177V		NM_001190765.1	NP_001177694.1	D3W0D1	KLRF2_HUMAN	killer cell lectin-like receptor subfamily F, member 2	177	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine secretion (GO:0050663)|natural killer cell degranulation (GO:0043320)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)										GTTATCACAGGAAACTGGGTG	0.418																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS53743.1	12p13.31	2010-06-30				ENSG00000256797		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	37646	protein-coding gene	gene with protein product						20194751	Standard	NM_001190765		Approved	NKp65	uc021quy.1	D3W0D1		ENST00000535540.1:c.530G>T	12.37:g.10048338G>T	ENSP00000438244:p.Gly177Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.G177V	ENST00000535540.1	37	c.530	CCDS53743.1	12	.	.	.	.	.	.	.	.	.	.	G	5.153	0.213845	0.09810	.	.	ENSG00000256797	ENST00000535540	T	0.18657	2.2	1.98	1.03	0.20045	.	.	.	.	.	T	0.13200	0.0320	N	0.25992	0.78	0.09310	N	1	.	.	.	.	.	.	T	0.33497	-0.9866	7	0.22706	T	0.39	.	4.8346	0.13458	0.1951:0.0:0.8049:0.0	.	.	.	.	V	177	ENSP00000438244:G177V	ENSP00000438244:G177V	G	+	2	0	KLRF2	9939605	0.001000	0.12720	0.001000	0.08648	0.058000	0.15608	0.564000	0.23563	0.357000	0.24183	0.313000	0.20887	GGA	KLRF2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000256797		0.418	KLRF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF2	HGNC	protein_coding		55	0.00	0	G	NM_001190765		10048338	10048338	+1	no_errors	ENST00000535540	ensembl	human	known	69_37n	missense	58	24.68	19	SNP	0.001	T
KLRF2	100431172	genome.wustl.edu	37	12	10048338	10048338	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:10048338G>T	ENST00000535540.1	+	6	637	c.530G>T	c.(529-531)gGa>gTa	p.G177V		NM_001190765.1	NP_001177694.1	D3W0D1	KLRF2_HUMAN	killer cell lectin-like receptor subfamily F, member 2	177	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine secretion (GO:0050663)|natural killer cell degranulation (GO:0043320)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)										GTTATCACAGGAAACTGGGTG	0.418																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS53743.1	12p13.31	2010-06-30				ENSG00000256797		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	37646	protein-coding gene	gene with protein product						20194751	Standard	NM_001190765		Approved	NKp65	uc021quy.1	D3W0D1		ENST00000535540.1:c.530G>T	12.37:g.10048338G>T	ENSP00000438244:p.Gly177Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.G177V	ENST00000535540.1	37	c.530	CCDS53743.1	12	.	.	.	.	.	.	.	.	.	.	G	5.153	0.213845	0.09810	.	.	ENSG00000256797	ENST00000535540	T	0.18657	2.2	1.98	1.03	0.20045	.	.	.	.	.	T	0.13200	0.0320	N	0.25992	0.78	0.09310	N	1	.	.	.	.	.	.	T	0.33497	-0.9866	7	0.22706	T	0.39	.	4.8346	0.13458	0.1951:0.0:0.8049:0.0	.	.	.	.	V	177	ENSP00000438244:G177V	ENSP00000438244:G177V	G	+	2	0	KLRF2	9939605	0.001000	0.12720	0.001000	0.08648	0.058000	0.15608	0.564000	0.23563	0.357000	0.24183	0.313000	0.20887	GGA	KLRF2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000256797		0.418	KLRF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF2	HGNC	protein_coding		50	0.00	0	G	NM_001190765		10048338	10048338	+1	no_errors	ENST00000535540	ensembl	human	known	69_37n	missense	58	24.68	19	SNP	0.001	T
KRTAP4-1	85285	genome.wustl.edu	37	17	39340673	39340673	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:39340673G>A	ENST00000398472.1	-	1	921	c.434C>T	c.(433-435)tCt>tTt	p.S145F				Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	145	18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GGTTCAACAAGAGGATCCACA	0.527																																						dbGAP											0													109.0	116.0	113.0					17																	39340673		2142	4271	6413	-	-	-	SO:0001583	missense	0			AC006070		17q21.2	2013-06-25			ENSG00000198443	ENSG00000198443		"""Keratin associated proteins"""	18907	protein-coding gene	gene with protein product			"""keratin associated protein 4-10"""	KRTAP4-10		11279113	Standard	NM_033060		Approved	KAP4.1, KAP4.10	uc002hwe.4	Q9BYQ7	OTTHUMG00000132081	ENST00000398472.1:c.434C>T	17.37:g.39340673G>A	ENSP00000381489:p.Ser145Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWS7|Q3SYF2	Missense_Mutation	SNP	pfam_Keratin-assoc	p.S145F	ENST00000398472.1	37	c.434		17	.	.	.	.	.	.	.	.	.	.	.	11.54	1.668631	0.29604	.	.	ENSG00000198443	ENST00000398472;ENST00000334190	T	0.01560	4.77	4.76	-1.34	0.09143	.	.	.	.	.	T	0.01558	0.0050	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.45234	-0.9275	8	0.66056	D	0.02	.	4.7087	0.12861	0.2693:0.2948:0.436:0.0	.	145	Q9BYQ7	KRA41_HUMAN	F	145;126	ENSP00000381489:S145F	ENSP00000335483:S126F	S	-	2	0	KRTAP4-1	36594199	0.004000	0.15560	0.000000	0.03702	0.010000	0.07245	0.131000	0.15870	-0.157000	0.11059	-0.140000	0.14226	TCT	KRTAP4-1	-	NULL	ENSG00000198443		0.527	KRTAP4-1-001	KNOWN	basic|appris_principal	protein_coding	KRTAP4-1	HGNC	protein_coding	OTTHUMT00000255108.1	105	0.00	0	G	NM_033060		39340673	39340673	-1	no_errors	ENST00000398472	ensembl	human	known	69_37n	missense	79	37.30	47	SNP	0.000	A
KRTAP4-1	85285	genome.wustl.edu	37	17	39340673	39340673	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:39340673G>A	ENST00000398472.1	-	1	921	c.434C>T	c.(433-435)tCt>tTt	p.S145F				Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	145	18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GGTTCAACAAGAGGATCCACA	0.527																																						dbGAP											0													109.0	116.0	113.0					17																	39340673		2142	4271	6413	-	-	-	SO:0001583	missense	0			AC006070		17q21.2	2013-06-25			ENSG00000198443	ENSG00000198443		"""Keratin associated proteins"""	18907	protein-coding gene	gene with protein product			"""keratin associated protein 4-10"""	KRTAP4-10		11279113	Standard	NM_033060		Approved	KAP4.1, KAP4.10	uc002hwe.4	Q9BYQ7	OTTHUMG00000132081	ENST00000398472.1:c.434C>T	17.37:g.39340673G>A	ENSP00000381489:p.Ser145Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWS7|Q3SYF2	Missense_Mutation	SNP	pfam_Keratin-assoc	p.S145F	ENST00000398472.1	37	c.434		17	.	.	.	.	.	.	.	.	.	.	.	11.54	1.668631	0.29604	.	.	ENSG00000198443	ENST00000398472;ENST00000334190	T	0.01560	4.77	4.76	-1.34	0.09143	.	.	.	.	.	T	0.01558	0.0050	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.45234	-0.9275	8	0.66056	D	0.02	.	4.7087	0.12861	0.2693:0.2948:0.436:0.0	.	145	Q9BYQ7	KRA41_HUMAN	F	145;126	ENSP00000381489:S145F	ENSP00000335483:S126F	S	-	2	0	KRTAP4-1	36594199	0.004000	0.15560	0.000000	0.03702	0.010000	0.07245	0.131000	0.15870	-0.157000	0.11059	-0.140000	0.14226	TCT	KRTAP4-1	-	NULL	ENSG00000198443		0.527	KRTAP4-1-001	KNOWN	basic|appris_principal	protein_coding	KRTAP4-1	HGNC	protein_coding	OTTHUMT00000255108.1	94	0.00	0	G	NM_033060		39340673	39340673	-1	no_errors	ENST00000398472	ensembl	human	known	69_37n	missense	79	37.30	47	SNP	0.000	A
LAMA2	3908	genome.wustl.edu	37	6	129722406	129722406	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:129722406T>C	ENST00000421865.2	+	38	5532	c.5483T>C	c.(5482-5484)aTt>aCt	p.I1828T		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1828	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AAACGACAAATTGAGAACACT	0.388																																						dbGAP											0													143.0	141.0	142.0					6																	129722406		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5483T>C	6.37:g.129722406T>C	ENSP00000400365:p.Ile1828Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.I1828T	ENST00000421865.2	37	c.5483	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	T	1.319	-0.600110	0.03744	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.10099	2.91	4.82	2.8	0.32819	Laminin I (1);	0.468291	0.21268	N	0.077361	T	0.01489	0.0048	N	0.12182	0.205	0.27403	N	0.954799	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.48422	-0.9037	10	0.23302	T	0.38	.	6.4265	0.21772	0.0:0.5213:0.0:0.4787	.	1828;1828	A6NF00;P24043	.;LAMA2_HUMAN	T	1828	ENSP00000400365:I1828T	ENSP00000346769:I1828T	I	+	2	0	LAMA2	129764099	1.000000	0.71417	0.987000	0.45799	0.924000	0.55760	1.415000	0.34748	0.395000	0.25257	0.533000	0.62120	ATT	LAMA2	-	pfam_Laminin_I	ENSG00000196569		0.388	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	21	0.00	0	T			129722406	129722406	+1	no_errors	ENST00000421865	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	C
LAMA2	3908	genome.wustl.edu	37	6	129722406	129722406	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr6:129722406T>C	ENST00000421865.2	+	38	5532	c.5483T>C	c.(5482-5484)aTt>aCt	p.I1828T		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1828	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AAACGACAAATTGAGAACACT	0.388																																						dbGAP											0													143.0	141.0	142.0					6																	129722406		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5483T>C	6.37:g.129722406T>C	ENSP00000400365:p.Ile1828Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.I1828T	ENST00000421865.2	37	c.5483	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	T	1.319	-0.600110	0.03744	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.10099	2.91	4.82	2.8	0.32819	Laminin I (1);	0.468291	0.21268	N	0.077361	T	0.01489	0.0048	N	0.12182	0.205	0.27403	N	0.954799	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.48422	-0.9037	10	0.23302	T	0.38	.	6.4265	0.21772	0.0:0.5213:0.0:0.4787	.	1828;1828	A6NF00;P24043	.;LAMA2_HUMAN	T	1828	ENSP00000400365:I1828T	ENSP00000346769:I1828T	I	+	2	0	LAMA2	129764099	1.000000	0.71417	0.987000	0.45799	0.924000	0.55760	1.415000	0.34748	0.395000	0.25257	0.533000	0.62120	ATT	LAMA2	-	pfam_Laminin_I	ENSG00000196569		0.388	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	27	0.00	0	T			129722406	129722406	+1	no_errors	ENST00000421865	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	C
GNB3	2784	genome.wustl.edu	37	12	6947182	6947182	+	5'Flank	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:6947182C>T	ENST00000229264.3	+	0	0				LEPREL2_ENST00000251761.8_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000538102.1_RNA|GNB3_ENST00000435982.2_5'Flank|LEPREL2_ENST00000396725.2_RNA	NM_002075.2	NP_002066.1	P16520	GBB3_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 3						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|stomach(1)	20						CGGAGCCCAACGCCCTCACTG	0.592																																						dbGAP											0													31.0	34.0	33.0					12																	6947182		2073	4214	6287	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS8564.1, CCDS73427.1	12p13	2013-01-10			ENSG00000111664	ENSG00000111664		"""WD repeat domain containing"""	4400	protein-coding gene	gene with protein product		139130				11770079, 16600389	Standard	XM_005253680		Approved		uc001qrd.3	P16520	OTTHUMG00000168517		12.37:g.6947182C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96B71|Q9BQC0	Silent	SNP	smart_Pro_4_hyd_alph	p.N629	ENST00000229264.3	37	c.1887	CCDS8564.1	12																																																																																			LEPREL2	-	smart_Pro_4_hyd_alph	ENSG00000110811		0.592	GNB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPREL2	HGNC	protein_coding	OTTHUMT00000400006.1	40	0.00	0	C	NM_002075		6947182	6947182	+1	no_errors	ENST00000396725	ensembl	human	known	69_37n	silent	37	39.34	24	SNP	0.801	T
GNB3	2784	genome.wustl.edu	37	12	6947182	6947182	+	5'Flank	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:6947182C>T	ENST00000229264.3	+	0	0				LEPREL2_ENST00000251761.8_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000538102.1_RNA|GNB3_ENST00000435982.2_5'Flank|LEPREL2_ENST00000396725.2_RNA	NM_002075.2	NP_002066.1	P16520	GBB3_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 3						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|stomach(1)	20						CGGAGCCCAACGCCCTCACTG	0.592																																						dbGAP											0													31.0	34.0	33.0					12																	6947182		2073	4214	6287	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS8564.1, CCDS73427.1	12p13	2013-01-10			ENSG00000111664	ENSG00000111664		"""WD repeat domain containing"""	4400	protein-coding gene	gene with protein product		139130				11770079, 16600389	Standard	XM_005253680		Approved		uc001qrd.3	P16520	OTTHUMG00000168517		12.37:g.6947182C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96B71|Q9BQC0	Silent	SNP	smart_Pro_4_hyd_alph	p.N629	ENST00000229264.3	37	c.1887	CCDS8564.1	12																																																																																			LEPREL2	-	smart_Pro_4_hyd_alph	ENSG00000110811		0.592	GNB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPREL2	HGNC	protein_coding	OTTHUMT00000400006.1	41	0.00	0	C	NM_002075		6947182	6947182	+1	no_errors	ENST00000396725	ensembl	human	known	69_37n	silent	37	39.34	24	SNP	0.801	T
LMTK2	22853	genome.wustl.edu	37	7	97833267	97833267	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:97833267G>C	ENST00000297293.5	+	13	4545	c.4252G>C	c.(4252-4254)Gag>Cag	p.E1418Q		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1418					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TGGTGGCTTTGAGTGGGATGA	0.498																																						dbGAP											0													85.0	100.0	95.0					7																	97833267		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4252G>C	7.37:g.97833267G>C	ENSP00000297293:p.Glu1418Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1418Q	ENST00000297293.5	37	c.4252	CCDS5654.1	7	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893207	0.91889	.	.	ENSG00000164715	ENST00000297293	D	0.87966	-2.32	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.93762	0.8006	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.93784	0.7086	10	0.72032	D	0.01	.	19.1316	0.93410	0.0:0.0:1.0:0.0	.	1418	Q8IWU2	LMTK2_HUMAN	Q	1418	ENSP00000297293:E1418Q	ENSP00000297293:E1418Q	E	+	1	0	LMTK2	97671203	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	9.434000	0.97515	2.769000	0.95229	0.563000	0.77884	GAG	LMTK2	-	NULL	ENSG00000164715		0.498	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	47	0.00	0	G	NM_014916		97833267	97833267	+1	no_errors	ENST00000297293	ensembl	human	known	69_37n	missense	49	18.03	11	SNP	1.000	C
LMTK2	22853	genome.wustl.edu	37	7	97833267	97833267	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:97833267G>C	ENST00000297293.5	+	13	4545	c.4252G>C	c.(4252-4254)Gag>Cag	p.E1418Q		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1418					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TGGTGGCTTTGAGTGGGATGA	0.498																																						dbGAP											0													85.0	100.0	95.0					7																	97833267		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4252G>C	7.37:g.97833267G>C	ENSP00000297293:p.Glu1418Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1418Q	ENST00000297293.5	37	c.4252	CCDS5654.1	7	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893207	0.91889	.	.	ENSG00000164715	ENST00000297293	D	0.87966	-2.32	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.93762	0.8006	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.93784	0.7086	10	0.72032	D	0.01	.	19.1316	0.93410	0.0:0.0:1.0:0.0	.	1418	Q8IWU2	LMTK2_HUMAN	Q	1418	ENSP00000297293:E1418Q	ENSP00000297293:E1418Q	E	+	1	0	LMTK2	97671203	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	9.434000	0.97515	2.769000	0.95229	0.563000	0.77884	GAG	LMTK2	-	NULL	ENSG00000164715		0.498	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	62	0.00	0	G	NM_014916		97833267	97833267	+1	no_errors	ENST00000297293	ensembl	human	known	69_37n	missense	49	18.03	11	SNP	1.000	C
LRRC70	100130733	genome.wustl.edu	37	5	61875872	61875872	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:61875872C>T	ENST00000334994.5	+	2	846	c.607C>T	c.(607-609)Ctt>Ttt	p.L203F	LRRC70_ENST00000491184.2_Intron|IPO11_ENST00000409296.3_Intron|IPO11_ENST00000409534.1_Intron|LRRC70_ENST00000448151.2_Intron|IPO11_ENST00000325324.6_Intron	NM_181506.4	NP_852607.3	Q7Z2Q7	LRR70_HUMAN	leucine rich repeat containing 70	203						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						CTTTCAACATCTTGAAAACCT	0.338																																						dbGAP											0													121.0	97.0	105.0					5																	61875872		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47218.1	5q12.1	2008-12-18			ENSG00000186105	ENSG00000186105			35155	protein-coding gene	gene with protein product	"""synleurin"""						Standard	NM_181506		Approved	SLRN, LOC100130733	uc011cqs.1	Q7Z2Q7	OTTHUMG00000154401	ENST00000334994.5:c.607C>T	5.37:g.61875872C>T	ENSP00000399441:p.Leu203Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZWI5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L203F	ENST00000334994.5	37	c.607	CCDS47218.1	5	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733465	0.48939	.	.	ENSG00000186105	ENST00000334994	T	0.34667	1.35	4.9	4.03	0.46877	.	.	.	.	.	T	0.41236	0.1150	L	0.60957	1.885	0.80722	D	1	P	0.48350	0.909	P	0.47015	0.534	T	0.24905	-1.0147	8	.	.	.	.	14.1285	0.65238	0.0:0.9235:0.0:0.0765	.	203	Q7Z2Q7	LRR70_HUMAN	F	203	ENSP00000399441:L203F	.	L	+	1	0	LRRC70	61911628	0.998000	0.40836	0.945000	0.38365	0.813000	0.45954	2.844000	0.48246	2.693000	0.91896	0.655000	0.94253	CTT	LRRC70	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000186105		0.338	LRRC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC70	HGNC	protein_coding	OTTHUMT00000335067.3	35	0.00	0	C	XR_042302		61875872	61875872	+1	no_errors	ENST00000334994	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	T
LRSAM1	90678	genome.wustl.edu	37	9	130223502	130223502	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr9:130223502G>A	ENST00000323301.4	+	7	976	c.372G>A	c.(370-372)ggG>ggA	p.G124G	LRSAM1_ENST00000373324.4_Silent_p.G124G|LRSAM1_ENST00000300417.6_Silent_p.G124G|LRSAM1_ENST00000373322.1_Silent_p.G124G	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	124					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GTTCCATTGGGAACCTGACCC	0.547																																						dbGAP											0													107.0	99.0	101.0					9																	130223502		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.372G>A	9.37:g.130223502G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Silent	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.G124	ENST00000323301.4	37	c.372	CCDS6873.1	9																																																																																			LRSAM1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000148356		0.547	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	62	0.00	0	G	NM_138361		130223502	130223502	+1	no_errors	ENST00000300417	ensembl	human	known	69_37n	silent	63	20.25	16	SNP	1.000	A
LRSAM1	90678	genome.wustl.edu	37	9	130223502	130223502	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr9:130223502G>A	ENST00000323301.4	+	7	976	c.372G>A	c.(370-372)ggG>ggA	p.G124G	LRSAM1_ENST00000373324.4_Silent_p.G124G|LRSAM1_ENST00000300417.6_Silent_p.G124G|LRSAM1_ENST00000373322.1_Silent_p.G124G	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	124					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GTTCCATTGGGAACCTGACCC	0.547																																						dbGAP											0													107.0	99.0	101.0					9																	130223502		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.372G>A	9.37:g.130223502G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Silent	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.G124	ENST00000323301.4	37	c.372	CCDS6873.1	9																																																																																			LRSAM1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000148356		0.547	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	43	0.00	0	G	NM_138361		130223502	130223502	+1	no_errors	ENST00000300417	ensembl	human	known	69_37n	silent	63	20.25	16	SNP	1.000	A
MAGEA6	4105	genome.wustl.edu	37	X	151869614	151869614	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:151869614G>C	ENST00000329342.5	+	3	529	c.304G>C	c.(304-306)Gag>Cag	p.E102Q		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	102										breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGACCTGGAGTCTGAGTT	0.547																																						dbGAP											0													125.0	113.0	117.0					X																	151869614		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.304G>C	X.37:g.151869614G>C	ENSP00000329199:p.Glu102Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IF93|Q6NW44	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E102Q	ENST00000329342.5	37	c.304	CCDS14708.1	X	.	.	.	.	.	.	.	.	.	.	g	4.776	0.144212	0.09134	.	.	ENSG00000197172	ENST00000329342;ENST00000412733;ENST00000457643	T;T;T	0.02863	4.52;4.13;4.24	0.605	-1.02	0.10135	.	3.142030	0.00918	N	0.002540	T	0.06280	0.0162	M	0.82630	2.6	0.09310	N	1	B	0.27791	0.189	B	0.24701	0.055	T	0.40869	-0.9540	9	0.59425	D	0.04	.	.	.	.	.	102	P43360	MAGA6_HUMAN	Q	102	ENSP00000329199:E102Q;ENSP00000403303:E102Q;ENSP00000401806:E102Q	ENSP00000329199:E102Q	E	+	1	0	MAGEA6	151620270	0.009000	0.17119	0.001000	0.08648	0.036000	0.12997	0.840000	0.27600	-0.377000	0.07930	0.181000	0.17075	GAG	MAGEA6	-	NULL	ENSG00000197172		0.547	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA6	HGNC	protein_coding	OTTHUMT00000058747.2	121	0.00	0	G	NM_005363		151869614	151869614	+1	no_errors	ENST00000329342	ensembl	human	known	69_37n	missense	163	13.30	25	SNP	0.001	C
MAGEA6	4105	genome.wustl.edu	37	X	151869614	151869614	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:151869614G>C	ENST00000329342.5	+	3	529	c.304G>C	c.(304-306)Gag>Cag	p.E102Q		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	102										breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGACCTGGAGTCTGAGTT	0.547																																						dbGAP											0													125.0	113.0	117.0					X																	151869614		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.304G>C	X.37:g.151869614G>C	ENSP00000329199:p.Glu102Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IF93|Q6NW44	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E102Q	ENST00000329342.5	37	c.304	CCDS14708.1	X	.	.	.	.	.	.	.	.	.	.	g	4.776	0.144212	0.09134	.	.	ENSG00000197172	ENST00000329342;ENST00000412733;ENST00000457643	T;T;T	0.02863	4.52;4.13;4.24	0.605	-1.02	0.10135	.	3.142030	0.00918	N	0.002540	T	0.06280	0.0162	M	0.82630	2.6	0.09310	N	1	B	0.27791	0.189	B	0.24701	0.055	T	0.40869	-0.9540	9	0.59425	D	0.04	.	.	.	.	.	102	P43360	MAGA6_HUMAN	Q	102	ENSP00000329199:E102Q;ENSP00000403303:E102Q;ENSP00000401806:E102Q	ENSP00000329199:E102Q	E	+	1	0	MAGEA6	151620270	0.009000	0.17119	0.001000	0.08648	0.036000	0.12997	0.840000	0.27600	-0.377000	0.07930	0.181000	0.17075	GAG	MAGEA6	-	NULL	ENSG00000197172		0.547	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA6	HGNC	protein_coding	OTTHUMT00000058747.2	130	0.00	0	G	NM_005363		151869614	151869614	+1	no_errors	ENST00000329342	ensembl	human	known	69_37n	missense	163	13.30	25	SNP	0.001	C
MAP7	9053	genome.wustl.edu	37	6	136681924	136681926	+	In_Frame_Del	DEL	CTT	CTT	-	rs143950846|rs181208871	byFrequency	TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:136681924_136681926delCTT	ENST00000354570.3	-	13	2122_2124	c.1712_1714delAAG	c.(1711-1716)gaagct>gct	p.E571del	MAP7_ENST00000544465.1_In_Frame_Del_p.E556del|MAP7_ENST00000432797.2_In_Frame_Del_p.E425del|MAP7_ENST00000438100.2_In_Frame_Del_p.E556del|MAP7_ENST00000454590.1_In_Frame_Del_p.E593del	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	571					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		CGAACGCGAGCTTCTTCTTCTTT	0.601														119	0.023762	0.0862	0.0058	5008	,	,		15142	0.0		0.001	False		,,,				2504	0.0					dbGAP											0									,,,,,,,,,	281,3983		12,257,1863					,,,,,,,,,	5.6	1.0		dbSNP_134	199	44,8208		18,8,4100	no	coding,coding,coding,coding,coding,coding,coding,coding,coding,coding	MAP7	NM_003980.4,NM_001198619.1,NM_001198618.1,NM_001198617.1,NM_001198616.1,NM_001198615.1,NM_001198614.1,NM_001198611.1,NM_001198609.1,NM_001198608.1	,,,,,,,,,	30,265,5963	A1A1,A1R,RR		0.5332,6.5901,2.5967	,,,,,,,,,	,,,,,,,,,		325,12191				-	-	-	SO:0001651	inframe_deletion	0			X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1712_1714delAAG	6.37:g.136681933_136681935delCTT	ENSP00000346581:p.Glu571del	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	In_Frame_Del	DEL	pfam_E-MAP-115	p.E593in_frame_del	ENST00000354570.3	37	c.1780_1778	CCDS5178.1	6																																																																																			MAP7	-	pfam_E-MAP-115	ENSG00000135525		0.601	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP7	HGNC	protein_coding	OTTHUMT00000042382.2	11	0.00	0	CTT	NM_003980		136681924	136681926	-1	no_errors	ENST00000454590	ensembl	human	known	69_37n	in_frame_del	36	33.33	18	DEL	1.000:1.000:1.000	-
MCM10	55388	genome.wustl.edu	37	10	13222545	13222545	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr10:13222545G>A	ENST00000484800.2	+	7	974	c.871G>A	c.(871-873)Gaa>Aaa	p.E291K	MCM10_ENST00000378694.1_Missense_Mutation_p.E290K|MCM10_ENST00000378714.3_Missense_Mutation_p.E290K			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	291	OB-fold domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GAAGCTGGAAGAAATAGATTG	0.423																																						dbGAP											0													199.0	196.0	197.0					10																	13222545		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.871G>A	10.37:g.13222545G>A	ENSP00000418268:p.Glu291Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.E291K	ENST00000484800.2	37	c.871	CCDS7096.1	10	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514599	0.64522	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.18810	2.2;2.2;2.19	5.82	4.86	0.63082	.	0.146817	0.64402	D	0.000009	T	0.25195	0.0612	M	0.71206	2.165	0.46521	D	0.999087	P;B;B	0.45531	0.86;0.058;0.034	B;B;B	0.38616	0.277;0.062;0.028	T	0.05321	-1.0892	10	0.30078	T	0.28	-6.7197	16.3941	0.83550	0.0:0.1314:0.8686:0.0	.	290;290;291	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	K	290;291;291;290	ENSP00000367986:E290K;ENSP00000418268:E291K;ENSP00000367966:E290K	ENSP00000354945:E291K	E	+	1	0	MCM10	13262551	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.169000	0.71913	2.767000	0.95098	0.655000	0.94253	GAA	MCM10	-	NULL	ENSG00000065328		0.423	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	58	0.00	0	G	NM_182751		13222545	13222545	+1	no_errors	ENST00000361282	ensembl	human	known	69_37n	missense	80	10.11	9	SNP	1.000	A
MCM10	55388	genome.wustl.edu	37	10	13222545	13222545	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr10:13222545G>A	ENST00000484800.2	+	7	974	c.871G>A	c.(871-873)Gaa>Aaa	p.E291K	MCM10_ENST00000378694.1_Missense_Mutation_p.E290K|MCM10_ENST00000378714.3_Missense_Mutation_p.E290K			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	291	OB-fold domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GAAGCTGGAAGAAATAGATTG	0.423																																						dbGAP											0													199.0	196.0	197.0					10																	13222545		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.871G>A	10.37:g.13222545G>A	ENSP00000418268:p.Glu291Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.E291K	ENST00000484800.2	37	c.871	CCDS7096.1	10	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514599	0.64522	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.18810	2.2;2.2;2.19	5.82	4.86	0.63082	.	0.146817	0.64402	D	0.000009	T	0.25195	0.0612	M	0.71206	2.165	0.46521	D	0.999087	P;B;B	0.45531	0.86;0.058;0.034	B;B;B	0.38616	0.277;0.062;0.028	T	0.05321	-1.0892	10	0.30078	T	0.28	-6.7197	16.3941	0.83550	0.0:0.1314:0.8686:0.0	.	290;290;291	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	K	290;291;291;290	ENSP00000367986:E290K;ENSP00000418268:E291K;ENSP00000367966:E290K	ENSP00000354945:E291K	E	+	1	0	MCM10	13262551	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.169000	0.71913	2.767000	0.95098	0.655000	0.94253	GAA	MCM10	-	NULL	ENSG00000065328		0.423	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	41	0.00	0	G	NM_182751		13222545	13222545	+1	no_errors	ENST00000361282	ensembl	human	known	69_37n	missense	80	10.11	9	SNP	1.000	A
MRPS6	64968	genome.wustl.edu	37	21	35497440	35497440	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr21:35497440C>G	ENST00000399312.2	+	2	223				MRPS6_ENST00000482679.1_3'UTR|AP000320.7_ENST00000362077.4_RNA	NM_032476.3	NP_115865.1	P82932	RT06_HUMAN	mitochondrial ribosomal protein S6						translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|pancreas(1)|skin(1)	6						ttcctcgtatctgtgagctat	0.453																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB051347	CCDS33548.1	21q22.11	2012-09-13	2002-06-20		ENSG00000243927	ENSG00000243927		"""Mitochondrial ribosomal proteins / small subunits"""	14051	protein-coding gene	gene with protein product		611973	"""chromosome 21 open reading frame 101"""	C21orf101			Standard	NM_032476		Approved	MRP-S6, RPMS6	uc002ytp.2	P82932	OTTHUMG00000065820	ENST00000399312.2:c.46-201C>G	21.37:g.35497440C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R573|Q96Q64|Q9BSK8|Q9BW89	RNA	SNP	-	NULL	ENST00000399312.2	37	NULL	CCDS33548.1	21																																																																																			MRPS6	-	-	ENSG00000243927		0.453	MRPS6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	MRPS6	HGNC	protein_coding	OTTHUMT00000141033.1	56	0.00	0	C	NM_032476		35497440	35497440	+1	no_errors	ENST00000482679	ensembl	human	known	69_37n	rna	44	16.98	9	SNP	0.923	G
MRPS6	64968	genome.wustl.edu	37	21	35497440	35497440	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr21:35497440C>G	ENST00000399312.2	+	2	223				MRPS6_ENST00000482679.1_3'UTR|AP000320.7_ENST00000362077.4_RNA	NM_032476.3	NP_115865.1	P82932	RT06_HUMAN	mitochondrial ribosomal protein S6						translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|pancreas(1)|skin(1)	6						ttcctcgtatctgtgagctat	0.453																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB051347	CCDS33548.1	21q22.11	2012-09-13	2002-06-20		ENSG00000243927	ENSG00000243927		"""Mitochondrial ribosomal proteins / small subunits"""	14051	protein-coding gene	gene with protein product		611973	"""chromosome 21 open reading frame 101"""	C21orf101			Standard	NM_032476		Approved	MRP-S6, RPMS6	uc002ytp.2	P82932	OTTHUMG00000065820	ENST00000399312.2:c.46-201C>G	21.37:g.35497440C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R573|Q96Q64|Q9BSK8|Q9BW89	RNA	SNP	-	NULL	ENST00000399312.2	37	NULL	CCDS33548.1	21																																																																																			MRPS6	-	-	ENSG00000243927		0.453	MRPS6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	MRPS6	HGNC	protein_coding	OTTHUMT00000141033.1	50	0.00	0	C	NM_032476		35497440	35497440	+1	no_errors	ENST00000482679	ensembl	human	known	69_37n	rna	44	16.98	9	SNP	0.923	G
MUC5B	727897	genome.wustl.edu	37	11	1255768	1255768	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr11:1255768C>T	ENST00000529681.1	+	21	2546	c.2488C>T	c.(2488-2490)Cac>Tac	p.H830Y	MUC5B_ENST00000447027.1_Missense_Mutation_p.H833Y	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	830	TIL 3.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTTCAGCACACACTGCGTGTC	0.677																																						dbGAP											0													26.0	31.0	29.0					11																	1255768		2138	4224	6362	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2488C>T	11.37:g.1255768C>T	ENSP00000436812:p.His830Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.H833Y	ENST00000529681.1	37	c.2497	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	c	8.816	0.936359	0.18206	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21543	2.0;2.0	4.83	4.83	0.62350	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	.	.	.	.	T	0.40473	0.1118	L	0.58101	1.795	0.09310	N	1	P;D;D	0.67145	0.866;0.985;0.996	B;P;D	0.63488	0.369;0.728;0.915	T	0.15292	-1.0442	9	0.87932	D	0	.	13.1166	0.59303	0.1602:0.8398:0.0:0.0	.	830;1489;833	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	Y	830;833;831;866	ENSP00000436812:H830Y;ENSP00000415793:H833Y	ENSP00000343037:H831Y	H	+	1	0	MUC5B	1212344	0.000000	0.05858	0.023000	0.16930	0.677000	0.39632	0.909000	0.28558	2.496000	0.84212	0.556000	0.70494	CAC	MUC5B	-	pfam_TIL_dom,superfamily_TIL_dom	ENSG00000117983		0.677	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	100	0.00	0	C	XM_001126093		1255768	1255768	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	0.003	T
MUC5B	727897	genome.wustl.edu	37	11	1255768	1255768	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr11:1255768C>T	ENST00000529681.1	+	21	2546	c.2488C>T	c.(2488-2490)Cac>Tac	p.H830Y	MUC5B_ENST00000447027.1_Missense_Mutation_p.H833Y	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	830	TIL 3.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTTCAGCACACACTGCGTGTC	0.677																																						dbGAP											0													26.0	31.0	29.0					11																	1255768		2138	4224	6362	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2488C>T	11.37:g.1255768C>T	ENSP00000436812:p.His830Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.H833Y	ENST00000529681.1	37	c.2497	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	c	8.816	0.936359	0.18206	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21543	2.0;2.0	4.83	4.83	0.62350	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	.	.	.	.	T	0.40473	0.1118	L	0.58101	1.795	0.09310	N	1	P;D;D	0.67145	0.866;0.985;0.996	B;P;D	0.63488	0.369;0.728;0.915	T	0.15292	-1.0442	9	0.87932	D	0	.	13.1166	0.59303	0.1602:0.8398:0.0:0.0	.	830;1489;833	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	Y	830;833;831;866	ENSP00000436812:H830Y;ENSP00000415793:H833Y	ENSP00000343037:H831Y	H	+	1	0	MUC5B	1212344	0.000000	0.05858	0.023000	0.16930	0.677000	0.39632	0.909000	0.28558	2.496000	0.84212	0.556000	0.70494	CAC	MUC5B	-	pfam_TIL_dom,superfamily_TIL_dom	ENSG00000117983		0.677	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	49	0.00	0	C	XM_001126093		1255768	1255768	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	0.003	T
MXRA5	25878	genome.wustl.edu	37	X	3242930	3242930	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:3242930C>A	ENST00000217939.6	-	5	950	c.796G>T	c.(796-798)Gag>Tag	p.E266*		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	266	LRRCT.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGTGTATCTCATGTTTGTAC	0.428																																						dbGAP											0													76.0	70.0	72.0					X																	3242930		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.796G>T	X.37:g.3242930C>A	ENSP00000217939:p.Glu266*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E266*	ENST00000217939.6	37	c.796	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390290	0.62066	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	.	.	.	3.08	3.08	0.35506	.	0.000000	0.38720	U	0.001600	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	14.1181	0.65167	0.0:1.0:0.0:0.0	.	.	.	.	X	266	.	ENSP00000217939:E266X	E	-	1	0	MXRA5	3252930	0.991000	0.36638	0.022000	0.16811	0.023000	0.10783	3.482000	0.53186	1.172000	0.42781	0.425000	0.28330	GAG	MXRA5	-	smart_Cys-rich_flank_reg_C	ENSG00000101825		0.428	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	80	0.00	0	C	NM_015419		3242930	3242930	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	nonsense	195	16.31	38	SNP	0.987	A
MXRA5	25878	genome.wustl.edu	37	X	3242930	3242930	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:3242930C>A	ENST00000217939.6	-	5	950	c.796G>T	c.(796-798)Gag>Tag	p.E266*		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	266	LRRCT.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGTGTATCTCATGTTTGTAC	0.428																																						dbGAP											0													76.0	70.0	72.0					X																	3242930		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.796G>T	X.37:g.3242930C>A	ENSP00000217939:p.Glu266*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E266*	ENST00000217939.6	37	c.796	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390290	0.62066	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	.	.	.	3.08	3.08	0.35506	.	0.000000	0.38720	U	0.001600	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	14.1181	0.65167	0.0:1.0:0.0:0.0	.	.	.	.	X	266	.	ENSP00000217939:E266X	E	-	1	0	MXRA5	3252930	0.991000	0.36638	0.022000	0.16811	0.023000	0.10783	3.482000	0.53186	1.172000	0.42781	0.425000	0.28330	GAG	MXRA5	-	smart_Cys-rich_flank_reg_C	ENSG00000101825		0.428	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	94	0.00	0	C	NM_015419		3242930	3242930	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	nonsense	195	16.31	38	SNP	0.987	A
NAP1L3	4675	genome.wustl.edu	37	X	92928470	92928470	+	5'UTR	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:92928470C>T	ENST00000373079.3	-	0	97				FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_5'UTR|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000322139.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3						nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						cagaggccggcgctgaggtgg	0.721																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.-167G>A	X.37:g.92928470C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCM0|O60788	RNA	SNP	-	NULL	ENST00000373079.3	37	NULL	CCDS14465.1	X																																																																																			NAP1L3	-	-	ENSG00000186310		0.721	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L3	HGNC	protein_coding	OTTHUMT00000057449.1	63	0.00	0	C	NM_004538		92928470	92928470	-1	no_errors	ENST00000475430	ensembl	human	known	69_37n	rna	91	10.58	11	SNP	0.000	T
NAP1L3	4675	genome.wustl.edu	37	X	92928470	92928470	+	5'UTR	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:92928470C>T	ENST00000373079.3	-	0	97				FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_5'UTR|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000322139.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3						nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						cagaggccggcgctgaggtgg	0.721																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.-167G>A	X.37:g.92928470C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCM0|O60788	RNA	SNP	-	NULL	ENST00000373079.3	37	NULL	CCDS14465.1	X																																																																																			NAP1L3	-	-	ENSG00000186310		0.721	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L3	HGNC	protein_coding	OTTHUMT00000057449.1	70	0.00	0	C	NM_004538		92928470	92928470	-1	no_errors	ENST00000475430	ensembl	human	known	69_37n	rna	91	10.58	11	SNP	0.000	T
NAT9	26151	genome.wustl.edu	37	17	72769777	72769777	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:72769777G>A	ENST00000357814.3	-	3	201	c.128C>T	c.(127-129)tCg>tTg	p.S43L	NAT9_ENST00000583757.1_Missense_Mutation_p.S42L|NAT9_ENST00000580301.1_Missense_Mutation_p.S42L|NAT9_ENST00000581136.1_Missense_Mutation_p.S43L|TMEM104_ENST00000417024.2_5'Flank|NAT9_ENST00000580216.1_5'UTR|NAT9_ENST00000580632.1_Missense_Mutation_p.S42L|TMEM104_ENST00000582773.1_5'Flank|NAT9_ENST00000578822.1_Missense_Mutation_p.S48L|NAT9_ENST00000583476.1_Missense_Mutation_p.S43L|TMEM104_ENST00000582330.1_5'Flank|NAT9_ENST00000582870.1_Missense_Mutation_p.S47L|TMEM104_ENST00000335464.5_5'Flank|NAT9_ENST00000582524.1_Missense_Mutation_p.S43L	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	43	N-acetyltransferase.					protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						CAGCGGCTCCGAGGCTGTCAA	0.587																																						dbGAP											0													110.0	101.0	104.0					17																	72769777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.128C>T	17.37:g.72769777G>A	ENSP00000350467:p.Ser43Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7F0|Q9BTD0|Q9Y3T3	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.S43L	ENST00000357814.3	37	c.128	CCDS11706.1	17	.	.	.	.	.	.	.	.	.	.	G	17.41	3.381691	0.61845	.	.	ENSG00000109065	ENST00000357814	T	0.42513	0.97	4.87	4.87	0.63330	Acyl-CoA N-acyltransferase (2);	0.072630	0.64402	D	0.000016	T	0.75583	0.3869	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83406	0.0025	10	0.56958	D	0.05	-11.0843	18.3781	0.90441	0.0:0.0:1.0:0.0	.	42;43	Q9BTE0-2;Q9BTE0	.;NAT9_HUMAN	L	43	ENSP00000350467:S43L	ENSP00000350467:S43L	S	-	2	0	NAT9	70281372	1.000000	0.71417	0.941000	0.38009	0.941000	0.58515	9.772000	0.98984	2.406000	0.81754	0.313000	0.20887	TCG	NAT9	-	superfamily_Acyl_CoA_acyltransferase	ENSG00000109065		0.587	NAT9-001	KNOWN	basic|CCDS	protein_coding	NAT9	HGNC	protein_coding	OTTHUMT00000443700.1	84	0.00	0	G	NM_015654		72769777	72769777	-1	no_errors	ENST00000357814	ensembl	human	known	69_37n	missense	39	32.76	19	SNP	1.000	A
NAT9	26151	genome.wustl.edu	37	17	72769777	72769777	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:72769777G>A	ENST00000357814.3	-	3	201	c.128C>T	c.(127-129)tCg>tTg	p.S43L	NAT9_ENST00000583757.1_Missense_Mutation_p.S42L|NAT9_ENST00000580301.1_Missense_Mutation_p.S42L|NAT9_ENST00000581136.1_Missense_Mutation_p.S43L|TMEM104_ENST00000417024.2_5'Flank|NAT9_ENST00000580216.1_5'UTR|NAT9_ENST00000580632.1_Missense_Mutation_p.S42L|TMEM104_ENST00000582773.1_5'Flank|NAT9_ENST00000578822.1_Missense_Mutation_p.S48L|NAT9_ENST00000583476.1_Missense_Mutation_p.S43L|TMEM104_ENST00000582330.1_5'Flank|NAT9_ENST00000582870.1_Missense_Mutation_p.S47L|TMEM104_ENST00000335464.5_5'Flank|NAT9_ENST00000582524.1_Missense_Mutation_p.S43L	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	43	N-acetyltransferase.					protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						CAGCGGCTCCGAGGCTGTCAA	0.587																																						dbGAP											0													110.0	101.0	104.0					17																	72769777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.128C>T	17.37:g.72769777G>A	ENSP00000350467:p.Ser43Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7F0|Q9BTD0|Q9Y3T3	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.S43L	ENST00000357814.3	37	c.128	CCDS11706.1	17	.	.	.	.	.	.	.	.	.	.	G	17.41	3.381691	0.61845	.	.	ENSG00000109065	ENST00000357814	T	0.42513	0.97	4.87	4.87	0.63330	Acyl-CoA N-acyltransferase (2);	0.072630	0.64402	D	0.000016	T	0.75583	0.3869	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83406	0.0025	10	0.56958	D	0.05	-11.0843	18.3781	0.90441	0.0:0.0:1.0:0.0	.	42;43	Q9BTE0-2;Q9BTE0	.;NAT9_HUMAN	L	43	ENSP00000350467:S43L	ENSP00000350467:S43L	S	-	2	0	NAT9	70281372	1.000000	0.71417	0.941000	0.38009	0.941000	0.58515	9.772000	0.98984	2.406000	0.81754	0.313000	0.20887	TCG	NAT9	-	superfamily_Acyl_CoA_acyltransferase	ENSG00000109065		0.587	NAT9-001	KNOWN	basic|CCDS	protein_coding	NAT9	HGNC	protein_coding	OTTHUMT00000443700.1	31	0.00	0	G	NM_015654		72769777	72769777	-1	no_errors	ENST00000357814	ensembl	human	known	69_37n	missense	39	32.76	19	SNP	1.000	A
NDC80	10403	genome.wustl.edu	37	18	2595498	2595498	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr18:2595498G>A	ENST00000261597.4	+	11	1281	c.1099G>A	c.(1099-1101)Gag>Aag	p.E367K		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	367	Interaction with NEK2 and ZWINT.|Interaction with PSMC2 and SMC1A.|Interaction with SMC1A.|Interaction with the N-terminus of CDCA1.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						TGCAGACATTGAGCGAATAAA	0.358																																						dbGAP											0													78.0	81.0	80.0					18																	2595498		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1099G>A	18.37:g.2595498G>A	ENSP00000261597:p.Glu367Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.E367K	ENST00000261597.4	37	c.1099	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443155	0.83993	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	T	0.64803	-0.12	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	M	0.66939	2.045	0.53005	D	0.999965	P	0.48503	0.911	P	0.48089	0.566	T	0.62613	-0.6817	10	0.23302	T	0.38	-15.8263	13.8534	0.63510	0.0731:0.0:0.9269:0.0	.	367	O14777	NDC80_HUMAN	K	367	ENSP00000261597:E367K	ENSP00000261597:E367K	E	+	1	0	NDC80	2585498	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.304000	0.65744	2.625000	0.88918	0.650000	0.86243	GAG	NDC80	-	NULL	ENSG00000080986		0.358	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	27	0.00	0	G	NM_006101		2595498	2595498	+1	no_errors	ENST00000261597	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	1.000	A
NDC80	10403	genome.wustl.edu	37	18	2595498	2595498	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr18:2595498G>A	ENST00000261597.4	+	11	1281	c.1099G>A	c.(1099-1101)Gag>Aag	p.E367K		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	367	Interaction with NEK2 and ZWINT.|Interaction with PSMC2 and SMC1A.|Interaction with SMC1A.|Interaction with the N-terminus of CDCA1.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						TGCAGACATTGAGCGAATAAA	0.358																																						dbGAP											0													78.0	81.0	80.0					18																	2595498		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1099G>A	18.37:g.2595498G>A	ENSP00000261597:p.Glu367Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.E367K	ENST00000261597.4	37	c.1099	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443155	0.83993	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	T	0.64803	-0.12	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	M	0.66939	2.045	0.53005	D	0.999965	P	0.48503	0.911	P	0.48089	0.566	T	0.62613	-0.6817	10	0.23302	T	0.38	-15.8263	13.8534	0.63510	0.0731:0.0:0.9269:0.0	.	367	O14777	NDC80_HUMAN	K	367	ENSP00000261597:E367K	ENSP00000261597:E367K	E	+	1	0	NDC80	2585498	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.304000	0.65744	2.625000	0.88918	0.650000	0.86243	GAG	NDC80	-	NULL	ENSG00000080986		0.358	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	24	0.00	0	G	NM_006101		2595498	2595498	+1	no_errors	ENST00000261597	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	1.000	A
NDUFAF2	91942	genome.wustl.edu	37	5	60241212	60241212	+	Intron	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:60241212G>C	ENST00000296597.5	+	1	254				ERCC8_ENST00000543101.1_5'Flank|ERCC8_ENST00000426742.2_5'Flank|NDUFAF2_ENST00000511107.1_Missense_Mutation_p.E44Q|ERCC8_ENST00000265038.5_5'Flank	NM_174889.4	NP_777549.1	Q8N183	MIMIT_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 2						negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)	mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|ovary(1)	6		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)				CTGGAGAGGTGAGGTGGCGGC	0.542																																						dbGAP											0													66.0	55.0	59.0					5																	60241212		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB183433	CCDS3979.1	5q12.1	2012-10-12	2012-05-08	2008-02-15	ENSG00000164182	ENSG00000164182		"""Mitochondrial respiratory chain complex assembly factors"""	28086	protein-coding gene	gene with protein product	"""Myc-induced mitochondrial protein"""	609653	"""NDUFA12-like"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2"""	NDUFA12L		15774466, 16200211, 17383918	Standard	NM_174889		Approved	B17.2L, MMTN, mimitin	uc003jsp.4	Q8N183	OTTHUMG00000131221	ENST00000296597.5:c.127+3G>C	5.37:g.60241212G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5I1	Missense_Mutation	SNP	NULL	p.E44Q	ENST00000296597.5	37	c.130	CCDS3979.1	5	.	.	.	.	.	.	.	.	.	.	G	8.883	0.952034	0.18431	.	.	ENSG00000164182	ENST00000511107	T	0.74947	-0.89	5.36	5.36	0.76844	.	.	.	.	.	T	0.52629	0.1746	.	.	.	0.21445	N	0.999689	.	.	.	.	.	.	T	0.23332	-1.0191	6	0.02654	T	1	.	14.4712	0.67517	0.0:0.0:1.0:0.0	.	.	.	.	Q	44	ENSP00000423377:E44Q	ENSP00000423377:E44Q	E	+	1	0	NDUFAF2	60276969	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	2.607000	0.46300	2.783000	0.95769	0.655000	0.94253	GAG	NDUFAF2	-	NULL	ENSG00000164182		0.542	NDUFAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF2	HGNC	protein_coding	OTTHUMT00000253965.1	65	0.00	0	G	NM_174889		60241212	60241212	+1	no_errors	ENST00000511107	ensembl	human	putative	69_37n	missense	95	11.21	12	SNP	1.000	C
NDUFAF2	91942	genome.wustl.edu	37	5	60241212	60241212	+	Intron	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:60241212G>C	ENST00000296597.5	+	1	254				ERCC8_ENST00000543101.1_5'Flank|ERCC8_ENST00000426742.2_5'Flank|NDUFAF2_ENST00000511107.1_Missense_Mutation_p.E44Q|ERCC8_ENST00000265038.5_5'Flank	NM_174889.4	NP_777549.1	Q8N183	MIMIT_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 2						negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)	mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|ovary(1)	6		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)				CTGGAGAGGTGAGGTGGCGGC	0.542																																						dbGAP											0													66.0	55.0	59.0					5																	60241212		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB183433	CCDS3979.1	5q12.1	2012-10-12	2012-05-08	2008-02-15	ENSG00000164182	ENSG00000164182		"""Mitochondrial respiratory chain complex assembly factors"""	28086	protein-coding gene	gene with protein product	"""Myc-induced mitochondrial protein"""	609653	"""NDUFA12-like"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2"""	NDUFA12L		15774466, 16200211, 17383918	Standard	NM_174889		Approved	B17.2L, MMTN, mimitin	uc003jsp.4	Q8N183	OTTHUMG00000131221	ENST00000296597.5:c.127+3G>C	5.37:g.60241212G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5I1	Missense_Mutation	SNP	NULL	p.E44Q	ENST00000296597.5	37	c.130	CCDS3979.1	5	.	.	.	.	.	.	.	.	.	.	G	8.883	0.952034	0.18431	.	.	ENSG00000164182	ENST00000511107	T	0.74947	-0.89	5.36	5.36	0.76844	.	.	.	.	.	T	0.52629	0.1746	.	.	.	0.21445	N	0.999689	.	.	.	.	.	.	T	0.23332	-1.0191	6	0.02654	T	1	.	14.4712	0.67517	0.0:0.0:1.0:0.0	.	.	.	.	Q	44	ENSP00000423377:E44Q	ENSP00000423377:E44Q	E	+	1	0	NDUFAF2	60276969	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	2.607000	0.46300	2.783000	0.95769	0.655000	0.94253	GAG	NDUFAF2	-	NULL	ENSG00000164182		0.542	NDUFAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF2	HGNC	protein_coding	OTTHUMT00000253965.1	66	0.00	0	G	NM_174889		60241212	60241212	+1	no_errors	ENST00000511107	ensembl	human	putative	69_37n	missense	95	11.21	12	SNP	1.000	C
NLGN3	54413	genome.wustl.edu	37	X	70390825	70390825	+	IGR	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:70390825C>T	ENST00000358741.3	+	0	3046				NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_3'UTR|NLGN3_ENST00000374051.3_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3						adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GGTTTTGCCTCTGCCCTTGGG	0.463																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790		X.37:g.70390825C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	RNA	SNP	-	NULL	ENST00000358741.3	37	NULL	CCDS55441.1	X																																																																																			NLGN3	-	-	ENSG00000196338		0.463	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	82	0.00	0	C	NM_018977		70390825	70390825	+1	no_errors	ENST00000476589	ensembl	human	known	69_37n	rna	88	22.12	25	SNP	0.931	T
NLGN3	54413	genome.wustl.edu	37	X	70390825	70390825	+	IGR	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:70390825C>T	ENST00000358741.3	+	0	3046				NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_3'UTR|NLGN3_ENST00000374051.3_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3						adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GGTTTTGCCTCTGCCCTTGGG	0.463																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790		X.37:g.70390825C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	RNA	SNP	-	NULL	ENST00000358741.3	37	NULL	CCDS55441.1	X																																																																																			NLGN3	-	-	ENSG00000196338		0.463	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	70	0.00	0	C	NM_018977		70390825	70390825	+1	no_errors	ENST00000476589	ensembl	human	known	69_37n	rna	88	22.12	25	SNP	0.931	T
OLFML3	56944	genome.wustl.edu	37	1	114523992	114523992	+	Silent	SNP	C	C	T	rs200705182		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:114523992C>T	ENST00000320334.4	+	3	896	c.822C>T	c.(820-822)atC>atT	p.I274I	OLFML3_ENST00000369551.1_Silent_p.I254I|OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000393300.2_Silent_p.I254I	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	274	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACACCTACATCGACCTGGCAG	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		18212	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	71.0	75.0					1																	114523992		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.822C>T	1.37:g.114523992C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Silent	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.I274	ENST00000320334.4	37	c.822	CCDS870.1	1																																																																																			OLFML3	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000116774		0.552	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	33	0.00	0	C	NM_020190		114523992	114523992	+1	no_errors	ENST00000320334	ensembl	human	known	69_37n	silent	42	26.32	15	SNP	0.249	T
OLFML3	56944	genome.wustl.edu	37	1	114523992	114523992	+	Silent	SNP	C	C	T	rs200705182		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:114523992C>T	ENST00000320334.4	+	3	896	c.822C>T	c.(820-822)atC>atT	p.I274I	OLFML3_ENST00000369551.1_Silent_p.I254I|OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000393300.2_Silent_p.I254I	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	274	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACACCTACATCGACCTGGCAG	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		18212	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	71.0	75.0					1																	114523992		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.822C>T	1.37:g.114523992C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Silent	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.I274	ENST00000320334.4	37	c.822	CCDS870.1	1																																																																																			OLFML3	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000116774		0.552	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	34	0.00	0	C	NM_020190		114523992	114523992	+1	no_errors	ENST00000320334	ensembl	human	known	69_37n	silent	42	26.32	15	SNP	0.249	T
OR2M4	26245	genome.wustl.edu	37	1	248402479	248402479	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:248402479C>T	ENST00000306687.1	+	1	249	c.249C>T	c.(247-249)ttC>ttT	p.F83F		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	83					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AGATGATCTTCAGCTACTTGT	0.473																																						dbGAP											0													172.0	152.0	159.0					1																	248402479		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.249C>T	1.37:g.248402479C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15611|Q8NG82	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F83	ENST00000306687.1	37	c.249	CCDS31108.1	1																																																																																			OR2M4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171180		0.473	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	HGNC	protein_coding	OTTHUMT00000097352.1	70	0.00	0	C	NM_017504		248402479	248402479	+1	no_errors	ENST00000306687	ensembl	human	known	69_37n	silent	109	16.79	22	SNP	0.000	T
OR2M4	26245	genome.wustl.edu	37	1	248402479	248402479	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:248402479C>T	ENST00000306687.1	+	1	249	c.249C>T	c.(247-249)ttC>ttT	p.F83F		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	83					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AGATGATCTTCAGCTACTTGT	0.473																																						dbGAP											0													172.0	152.0	159.0					1																	248402479		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.249C>T	1.37:g.248402479C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15611|Q8NG82	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F83	ENST00000306687.1	37	c.249	CCDS31108.1	1																																																																																			OR2M4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171180		0.473	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	HGNC	protein_coding	OTTHUMT00000097352.1	84	0.00	0	C	NM_017504		248402479	248402479	+1	no_errors	ENST00000306687	ensembl	human	known	69_37n	silent	109	16.79	22	SNP	0.000	T
OSBPL3	26031	genome.wustl.edu	37	7	24905791	24905791	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:24905791C>T	ENST00000313367.2	-	6	898	c.447G>A	c.(445-447)caG>caA	p.Q149Q	OSBPL3_ENST00000352860.1_Silent_p.Q149Q|OSBPL3_ENST00000396429.1_Silent_p.Q149Q|OSBPL3_ENST00000353930.1_Silent_p.Q149Q|OSBPL3_ENST00000409069.1_Silent_p.Q149Q|OSBPL3_ENST00000431825.2_Silent_p.Q149Q|OSBPL3_ENST00000396431.1_Silent_p.Q149Q	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	149					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CAATTTCATTCTGACGATACA	0.403																																						dbGAP											0													165.0	136.0	145.0					7																	24905791		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.447G>A	7.37:g.24905791C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q149	ENST00000313367.2	37	c.447	CCDS5390.1	7																																																																																			OSBPL3	-	NULL	ENSG00000070882		0.403	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	HGNC	protein_coding	OTTHUMT00000214085.2	35	0.00	0	C			24905791	24905791	-1	no_errors	ENST00000313367	ensembl	human	known	69_37n	silent	52	11.86	7	SNP	1.000	T
OSBPL3	26031	genome.wustl.edu	37	7	24905791	24905791	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:24905791C>T	ENST00000313367.2	-	6	898	c.447G>A	c.(445-447)caG>caA	p.Q149Q	OSBPL3_ENST00000352860.1_Silent_p.Q149Q|OSBPL3_ENST00000396429.1_Silent_p.Q149Q|OSBPL3_ENST00000353930.1_Silent_p.Q149Q|OSBPL3_ENST00000409069.1_Silent_p.Q149Q|OSBPL3_ENST00000431825.2_Silent_p.Q149Q|OSBPL3_ENST00000396431.1_Silent_p.Q149Q	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	149					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CAATTTCATTCTGACGATACA	0.403																																						dbGAP											0													165.0	136.0	145.0					7																	24905791		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.447G>A	7.37:g.24905791C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q149	ENST00000313367.2	37	c.447	CCDS5390.1	7																																																																																			OSBPL3	-	NULL	ENSG00000070882		0.403	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	HGNC	protein_coding	OTTHUMT00000214085.2	43	0.00	0	C			24905791	24905791	-1	no_errors	ENST00000313367	ensembl	human	known	69_37n	silent	52	11.86	7	SNP	1.000	T
OTOG	340990	genome.wustl.edu	37	11	17623848	17623848	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr11:17623848G>A	ENST00000399391.2	+	31	3837	c.3837G>A	c.(3835-3837)gtG>gtA	p.V1279V	OTOG_ENST00000399397.1_Silent_p.V1206V|OTOG_ENST00000342528.2_Silent_p.V285V	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1279					adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						TAGTCCTAGTGAGGACAGAGG	0.592																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.3837G>A	11.37:g.17623848G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.V1279	ENST00000399391.2	37	c.3837	CCDS59225.1	11																																																																																			OTOG	-	pfam_AbfB,superfamily_AbfB	ENSG00000188162		0.592	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		58	0.00	0	G			17623848	17623848	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	silent	54	25.00	18	SNP	0.013	A
OTOG	340990	genome.wustl.edu	37	11	17623848	17623848	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr11:17623848G>A	ENST00000399391.2	+	31	3837	c.3837G>A	c.(3835-3837)gtG>gtA	p.V1279V	OTOG_ENST00000399397.1_Silent_p.V1206V|OTOG_ENST00000342528.2_Silent_p.V285V	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1279					adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						TAGTCCTAGTGAGGACAGAGG	0.592																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.3837G>A	11.37:g.17623848G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.V1279	ENST00000399391.2	37	c.3837	CCDS59225.1	11																																																																																			OTOG	-	pfam_AbfB,superfamily_AbfB	ENSG00000188162		0.592	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		47	0.00	0	G			17623848	17623848	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	silent	54	25.00	18	SNP	0.013	A
PABPC4	8761	genome.wustl.edu	37	1	40033473	40033473	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:40033473C>T	ENST00000372857.3	-	7	1714	c.922G>A	c.(922-924)Gag>Aag	p.E308K	PABPC4_ENST00000372856.3_Missense_Mutation_p.E308K|SNORA55_ENST00000364587.1_RNA|PABPC4_ENST00000529216.1_5'Flank|PABPC4_ENST00000372862.3_Missense_Mutation_p.E308K|PABPC4_ENST00000372858.3_Missense_Mutation_p.E308K|RP11-69E11.8_ENST00000415255.1_RNA	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	308	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CTTAATTTCTCATCATCAATA	0.363																																						dbGAP											0													89.0	88.0	89.0					1																	40033473		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.922G>A	1.37:g.40033473C>T	ENSP00000361948:p.Glu308Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.E308K	ENST00000372857.3	37	c.922	CCDS438.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.763359|5.763359	0.96906|0.96906	.|.	.|.	ENSG00000090621|ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856|ENST00000421687;ENST00000527718	T;T;T;T|.	0.19250|.	2.16;2.16;2.16;2.16|.	5.81|5.81	4.87|4.87	0.63330|0.63330	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63141|0.63141	0.2486|0.2486	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.61697|.	0.99;0.977;0.988|.	P;P;D|.	0.63113|.	0.817;0.548;0.911|.	T|T	0.58317|0.58317	-0.7657|-0.7657	10|5	0.87932|.	D|.	0|.	.|.	16.3403|16.3403	0.83080|0.83080	0.1324:0.8676:0.0:0.0|0.1324:0.8676:0.0:0.0	.|.	308;308;308|.	Q13310;Q13310-2;Q4VC03|.	PABP4_HUMAN;.;.|.	K|I	308|209;34	ENSP00000361953:E308K;ENSP00000361949:E308K;ENSP00000361948:E308K;ENSP00000361947:E308K|.	ENSP00000361947:E308K|.	E|M	-|-	1|3	0|0	PABPC4|PABPC4	39806060|39806060	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.067000|6.067000	0.71193|0.71193	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GAG|ATG	PABPC4	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000090621		0.363	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	HGNC	protein_coding	OTTHUMT00000025220.1	50	0.00	0	C	NM_001135653		40033473	40033473	-1	no_errors	ENST00000372858	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	T
PABPC4	8761	genome.wustl.edu	37	1	40033473	40033473	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:40033473C>T	ENST00000372857.3	-	7	1714	c.922G>A	c.(922-924)Gag>Aag	p.E308K	PABPC4_ENST00000372856.3_Missense_Mutation_p.E308K|SNORA55_ENST00000364587.1_RNA|PABPC4_ENST00000529216.1_5'Flank|PABPC4_ENST00000372862.3_Missense_Mutation_p.E308K|PABPC4_ENST00000372858.3_Missense_Mutation_p.E308K|RP11-69E11.8_ENST00000415255.1_RNA	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	308	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CTTAATTTCTCATCATCAATA	0.363																																						dbGAP											0													89.0	88.0	89.0					1																	40033473		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.922G>A	1.37:g.40033473C>T	ENSP00000361948:p.Glu308Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.E308K	ENST00000372857.3	37	c.922	CCDS438.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.763359|5.763359	0.96906|0.96906	.|.	.|.	ENSG00000090621|ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856|ENST00000421687;ENST00000527718	T;T;T;T|.	0.19250|.	2.16;2.16;2.16;2.16|.	5.81|5.81	4.87|4.87	0.63330|0.63330	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63141|0.63141	0.2486|0.2486	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.61697|.	0.99;0.977;0.988|.	P;P;D|.	0.63113|.	0.817;0.548;0.911|.	T|T	0.58317|0.58317	-0.7657|-0.7657	10|5	0.87932|.	D|.	0|.	.|.	16.3403|16.3403	0.83080|0.83080	0.1324:0.8676:0.0:0.0|0.1324:0.8676:0.0:0.0	.|.	308;308;308|.	Q13310;Q13310-2;Q4VC03|.	PABP4_HUMAN;.;.|.	K|I	308|209;34	ENSP00000361953:E308K;ENSP00000361949:E308K;ENSP00000361948:E308K;ENSP00000361947:E308K|.	ENSP00000361947:E308K|.	E|M	-|-	1|3	0|0	PABPC4|PABPC4	39806060|39806060	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.067000|6.067000	0.71193|0.71193	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GAG|ATG	PABPC4	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000090621		0.363	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	HGNC	protein_coding	OTTHUMT00000025220.1	45	0.00	0	C	NM_001135653		40033473	40033473	-1	no_errors	ENST00000372858	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	T
PASK	23178	genome.wustl.edu	37	2	242046130	242046130	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr2:242046130C>T	ENST00000405260.1	-	18	4521	c.3823G>A	c.(3823-3825)Gtt>Att	p.V1275I	PASK_ENST00000358649.4_Missense_Mutation_p.V1282I|PASK_ENST00000475666.1_5'Flank|PASK_ENST00000539818.1_Missense_Mutation_p.V1059I|PASK_ENST00000234040.4_Missense_Mutation_p.V1275I|PASK_ENST00000544142.1_Missense_Mutation_p.V1089I	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1275					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GCGGACAGAACTCCACTTTCT	0.502																																						dbGAP											0													60.0	61.0	60.0					2																	242046130		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3823G>A	2.37:g.242046130C>T	ENSP00000384016:p.Val1275Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_cat_dom,tigrfam_PAS	p.V1282I	ENST00000405260.1	37	c.3844	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	C	9.487	1.099734	0.20552	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818	T;T;T;T;T	0.66638	1.85;1.85;1.85;-0.22;1.85	3.41	1.6	0.23607	Protein kinase-like domain (1);	1.200080	0.06524	N	0.740144	T	0.52980	0.1768	L	0.38175	1.15	0.09310	N	1	B;B;B;B	0.33171	0.131;0.4;0.206;0.131	B;B;B;B	0.33960	0.058;0.173;0.124;0.058	T	0.39165	-0.9627	10	0.21540	T	0.41	.	4.7621	0.13113	0.0:0.5423:0.3135:0.1442	.	1240;1089;1282;1275	B7Z7R6;F5GYW7;Q96RG2-2;Q96RG2	.;.;.;PASK_HUMAN	I	1275;1089;1275;1282;1059	ENSP00000234040:V1275I;ENSP00000441374:V1089I;ENSP00000384016:V1275I;ENSP00000351475:V1282I;ENSP00000443083:V1059I	ENSP00000234040:V1275I	V	-	1	0	PASK	241694803	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.369000	0.07533	0.450000	0.26774	-0.157000	0.13467	GTT	PASK	-	superfamily_Kinase-like_dom	ENSG00000115687		0.502	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	31	0.00	0	C	NM_015148		242046130	242046130	-1	no_errors	ENST00000358649	ensembl	human	known	69_37n	missense	20	39.39	13	SNP	0.000	T
PASK	23178	genome.wustl.edu	37	2	242046130	242046130	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:242046130C>T	ENST00000405260.1	-	18	4521	c.3823G>A	c.(3823-3825)Gtt>Att	p.V1275I	PASK_ENST00000358649.4_Missense_Mutation_p.V1282I|PASK_ENST00000475666.1_5'Flank|PASK_ENST00000539818.1_Missense_Mutation_p.V1059I|PASK_ENST00000234040.4_Missense_Mutation_p.V1275I|PASK_ENST00000544142.1_Missense_Mutation_p.V1089I	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1275					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GCGGACAGAACTCCACTTTCT	0.502																																						dbGAP											0													60.0	61.0	60.0					2																	242046130		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3823G>A	2.37:g.242046130C>T	ENSP00000384016:p.Val1275Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_cat_dom,tigrfam_PAS	p.V1282I	ENST00000405260.1	37	c.3844	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	C	9.487	1.099734	0.20552	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818	T;T;T;T;T	0.66638	1.85;1.85;1.85;-0.22;1.85	3.41	1.6	0.23607	Protein kinase-like domain (1);	1.200080	0.06524	N	0.740144	T	0.52980	0.1768	L	0.38175	1.15	0.09310	N	1	B;B;B;B	0.33171	0.131;0.4;0.206;0.131	B;B;B;B	0.33960	0.058;0.173;0.124;0.058	T	0.39165	-0.9627	10	0.21540	T	0.41	.	4.7621	0.13113	0.0:0.5423:0.3135:0.1442	.	1240;1089;1282;1275	B7Z7R6;F5GYW7;Q96RG2-2;Q96RG2	.;.;.;PASK_HUMAN	I	1275;1089;1275;1282;1059	ENSP00000234040:V1275I;ENSP00000441374:V1089I;ENSP00000384016:V1275I;ENSP00000351475:V1282I;ENSP00000443083:V1059I	ENSP00000234040:V1275I	V	-	1	0	PASK	241694803	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.369000	0.07533	0.450000	0.26774	-0.157000	0.13467	GTT	PASK	-	superfamily_Kinase-like_dom	ENSG00000115687		0.502	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	40	0.00	0	C	NM_015148		242046130	242046130	-1	no_errors	ENST00000358649	ensembl	human	known	69_37n	missense	20	39.39	13	SNP	0.000	T
PCOLCE2	26577	genome.wustl.edu	37	3	142539868	142539868	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr3:142539868G>A	ENST00000295992.3	-	8	1275	c.969C>T	c.(967-969)atC>atT	p.I323I	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.H244Y	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	323	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						TGATGGTTGTGATAACAGTGC	0.438																																						dbGAP											0													113.0	98.0	103.0					3																	142539868		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.969C>T	3.37:g.142539868G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	p.H244Y	ENST00000295992.3	37	c.730	CCDS3127.1	3	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737499	0.49045	.	.	ENSG00000163710	ENST00000485766	T	0.21031	2.03	5.42	4.53	0.55603	.	.	.	.	.	T	0.35158	0.0922	.	.	.	0.25080	N	0.990932	.	.	.	.	.	.	T	0.16958	-1.0385	6	0.87932	D	0	-20.0549	15.3695	0.74551	0.0:0.0:0.8591:0.1409	.	.	.	.	Y	244	ENSP00000419842:H244Y	ENSP00000419842:H244Y	H	-	1	0	PCOLCE2	144022558	1.000000	0.71417	0.795000	0.32087	0.560000	0.35617	2.087000	0.41653	1.233000	0.43693	0.655000	0.94253	CAC	PCOLCE2	-	superfamily_CUB,smart_CUB	ENSG00000163710		0.438	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE2	HGNC	protein_coding	OTTHUMT00000354509.1	67	0.00	0	G	NM_013363		142539868	142539868	-1	no_errors	ENST00000485766	ensembl	human	putative	69_37n	missense	108	12.90	16	SNP	1.000	A
PCOLCE2	26577	genome.wustl.edu	37	3	142539868	142539868	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr3:142539868G>A	ENST00000295992.3	-	8	1275	c.969C>T	c.(967-969)atC>atT	p.I323I	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.H244Y	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	323	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						TGATGGTTGTGATAACAGTGC	0.438																																						dbGAP											0													113.0	98.0	103.0					3																	142539868		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.969C>T	3.37:g.142539868G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	p.H244Y	ENST00000295992.3	37	c.730	CCDS3127.1	3	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737499	0.49045	.	.	ENSG00000163710	ENST00000485766	T	0.21031	2.03	5.42	4.53	0.55603	.	.	.	.	.	T	0.35158	0.0922	.	.	.	0.25080	N	0.990932	.	.	.	.	.	.	T	0.16958	-1.0385	6	0.87932	D	0	-20.0549	15.3695	0.74551	0.0:0.0:0.8591:0.1409	.	.	.	.	Y	244	ENSP00000419842:H244Y	ENSP00000419842:H244Y	H	-	1	0	PCOLCE2	144022558	1.000000	0.71417	0.795000	0.32087	0.560000	0.35617	2.087000	0.41653	1.233000	0.43693	0.655000	0.94253	CAC	PCOLCE2	-	superfamily_CUB,smart_CUB	ENSG00000163710		0.438	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE2	HGNC	protein_coding	OTTHUMT00000354509.1	61	0.00	0	G	NM_013363		142539868	142539868	-1	no_errors	ENST00000485766	ensembl	human	putative	69_37n	missense	108	12.90	16	SNP	1.000	A
PCYOX1	51449	genome.wustl.edu	37	2	70485348	70485348	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr2:70485348T>A	ENST00000433351.2	+	1	80	c.52T>A	c.(52-54)Ttg>Atg	p.L18M	PCYOX1_ENST00000505044.2_Intron|PCYOX1_ENST00000264441.5_Missense_Mutation_p.L18M|PCYOX1_ENST00000545138.1_5'Flank	NM_016297.3	NP_057381.3	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1	18					prenylated protein catabolic process (GO:0030327)|prenylcysteine catabolic process (GO:0030328)|prenylcysteine metabolic process (GO:0030329)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	chloride-transporting ATPase activity (GO:0008555)|prenylcysteine oxidase activity (GO:0001735)	p.L18V(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)	15						GTTGTGGCTGTTGCTGTGCAG	0.692																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											37.0	39.0	38.0					2																	70485348		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020715	CCDS1902.1	2p13.3	2008-02-05			ENSG00000116005	ENSG00000116005	1.8.3.5		20588	protein-coding gene	gene with protein product		610995				10585463, 12186880	Standard	NM_016297		Approved	KIAA0908, PCL1	uc002sgn.4	Q9UHG3	OTTHUMG00000129671	ENST00000433351.2:c.52T>A	2.37:g.70485348T>A	ENSP00000387654:p.Leu18Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB14|B7Z9P8|O94982|Q8N4N5|Q96QM8	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Amino_oxidase,pirsf_Prenylcysteine_Oxase	p.L18M	ENST00000433351.2	37	c.52	CCDS1902.1	2	.	.	.	.	.	.	.	.	.	.	T	13.26	2.183515	0.38609	.	.	ENSG00000116005	ENST00000433351;ENST00000264441	T;T	0.48836	2.4;0.8	4.62	2.72	0.32119	.	0.768041	0.11469	N	0.560950	T	0.49677	0.1571	N	0.19112	0.55	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.994	T	0.39272	-0.9622	10	0.51188	T	0.08	-10.9823	6.8877	0.24212	0.0:0.7871:0.0:0.2129	.	18;18	B7Z8A2;Q9UHG3	.;PCYOX_HUMAN	M	18	ENSP00000387654:L18M;ENSP00000264441:L18M	ENSP00000264441:L18M	L	+	1	2	PCYOX1	70338852	0.990000	0.36364	1.000000	0.80357	0.022000	0.10575	0.839000	0.27586	0.500000	0.27991	-1.022000	0.02435	TTG	PCYOX1	-	pirsf_Prenylcysteine_Oxase	ENSG00000116005		0.692	PCYOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1	HGNC	protein_coding	OTTHUMT00000251872.3	18	0.00	0	T	NM_016297		70485348	70485348	+1	no_errors	ENST00000433351	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	1.000	A
PCYOX1	51449	genome.wustl.edu	37	2	70485348	70485348	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:70485348T>A	ENST00000433351.2	+	1	80	c.52T>A	c.(52-54)Ttg>Atg	p.L18M	PCYOX1_ENST00000505044.2_Intron|PCYOX1_ENST00000264441.5_Missense_Mutation_p.L18M|PCYOX1_ENST00000545138.1_5'Flank	NM_016297.3	NP_057381.3	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1	18					prenylated protein catabolic process (GO:0030327)|prenylcysteine catabolic process (GO:0030328)|prenylcysteine metabolic process (GO:0030329)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	chloride-transporting ATPase activity (GO:0008555)|prenylcysteine oxidase activity (GO:0001735)	p.L18V(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)	15						GTTGTGGCTGTTGCTGTGCAG	0.692																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											37.0	39.0	38.0					2																	70485348		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020715	CCDS1902.1	2p13.3	2008-02-05			ENSG00000116005	ENSG00000116005	1.8.3.5		20588	protein-coding gene	gene with protein product		610995				10585463, 12186880	Standard	NM_016297		Approved	KIAA0908, PCL1	uc002sgn.4	Q9UHG3	OTTHUMG00000129671	ENST00000433351.2:c.52T>A	2.37:g.70485348T>A	ENSP00000387654:p.Leu18Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB14|B7Z9P8|O94982|Q8N4N5|Q96QM8	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Amino_oxidase,pirsf_Prenylcysteine_Oxase	p.L18M	ENST00000433351.2	37	c.52	CCDS1902.1	2	.	.	.	.	.	.	.	.	.	.	T	13.26	2.183515	0.38609	.	.	ENSG00000116005	ENST00000433351;ENST00000264441	T;T	0.48836	2.4;0.8	4.62	2.72	0.32119	.	0.768041	0.11469	N	0.560950	T	0.49677	0.1571	N	0.19112	0.55	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.994	T	0.39272	-0.9622	10	0.51188	T	0.08	-10.9823	6.8877	0.24212	0.0:0.7871:0.0:0.2129	.	18;18	B7Z8A2;Q9UHG3	.;PCYOX_HUMAN	M	18	ENSP00000387654:L18M;ENSP00000264441:L18M	ENSP00000264441:L18M	L	+	1	2	PCYOX1	70338852	0.990000	0.36364	1.000000	0.80357	0.022000	0.10575	0.839000	0.27586	0.500000	0.27991	-1.022000	0.02435	TTG	PCYOX1	-	pirsf_Prenylcysteine_Oxase	ENSG00000116005		0.692	PCYOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1	HGNC	protein_coding	OTTHUMT00000251872.3	8	0.00	0	T	NM_016297		70485348	70485348	+1	no_errors	ENST00000433351	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	1.000	A
PIK3R1	5295	genome.wustl.edu	37	5	67589149	67589151	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	ATT	ATT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:67589149_67589151delATT	ENST00000521381.1	+	10	1753_1755	c.1137_1139delATT	c.(1135-1140)aaatta>aaa	p.L380del	PIK3R1_ENST00000521657.1_In_Frame_Del_p.L380del|PIK3R1_ENST00000320694.8_In_Frame_Del_p.L80del|PIK3R1_ENST00000396611.1_In_Frame_Del_p.L380del|PIK3R1_ENST00000523872.1_In_Frame_Del_p.L17del|PIK3R1_ENST00000274335.5_In_Frame_Del_p.L380del|PIK3R1_ENST00000336483.5_In_Frame_Del_p.L110del	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	380	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)|p.L380del(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	GAAATAACAAATTAATCAAAATA	0.305			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																												dbGAP		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	3	Whole gene deletion(1)|Deletion - In frame(1)|Unknown(1)	large_intestine(1)|lung(1)|central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1137_1139delATT	5.37:g.67589149_67589151delATT	ENSP00000428056:p.Leu380del	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	In_Frame_Del	DEL	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.L380in_frame_del	ENST00000521381.1	37	c.1137_1139	CCDS3993.1	5																																																																																			PIK3R1	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000145675		0.305	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	35	0.00	0	ATT	NM_181504		67589149	67589151	+1	no_errors	ENST00000396611	ensembl	human	known	69_37n	in_frame_del	28	46.30	25	DEL	1.000:1.000:1.000	-
PIK3R1	5295	genome.wustl.edu	37	5	67589149	67589151	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	ATT	ATT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:67589149_67589151delATT	ENST00000521381.1	+	10	1753_1755	c.1137_1139delATT	c.(1135-1140)aaatta>aaa	p.L380del	PIK3R1_ENST00000521657.1_In_Frame_Del_p.L380del|PIK3R1_ENST00000320694.8_In_Frame_Del_p.L80del|PIK3R1_ENST00000396611.1_In_Frame_Del_p.L380del|PIK3R1_ENST00000523872.1_In_Frame_Del_p.L17del|PIK3R1_ENST00000274335.5_In_Frame_Del_p.L380del|PIK3R1_ENST00000336483.5_In_Frame_Del_p.L110del	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	380	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)|p.L380del(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	GAAATAACAAATTAATCAAAATA	0.305			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																												dbGAP		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	3	Whole gene deletion(1)|Deletion - In frame(1)|Unknown(1)	large_intestine(1)|lung(1)|central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1137_1139delATT	5.37:g.67589149_67589151delATT	ENSP00000428056:p.Leu380del	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	In_Frame_Del	DEL	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.L380in_frame_del	ENST00000521381.1	37	c.1137_1139	CCDS3993.1	5																																																																																			PIK3R1	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000145675		0.305	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	26	0.00	0	ATT	NM_181504		67589149	67589151	+1	no_errors	ENST00000396611	ensembl	human	known	69_37n	in_frame_del	28	46.30	25	DEL	1.000:1.000:1.000	-
PDE6A	5145	genome.wustl.edu	37	5	149294525	149294525	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:149294525C>G	ENST00000255266.5	-	6	1098	c.979G>C	c.(979-981)Gag>Cag	p.E327Q		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	327	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	TTGATGTCCTCTTTGCCATGC	0.323																																						dbGAP											0													146.0	138.0	141.0					5																	149294525		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.979G>C	5.37:g.149294525C>G	ENSP00000255266:p.Glu327Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P638	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.E327Q	ENST00000255266.5	37	c.979	CCDS4299.1	5	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213021	0.79352	.	.	ENSG00000132915	ENST00000255266	T	0.69926	-0.44	5.19	5.19	0.71726	GAF (2);	0.112267	0.64402	D	0.000019	T	0.78767	0.4335	M	0.83692	2.655	0.58432	D	0.999991	P	0.50272	0.933	P	0.53102	0.718	T	0.81274	-0.1007	10	0.52906	T	0.07	.	16.5661	0.84599	0.0:1.0:0.0:0.0	.	327	P16499	PDE6A_HUMAN	Q	327	ENSP00000255266:E327Q	ENSP00000255266:E327Q	E	-	1	0	PDE6A	149274718	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.481000	0.73608	2.578000	0.87016	0.591000	0.81541	GAG	PDE6A	-	pfam_GAF,smart_GAF	ENSG00000132915		0.323	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6A	HGNC	protein_coding	OTTHUMT00000252326.2	46	0.00	0	C			149294525	149294525	-1	no_errors	ENST00000255266	ensembl	human	known	69_37n	missense	72	25.00	24	SNP	1.000	G
PDE6A	5145	genome.wustl.edu	37	5	149294525	149294525	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:149294525C>G	ENST00000255266.5	-	6	1098	c.979G>C	c.(979-981)Gag>Cag	p.E327Q		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	327	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	TTGATGTCCTCTTTGCCATGC	0.323																																						dbGAP											0													146.0	138.0	141.0					5																	149294525		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.979G>C	5.37:g.149294525C>G	ENSP00000255266:p.Glu327Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P638	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.E327Q	ENST00000255266.5	37	c.979	CCDS4299.1	5	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213021	0.79352	.	.	ENSG00000132915	ENST00000255266	T	0.69926	-0.44	5.19	5.19	0.71726	GAF (2);	0.112267	0.64402	D	0.000019	T	0.78767	0.4335	M	0.83692	2.655	0.58432	D	0.999991	P	0.50272	0.933	P	0.53102	0.718	T	0.81274	-0.1007	10	0.52906	T	0.07	.	16.5661	0.84599	0.0:1.0:0.0:0.0	.	327	P16499	PDE6A_HUMAN	Q	327	ENSP00000255266:E327Q	ENSP00000255266:E327Q	E	-	1	0	PDE6A	149274718	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.481000	0.73608	2.578000	0.87016	0.591000	0.81541	GAG	PDE6A	-	pfam_GAF,smart_GAF	ENSG00000132915		0.323	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6A	HGNC	protein_coding	OTTHUMT00000252326.2	54	0.00	0	C			149294525	149294525	-1	no_errors	ENST00000255266	ensembl	human	known	69_37n	missense	72	25.00	24	SNP	1.000	G
PISD	23761	genome.wustl.edu	37	22	32021619	32021619	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr22:32021619C>G	ENST00000439502.2	-	4	545				PISD_ENST00000478893.1_5'UTR|PISD_ENST00000266095.5_Intron|PISD_ENST00000336566.4_Intron|PISD_ENST00000382151.2_Intron|PISD_ENST00000397500.1_Intron			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)			central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	CCAGGCTCCTCCAGCCTCGGG	0.677																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.322-3748G>C	22.37:g.32021619C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	RNA	SNP	-	NULL	ENST00000439502.2	37	NULL		22																																																																																			PISD	-	-	ENSG00000241878		0.677	PISD-001	KNOWN	basic	protein_coding	PISD	HGNC	protein_coding	OTTHUMT00000075106.4	115	0.00	0	C			32021619	32021619	-1	no_errors	ENST00000478893	ensembl	human	known	69_37n	rna	108	16.15	21	SNP	1.000	G
PISD	23761	genome.wustl.edu	37	22	32021619	32021619	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr22:32021619C>G	ENST00000439502.2	-	4	545				PISD_ENST00000478893.1_5'UTR|PISD_ENST00000266095.5_Intron|PISD_ENST00000336566.4_Intron|PISD_ENST00000382151.2_Intron|PISD_ENST00000397500.1_Intron			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)			central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	CCAGGCTCCTCCAGCCTCGGG	0.677																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.322-3748G>C	22.37:g.32021619C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	RNA	SNP	-	NULL	ENST00000439502.2	37	NULL		22																																																																																			PISD	-	-	ENSG00000241878		0.677	PISD-001	KNOWN	basic	protein_coding	PISD	HGNC	protein_coding	OTTHUMT00000075106.4	98	0.00	0	C			32021619	32021619	-1	no_errors	ENST00000478893	ensembl	human	known	69_37n	rna	108	16.15	21	SNP	1.000	G
PITPNM2	57605	genome.wustl.edu	37	12	123497206	123497206	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr12:123497206G>A	ENST00000542749.1	-	3	432	c.369C>T	c.(367-369)ccC>ccT	p.P123P	PITPNM2_ENST00000392428.1_Intron|PITPNM2_ENST00000320201.4_Silent_p.P123P|PITPNM2_ENST00000280562.5_Silent_p.P123P|PITPNM2_ENST00000546049.1_Silent_p.P123P|MIR4304_ENST00000580964.1_RNA|PITPNM2_ENST00000451868.2_5'UTR			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	123					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TGAACACGTCGGGGTTTTCTC	0.498																																						dbGAP											0													169.0	180.0	176.0					12																	123497206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.369C>T	12.37:g.123497206G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P271	Silent	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.P123	ENST00000542749.1	37	c.369	CCDS9242.1	12																																																																																			PITPNM2	-	pfam_PI_transfer,prints_PI_transfer	ENSG00000090975		0.498	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	HGNC	protein_coding	OTTHUMT00000401342.1	96	0.00	0	G	NM_020845		123497206	123497206	-1	no_errors	ENST00000320201	ensembl	human	known	69_37n	silent	116	31.76	54	SNP	0.000	A
PLEKHH3	79990	genome.wustl.edu	37	17	40821596	40821596	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:40821596C>T	ENST00000591022.1	-	12	2444	c.2057G>A	c.(2056-2058)gGa>gAa	p.G686E	PLEKHH3_ENST00000412503.1_Intron|PLEKHH3_ENST00000293349.6_Missense_Mutation_p.G683E|PLEKHH3_ENST00000456950.2_5'UTR	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	686	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GGCCTTGGCTCCCAAGCCCAG	0.637																																						dbGAP											0													30.0	32.0	31.0					17																	40821596		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.2057G>A	17.37:g.40821596C>T	ENSP00000468678:p.Gly686Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	pfam_MyTH4_dom,pfam_FERM_central,pfam_Ras-assoc,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.G686E	ENST00000591022.1	37	c.2057	CCDS11434.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.643199|4.643199	0.87859|0.87859	.|.	.|.	ENSG00000068137|ENSG00000068137	ENST00000456950|ENST00000293349	.|.	.|.	.|.	4.43|4.43	4.43|4.43	0.53597|0.53597	.|FERM domain (1);	.|0.000000	.|0.41194	.|D	.|0.000935	T|T	0.64193|0.64193	0.2576|0.2576	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	.|D	.|0.64830	.|0.994	.|P	.|0.57911	.|0.829	T|T	0.67995|0.67995	-0.5526|-0.5526	6|9	0.45353|0.66056	T|D	0.12|0.02	-10.8395|-10.8395	16.1774|16.1774	0.81862|0.81862	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|686	.|Q7Z736	.|PKHH3_HUMAN	K|E	337|686	.|.	ENSP00000394251:E337K|ENSP00000293349:G686E	E|G	-|-	1|2	0|0	PLEKHH3|PLEKHH3	38075122|38075122	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.564000|2.564000	0.45931|0.45931	2.465000|2.465000	0.83290|0.83290	0.655000|0.655000	0.94253|0.94253	GAG|GGA	PLEKHH3	-	pfscan_FERM_domain	ENSG00000068137		0.637	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHH3	HGNC	protein_coding	OTTHUMT00000452332.1	52	0.00	0	C	NM_024927		40821596	40821596	-1	no_errors	ENST00000591022	ensembl	human	known	69_37n	missense	43	34.85	23	SNP	1.000	T
PLEKHH3	79990	genome.wustl.edu	37	17	40821596	40821596	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:40821596C>T	ENST00000591022.1	-	12	2444	c.2057G>A	c.(2056-2058)gGa>gAa	p.G686E	PLEKHH3_ENST00000412503.1_Intron|PLEKHH3_ENST00000293349.6_Missense_Mutation_p.G683E|PLEKHH3_ENST00000456950.2_5'UTR	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	686	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GGCCTTGGCTCCCAAGCCCAG	0.637																																						dbGAP											0													30.0	32.0	31.0					17																	40821596		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.2057G>A	17.37:g.40821596C>T	ENSP00000468678:p.Gly686Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	pfam_MyTH4_dom,pfam_FERM_central,pfam_Ras-assoc,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.G686E	ENST00000591022.1	37	c.2057	CCDS11434.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.643199|4.643199	0.87859|0.87859	.|.	.|.	ENSG00000068137|ENSG00000068137	ENST00000456950|ENST00000293349	.|.	.|.	.|.	4.43|4.43	4.43|4.43	0.53597|0.53597	.|FERM domain (1);	.|0.000000	.|0.41194	.|D	.|0.000935	T|T	0.64193|0.64193	0.2576|0.2576	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	.|D	.|0.64830	.|0.994	.|P	.|0.57911	.|0.829	T|T	0.67995|0.67995	-0.5526|-0.5526	6|9	0.45353|0.66056	T|D	0.12|0.02	-10.8395|-10.8395	16.1774|16.1774	0.81862|0.81862	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|686	.|Q7Z736	.|PKHH3_HUMAN	K|E	337|686	.|.	ENSP00000394251:E337K|ENSP00000293349:G686E	E|G	-|-	1|2	0|0	PLEKHH3|PLEKHH3	38075122|38075122	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.564000|2.564000	0.45931|0.45931	2.465000|2.465000	0.83290|0.83290	0.655000|0.655000	0.94253|0.94253	GAG|GGA	PLEKHH3	-	pfscan_FERM_domain	ENSG00000068137		0.637	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHH3	HGNC	protein_coding	OTTHUMT00000452332.1	44	0.00	0	C	NM_024927		40821596	40821596	-1	no_errors	ENST00000591022	ensembl	human	known	69_37n	missense	43	34.85	23	SNP	1.000	T
PNMAL1	55228	genome.wustl.edu	37	19	46973575	46973575	+	Missense_Mutation	SNP	G	G	C	rs116822170		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:46973575G>C	ENST00000313683.10	-	2	1023	c.718C>G	c.(718-720)Cgc>Ggc	p.R240G	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_Missense_Mutation_p.R240G	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	240										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CTCCTGGAGCGAGACTTAGCT	0.527																																						dbGAP											0													72.0	72.0	72.0					19																	46973575		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.718C>G	19.37:g.46973575G>C	ENSP00000318131:p.Arg240Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	NULL	p.R240G	ENST00000313683.10	37	c.718	CCDS33059.1	19	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429361	0.25726	.	.	ENSG00000182013	ENST00000438932;ENST00000313683	T;T	0.10382	2.88;2.88	3.94	-0.713	0.11223	.	0.896444	0.09379	N	0.810271	T	0.06234	0.0161	N	0.19112	0.55	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.10450	0.005;0.005	T	0.40059	-0.9583	10	0.42905	T	0.14	-1.3288	3.9993	0.09572	0.3041:0.1758:0.5201:0.0	.	240;240	Q86V59-2;Q86V59	.;PNML1_HUMAN	G	240	ENSP00000410273:R240G;ENSP00000318131:R240G	ENSP00000318131:R240G	R	-	1	0	PNMAL1	51665415	0.000000	0.05858	0.043000	0.18650	0.963000	0.63663	-0.349000	0.07731	-0.002000	0.14469	0.655000	0.94253	CGC	PNMAL1	-	NULL	ENSG00000182013		0.527	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNMAL1	HGNC	protein_coding	OTTHUMT00000403929.1	50	0.00	0	G	NM_018215		46973575	46973575	-1	no_errors	ENST00000313683	ensembl	human	known	69_37n	missense	55	30.38	24	SNP	0.043	C
PNMAL1	55228	genome.wustl.edu	37	19	46973575	46973575	+	Missense_Mutation	SNP	G	G	C	rs116822170		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr19:46973575G>C	ENST00000313683.10	-	2	1023	c.718C>G	c.(718-720)Cgc>Ggc	p.R240G	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_Missense_Mutation_p.R240G	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	240										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CTCCTGGAGCGAGACTTAGCT	0.527																																						dbGAP											0													72.0	72.0	72.0					19																	46973575		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.718C>G	19.37:g.46973575G>C	ENSP00000318131:p.Arg240Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	NULL	p.R240G	ENST00000313683.10	37	c.718	CCDS33059.1	19	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429361	0.25726	.	.	ENSG00000182013	ENST00000438932;ENST00000313683	T;T	0.10382	2.88;2.88	3.94	-0.713	0.11223	.	0.896444	0.09379	N	0.810271	T	0.06234	0.0161	N	0.19112	0.55	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.10450	0.005;0.005	T	0.40059	-0.9583	10	0.42905	T	0.14	-1.3288	3.9993	0.09572	0.3041:0.1758:0.5201:0.0	.	240;240	Q86V59-2;Q86V59	.;PNML1_HUMAN	G	240	ENSP00000410273:R240G;ENSP00000318131:R240G	ENSP00000318131:R240G	R	-	1	0	PNMAL1	51665415	0.000000	0.05858	0.043000	0.18650	0.963000	0.63663	-0.349000	0.07731	-0.002000	0.14469	0.655000	0.94253	CGC	PNMAL1	-	NULL	ENSG00000182013		0.527	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNMAL1	HGNC	protein_coding	OTTHUMT00000403929.1	41	0.00	0	G	NM_018215		46973575	46973575	-1	no_errors	ENST00000313683	ensembl	human	known	69_37n	missense	55	30.38	24	SNP	0.043	C
PPFIA2	8499	genome.wustl.edu	37	12	81839411	81839411	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr12:81839411G>C	ENST00000549396.1	-	6	654	c.494C>G	c.(493-495)tCa>tGa	p.S165*	PPFIA2_ENST00000550584.2_Nonsense_Mutation_p.S165*|RP11-315E17.1_ENST00000550272.1_RNA|PPFIA2_ENST00000550359.2_Nonsense_Mutation_p.S12*|PPFIA2_ENST00000552948.1_Nonsense_Mutation_p.S165*|PPFIA2_ENST00000548586.1_Nonsense_Mutation_p.S165*|PPFIA2_ENST00000443686.3_Nonsense_Mutation_p.S91*|PPFIA2_ENST00000333447.7_Nonsense_Mutation_p.S147*|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000549325.1_Nonsense_Mutation_p.S147*|PPFIA2_ENST00000407050.4_Nonsense_Mutation_p.S91*	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	165	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GGATACTCCTGAGGGAGACTG	0.433																																						dbGAP											0													119.0	113.0	115.0					12																	81839411		1912	4130	6042	-	-	-	SO:0001587	stop_gained	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.494C>G	12.37:g.81839411G>C	ENSP00000450337:p.Ser165*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Nonsense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S165*	ENST00000549396.1	37	c.494	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.222517	0.95139	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000551442	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.0882	19.7763	0.96395	0.0:0.0:1.0:0.0	.	.	.	.	X	165;147;91;176;147;165;91;165;147	.	ENSP00000327416:S147X	S	-	2	0	PPFIA2	80363542	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.684000	0.91462	0.650000	0.86243	TCA	PPFIA2	-	NULL	ENSG00000139220		0.433	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	72	0.00	0	G			81839411	81839411	-1	no_errors	ENST00000549396	ensembl	human	known	69_37n	nonsense	66	30.53	29	SNP	1.000	C
PPP1R21	129285	genome.wustl.edu	37	2	48741861	48741861	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr2:48741861C>T	ENST00000294952.8	+	22	2478	c.2321C>T	c.(2320-2322)tCt>tTt	p.S774F	PPP1R21_ENST00000281394.4_Missense_Mutation_p.S763F|PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000449090.2_Missense_Mutation_p.S732F	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	774						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						CAGGGGAATTCTAAAAAGAAC	0.398																																						dbGAP											0													123.0	119.0	120.0					2																	48741861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.2321C>T	2.37:g.48741861C>T	ENSP00000294952:p.Ser774Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin/RR-like	p.S774F	ENST00000294952.8	37	c.2321	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504554	0.64410	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.92	5.92	0.95590	.	0.234553	0.44285	D	0.000470	T	0.65238	0.2672	L	0.44542	1.39	0.52099	D	0.999948	P;P;P	0.39883	0.567;0.567;0.693	B;B;P	0.44772	0.271;0.384;0.46	T	0.65290	-0.6204	9	0.59425	D	0.04	-7.5852	20.3343	0.98733	0.0:1.0:0.0:0.0	.	732;774;763	E1B6W7;Q6ZMI0;Q6ZMI0-2	.;PPR21_HUMAN;.	F	763;774;732	.	ENSP00000281394:S763F	S	+	2	0	KLRAQ1	48595365	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.198000	0.72106	2.822000	0.97130	0.650000	0.86243	TCT	PPP1R21	-	NULL	ENSG00000162869		0.398	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	HGNC	protein_coding	OTTHUMT00000251238.4	45	0.00	0	C	NM_152994		48741861	48741861	+1	no_errors	ENST00000294952	ensembl	human	known	69_37n	missense	75	17.58	16	SNP	1.000	T
PPP1R21	129285	genome.wustl.edu	37	2	48741861	48741861	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr2:48741861C>T	ENST00000294952.8	+	22	2478	c.2321C>T	c.(2320-2322)tCt>tTt	p.S774F	PPP1R21_ENST00000281394.4_Missense_Mutation_p.S763F|PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000449090.2_Missense_Mutation_p.S732F	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	774						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						CAGGGGAATTCTAAAAAGAAC	0.398																																						dbGAP											0													123.0	119.0	120.0					2																	48741861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.2321C>T	2.37:g.48741861C>T	ENSP00000294952:p.Ser774Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin/RR-like	p.S774F	ENST00000294952.8	37	c.2321	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504554	0.64410	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.92	5.92	0.95590	.	0.234553	0.44285	D	0.000470	T	0.65238	0.2672	L	0.44542	1.39	0.52099	D	0.999948	P;P;P	0.39883	0.567;0.567;0.693	B;B;P	0.44772	0.271;0.384;0.46	T	0.65290	-0.6204	9	0.59425	D	0.04	-7.5852	20.3343	0.98733	0.0:1.0:0.0:0.0	.	732;774;763	E1B6W7;Q6ZMI0;Q6ZMI0-2	.;PPR21_HUMAN;.	F	763;774;732	.	ENSP00000281394:S763F	S	+	2	0	KLRAQ1	48595365	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.198000	0.72106	2.822000	0.97130	0.650000	0.86243	TCT	PPP1R21	-	NULL	ENSG00000162869		0.398	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	HGNC	protein_coding	OTTHUMT00000251238.4	59	0.00	0	C	NM_152994		48741861	48741861	+1	no_errors	ENST00000294952	ensembl	human	known	69_37n	missense	75	17.58	16	SNP	1.000	T
PPP6R3	55291	genome.wustl.edu	37	11	68305343	68305343	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr11:68305343G>C	ENST00000393800.2	+	3	465	c.211G>C	c.(211-213)Gaa>Caa	p.E71Q	PPP6R3_ENST00000393801.3_Missense_Mutation_p.E71Q|PPP6R3_ENST00000527403.2_Missense_Mutation_p.E71Q|PPP6R3_ENST00000265637.4_Missense_Mutation_p.E71Q|PPP6R3_ENST00000393799.2_Missense_Mutation_p.E71Q|PPP6R3_ENST00000524845.1_Missense_Mutation_p.E71Q|PPP6R3_ENST00000265636.5_Missense_Mutation_p.E71Q|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000524904.1_Missense_Mutation_p.E71Q|PPP6R3_ENST00000529710.1_Missense_Mutation_p.E71Q	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	71					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGACATGGATGAAAAGATCAG	0.378																																						dbGAP											0													65.0	65.0	65.0					11																	68305343		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.211G>C	11.37:g.68305343G>C	ENSP00000377389:p.Glu71Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.E71Q	ENST00000393800.2	37	c.211	CCDS53672.1	11	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911790	0.92178	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000529344;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000531244	T;T;T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;1.68;1.67;-0.22	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.84692	0.5528	M	0.86420	2.815	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.994;0.997;0.994;0.999;1.0	D	0.86763	0.1968	10	0.66056	D	0.02	.	18.8841	0.92368	0.0:0.0:1.0:0.0	.	71;71;71;71;71;71	Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;PP6R3_HUMAN;.;.	Q	71	ENSP00000377388:E71Q;ENSP00000377389:E71Q;ENSP00000431415:E71Q;ENSP00000265637:E71Q;ENSP00000433058:E71Q;ENSP00000377390:E71Q;ENSP00000265636:E71Q;ENSP00000437329:E71Q;ENSP00000433565:E71Q	ENSP00000265636:E71Q	E	+	1	0	PPP6R3	68061919	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.538000	0.98072	2.701000	0.92244	0.563000	0.77884	GAA	PPP6R3	-	NULL	ENSG00000110075		0.378	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP6R3	HGNC	protein_coding	OTTHUMT00000395275.1	35	0.00	0	G	NM_018312		68305343	68305343	+1	no_errors	ENST00000393799	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	1.000	C
PPP6R3	55291	genome.wustl.edu	37	11	68305343	68305343	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr11:68305343G>C	ENST00000393800.2	+	3	465	c.211G>C	c.(211-213)Gaa>Caa	p.E71Q	PPP6R3_ENST00000393801.3_Missense_Mutation_p.E71Q|PPP6R3_ENST00000527403.2_Missense_Mutation_p.E71Q|PPP6R3_ENST00000265637.4_Missense_Mutation_p.E71Q|PPP6R3_ENST00000393799.2_Missense_Mutation_p.E71Q|PPP6R3_ENST00000524845.1_Missense_Mutation_p.E71Q|PPP6R3_ENST00000265636.5_Missense_Mutation_p.E71Q|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000524904.1_Missense_Mutation_p.E71Q|PPP6R3_ENST00000529710.1_Missense_Mutation_p.E71Q	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	71					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGACATGGATGAAAAGATCAG	0.378																																						dbGAP											0													65.0	65.0	65.0					11																	68305343		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.211G>C	11.37:g.68305343G>C	ENSP00000377389:p.Glu71Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.E71Q	ENST00000393800.2	37	c.211	CCDS53672.1	11	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911790	0.92178	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000529344;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000531244	T;T;T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;1.68;1.67;-0.22	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.84692	0.5528	M	0.86420	2.815	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.994;0.997;0.994;0.999;1.0	D	0.86763	0.1968	10	0.66056	D	0.02	.	18.8841	0.92368	0.0:0.0:1.0:0.0	.	71;71;71;71;71;71	Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;PP6R3_HUMAN;.;.	Q	71	ENSP00000377388:E71Q;ENSP00000377389:E71Q;ENSP00000431415:E71Q;ENSP00000265637:E71Q;ENSP00000433058:E71Q;ENSP00000377390:E71Q;ENSP00000265636:E71Q;ENSP00000437329:E71Q;ENSP00000433565:E71Q	ENSP00000265636:E71Q	E	+	1	0	PPP6R3	68061919	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.538000	0.98072	2.701000	0.92244	0.563000	0.77884	GAA	PPP6R3	-	NULL	ENSG00000110075		0.378	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP6R3	HGNC	protein_coding	OTTHUMT00000395275.1	29	0.00	0	G	NM_018312		68305343	68305343	+1	no_errors	ENST00000393799	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	1.000	C
PPP6R3	55291	genome.wustl.edu	37	11	68305348	68305348	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr11:68305348G>A	ENST00000393800.2	+	3	470	c.216G>A	c.(214-216)aaG>aaA	p.K72K	PPP6R3_ENST00000393801.3_Silent_p.K72K|PPP6R3_ENST00000527403.2_Silent_p.K72K|PPP6R3_ENST00000265637.4_Silent_p.K72K|PPP6R3_ENST00000393799.2_Silent_p.K72K|PPP6R3_ENST00000524845.1_Silent_p.K72K|PPP6R3_ENST00000265636.5_Silent_p.K72K|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000524904.1_Silent_p.K72K|PPP6R3_ENST00000529710.1_Silent_p.K72K	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	72					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TGGATGAAAAGATCAGATACA	0.383																																						dbGAP											0													62.0	63.0	63.0					11																	68305348		2199	4293	6492	-	-	-	SO:0001819	synonymous_variant	0			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.216G>A	11.37:g.68305348G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Silent	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.K72	ENST00000393800.2	37	c.216	CCDS53672.1	11																																																																																			PPP6R3	-	NULL	ENSG00000110075		0.383	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP6R3	HGNC	protein_coding	OTTHUMT00000395275.1	31	0.00	0	G	NM_018312		68305348	68305348	+1	no_errors	ENST00000393799	ensembl	human	known	69_37n	silent	29	30.95	13	SNP	1.000	A
PPP6R3	55291	genome.wustl.edu	37	11	68305348	68305348	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr11:68305348G>A	ENST00000393800.2	+	3	470	c.216G>A	c.(214-216)aaG>aaA	p.K72K	PPP6R3_ENST00000393801.3_Silent_p.K72K|PPP6R3_ENST00000527403.2_Silent_p.K72K|PPP6R3_ENST00000265637.4_Silent_p.K72K|PPP6R3_ENST00000393799.2_Silent_p.K72K|PPP6R3_ENST00000524845.1_Silent_p.K72K|PPP6R3_ENST00000265636.5_Silent_p.K72K|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000524904.1_Silent_p.K72K|PPP6R3_ENST00000529710.1_Silent_p.K72K	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	72					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TGGATGAAAAGATCAGATACA	0.383																																						dbGAP											0													62.0	63.0	63.0					11																	68305348		2199	4293	6492	-	-	-	SO:0001819	synonymous_variant	0			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.216G>A	11.37:g.68305348G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Silent	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.K72	ENST00000393800.2	37	c.216	CCDS53672.1	11																																																																																			PPP6R3	-	NULL	ENSG00000110075		0.383	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP6R3	HGNC	protein_coding	OTTHUMT00000395275.1	28	0.00	0	G	NM_018312		68305348	68305348	+1	no_errors	ENST00000393799	ensembl	human	known	69_37n	silent	29	30.95	13	SNP	1.000	A
PTBP2	58155	genome.wustl.edu	37	1	97272403	97272403	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:97272403C>G	ENST00000426398.2	+	11	1121				PTBP2_ENST00000370197.1_Intron|PTBP2_ENST00000394184.3_Intron|PTBP2_ENST00000482253.1_Intron|PTBP2_ENST00000370198.1_Intron|PTBP2_ENST00000541987.1_Intron|PTBP2_ENST00000609116.1_Intron	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2						mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		TGGATTACCTCTCTGTGGCTC	0.358																																						dbGAP											0													91.0	90.0	91.0					1																	97272403		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.1079-19C>G	1.37:g.97272403C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	RNA	SNP	-	NULL	ENST00000426398.2	37	NULL	CCDS754.1	1																																																																																			PTBP2	-	-	ENSG00000117569		0.358	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP2	HGNC	protein_coding	OTTHUMT00000029453.1	22	0.00	0	C			97272403	97272403	+1	no_errors	ENST00000462433	ensembl	human	known	69_37n	rna	34	19.05	8	SNP	1.000	G
PTBP2	58155	genome.wustl.edu	37	1	97272403	97272403	+	Intron	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:97272403C>G	ENST00000426398.2	+	11	1121				PTBP2_ENST00000370197.1_Intron|PTBP2_ENST00000394184.3_Intron|PTBP2_ENST00000482253.1_Intron|PTBP2_ENST00000370198.1_Intron|PTBP2_ENST00000541987.1_Intron|PTBP2_ENST00000609116.1_Intron	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2						mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		TGGATTACCTCTCTGTGGCTC	0.358																																						dbGAP											0													91.0	90.0	91.0					1																	97272403		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.1079-19C>G	1.37:g.97272403C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	RNA	SNP	-	NULL	ENST00000426398.2	37	NULL	CCDS754.1	1																																																																																			PTBP2	-	-	ENSG00000117569		0.358	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP2	HGNC	protein_coding	OTTHUMT00000029453.1	38	0.00	0	C			97272403	97272403	+1	no_errors	ENST00000462433	ensembl	human	known	69_37n	rna	34	19.05	8	SNP	1.000	G
RALGAPA1	253959	genome.wustl.edu	37	14	36221341	36221341	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr14:36221341C>G	ENST00000389698.3	-	8	1081	c.691G>C	c.(691-693)Gaa>Caa	p.E231Q	RALGAPA1_ENST00000258840.6_Missense_Mutation_p.E231Q|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.E231Q|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.E231Q	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	231					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCTTGGTTTTCTTTGTTCTTC	0.244																																						dbGAP											0													15.0	15.0	15.0					14																	36221341		2133	4191	6324	-	-	-	SO:0001583	missense	0			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.691G>C	14.37:g.36221341C>G	ENSP00000374348:p.Glu231Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.E231Q	ENST00000389698.3	37	c.691	CCDS32065.1	14	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486643	0.84854	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23	5.18	5.18	0.71444	.	0.051564	0.85682	D	0.000000	T	0.81847	0.4909	L	0.35341	1.055	0.53688	D	0.999978	D;D;B;P;D	0.59767	0.986;0.976;0.046;0.955;0.985	P;P;B;P;P	0.62089	0.87;0.744;0.096;0.898;0.773	T	0.82878	-0.0239	10	0.51188	T	0.08	-15.9711	18.6921	0.91586	0.0:1.0:0.0:0.0	.	231;231;231;231;231	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	Q	231	ENSP00000374348:E231Q;ENSP00000302647:E231Q;ENSP00000258840:E231Q;ENSP00000371803:E231Q;ENSP00000451877:E231Q	ENSP00000258840:E231Q	E	-	1	0	RALGAPA1	35291092	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.268000	0.78473	2.413000	0.81919	0.563000	0.77884	GAA	RALGAPA1	-	NULL	ENSG00000174373		0.244	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	HGNC	protein_coding	OTTHUMT00000409829.1	40	0.00	0	C	XM_210022		36221341	36221341	-1	no_errors	ENST00000258840	ensembl	human	known	69_37n	missense	64	31.18	29	SNP	1.000	G
RALGAPA1	253959	genome.wustl.edu	37	14	36221341	36221341	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr14:36221341C>G	ENST00000389698.3	-	8	1081	c.691G>C	c.(691-693)Gaa>Caa	p.E231Q	RALGAPA1_ENST00000258840.6_Missense_Mutation_p.E231Q|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.E231Q|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.E231Q	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	231					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCTTGGTTTTCTTTGTTCTTC	0.244																																						dbGAP											0													15.0	15.0	15.0					14																	36221341		2133	4191	6324	-	-	-	SO:0001583	missense	0			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.691G>C	14.37:g.36221341C>G	ENSP00000374348:p.Glu231Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.E231Q	ENST00000389698.3	37	c.691	CCDS32065.1	14	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486643	0.84854	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23	5.18	5.18	0.71444	.	0.051564	0.85682	D	0.000000	T	0.81847	0.4909	L	0.35341	1.055	0.53688	D	0.999978	D;D;B;P;D	0.59767	0.986;0.976;0.046;0.955;0.985	P;P;B;P;P	0.62089	0.87;0.744;0.096;0.898;0.773	T	0.82878	-0.0239	10	0.51188	T	0.08	-15.9711	18.6921	0.91586	0.0:1.0:0.0:0.0	.	231;231;231;231;231	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	Q	231	ENSP00000374348:E231Q;ENSP00000302647:E231Q;ENSP00000258840:E231Q;ENSP00000371803:E231Q;ENSP00000451877:E231Q	ENSP00000258840:E231Q	E	-	1	0	RALGAPA1	35291092	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.268000	0.78473	2.413000	0.81919	0.563000	0.77884	GAA	RALGAPA1	-	NULL	ENSG00000174373		0.244	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	HGNC	protein_coding	OTTHUMT00000409829.1	55	0.00	0	C	XM_210022		36221341	36221341	-1	no_errors	ENST00000258840	ensembl	human	known	69_37n	missense	64	31.18	29	SNP	1.000	G
PTPN21	11099	genome.wustl.edu	37	14	88974301	88974301	+	Silent	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr14:88974301T>C	ENST00000556564.1	-	4	698	c.414A>G	c.(412-414)gaA>gaG	p.E138E	RP11-507K2.2_ENST00000555444.1_RNA|PTPN21_ENST00000328736.3_Silent_p.E138E|PTPN21_ENST00000554628.1_5'UTR	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	138	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GAATTGCTTGTTCTAAGGTAC	0.318																																						dbGAP											0													89.0	84.0	85.0					14																	88974301		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.414A>G	14.37:g.88974301T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.E138	ENST00000556564.1	37	c.414	CCDS9884.1	14																																																																																			PTPN21	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000070778		0.318	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	HGNC	protein_coding	OTTHUMT00000410303.1	22	0.00	0	T			88974301	88974301	-1	no_errors	ENST00000328736	ensembl	human	known	69_37n	silent	32	36.00	18	SNP	0.999	C
PTPN21	11099	genome.wustl.edu	37	14	88974301	88974301	+	Silent	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr14:88974301T>C	ENST00000556564.1	-	4	698	c.414A>G	c.(412-414)gaA>gaG	p.E138E	RP11-507K2.2_ENST00000555444.1_RNA|PTPN21_ENST00000328736.3_Silent_p.E138E|PTPN21_ENST00000554628.1_5'UTR	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	138	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GAATTGCTTGTTCTAAGGTAC	0.318																																						dbGAP											0													89.0	84.0	85.0					14																	88974301		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.414A>G	14.37:g.88974301T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.E138	ENST00000556564.1	37	c.414	CCDS9884.1	14																																																																																			PTPN21	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000070778		0.318	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	HGNC	protein_coding	OTTHUMT00000410303.1	20	0.00	0	T			88974301	88974301	-1	no_errors	ENST00000328736	ensembl	human	known	69_37n	silent	32	36.00	18	SNP	0.999	C
RBBP9	10741	genome.wustl.edu	37	20	18474699	18474699	+	Nonsense_Mutation	SNP	G	G	A	rs540214428		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr20:18474699G>A	ENST00000337227.4	-	3	226	c.151C>T	c.(151-153)Cga>Tga	p.R51*	RBBP9_ENST00000493184.1_5'UTR	NM_006606.2	NP_006597.2	O75884	RBBP9_HUMAN	retinoblastoma binding protein 9	51					regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|prostate(1)	9						ATGCTCTCTCGTGCTGTAACT	0.502																																						dbGAP											0													93.0	78.0	83.0					20																	18474699		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF039564	CCDS13136.1	20p11.2	2008-08-01	2001-11-28		ENSG00000089050	ENSG00000089050			9892	protein-coding gene	gene with protein product		602908	"""retinoblastoma-binding protein 9"""			9697699, 10449909	Standard	NM_006606		Approved	Bog	uc002wqy.3	O75884	OTTHUMG00000031972	ENST00000337227.4:c.151C>T	20.37:g.18474699G>A	ENSP00000336866:p.Arg51*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW31|Q5JPH9|Q9H1D8	Nonsense_Mutation	SNP	pfam_DUF1234_Hydrolase	p.R51*	ENST00000337227.4	37	c.151	CCDS13136.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.183319	0.94885	.	.	ENSG00000089050	ENST00000337227;ENST00000339848	.	.	.	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-2.2101	10.768	0.46305	0.0:0.0:0.8107:0.1892	.	.	.	.	X	51	.	ENSP00000336866:R51X	R	-	1	2	RBBP9	18422699	1.000000	0.71417	0.994000	0.49952	0.933000	0.57130	2.405000	0.44548	2.667000	0.90743	0.655000	0.94253	CGA	RBBP9	-	pfam_DUF1234_Hydrolase	ENSG00000089050		0.502	RBBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP9	HGNC	protein_coding	OTTHUMT00000078175.1	27	0.00	0	G	NM_006606		18474699	18474699	-1	no_errors	ENST00000337227	ensembl	human	known	69_37n	nonsense	44	16.98	9	SNP	0.987	A
RBBP9	10741	genome.wustl.edu	37	20	18474699	18474699	+	Nonsense_Mutation	SNP	G	G	A	rs540214428		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr20:18474699G>A	ENST00000337227.4	-	3	226	c.151C>T	c.(151-153)Cga>Tga	p.R51*	RBBP9_ENST00000493184.1_5'UTR	NM_006606.2	NP_006597.2	O75884	RBBP9_HUMAN	retinoblastoma binding protein 9	51					regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|prostate(1)	9						ATGCTCTCTCGTGCTGTAACT	0.502																																						dbGAP											0													93.0	78.0	83.0					20																	18474699		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF039564	CCDS13136.1	20p11.2	2008-08-01	2001-11-28		ENSG00000089050	ENSG00000089050			9892	protein-coding gene	gene with protein product		602908	"""retinoblastoma-binding protein 9"""			9697699, 10449909	Standard	NM_006606		Approved	Bog	uc002wqy.3	O75884	OTTHUMG00000031972	ENST00000337227.4:c.151C>T	20.37:g.18474699G>A	ENSP00000336866:p.Arg51*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW31|Q5JPH9|Q9H1D8	Nonsense_Mutation	SNP	pfam_DUF1234_Hydrolase	p.R51*	ENST00000337227.4	37	c.151	CCDS13136.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.183319	0.94885	.	.	ENSG00000089050	ENST00000337227;ENST00000339848	.	.	.	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-2.2101	10.768	0.46305	0.0:0.0:0.8107:0.1892	.	.	.	.	X	51	.	ENSP00000336866:R51X	R	-	1	2	RBBP9	18422699	1.000000	0.71417	0.994000	0.49952	0.933000	0.57130	2.405000	0.44548	2.667000	0.90743	0.655000	0.94253	CGA	RBBP9	-	pfam_DUF1234_Hydrolase	ENSG00000089050		0.502	RBBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP9	HGNC	protein_coding	OTTHUMT00000078175.1	23	0.00	0	G	NM_006606		18474699	18474699	-1	no_errors	ENST00000337227	ensembl	human	known	69_37n	nonsense	44	16.98	9	SNP	0.987	A
RGN	9104	genome.wustl.edu	37	X	46952339	46952339	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:46952339C>T	ENST00000352078.4	+	7	1238	c.893C>T	c.(892-894)gCg>gTg	p.A298V	RGN_ENST00000336169.3_Missense_Mutation_p.A298V|RGN_ENST00000457380.1_Missense_Mutation_p.A226V|RGN_ENST00000397180.1_Missense_Mutation_p.A298V	NM_004683.4	NP_004674.1	Q15493	RGN_HUMAN	regucalcin	298					cellular calcium ion homeostasis (GO:0006874)|L-ascorbic acid biosynthetic process (GO:0019853)|positive regulation of ATPase activity (GO:0032781)|regulation of calcium-mediated signaling (GO:0050848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|enzyme regulator activity (GO:0030234)|gluconolactonase activity (GO:0004341)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	9						TACTCCTATGCGGGATGAGGA	0.433																																						dbGAP											0													68.0	59.0	62.0					X																	46952339		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31815	CCDS14272.1, CCDS75968.1	Xp11.3	2014-03-14	2013-04-26		ENSG00000130988	ENSG00000130988	3.1.1.17		9989	protein-coding gene	gene with protein product	"""senescence marker protein-30"", ""gluconolactonase"""	300212	"""regucalcin (senescence marker protein-30)"""			7548213	Standard	NM_152869		Approved	SMP30, RC	uc004dha.1	Q15493	OTTHUMG00000021435	ENST00000352078.4:c.893C>T	X.37:g.46952339C>T	ENSP00000253303:p.Ala298Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTW1|A8K271|Q53FC9|Q5JRR5	Missense_Mutation	SNP	pfam_SGL,prints_SMP-30,prints_Regucalcin	p.A298V	ENST00000352078.4	37	c.893	CCDS14272.1	X	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492688	0.26774	.	.	ENSG00000130988	ENST00000397180;ENST00000457380;ENST00000352078;ENST00000336169	.	.	.	5.39	3.63	0.41609	.	0.265030	0.43919	N	0.000519	T	0.59797	0.2220	M	0.76328	2.33	0.40166	D	0.97712	B;B	0.22211	0.066;0.048	B;B	0.09377	0.004;0.004	T	0.58418	-0.7640	9	0.49607	T	0.09	-7.7105	11.0466	0.47863	0.0:0.8472:0.0:0.1528	.	226;298	Q15493-2;Q15493	.;RGN_HUMAN	V	298;226;298;298	.	ENSP00000338400:A298V	A	+	2	0	RGN	46837283	0.998000	0.40836	0.031000	0.17742	0.094000	0.18550	2.276000	0.43408	0.646000	0.30693	0.529000	0.55759	GCG	RGN	-	NULL	ENSG00000130988		0.433	RGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGN	HGNC	protein_coding	OTTHUMT00000056385.1	107	0.00	0	C	NM_004683		46952339	46952339	+1	no_errors	ENST00000336169	ensembl	human	known	69_37n	missense	95	28.57	38	SNP	0.977	T
RGN	9104	genome.wustl.edu	37	X	46952339	46952339	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:46952339C>T	ENST00000352078.4	+	7	1238	c.893C>T	c.(892-894)gCg>gTg	p.A298V	RGN_ENST00000336169.3_Missense_Mutation_p.A298V|RGN_ENST00000457380.1_Missense_Mutation_p.A226V|RGN_ENST00000397180.1_Missense_Mutation_p.A298V	NM_004683.4	NP_004674.1	Q15493	RGN_HUMAN	regucalcin	298					cellular calcium ion homeostasis (GO:0006874)|L-ascorbic acid biosynthetic process (GO:0019853)|positive regulation of ATPase activity (GO:0032781)|regulation of calcium-mediated signaling (GO:0050848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|enzyme regulator activity (GO:0030234)|gluconolactonase activity (GO:0004341)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	9						TACTCCTATGCGGGATGAGGA	0.433																																						dbGAP											0													68.0	59.0	62.0					X																	46952339		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31815	CCDS14272.1, CCDS75968.1	Xp11.3	2014-03-14	2013-04-26		ENSG00000130988	ENSG00000130988	3.1.1.17		9989	protein-coding gene	gene with protein product	"""senescence marker protein-30"", ""gluconolactonase"""	300212	"""regucalcin (senescence marker protein-30)"""			7548213	Standard	NM_152869		Approved	SMP30, RC	uc004dha.1	Q15493	OTTHUMG00000021435	ENST00000352078.4:c.893C>T	X.37:g.46952339C>T	ENSP00000253303:p.Ala298Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTW1|A8K271|Q53FC9|Q5JRR5	Missense_Mutation	SNP	pfam_SGL,prints_SMP-30,prints_Regucalcin	p.A298V	ENST00000352078.4	37	c.893	CCDS14272.1	X	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492688	0.26774	.	.	ENSG00000130988	ENST00000397180;ENST00000457380;ENST00000352078;ENST00000336169	.	.	.	5.39	3.63	0.41609	.	0.265030	0.43919	N	0.000519	T	0.59797	0.2220	M	0.76328	2.33	0.40166	D	0.97712	B;B	0.22211	0.066;0.048	B;B	0.09377	0.004;0.004	T	0.58418	-0.7640	9	0.49607	T	0.09	-7.7105	11.0466	0.47863	0.0:0.8472:0.0:0.1528	.	226;298	Q15493-2;Q15493	.;RGN_HUMAN	V	298;226;298;298	.	ENSP00000338400:A298V	A	+	2	0	RGN	46837283	0.998000	0.40836	0.031000	0.17742	0.094000	0.18550	2.276000	0.43408	0.646000	0.30693	0.529000	0.55759	GCG	RGN	-	NULL	ENSG00000130988		0.433	RGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGN	HGNC	protein_coding	OTTHUMT00000056385.1	84	0.00	0	C	NM_004683		46952339	46952339	+1	no_errors	ENST00000336169	ensembl	human	known	69_37n	missense	95	28.57	38	SNP	0.977	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037863	10037863	+	RNA	DEL	C	C	-	rs373540942		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrY:10037863delC	ENST00000515896.1	+	0	100									RNA, 5.8S ribosomal pseudogene 6																		ATCGACACTTCGAACGCACTT	0.552																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037863delC		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.552	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		25	0.00	0	C			10037863	10037863	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	33	12.50	7	DEL	1.000	-
RPL15	6138	genome.wustl.edu	37	3	23960937	23960937	+	Frame_Shift_Del	DEL	C	C	-	rs11547055		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr3:23960937delC	ENST00000307839.5	+	4	1199	c.560delC	c.(559-561)tctfs	p.S187fs	NKIRAS1_ENST00000415901.2_5'Flank|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000425478.2_5'Flank|NKIRAS1_ENST00000443659.2_5'Flank|RPL15_ENST00000456530.2_Intron|NKIRAS1_ENST00000412028.1_5'Flank|RPL15_ENST00000435882.1_Frame_Shift_Del_p.S187fs|NKIRAS1_ENST00000416026.2_5'Flank|RPL15_ENST00000354811.5_Frame_Shift_Del_p.S187fs|RPL15_ENST00000413699.1_Frame_Shift_Del_p.S187fs|NKIRAS1_ENST00000437230.1_5'Flank|RPL15_ENST00000415719.1_Frame_Shift_Del_p.S187fs	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	187					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						ATTGGTGGCTCTCGCCGGGCA	0.502																																						dbGAP											0													17.0	19.0	18.0					3																	23960937		2182	4292	6474	-	-	-	SO:0001589	frameshift_variant	0			AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.560delC	3.37:g.23960937delC	ENSP00000309334:p.Ser187fs	Somatic		WXS	Illumina GAIIx	Phase_IV	P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Frame_Shift_Del	DEL	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	p.S187fs	ENST00000307839.5	37	c.560	CCDS2640.1	3																																																																																			RPL15	-	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	ENSG00000174748		0.502	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL15	HGNC	protein_coding	OTTHUMT00000252885.3	49	0.00	0	C	NM_002948		23960937	23960937	+1	no_errors	ENST00000307839	ensembl	human	known	69_37n	frame_shift_del	31	49.28	34	DEL	1.000	-
RPL15	6138	genome.wustl.edu	37	3	23960937	23960937	+	Frame_Shift_Del	DEL	C	C	-	rs11547055		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr3:23960937delC	ENST00000307839.5	+	4	1199	c.560delC	c.(559-561)tctfs	p.S187fs	NKIRAS1_ENST00000415901.2_5'Flank|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000425478.2_5'Flank|NKIRAS1_ENST00000443659.2_5'Flank|RPL15_ENST00000456530.2_Intron|NKIRAS1_ENST00000412028.1_5'Flank|RPL15_ENST00000435882.1_Frame_Shift_Del_p.S187fs|NKIRAS1_ENST00000416026.2_5'Flank|RPL15_ENST00000354811.5_Frame_Shift_Del_p.S187fs|RPL15_ENST00000413699.1_Frame_Shift_Del_p.S187fs|NKIRAS1_ENST00000437230.1_5'Flank|RPL15_ENST00000415719.1_Frame_Shift_Del_p.S187fs	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	187					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						ATTGGTGGCTCTCGCCGGGCA	0.502																																						dbGAP											0													17.0	19.0	18.0					3																	23960937		2182	4292	6474	-	-	-	SO:0001589	frameshift_variant	0			AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.560delC	3.37:g.23960937delC	ENSP00000309334:p.Ser187fs	Somatic		WXS	Illumina GAIIx	Phase_IV	P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Frame_Shift_Del	DEL	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	p.S187fs	ENST00000307839.5	37	c.560	CCDS2640.1	3																																																																																			RPL15	-	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	ENSG00000174748		0.502	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL15	HGNC	protein_coding	OTTHUMT00000252885.3	60	0.00	0	C	NM_002948		23960937	23960937	+1	no_errors	ENST00000307839	ensembl	human	known	69_37n	frame_shift_del	31	49.28	34	DEL	1.000	-
RPL15	6138	genome.wustl.edu	37	3	23960941	23960942	+	Frame_Shift_Del	DEL	CC	CC	-	rs370345068		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr3:23960941_23960942delCC	ENST00000307839.5	+	4	1203_1204	c.564_565delCC	c.(562-567)cgccggfs	p.RR188fs	NKIRAS1_ENST00000415901.2_5'Flank|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000425478.2_5'Flank|NKIRAS1_ENST00000443659.2_5'Flank|RPL15_ENST00000456530.2_Intron|NKIRAS1_ENST00000412028.1_5'Flank|RPL15_ENST00000435882.1_Frame_Shift_Del_p.RR188fs|NKIRAS1_ENST00000416026.2_5'Flank|RPL15_ENST00000354811.5_Frame_Shift_Del_p.RR188fs|RPL15_ENST00000413699.1_Frame_Shift_Del_p.RR188fs|NKIRAS1_ENST00000437230.1_5'Flank|RPL15_ENST00000415719.1_Frame_Shift_Del_p.RR188fs	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	188					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						GTGGCTCTCGCCGGGCAGCTTG	0.5																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.564_565delCC	3.37:g.23960941_23960942delCC	ENSP00000309334:p.Arg188fs	Somatic		WXS	Illumina GAIIx	Phase_IV	P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Frame_Shift_Del	DEL	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	p.R189fs	ENST00000307839.5	37	c.564_565	CCDS2640.1	3																																																																																			RPL15	-	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	ENSG00000174748		0.500	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL15	HGNC	protein_coding	OTTHUMT00000252885.3	47	0.00	0	CC	NM_002948		23960941	23960942	+1	no_errors	ENST00000307839	ensembl	human	known	69_37n	frame_shift_del	34	47.83	33	DEL	1.000:1.000	-
RPL15	6138	genome.wustl.edu	37	3	23960941	23960942	+	Frame_Shift_Del	DEL	CC	CC	-	rs370345068		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr3:23960941_23960942delCC	ENST00000307839.5	+	4	1203_1204	c.564_565delCC	c.(562-567)cgccggfs	p.RR188fs	NKIRAS1_ENST00000415901.2_5'Flank|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000425478.2_5'Flank|NKIRAS1_ENST00000443659.2_5'Flank|RPL15_ENST00000456530.2_Intron|NKIRAS1_ENST00000412028.1_5'Flank|RPL15_ENST00000435882.1_Frame_Shift_Del_p.RR188fs|NKIRAS1_ENST00000416026.2_5'Flank|RPL15_ENST00000354811.5_Frame_Shift_Del_p.RR188fs|RPL15_ENST00000413699.1_Frame_Shift_Del_p.RR188fs|NKIRAS1_ENST00000437230.1_5'Flank|RPL15_ENST00000415719.1_Frame_Shift_Del_p.RR188fs	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	188					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						GTGGCTCTCGCCGGGCAGCTTG	0.5																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.564_565delCC	3.37:g.23960941_23960942delCC	ENSP00000309334:p.Arg188fs	Somatic		WXS	Illumina GAIIx	Phase_IV	P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Frame_Shift_Del	DEL	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	p.R189fs	ENST00000307839.5	37	c.564_565	CCDS2640.1	3																																																																																			RPL15	-	pfam_Ribosomal_L15e,superfamily_Ribosomal_L23/L15e_core_dom	ENSG00000174748		0.500	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL15	HGNC	protein_coding	OTTHUMT00000252885.3	53	0.00	0	CC	NM_002948		23960941	23960942	+1	no_errors	ENST00000307839	ensembl	human	known	69_37n	frame_shift_del	34	47.83	33	DEL	1.000:1.000	-
RPS6	6194	genome.wustl.edu	37	9	19379494	19379494	+	Silent	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr9:19379494T>C	ENST00000380394.4	-	2	187	c.129A>G	c.(127-129)gaA>gaG	p.E43E	RPS6_ENST00000380384.1_Silent_p.E12E|RPS6_ENST00000315377.4_Silent_p.E12E|RPS6_ENST00000498815.1_5'Flank|RPS6_ENST00000380381.3_Silent_p.E43E	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	43					activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		CCTTCCATTCTTCACCCAGAG	0.463																																						dbGAP											0													60.0	50.0	53.0					9																	19379494		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.129A>G	9.37:g.19379494T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P08227|P10660|Q4VBY7|Q8N6Z7	Silent	SNP	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	p.E43	ENST00000380394.4	37	c.129	CCDS6492.1	9																																																																																			RPS6	-	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	ENSG00000137154		0.463	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6	HGNC	protein_coding	OTTHUMT00000051858.1	47	0.00	0	T	NM_001010		19379494	19379494	-1	no_errors	ENST00000380394	ensembl	human	known	69_37n	silent	65	21.69	18	SNP	0.992	C
RPS6	6194	genome.wustl.edu	37	9	19379494	19379494	+	Silent	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr9:19379494T>C	ENST00000380394.4	-	2	187	c.129A>G	c.(127-129)gaA>gaG	p.E43E	RPS6_ENST00000380384.1_Silent_p.E12E|RPS6_ENST00000315377.4_Silent_p.E12E|RPS6_ENST00000498815.1_5'Flank|RPS6_ENST00000380381.3_Silent_p.E43E	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	43					activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		CCTTCCATTCTTCACCCAGAG	0.463																																						dbGAP											0													60.0	50.0	53.0					9																	19379494		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.129A>G	9.37:g.19379494T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P08227|P10660|Q4VBY7|Q8N6Z7	Silent	SNP	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	p.E43	ENST00000380394.4	37	c.129	CCDS6492.1	9																																																																																			RPS6	-	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	ENSG00000137154		0.463	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6	HGNC	protein_coding	OTTHUMT00000051858.1	48	0.00	0	T	NM_001010		19379494	19379494	-1	no_errors	ENST00000380394	ensembl	human	known	69_37n	silent	65	21.69	18	SNP	0.992	C
SAT1	6303	genome.wustl.edu	37	X	23801333	23801333	+	5'UTR	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:23801333C>T	ENST00000379270.4	+	0	44				RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000379253.3_5'UTR|SAT1_ENST00000379251.3_5'UTR|SAT1_ENST00000489394.1_3'UTR|SAT1_ENST00000379254.1_5'UTR|Y_RNA_ENST00000365402.1_RNA	NM_002970.2	NP_002961.1	Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						ATCCGTCACTCGCCGAGGTTC	0.602											OREG0019712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379270.4:c.-136C>T	X.37:g.23801333C>T		Somatic	766	WXS	Illumina GAIIx	Phase_IV	A8K9N2|Q7Z5R3|Q96BK0	RNA	SNP	-	NULL	ENST00000379270.4	37	NULL	CCDS14207.1	X																																																																																			SAT1	-	-	ENSG00000130066		0.602	SAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAT1	HGNC	protein_coding	OTTHUMT00000056056.1	19	0.00	0	C	NM_002970		23801333	23801333	+1	no_errors	ENST00000489394	ensembl	human	known	69_37n	rna	19	54.76	23	SNP	0.000	T
SAT1	6303	genome.wustl.edu	37	X	23801333	23801333	+	5'UTR	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:23801333C>T	ENST00000379270.4	+	0	44				RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000379253.3_5'UTR|SAT1_ENST00000379251.3_5'UTR|SAT1_ENST00000489394.1_3'UTR|SAT1_ENST00000379254.1_5'UTR|Y_RNA_ENST00000365402.1_RNA	NM_002970.2	NP_002961.1	Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						ATCCGTCACTCGCCGAGGTTC	0.602											OREG0019712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379270.4:c.-136C>T	X.37:g.23801333C>T		Somatic	766	WXS	Illumina GAIIx	Phase_IV	A8K9N2|Q7Z5R3|Q96BK0	RNA	SNP	-	NULL	ENST00000379270.4	37	NULL	CCDS14207.1	X																																																																																			SAT1	-	-	ENSG00000130066		0.602	SAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAT1	HGNC	protein_coding	OTTHUMT00000056056.1	19	0.00	0	C	NM_002970		23801333	23801333	+1	no_errors	ENST00000489394	ensembl	human	known	69_37n	rna	19	54.76	23	SNP	0.000	T
SCN4A	6329	genome.wustl.edu	37	17	62025337	62025337	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:62025337G>A	ENST00000435607.1	-	17	3307	c.3231C>T	c.(3229-3231)atC>atT	p.I1077I	SCN4A_ENST00000578147.1_Silent_p.I1077I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1077					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCATCTCCATGATGAAGATGT	0.552																																						dbGAP											0													89.0	94.0	93.0					17																	62025337		2179	4298	6477	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3231C>T	17.37:g.62025337G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.I1077	ENST00000435607.1	37	c.3231	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.552	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		82	0.00	0	G	NM_000334		62025337	62025337	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	203	48.99	195	SNP	0.836	A
SCN4A	6329	genome.wustl.edu	37	17	62025337	62025337	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:62025337G>A	ENST00000435607.1	-	17	3307	c.3231C>T	c.(3229-3231)atC>atT	p.I1077I	SCN4A_ENST00000578147.1_Silent_p.I1077I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1077					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCATCTCCATGATGAAGATGT	0.552																																						dbGAP											0													89.0	94.0	93.0					17																	62025337		2179	4298	6477	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3231C>T	17.37:g.62025337G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.I1077	ENST00000435607.1	37	c.3231	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.552	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		57	0.00	0	G	NM_000334		62025337	62025337	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	203	48.99	195	SNP	0.836	A
SCN4A	6329	genome.wustl.edu	37	17	62026001	62026001	+	Silent	SNP	G	G	A	rs572541145		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:62026001G>A	ENST00000435607.1	-	16	3190	c.3114C>T	c.(3112-3114)gtC>gtT	p.V1038V	SCN4A_ENST00000578147.1_Silent_p.V1038V	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1038					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGATCATGAAGACAATGAAGG	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18564	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													49.0	51.0	50.0					17																	62026001		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3114C>T	17.37:g.62026001G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.V1038	ENST00000435607.1	37	c.3114	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Na_trans_assoc	ENSG00000007314		0.617	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		44	0.00	0	G	NM_000334		62026001	62026001	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	103	46.07	88	SNP	1.000	A
SCN4A	6329	genome.wustl.edu	37	17	62026001	62026001	+	Silent	SNP	G	G	A	rs572541145		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:62026001G>A	ENST00000435607.1	-	16	3190	c.3114C>T	c.(3112-3114)gtC>gtT	p.V1038V	SCN4A_ENST00000578147.1_Silent_p.V1038V	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1038					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGATCATGAAGACAATGAAGG	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18564	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													49.0	51.0	50.0					17																	62026001		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3114C>T	17.37:g.62026001G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.V1038	ENST00000435607.1	37	c.3114	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Na_trans_assoc	ENSG00000007314		0.617	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		26	0.00	0	G	NM_000334		62026001	62026001	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	103	46.07	88	SNP	1.000	A
SLAIN2	57606	genome.wustl.edu	37	4	48343849	48343849	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr4:48343849G>A	ENST00000264313.6	+	1	511	c.93G>A	c.(91-93)ctG>ctA	p.L31L		NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	31					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						ACGAACAGCTGAGGAGCCGCT	0.701																																						dbGAP											0													3.0	5.0	4.0					4																	48343849		1625	3528	5153	-	-	-	SO:0001819	synonymous_variant	0			BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.93G>A	4.37:g.48343849G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4P1|Q8N5R3	Silent	SNP	NULL	p.L31	ENST00000264313.6	37	c.93	CCDS47051.1	4																																																																																			SLAIN2	-	NULL	ENSG00000109171		0.701	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAIN2	HGNC	protein_coding	OTTHUMT00000365807.4	19	0.00	0	G	NM_020846		48343849	48343849	+1	no_errors	ENST00000264313	ensembl	human	known	69_37n	silent	22	24.14	7	SNP	0.993	A
SLAIN2	57606	genome.wustl.edu	37	4	48343849	48343849	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr4:48343849G>A	ENST00000264313.6	+	1	511	c.93G>A	c.(91-93)ctG>ctA	p.L31L		NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	31					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						ACGAACAGCTGAGGAGCCGCT	0.701																																						dbGAP											0													3.0	5.0	4.0					4																	48343849		1625	3528	5153	-	-	-	SO:0001819	synonymous_variant	0			BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.93G>A	4.37:g.48343849G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4P1|Q8N5R3	Silent	SNP	NULL	p.L31	ENST00000264313.6	37	c.93	CCDS47051.1	4																																																																																			SLAIN2	-	NULL	ENSG00000109171		0.701	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAIN2	HGNC	protein_coding	OTTHUMT00000365807.4	24	0.00	0	G	NM_020846		48343849	48343849	+1	no_errors	ENST00000264313	ensembl	human	known	69_37n	silent	22	24.14	7	SNP	0.993	A
SLC25A39	51629	genome.wustl.edu	37	17	42398807	42398807	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:42398807G>C	ENST00000377095.5	-	7	631	c.512C>G	c.(511-513)gCc>gGc	p.A171G	SLC25A39_ENST00000225308.8_Missense_Mutation_p.A163G|SLC25A39_ENST00000586016.1_Missense_Mutation_p.A39G|SLC25A39_ENST00000537904.2_Missense_Mutation_p.A148G|SLC25A39_ENST00000590194.1_Missense_Mutation_p.A163G	NM_001143780.1	NP_001137252.1	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39	171					heme biosynthetic process (GO:0006783)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CTCACGGCGGGCCAGCGCGCC	0.632																																						dbGAP											0													49.0	57.0	54.0					17																	42398807		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC096819	CCDS11482.1, CCDS45700.1	17q12	2013-05-22			ENSG00000013306	ENSG00000013306		"""Solute carriers"""	24279	protein-coding gene	gene with protein product		610820				16949250	Standard	NM_001143780		Approved	FLJ22407, CGI-69	uc002ign.2	Q9BZJ4	OTTHUMG00000132628	ENST00000377095.5:c.512C>G	17.37:g.42398807G>C	ENSP00000366299:p.Ala171Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8JZZ2|D3DX51|D3DX54|Q4V9M1|Q9P182|Q9UF66|Q9Y379	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.A171G	ENST00000377095.5	37	c.512	CCDS45700.1	17	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984288	0.74474	.	.	ENSG00000013306	ENST00000225308;ENST00000377095;ENST00000537904	D;D;D	0.87103	-2.21;-2.21;-2.21	5.31	5.31	0.75309	Mitochondrial carrier domain (2);	0.054526	0.64402	D	0.000001	D	0.91536	0.7327	L	0.49778	1.585	0.80722	D	1	D;D;D;D;D	0.89917	0.994;0.993;0.974;1.0;0.988	P;P;P;D;P	0.79108	0.891;0.751;0.766;0.992;0.654	D	0.91912	0.5540	10	0.72032	D	0.01	-8.9114	16.9594	0.86268	0.0:0.0:1.0:0.0	.	156;163;148;171;163	B4DVL9;B4DI93;B4DFG5;Q9BZJ4;Q9BZJ4-2	.;.;.;S2539_HUMAN;.	G	163;171;148	ENSP00000225308:A163G;ENSP00000366299:A171G;ENSP00000444540:A148G	ENSP00000225308:A163G	A	-	2	0	SLC25A39	39754333	1.000000	0.71417	1.000000	0.80357	0.185000	0.23345	8.886000	0.92447	2.758000	0.94735	0.655000	0.94253	GCC	SLC25A39	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000013306		0.632	SLC25A39-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A39	HGNC	protein_coding	OTTHUMT00000457745.1	44	0.00	0	G	NM_016016		42398807	42398807	-1	no_errors	ENST00000377095	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	1.000	C
SLC25A39	51629	genome.wustl.edu	37	17	42398807	42398807	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:42398807G>C	ENST00000377095.5	-	7	631	c.512C>G	c.(511-513)gCc>gGc	p.A171G	SLC25A39_ENST00000225308.8_Missense_Mutation_p.A163G|SLC25A39_ENST00000586016.1_Missense_Mutation_p.A39G|SLC25A39_ENST00000537904.2_Missense_Mutation_p.A148G|SLC25A39_ENST00000590194.1_Missense_Mutation_p.A163G	NM_001143780.1	NP_001137252.1	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39	171					heme biosynthetic process (GO:0006783)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CTCACGGCGGGCCAGCGCGCC	0.632																																						dbGAP											0													49.0	57.0	54.0					17																	42398807		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC096819	CCDS11482.1, CCDS45700.1	17q12	2013-05-22			ENSG00000013306	ENSG00000013306		"""Solute carriers"""	24279	protein-coding gene	gene with protein product		610820				16949250	Standard	NM_001143780		Approved	FLJ22407, CGI-69	uc002ign.2	Q9BZJ4	OTTHUMG00000132628	ENST00000377095.5:c.512C>G	17.37:g.42398807G>C	ENSP00000366299:p.Ala171Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8JZZ2|D3DX51|D3DX54|Q4V9M1|Q9P182|Q9UF66|Q9Y379	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.A171G	ENST00000377095.5	37	c.512	CCDS45700.1	17	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984288	0.74474	.	.	ENSG00000013306	ENST00000225308;ENST00000377095;ENST00000537904	D;D;D	0.87103	-2.21;-2.21;-2.21	5.31	5.31	0.75309	Mitochondrial carrier domain (2);	0.054526	0.64402	D	0.000001	D	0.91536	0.7327	L	0.49778	1.585	0.80722	D	1	D;D;D;D;D	0.89917	0.994;0.993;0.974;1.0;0.988	P;P;P;D;P	0.79108	0.891;0.751;0.766;0.992;0.654	D	0.91912	0.5540	10	0.72032	D	0.01	-8.9114	16.9594	0.86268	0.0:0.0:1.0:0.0	.	156;163;148;171;163	B4DVL9;B4DI93;B4DFG5;Q9BZJ4;Q9BZJ4-2	.;.;.;S2539_HUMAN;.	G	163;171;148	ENSP00000225308:A163G;ENSP00000366299:A171G;ENSP00000444540:A148G	ENSP00000225308:A163G	A	-	2	0	SLC25A39	39754333	1.000000	0.71417	1.000000	0.80357	0.185000	0.23345	8.886000	0.92447	2.758000	0.94735	0.655000	0.94253	GCC	SLC25A39	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000013306		0.632	SLC25A39-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A39	HGNC	protein_coding	OTTHUMT00000457745.1	25	0.00	0	G	NM_016016		42398807	42398807	-1	no_errors	ENST00000377095	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	1.000	C
SLITRK2	84631	genome.wustl.edu	37	X	144905077	144905077	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chrX:144905077G>C	ENST00000370490.1	+	1	5389	c.1134G>C	c.(1132-1134)aaG>aaC	p.K378N	SLITRK2_ENST00000447897.2_Missense_Mutation_p.K378N|SLITRK2_ENST00000413937.2_Missense_Mutation_p.K378N|SLITRK2_ENST00000428560.2_Missense_Mutation_p.K378N|SLITRK2_ENST00000434188.2_Missense_Mutation_p.K378N			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	378					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGTCCAAAGAAACTCTACC	0.423																																						dbGAP											0													66.0	63.0	64.0					X																	144905077		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1134G>C	X.37:g.144905077G>C	ENSP00000359521:p.Lys378Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.K378N	ENST00000370490.1	37	c.1134	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793967	0.70452	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84	5.66	5.66	0.87406	.	0.051172	0.85682	D	0.000000	T	0.63462	0.2513	M	0.71206	2.165	0.54753	D	0.999983	P	0.51653	0.947	P	0.56088	0.791	T	0.67217	-0.5726	10	0.72032	D	0.01	-12.0407	15.9269	0.79624	0.0:0.0:1.0:0.0	.	378	Q9H156	SLIK2_HUMAN	N	378	ENSP00000334374:K378N;ENSP00000411681:K378N;ENSP00000359521:K378N;ENSP00000397015:K378N;ENSP00000407347:K378N;ENSP00000412010:K378N	ENSP00000334374:K378N	K	+	3	2	SLITRK2	144712769	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.704000	0.74639	2.360000	0.80028	0.594000	0.82650	AAG	SLITRK2	-	NULL	ENSG00000185985		0.423	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	37	0.00	0	G	NM_032539		144905077	144905077	+1	no_errors	ENST00000370490	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	C
SLITRK2	84631	genome.wustl.edu	37	X	144905077	144905077	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chrX:144905077G>C	ENST00000370490.1	+	1	5389	c.1134G>C	c.(1132-1134)aaG>aaC	p.K378N	SLITRK2_ENST00000447897.2_Missense_Mutation_p.K378N|SLITRK2_ENST00000413937.2_Missense_Mutation_p.K378N|SLITRK2_ENST00000428560.2_Missense_Mutation_p.K378N|SLITRK2_ENST00000434188.2_Missense_Mutation_p.K378N			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	378					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGTCCAAAGAAACTCTACC	0.423																																						dbGAP											0													66.0	63.0	64.0					X																	144905077		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1134G>C	X.37:g.144905077G>C	ENSP00000359521:p.Lys378Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.K378N	ENST00000370490.1	37	c.1134	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793967	0.70452	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84	5.66	5.66	0.87406	.	0.051172	0.85682	D	0.000000	T	0.63462	0.2513	M	0.71206	2.165	0.54753	D	0.999983	P	0.51653	0.947	P	0.56088	0.791	T	0.67217	-0.5726	10	0.72032	D	0.01	-12.0407	15.9269	0.79624	0.0:0.0:1.0:0.0	.	378	Q9H156	SLIK2_HUMAN	N	378	ENSP00000334374:K378N;ENSP00000411681:K378N;ENSP00000359521:K378N;ENSP00000397015:K378N;ENSP00000407347:K378N;ENSP00000412010:K378N	ENSP00000334374:K378N	K	+	3	2	SLITRK2	144712769	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.704000	0.74639	2.360000	0.80028	0.594000	0.82650	AAG	SLITRK2	-	NULL	ENSG00000185985		0.423	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	45	0.00	0	G	NM_032539		144905077	144905077	+1	no_errors	ENST00000370490	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	C
SMARCD2	6603	genome.wustl.edu	37	17	61910318	61910318	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:61910318G>A	ENST00000448276.2	-	13	1841	c.1576C>T	c.(1576-1578)Ctg>Ttg	p.L526L	SMARCD2_ENST00000323347.10_Silent_p.L478L|SMARCD2_ENST00000225742.9_Silent_p.L451L|FTSJ3_ENST00000580295.1_5'Flank	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	526					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						CGAATTCCCAGCACCTGTTCC	0.602																																						dbGAP											0													41.0	48.0	46.0					17																	61910318		1963	4150	6113	-	-	-	SO:0001819	synonymous_variant	0			U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.1576C>T	17.37:g.61910318G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.A225V	ENST00000448276.2	37	c.674	CCDS45756.1	17																																																																																			SMARCD2	-	NULL	ENSG00000108604		0.602	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD2	HGNC	protein_coding	OTTHUMT00000444544.1	55	0.00	0	G	NM_001098426		61910318	61910318	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000450364	ensembl	human	novel	69_37n	missense	134	18.79	31	SNP	1.000	A
SMARCD2	6603	genome.wustl.edu	37	17	61910318	61910318	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:61910318G>A	ENST00000448276.2	-	13	1841	c.1576C>T	c.(1576-1578)Ctg>Ttg	p.L526L	SMARCD2_ENST00000323347.10_Silent_p.L478L|SMARCD2_ENST00000225742.9_Silent_p.L451L|FTSJ3_ENST00000580295.1_5'Flank	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	526					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						CGAATTCCCAGCACCTGTTCC	0.602																																						dbGAP											0													41.0	48.0	46.0					17																	61910318		1963	4150	6113	-	-	-	SO:0001819	synonymous_variant	0			U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.1576C>T	17.37:g.61910318G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.A225V	ENST00000448276.2	37	c.674	CCDS45756.1	17																																																																																			SMARCD2	-	NULL	ENSG00000108604		0.602	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD2	HGNC	protein_coding	OTTHUMT00000444544.1	46	0.00	0	G	NM_001098426		61910318	61910318	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000450364	ensembl	human	novel	69_37n	missense	134	18.79	31	SNP	1.000	A
SMURF2	64750	genome.wustl.edu	37	17	62551044	62551044	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:62551044T>C	ENST00000262435.9	-	15	1865	c.1678A>G	c.(1678-1680)Att>Gtt	p.I560V		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	560	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			TCATGCTGAATAATTTCACCA	0.348																																						dbGAP											0													128.0	123.0	124.0					17																	62551044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.1678A>G	17.37:g.62551044T>C	ENSP00000262435:p.Ile560Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LL1|Q9H260	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.I560V	ENST00000262435.9	37	c.1678	CCDS32707.1	17	.	.	.	.	.	.	.	.	.	.	T	12.09	1.833821	0.32421	.	.	ENSG00000108854	ENST00000262435	T	0.56941	0.43	6.0	6.0	0.97389	HECT (4);	0.105282	0.64402	D	0.000004	T	0.21550	0.0519	N	0.00985	-1.075	0.58432	D	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.28299	-1.0048	10	0.08599	T	0.76	.	12.3645	0.55221	0.0:0.0:0.1405:0.8595	.	560	Q9HAU4	SMUF2_HUMAN	V	560	ENSP00000262435:I560V	ENSP00000262435:I560V	I	-	1	0	SMURF2	59981506	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.664000	0.61540	2.297000	0.77311	0.533000	0.62120	ATT	SMURF2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000108854		0.348	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMURF2	HGNC	protein_coding	OTTHUMT00000445227.1	35	0.00	0	T	NM_022739		62551044	62551044	-1	no_errors	ENST00000262435	ensembl	human	known	69_37n	missense	24	64.18	43	SNP	0.999	C
SMURF2	64750	genome.wustl.edu	37	17	62551044	62551044	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:62551044T>C	ENST00000262435.9	-	15	1865	c.1678A>G	c.(1678-1680)Att>Gtt	p.I560V		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	560	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			TCATGCTGAATAATTTCACCA	0.348																																						dbGAP											0													128.0	123.0	124.0					17																	62551044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.1678A>G	17.37:g.62551044T>C	ENSP00000262435:p.Ile560Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LL1|Q9H260	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.I560V	ENST00000262435.9	37	c.1678	CCDS32707.1	17	.	.	.	.	.	.	.	.	.	.	T	12.09	1.833821	0.32421	.	.	ENSG00000108854	ENST00000262435	T	0.56941	0.43	6.0	6.0	0.97389	HECT (4);	0.105282	0.64402	D	0.000004	T	0.21550	0.0519	N	0.00985	-1.075	0.58432	D	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.28299	-1.0048	10	0.08599	T	0.76	.	12.3645	0.55221	0.0:0.0:0.1405:0.8595	.	560	Q9HAU4	SMUF2_HUMAN	V	560	ENSP00000262435:I560V	ENSP00000262435:I560V	I	-	1	0	SMURF2	59981506	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.664000	0.61540	2.297000	0.77311	0.533000	0.62120	ATT	SMURF2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000108854		0.348	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMURF2	HGNC	protein_coding	OTTHUMT00000445227.1	38	0.00	0	T	NM_022739		62551044	62551044	-1	no_errors	ENST00000262435	ensembl	human	known	69_37n	missense	24	64.18	43	SNP	0.999	C
Unknown	0	genome.wustl.edu	37	1	84999433	84999433	+	IGR	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:84999433G>C								SPATA1 (6862 upstream) : CTBS (15855 downstream)																							GCTATCAGTAGAAGACAGGAC	0.294																																						dbGAP											0													73.0	72.0	72.0					1																	84999433		2199	4290	6489	-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.84999433G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		1																																																																																			SPATA1	-	-	ENSG00000122432	0	0.294					SPATA1	HGNC			33	0.00	0	G			84999433	84999433	+1	no_errors	ENST00000431031	ensembl	human	known	69_37n	rna	32	17.95	7	SNP	0.962	C
Unknown	0	genome.wustl.edu	37	1	84999433	84999433	+	IGR	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:84999433G>C								SPATA1 (6862 upstream) : CTBS (15855 downstream)																							GCTATCAGTAGAAGACAGGAC	0.294																																						dbGAP											0													73.0	72.0	72.0					1																	84999433		2199	4290	6489	-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.84999433G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		1																																																																																			SPATA1	-	-	ENSG00000122432	0	0.294					SPATA1	HGNC			29	0.00	0	G			84999433	84999433	+1	no_errors	ENST00000431031	ensembl	human	known	69_37n	rna	32	17.95	7	SNP	0.962	C
SPRR2B	6701	genome.wustl.edu	37	1	153043174	153043174	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:153043174G>A	ENST00000368755.2	-	1	142	c.142C>T	c.(142-144)Cag>Tag	p.Q48*	SPRR2B_ENST00000368752.4_Nonsense_Mutation_p.Q48*|SPRR2B_ENST00000341611.2_Nonsense_Mutation_p.Q48*			P35325	SPR2B_HUMAN	small proline-rich protein 2B	48					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(2)|large_intestine(1)|lung(2)	5	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGGCACTGCTGAGGTGGGCAG	0.597																																						dbGAP											0													119.0	109.0	112.0					1																	153043174		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			AF333952	CCDS30865.1	1q21-q22	2008-02-05			ENSG00000196805	ENSG00000196805			11262	protein-coding gene	gene with protein product		182268				8325635	Standard	NM_001017418		Approved		uc001fbg.3	P35325	OTTHUMG00000013863	ENST00000368755.2:c.142C>T	1.37:g.153043174G>A	ENSP00000357744:p.Gln48*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T528	Nonsense_Mutation	SNP	NULL	p.Q48*	ENST00000368755.2	37	c.142	CCDS30865.1	1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660216	0.29515	.	.	ENSG00000196805	ENST00000368755;ENST00000341611;ENST00000368752	.	.	.	2.69	0.539	0.17156	.	3.700400	0.01095	N	0.005265	.	.	.	.	.	.	0.21967	N	0.999445	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.428	0.16438	0.0:0.2225:0.5494:0.2281	.	.	.	.	X	48	.	ENSP00000340703:Q48X	Q	-	1	0	SPRR2B	151309798	0.017000	0.18338	0.000000	0.03702	0.095000	0.18619	1.298000	0.33412	-0.028000	0.13850	-0.519000	0.04390	CAG	SPRR2B	-	NULL	ENSG00000196805		0.597	SPRR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR2B	HGNC	protein_coding	OTTHUMT00000038905.2	130	0.00	0	G			153043174	153043174	-1	no_errors	ENST00000341611	ensembl	human	known	69_37n	nonsense	196	16.95	40	SNP	0.000	A
SPRR2B	6701	genome.wustl.edu	37	1	153043174	153043174	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:153043174G>A	ENST00000368755.2	-	1	142	c.142C>T	c.(142-144)Cag>Tag	p.Q48*	SPRR2B_ENST00000368752.4_Nonsense_Mutation_p.Q48*|SPRR2B_ENST00000341611.2_Nonsense_Mutation_p.Q48*			P35325	SPR2B_HUMAN	small proline-rich protein 2B	48					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(2)|large_intestine(1)|lung(2)	5	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGGCACTGCTGAGGTGGGCAG	0.597																																						dbGAP											0													119.0	109.0	112.0					1																	153043174		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			AF333952	CCDS30865.1	1q21-q22	2008-02-05			ENSG00000196805	ENSG00000196805			11262	protein-coding gene	gene with protein product		182268				8325635	Standard	NM_001017418		Approved		uc001fbg.3	P35325	OTTHUMG00000013863	ENST00000368755.2:c.142C>T	1.37:g.153043174G>A	ENSP00000357744:p.Gln48*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T528	Nonsense_Mutation	SNP	NULL	p.Q48*	ENST00000368755.2	37	c.142	CCDS30865.1	1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660216	0.29515	.	.	ENSG00000196805	ENST00000368755;ENST00000341611;ENST00000368752	.	.	.	2.69	0.539	0.17156	.	3.700400	0.01095	N	0.005265	.	.	.	.	.	.	0.21967	N	0.999445	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.428	0.16438	0.0:0.2225:0.5494:0.2281	.	.	.	.	X	48	.	ENSP00000340703:Q48X	Q	-	1	0	SPRR2B	151309798	0.017000	0.18338	0.000000	0.03702	0.095000	0.18619	1.298000	0.33412	-0.028000	0.13850	-0.519000	0.04390	CAG	SPRR2B	-	NULL	ENSG00000196805		0.597	SPRR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR2B	HGNC	protein_coding	OTTHUMT00000038905.2	121	0.00	0	G			153043174	153043174	-1	no_errors	ENST00000341611	ensembl	human	known	69_37n	nonsense	196	16.95	40	SNP	0.000	A
SPTLC3	55304	genome.wustl.edu	37	20	12989859	12989859	+	5'UTR	SNP	A	A	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr20:12989859A>G	ENST00000399002.2	+	0	218				SPTLC3_ENST00000378194.4_5'UTR|SPTLC3_ENST00000476791.1_3'UTR	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3						small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						ACTGAAAACTAAAGCCTGCAG	0.507																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.-57A>G	20.37:g.12989859A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	RNA	SNP	-	NULL	ENST00000399002.2	37	NULL	CCDS13115.2	20																																																																																			SPTLC3	-	-	ENSG00000172296		0.507	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC3	HGNC	protein_coding	OTTHUMT00000254544.1	13	0.00	0	A	NM_018327		12989859	12989859	+1	no_errors	ENST00000476791	ensembl	human	known	69_37n	rna	19	24.00	6	SNP	0.000	G
SPTLC3	55304	genome.wustl.edu	37	20	12989859	12989859	+	5'UTR	SNP	A	A	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr20:12989859A>G	ENST00000399002.2	+	0	218				SPTLC3_ENST00000378194.4_5'UTR|SPTLC3_ENST00000476791.1_3'UTR	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3						small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						ACTGAAAACTAAAGCCTGCAG	0.507																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.-57A>G	20.37:g.12989859A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	RNA	SNP	-	NULL	ENST00000399002.2	37	NULL	CCDS13115.2	20																																																																																			SPTLC3	-	-	ENSG00000172296		0.507	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC3	HGNC	protein_coding	OTTHUMT00000254544.1	22	0.00	0	A	NM_018327		12989859	12989859	+1	no_errors	ENST00000476791	ensembl	human	known	69_37n	rna	19	24.00	6	SNP	0.000	G
TARBP1	6894	genome.wustl.edu	37	1	234593419	234593419	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:234593419C>A	ENST00000040877.1	-	9	1715	c.1716G>T	c.(1714-1716)tgG>tgT	p.W572C		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	572					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCACCTCTGTCCACAATGAAG	0.338																																						dbGAP											0													55.0	55.0	55.0					1																	234593419		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.1716G>T	1.37:g.234593419C>A	ENSP00000040877:p.Trp572Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H581	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.W572C	ENST00000040877.1	37	c.1716	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955915	0.73902	.	.	ENSG00000059588	ENST00000040877	T	0.27256	1.68	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.55513	0.1925	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.54892	-0.8225	10	0.87932	D	0	-25.1797	20.4574	0.99148	0.0:1.0:0.0:0.0	.	572	Q13395	TARB1_HUMAN	C	572	ENSP00000040877:W572C	ENSP00000040877:W572C	W	-	3	0	TARBP1	232660042	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.555000	0.67301	2.843000	0.97960	0.591000	0.81541	TGG	TARBP1	-	NULL	ENSG00000059588		0.338	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	47	0.00	0	C	NM_005646		234593419	234593419	-1	no_errors	ENST00000040877	ensembl	human	known	69_37n	missense	84	12.50	12	SNP	1.000	A
TARBP1	6894	genome.wustl.edu	37	1	234593419	234593419	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:234593419C>A	ENST00000040877.1	-	9	1715	c.1716G>T	c.(1714-1716)tgG>tgT	p.W572C		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	572					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCACCTCTGTCCACAATGAAG	0.338																																						dbGAP											0													55.0	55.0	55.0					1																	234593419		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.1716G>T	1.37:g.234593419C>A	ENSP00000040877:p.Trp572Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H581	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.W572C	ENST00000040877.1	37	c.1716	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955915	0.73902	.	.	ENSG00000059588	ENST00000040877	T	0.27256	1.68	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.55513	0.1925	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.54892	-0.8225	10	0.87932	D	0	-25.1797	20.4574	0.99148	0.0:1.0:0.0:0.0	.	572	Q13395	TARB1_HUMAN	C	572	ENSP00000040877:W572C	ENSP00000040877:W572C	W	-	3	0	TARBP1	232660042	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.555000	0.67301	2.843000	0.97960	0.591000	0.81541	TGG	TARBP1	-	NULL	ENSG00000059588		0.338	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	56	0.00	0	C	NM_005646		234593419	234593419	-1	no_errors	ENST00000040877	ensembl	human	known	69_37n	missense	84	12.50	12	SNP	1.000	A
TEX10	54881	genome.wustl.edu	37	9	103092280	103092281	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr9:103092280_103092281insA	ENST00000374902.4	-	6	1597_1598	c.1421_1422insT	c.(1420-1422)ctafs	p.L474fs	TEX10_ENST00000535814.1_Frame_Shift_Ins_p.L477fs|TEX10_ENST00000537512.1_Frame_Shift_Ins_p.L409fs	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	474						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		GCTTACTATTTAGCCTAGAGCC	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1422dupT	9.37:g.103092281_103092281dupA	ENSP00000364037:p.Leu474fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Frame_Shift_Ins	INS	pfam_IPI1-like_dom,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.N475fs	ENST00000374902.4	37	c.1422_1421	CCDS6748.1	9																																																																																			TEX10	-	superfamily_ARM-type_fold	ENSG00000136891		0.421	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1	51	0.00	0	-	NM_017746		103092280	103092281	-1	no_errors	ENST00000374902	ensembl	human	known	69_37n	frame_shift_ins	53	33.75	27	INS	0.997:1.000	A
TEX10	54881	genome.wustl.edu	37	9	103092280	103092281	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr9:103092280_103092281insA	ENST00000374902.4	-	6	1597_1598	c.1421_1422insT	c.(1420-1422)ctafs	p.L474fs	TEX10_ENST00000535814.1_Frame_Shift_Ins_p.L477fs|TEX10_ENST00000537512.1_Frame_Shift_Ins_p.L409fs	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	474						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		GCTTACTATTTAGCCTAGAGCC	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1422dupT	9.37:g.103092281_103092281dupA	ENSP00000364037:p.Leu474fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Frame_Shift_Ins	INS	pfam_IPI1-like_dom,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.N475fs	ENST00000374902.4	37	c.1422_1421	CCDS6748.1	9																																																																																			TEX10	-	superfamily_ARM-type_fold	ENSG00000136891		0.421	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1	66	0.00	0	-	NM_017746		103092280	103092281	-1	no_errors	ENST00000374902	ensembl	human	known	69_37n	frame_shift_ins	53	33.75	27	INS	0.997:1.000	A
THAP5	168451	genome.wustl.edu	37	7	108204868	108204868	+	Missense_Mutation	SNP	G	G	C	rs373994318		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:108204868G>C	ENST00000415914.3	-	3	1108	c.955C>G	c.(955-957)Caa>Gaa	p.Q319E	THAP5_ENST00000313516.5_Missense_Mutation_p.Q277E|THAP5_ENST00000493722.1_5'UTR	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	319					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						TGTTCGATTTGTAAAACTTCT	0.338																																						dbGAP											0													119.0	117.0	118.0					7																	108204868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.955C>G	7.37:g.108204868G>C	ENSP00000400500:p.Gln319Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.Q319E	ENST00000415914.3	37	c.955	CCDS47687.1	7	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696111	0.30052	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.96651	-4.08;-2.6	4.45	4.45	0.53987	.	0.515999	0.14633	N	0.307687	D	0.90714	0.7086	N	0.11560	0.145	0.80722	D	1	P	0.36465	0.554	B	0.38458	0.274	D	0.88440	0.3041	9	.	.	.	.	12.3574	0.55184	0.0:0.1701:0.8299:0.0	.	319	Q7Z6K1	THAP5_HUMAN	E	319;277	ENSP00000400500:Q319E;ENSP00000322440:Q277E	.	Q	-	1	0	THAP5	107992104	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.558000	0.60789	2.188000	0.69820	0.650000	0.86243	CAA	THAP5	-	NULL	ENSG00000177683		0.338	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	HGNC	protein_coding	OTTHUMT00000337777.2	47	0.00	0	G	NM_182529		108204868	108204868	-1	no_errors	ENST00000415914	ensembl	human	known	69_37n	missense	70	20.45	18	SNP	1.000	C
THAP5	168451	genome.wustl.edu	37	7	108204868	108204868	+	Missense_Mutation	SNP	G	G	C	rs373994318		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:108204868G>C	ENST00000415914.3	-	3	1108	c.955C>G	c.(955-957)Caa>Gaa	p.Q319E	THAP5_ENST00000313516.5_Missense_Mutation_p.Q277E|THAP5_ENST00000493722.1_5'UTR	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	319					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						TGTTCGATTTGTAAAACTTCT	0.338																																						dbGAP											0													119.0	117.0	118.0					7																	108204868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.955C>G	7.37:g.108204868G>C	ENSP00000400500:p.Gln319Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.Q319E	ENST00000415914.3	37	c.955	CCDS47687.1	7	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696111	0.30052	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.96651	-4.08;-2.6	4.45	4.45	0.53987	.	0.515999	0.14633	N	0.307687	D	0.90714	0.7086	N	0.11560	0.145	0.80722	D	1	P	0.36465	0.554	B	0.38458	0.274	D	0.88440	0.3041	9	.	.	.	.	12.3574	0.55184	0.0:0.1701:0.8299:0.0	.	319	Q7Z6K1	THAP5_HUMAN	E	319;277	ENSP00000400500:Q319E;ENSP00000322440:Q277E	.	Q	-	1	0	THAP5	107992104	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.558000	0.60789	2.188000	0.69820	0.650000	0.86243	CAA	THAP5	-	NULL	ENSG00000177683		0.338	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	HGNC	protein_coding	OTTHUMT00000337777.2	73	0.00	0	G	NM_182529		108204868	108204868	-1	no_errors	ENST00000415914	ensembl	human	known	69_37n	missense	70	20.45	18	SNP	1.000	C
THTPA	79178	genome.wustl.edu	37	14	24026483	24026483	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr14:24026483G>C	ENST00000288014.6	+	1	1253	c.517G>C	c.(517-519)Gag>Cag	p.E173Q	THTPA_ENST00000556015.1_Intron|RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000404535.3_Missense_Mutation_p.E173Q|THTPA_ENST00000554789.1_Intron|THTPA_ENST00000554970.1_Intron|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA			Q9BU02	THTPA_HUMAN	thiamine triphosphatase	173	CYTH. {ECO:0000255|PROSITE- ProRule:PRU01044}.				dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)			large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		AACTGCCCTAGAGAAGATCCA	0.572																																						dbGAP											0													34.0	28.0	30.0					14																	24026483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.517G>C	14.37:g.24026483G>C	ENSP00000288014:p.Glu173Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS50|G3V4J3	Missense_Mutation	SNP	pfam_CYTH_domain,superfamily_CYTH-like_domain,pirsf_ThTPase	p.E173Q	ENST00000288014.6	37	c.517	CCDS32053.1	14	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046624	0.55110	.	.	ENSG00000157306	ENST00000404535;ENST00000288014	T;T	0.53206	0.63;0.63	5.13	3.33	0.38152	CYTH domain (2);CYTH-like domain (1);	0.393600	0.29493	N	0.011984	T	0.36880	0.0983	L	0.42686	1.345	0.80722	D	1	B	0.32829	0.386	B	0.35550	0.205	T	0.09530	-1.0670	10	0.30854	T	0.27	-8.0026	6.9906	0.24753	0.2701:0.0:0.7298:0.0	.	173	Q9BU02	THTPA_HUMAN	Q	173	ENSP00000384580:E173Q;ENSP00000288014:E173Q	ENSP00000288014:E173Q	E	+	1	0	THTPA	23096323	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	3.032000	0.49736	0.755000	0.32990	0.561000	0.74099	GAG	THTPA	-	pfam_CYTH_domain,superfamily_CYTH-like_domain,pirsf_ThTPase	ENSG00000259431		0.572	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THTPA	HGNC	protein_coding	OTTHUMT00000413800.2	44	0.00	0	G			24026483	24026483	+1	no_errors	ENST00000288014	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	1.000	C
THTPA	79178	genome.wustl.edu	37	14	24026483	24026483	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr14:24026483G>C	ENST00000288014.6	+	1	1253	c.517G>C	c.(517-519)Gag>Cag	p.E173Q	THTPA_ENST00000556015.1_Intron|RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000404535.3_Missense_Mutation_p.E173Q|THTPA_ENST00000554789.1_Intron|THTPA_ENST00000554970.1_Intron|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA			Q9BU02	THTPA_HUMAN	thiamine triphosphatase	173	CYTH. {ECO:0000255|PROSITE- ProRule:PRU01044}.				dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)			large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		AACTGCCCTAGAGAAGATCCA	0.572																																						dbGAP											0													34.0	28.0	30.0					14																	24026483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.517G>C	14.37:g.24026483G>C	ENSP00000288014:p.Glu173Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS50|G3V4J3	Missense_Mutation	SNP	pfam_CYTH_domain,superfamily_CYTH-like_domain,pirsf_ThTPase	p.E173Q	ENST00000288014.6	37	c.517	CCDS32053.1	14	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046624	0.55110	.	.	ENSG00000157306	ENST00000404535;ENST00000288014	T;T	0.53206	0.63;0.63	5.13	3.33	0.38152	CYTH domain (2);CYTH-like domain (1);	0.393600	0.29493	N	0.011984	T	0.36880	0.0983	L	0.42686	1.345	0.80722	D	1	B	0.32829	0.386	B	0.35550	0.205	T	0.09530	-1.0670	10	0.30854	T	0.27	-8.0026	6.9906	0.24753	0.2701:0.0:0.7298:0.0	.	173	Q9BU02	THTPA_HUMAN	Q	173	ENSP00000384580:E173Q;ENSP00000288014:E173Q	ENSP00000288014:E173Q	E	+	1	0	THTPA	23096323	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	3.032000	0.49736	0.755000	0.32990	0.561000	0.74099	GAG	THTPA	-	pfam_CYTH_domain,superfamily_CYTH-like_domain,pirsf_ThTPase	ENSG00000259431		0.572	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THTPA	HGNC	protein_coding	OTTHUMT00000413800.2	30	0.00	0	G			24026483	24026483	+1	no_errors	ENST00000288014	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	1.000	C
TMEM30A	55754	genome.wustl.edu	37	6	75969199	75969199	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:75969199T>G	ENST00000230461.6	-	5	878	c.549A>C	c.(547-549)ttA>ttC	p.L183F	TMEM30A_ENST00000370050.5_Missense_Mutation_p.L64F|TMEM30A_ENST00000475111.2_Missense_Mutation_p.L147F	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	183					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GAAACAATTCTAATGTATCTA	0.318																																						dbGAP											0													72.0	71.0	71.0					6																	75969199		2202	4298	6500	-	-	-	SO:0001583	missense	0			AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.549A>C	6.37:g.75969199T>G	ENSP00000230461:p.Leu183Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	p.L183F	ENST00000230461.6	37	c.549	CCDS4983.1	6	.	.	.	.	.	.	.	.	.	.	T	11.94	1.789359	0.31685	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111;ENST00000518161	.	.	.	5.31	2.94	0.34122	.	0.000000	0.64402	D	0.000001	T	0.15565	0.0375	N	0.12831	0.26	0.58432	D	0.999999	B;B	0.26708	0.074;0.157	B;B	0.43018	0.185;0.405	T	0.35101	-0.9802	9	0.02654	T	1	.	3.3936	0.07298	0.0:0.2814:0.2054:0.5132	.	147;183	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	F	183;167;64;147;64	.	ENSP00000230461:L183F	L	-	3	2	TMEM30A	76025919	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.519000	0.35888	0.976000	0.38417	0.533000	0.62120	TTA	TMEM30A	-	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	ENSG00000112697		0.318	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM30A	HGNC	protein_coding	OTTHUMT00000041248.2	28	0.00	0	T	NM_018247		75969199	75969199	-1	no_errors	ENST00000230461	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	G
TMEM30A	55754	genome.wustl.edu	37	6	75969199	75969199	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr6:75969199T>G	ENST00000230461.6	-	5	878	c.549A>C	c.(547-549)ttA>ttC	p.L183F	TMEM30A_ENST00000370050.5_Missense_Mutation_p.L64F|TMEM30A_ENST00000475111.2_Missense_Mutation_p.L147F	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	183					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GAAACAATTCTAATGTATCTA	0.318																																						dbGAP											0													72.0	71.0	71.0					6																	75969199		2202	4298	6500	-	-	-	SO:0001583	missense	0			AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.549A>C	6.37:g.75969199T>G	ENSP00000230461:p.Leu183Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	p.L183F	ENST00000230461.6	37	c.549	CCDS4983.1	6	.	.	.	.	.	.	.	.	.	.	T	11.94	1.789359	0.31685	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111;ENST00000518161	.	.	.	5.31	2.94	0.34122	.	0.000000	0.64402	D	0.000001	T	0.15565	0.0375	N	0.12831	0.26	0.58432	D	0.999999	B;B	0.26708	0.074;0.157	B;B	0.43018	0.185;0.405	T	0.35101	-0.9802	9	0.02654	T	1	.	3.3936	0.07298	0.0:0.2814:0.2054:0.5132	.	147;183	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	F	183;167;64;147;64	.	ENSP00000230461:L183F	L	-	3	2	TMEM30A	76025919	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.519000	0.35888	0.976000	0.38417	0.533000	0.62120	TTA	TMEM30A	-	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	ENSG00000112697		0.318	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM30A	HGNC	protein_coding	OTTHUMT00000041248.2	22	0.00	0	T	NM_018247		75969199	75969199	-1	no_errors	ENST00000230461	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	G
TOR1AIP1	26092	genome.wustl.edu	37	1	179851716	179851716	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:179851716G>A	ENST00000606911.2	+	1	270	c.79G>A	c.(79-81)Gag>Aag	p.E27K	TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.E27K|TOR1AIP1_ENST00000435319.4_5'Flank|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.E27K|RP11-533E19.7_ENST00000610272.1_lincRNA			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	27					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						CCCCATCCGAGAGGGAAGGGG	0.682																																						dbGAP											0													10.0	11.0	11.0					1																	179851716		2176	4262	6438	-	-	-	SO:0001583	missense	0				CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.79G>A	1.37:g.179851716G>A	ENSP00000476687:p.Glu27Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	pfam_Lamina-ass_polypeptide_CLAP1C	p.E27K	ENST00000606911.2	37	c.79	CCDS1335.1	1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.228454	0.79576	.	.	ENSG00000143337	ENST00000528443;ENST00000325993;ENST00000271583;ENST00000435319	T;T;T	0.26373	1.74;1.75;1.76	5.35	3.23	0.37069	.	0.234792	0.30244	N	0.010072	T	0.36936	0.0985	L	0.32530	0.975	0.21325	N	0.999724	D;D	0.76494	0.966;0.999	P;D	0.80764	0.505;0.994	T	0.07693	-1.0759	10	0.72032	D	0.01	-14.8241	11.5049	0.50459	0.0:0.4345:0.5655:0.0	.	27;27	Q5JTV8;E9PKD1	TOIP1_HUMAN;.	K	27	ENSP00000435365:E27K;ENSP00000271583:E27K;ENSP00000393292:E27K	ENSP00000271583:E27K	E	+	1	0	TOR1AIP1	178118339	0.919000	0.31177	0.653000	0.29593	0.771000	0.43674	1.667000	0.37471	1.329000	0.45376	0.655000	0.94253	GAG	TOR1AIP1	-	NULL	ENSG00000143337		0.682	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOR1AIP1	HGNC	protein_coding	OTTHUMT00000100313.4	33	0.00	0	G	NM_015602		179851716	179851716	+1	no_errors	ENST00000435319	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	0.434	A
TP53	7157	genome.wustl.edu	37	17	7577027	7577027	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:7577027delG	ENST00000269305.4	-	8	1100	c.911delC	c.(910-912)actfs	p.T304fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.T304fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.T304fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.T304fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.T304fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	304	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in a sporadic cancer; somatic mutation).|T -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.T304I(2)|p.L265_K305del41(1)|p.G293fs*1(1)|p.T304N(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACCTCGCTTAGTGCTCCCTGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	16	Whole gene deletion(8)|Substitution - Missense(3)|Unknown(3)|Deletion - In frame(1)|Deletion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(2)|urinary_tract(2)|large_intestine(1)|stomach(1)|soft_tissue(1)|lung(1)|breast(1)											117.0	103.0	108.0					17																	7577027		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.911delC	17.37:g.7577027delG	ENSP00000269305:p.Thr304fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.T304fs	ENST00000269305.4	37	c.911	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	82	0.00	0	G	NM_000546		7577027	7577027	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	41	39.73	29	DEL	0.689	-
TP53	7157	genome.wustl.edu	37	17	7577027	7577027	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:7577027delG	ENST00000269305.4	-	8	1100	c.911delC	c.(910-912)actfs	p.T304fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.T304fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.T304fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.T304fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.T304fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	304	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in a sporadic cancer; somatic mutation).|T -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.T304I(2)|p.L265_K305del41(1)|p.G293fs*1(1)|p.T304N(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACCTCGCTTAGTGCTCCCTGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	16	Whole gene deletion(8)|Substitution - Missense(3)|Unknown(3)|Deletion - In frame(1)|Deletion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(2)|urinary_tract(2)|large_intestine(1)|stomach(1)|soft_tissue(1)|lung(1)|breast(1)											117.0	103.0	108.0					17																	7577027		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.911delC	17.37:g.7577027delG	ENSP00000269305:p.Thr304fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.T304fs	ENST00000269305.4	37	c.911	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	77	0.00	0	G	NM_000546		7577027	7577027	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	41	39.73	29	DEL	0.689	-
TPGS2	25941	genome.wustl.edu	37	18	34367018	34367018	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr18:34367018T>A	ENST00000590842.1	-	7	756	c.682A>T	c.(682-684)Aga>Tga	p.R228*	TPGS2_ENST00000590652.1_Intron|TPGS2_ENST00000587129.1_Intron	NM_001271951.1	NP_001258880.1	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	0						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CATTTTCTTCTATTCATTTTG	0.438																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			BC015178	CCDS32817.1, CCDS62421.1, CCDS62422.1, CCDS62423.1, CCDS62424.1, CCDS74214.1, CCDS74215.1	18q12.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134779	ENSG00000134779			24561	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 10"""	C18orf10		12477932	Standard	NM_015476		Approved	DKFZP586M1523, HsT3006	uc031rhw.1	Q68CL5		ENST00000590842.1:c.682A>T	18.37:g.34367018T>A	ENSP00000464780:p.Arg228*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIX2|K7EIJ9|Q4KN59|Q8WTU3|Q96BT9|Q9Y435	Nonsense_Mutation	SNP	smart_Cell_wall_assmbl_KNR4-like	p.R228*	ENST00000590842.1	37	c.682		18																																																																																			TPGS2	-	NULL	ENSG00000134779		0.438	TPGS2-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	TPGS2	HGNC	protein_coding	OTTHUMT00000440406.2	79	0.00	0	T	NM_015476		34367018	34367018	-1	no_errors	ENST00000590842	ensembl	human	novel	69_37n	nonsense	81	30.17	35	SNP	0.265	A
TPGS2	25941	genome.wustl.edu	37	18	34367018	34367018	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr18:34367018T>A	ENST00000590842.1	-	7	756	c.682A>T	c.(682-684)Aga>Tga	p.R228*	TPGS2_ENST00000590652.1_Intron|TPGS2_ENST00000587129.1_Intron	NM_001271951.1	NP_001258880.1	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	0						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CATTTTCTTCTATTCATTTTG	0.438																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			BC015178	CCDS32817.1, CCDS62421.1, CCDS62422.1, CCDS62423.1, CCDS62424.1, CCDS74214.1, CCDS74215.1	18q12.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134779	ENSG00000134779			24561	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 10"""	C18orf10		12477932	Standard	NM_015476		Approved	DKFZP586M1523, HsT3006	uc031rhw.1	Q68CL5		ENST00000590842.1:c.682A>T	18.37:g.34367018T>A	ENSP00000464780:p.Arg228*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIX2|K7EIJ9|Q4KN59|Q8WTU3|Q96BT9|Q9Y435	Nonsense_Mutation	SNP	smart_Cell_wall_assmbl_KNR4-like	p.R228*	ENST00000590842.1	37	c.682		18																																																																																			TPGS2	-	NULL	ENSG00000134779		0.438	TPGS2-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	TPGS2	HGNC	protein_coding	OTTHUMT00000440406.2	87	0.00	0	T	NM_015476		34367018	34367018	-1	no_errors	ENST00000590842	ensembl	human	novel	69_37n	nonsense	81	30.17	35	SNP	0.265	A
TRAF4	9618	genome.wustl.edu	37	17	27076034	27076034	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr17:27076034G>A	ENST00000262395.5	+	7	981	c.852G>A	c.(850-852)ctG>ctA	p.L284L	TRAF4_ENST00000444415.3_Silent_p.L284L|AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000262396.6_Intron|AC010761.9_ENST00000577325.1_RNA	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	284					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			TGTGTGCCCTGGTGAGCCGGC	0.607																																						dbGAP											0													49.0	48.0	48.0					17																	27076034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.852G>A	17.37:g.27076034G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75615|Q14848|Q2KJU4|Q2PJN8	Silent	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.L284	ENST00000262395.5	37	c.852	CCDS11243.1	17																																																																																			TRAF4	-	superfamily_TRAF-like,pirsf_TNF_rcpt--assoc_TRAF	ENSG00000076604		0.607	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF4	HGNC	protein_coding	OTTHUMT00000255944.2	57	0.00	0	G	NM_145751		27076034	27076034	+1	no_errors	ENST00000262395	ensembl	human	known	69_37n	silent	174	15.12	31	SNP	1.000	A
TRAF4	9618	genome.wustl.edu	37	17	27076034	27076034	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr17:27076034G>A	ENST00000262395.5	+	7	981	c.852G>A	c.(850-852)ctG>ctA	p.L284L	TRAF4_ENST00000444415.3_Silent_p.L284L|AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000262396.6_Intron|AC010761.9_ENST00000577325.1_RNA	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	284					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			TGTGTGCCCTGGTGAGCCGGC	0.607																																						dbGAP											0													49.0	48.0	48.0					17																	27076034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.852G>A	17.37:g.27076034G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75615|Q14848|Q2KJU4|Q2PJN8	Silent	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.L284	ENST00000262395.5	37	c.852	CCDS11243.1	17																																																																																			TRAF4	-	superfamily_TRAF-like,pirsf_TNF_rcpt--assoc_TRAF	ENSG00000076604		0.607	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF4	HGNC	protein_coding	OTTHUMT00000255944.2	50	0.00	0	G	NM_145751		27076034	27076034	+1	no_errors	ENST00000262395	ensembl	human	known	69_37n	silent	174	15.12	31	SNP	1.000	A
TRPM2	7226	genome.wustl.edu	37	21	45826557	45826557	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr21:45826557C>G	ENST00000397928.1	+	19	3316	c.2871C>G	c.(2869-2871)atC>atG	p.I957M	TRPM2_ENST00000300482.5_Missense_Mutation_p.I957M|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Missense_Mutation_p.I957M|TRPM2_ENST00000300481.9_Missense_Mutation_p.I937M	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	957					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CCATCCTCATCCACAACGAGC	0.612																																						dbGAP											0													55.0	49.0	51.0					21																	45826557		2188	4287	6475	-	-	-	SO:0001583	missense	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2871C>G	21.37:g.45826557C>G	ENSP00000381023:p.Ile957Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.I957M	ENST00000397928.1	37	c.2871	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	c	15.43	2.832254	0.50845	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	3.98	3.07	0.35406	Ion transport (1);	0.138056	0.47455	D	0.000221	T	0.78923	0.4360	M	0.75447	2.3	0.48341	D	0.999633	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.984;0.984;0.984	T	0.77496	-0.2566	10	0.34782	T	0.22	-17.9495	13.3512	0.60603	0.1585:0.8415:0.0:0.0	.	957;743;957	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	M	957;957;937;957	ENSP00000300482:I957M;ENSP00000381023:I957M;ENSP00000300481:I937M;ENSP00000381026:I957M	ENSP00000300481:I937M	I	+	3	3	TRPM2	44650985	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.781000	0.26774	0.758000	0.33059	0.536000	0.68110	ATC	TRPM2	-	pfam_Ion_trans_dom	ENSG00000142185		0.612	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	276	0.00	0	C	NM_003307		45826557	45826557	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	missense	164	20.77	43	SNP	1.000	G
TRPM2	7226	genome.wustl.edu	37	21	45826557	45826557	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr21:45826557C>G	ENST00000397928.1	+	19	3316	c.2871C>G	c.(2869-2871)atC>atG	p.I957M	TRPM2_ENST00000300482.5_Missense_Mutation_p.I957M|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Missense_Mutation_p.I957M|TRPM2_ENST00000300481.9_Missense_Mutation_p.I937M	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	957					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CCATCCTCATCCACAACGAGC	0.612																																						dbGAP											0													55.0	49.0	51.0					21																	45826557		2188	4287	6475	-	-	-	SO:0001583	missense	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2871C>G	21.37:g.45826557C>G	ENSP00000381023:p.Ile957Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.I957M	ENST00000397928.1	37	c.2871	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	c	15.43	2.832254	0.50845	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	3.98	3.07	0.35406	Ion transport (1);	0.138056	0.47455	D	0.000221	T	0.78923	0.4360	M	0.75447	2.3	0.48341	D	0.999633	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.984;0.984;0.984	T	0.77496	-0.2566	10	0.34782	T	0.22	-17.9495	13.3512	0.60603	0.1585:0.8415:0.0:0.0	.	957;743;957	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	M	957;957;937;957	ENSP00000300482:I957M;ENSP00000381023:I957M;ENSP00000300481:I937M;ENSP00000381026:I957M	ENSP00000300481:I937M	I	+	3	3	TRPM2	44650985	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.781000	0.26774	0.758000	0.33059	0.536000	0.68110	ATC	TRPM2	-	pfam_Ion_trans_dom	ENSG00000142185		0.612	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	117	0.00	0	C	NM_003307		45826557	45826557	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	missense	164	20.77	43	SNP	1.000	G
TSC2	7249	genome.wustl.edu	37	16	2134598	2134598	+	Nonsense_Mutation	SNP	C	C	T	rs45517340		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr16:2134598C>T	ENST00000219476.3	+	34	5005	c.4375C>T	c.(4375-4377)Cga>Tga	p.R1459*	TSC2_ENST00000350773.4_Nonsense_Mutation_p.R1436*|TSC2_ENST00000568454.1_Nonsense_Mutation_p.R1403*|TSC2_ENST00000353929.4_Nonsense_Mutation_p.R1416*|TSC2_ENST00000382538.6_Nonsense_Mutation_p.R1344*|TSC2_ENST00000401874.2_Nonsense_Mutation_p.R1392*|TSC2_ENST00000439673.2_Nonsense_Mutation_p.R1356*	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1459					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCTCCGGCCCCGAGGTTACAC	0.657			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													dbGAP	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0			GRCh37	CD052530|CM991214	TSC2	D|M	rs45517340						18.0	22.0	21.0					16																	2134598		2192	4285	6477	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4375C>T	16.37:g.2134598C>T	ENSP00000219476:p.Arg1459*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Nonsense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP,superfamily_ARM-type_fold,prints_Tuberin,pfscan_Rap_GAP	p.R1459*	ENST00000219476.3	37	c.4375	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	C	42	9.193808	0.99096	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	.	.	.	5.02	3.02	0.34903	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-5.093	7.4343	0.27145	0.3137:0.6088:0.0:0.0775	rs45517340	.	.	.	X	1459;1393;1416;1356;1344;1436	.	ENSP00000219476:R1459X	R	+	1	2	TSC2	2074599	0.093000	0.21703	0.968000	0.41197	0.466000	0.32739	0.490000	0.22403	0.487000	0.27698	0.585000	0.79938	CGA	TSC2	-	NULL	ENSG00000103197		0.657	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	84	0.00	0	C	NM_000548		2134598	2134598	+1	no_errors	ENST00000219476	ensembl	human	known	69_37n	nonsense	57	30.49	25	SNP	0.992	T
TSC2	7249	genome.wustl.edu	37	16	2134598	2134598	+	Nonsense_Mutation	SNP	C	C	T	rs45517340		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr16:2134598C>T	ENST00000219476.3	+	34	5005	c.4375C>T	c.(4375-4377)Cga>Tga	p.R1459*	TSC2_ENST00000350773.4_Nonsense_Mutation_p.R1436*|TSC2_ENST00000568454.1_Nonsense_Mutation_p.R1403*|TSC2_ENST00000353929.4_Nonsense_Mutation_p.R1416*|TSC2_ENST00000382538.6_Nonsense_Mutation_p.R1344*|TSC2_ENST00000401874.2_Nonsense_Mutation_p.R1392*|TSC2_ENST00000439673.2_Nonsense_Mutation_p.R1356*	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1459					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCTCCGGCCCCGAGGTTACAC	0.657			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													dbGAP	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0			GRCh37	CD052530|CM991214	TSC2	D|M	rs45517340						18.0	22.0	21.0					16																	2134598		2192	4285	6477	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4375C>T	16.37:g.2134598C>T	ENSP00000219476:p.Arg1459*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Nonsense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP,superfamily_ARM-type_fold,prints_Tuberin,pfscan_Rap_GAP	p.R1459*	ENST00000219476.3	37	c.4375	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	C	42	9.193808	0.99096	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	.	.	.	5.02	3.02	0.34903	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-5.093	7.4343	0.27145	0.3137:0.6088:0.0:0.0775	rs45517340	.	.	.	X	1459;1393;1416;1356;1344;1436	.	ENSP00000219476:R1459X	R	+	1	2	TSC2	2074599	0.093000	0.21703	0.968000	0.41197	0.466000	0.32739	0.490000	0.22403	0.487000	0.27698	0.585000	0.79938	CGA	TSC2	-	NULL	ENSG00000103197		0.657	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	66	0.00	0	C	NM_000548		2134598	2134598	+1	no_errors	ENST00000219476	ensembl	human	known	69_37n	nonsense	57	30.49	25	SNP	0.992	T
UCP2	7351	genome.wustl.edu	37	11	73687705	73687705	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr11:73687705C>T	ENST00000310473.3	-	6	1457	c.615G>A	c.(613-615)ctG>ctA	p.L205L	UCP2_ENST00000536983.1_Silent_p.L205L|UCP2_ENST00000542615.1_5'Flank	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	205					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					GGTTGGCTTTCAGGAGGGCAT	0.557																																					Colon(191;388 2040 43557 45622 48925)	dbGAP											0													78.0	68.0	71.0					11																	73687705		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.615G>A	11.37:g.73687705C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4PJH8|Q53HM3	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.L205	ENST00000310473.3	37	c.615	CCDS8228.1	11																																																																																			UCP2	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom	ENSG00000175567		0.557	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP2	HGNC	protein_coding	OTTHUMT00000398108.1	38	0.00	0	C	NM_003355		73687705	73687705	-1	no_errors	ENST00000310473	ensembl	human	known	69_37n	silent	50	18.03	11	SNP	1.000	T
UCP2	7351	genome.wustl.edu	37	11	73687705	73687705	+	Silent	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr11:73687705C>T	ENST00000310473.3	-	6	1457	c.615G>A	c.(613-615)ctG>ctA	p.L205L	UCP2_ENST00000536983.1_Silent_p.L205L|UCP2_ENST00000542615.1_5'Flank	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	205					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					GGTTGGCTTTCAGGAGGGCAT	0.557																																					Colon(191;388 2040 43557 45622 48925)	dbGAP											0													78.0	68.0	71.0					11																	73687705		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.615G>A	11.37:g.73687705C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4PJH8|Q53HM3	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.L205	ENST00000310473.3	37	c.615	CCDS8228.1	11																																																																																			UCP2	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom	ENSG00000175567		0.557	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP2	HGNC	protein_coding	OTTHUMT00000398108.1	33	0.00	0	C	NM_003355		73687705	73687705	-1	no_errors	ENST00000310473	ensembl	human	known	69_37n	silent	50	18.03	11	SNP	1.000	T
URGCP	55665	genome.wustl.edu	37	7	43916211	43916211	+	3'UTR	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43916211C>G	ENST00000453200.1	-	0	3344				URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_3'UTR|URGCP_ENST00000223341.7_3'UTR|URGCP_ENST00000402306.3_3'UTR|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_3'UTR|URGCP_ENST00000447717.3_3'UTR			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation						cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGTGCCCCATCAGACAGGGCT	0.557																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.*55G>C	7.37:g.43916211C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	RNA	SNP	-	NULL	ENST00000453200.1	37	NULL	CCDS47578.1	7																																																																																			URGCP	-	-	ENSG00000106608		0.557	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	26	0.00	0	C	NM_001077664		43916211	43916211	-1	no_errors	ENST00000497914	ensembl	human	known	69_37n	rna	79	28.83	32	SNP	0.002	G
URGCP	55665	genome.wustl.edu	37	7	43916211	43916211	+	3'UTR	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43916211C>G	ENST00000453200.1	-	0	3344				URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_3'UTR|URGCP_ENST00000223341.7_3'UTR|URGCP_ENST00000402306.3_3'UTR|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_3'UTR|URGCP_ENST00000447717.3_3'UTR			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation						cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGTGCCCCATCAGACAGGGCT	0.557																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.*55G>C	7.37:g.43916211C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	RNA	SNP	-	NULL	ENST00000453200.1	37	NULL	CCDS47578.1	7																																																																																			URGCP	-	-	ENSG00000106608		0.557	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	21	0.00	0	C	NM_001077664		43916211	43916211	-1	no_errors	ENST00000497914	ensembl	human	known	69_37n	rna	79	28.83	32	SNP	0.002	G
URGCP	55665	genome.wustl.edu	37	7	43916314	43916314	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43916314G>C	ENST00000453200.1	-	6	3241	c.2748C>G	c.(2746-2748)aaC>aaG	p.N916K	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.N873K|URGCP_ENST00000223341.7_Missense_Mutation_p.N873K|URGCP_ENST00000402306.3_Missense_Mutation_p.N907K|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.N873K|URGCP_ENST00000447717.3_Missense_Mutation_p.N873K			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	916	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTTTGTTTTGGTTCGACAAGC	0.527																																						dbGAP											0													138.0	135.0	136.0					7																	43916314		1992	4179	6171	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2748C>G	7.37:g.43916314G>C	ENSP00000396918:p.Asn916Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.N916K	ENST00000453200.1	37	c.2748	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	9.563	1.119106	0.20877	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.08984	3.04;3.04;3.03;3.04;3.03;3.04	5.42	3.28	0.37604	.	0.507721	0.22595	N	0.058026	T	0.05868	0.0153	L	0.45581	1.43	0.33130	D	0.542905	B;B	0.24963	0.115;0.115	B;B	0.20767	0.031;0.031	T	0.18999	-1.0319	10	0.05525	T	0.97	-42.0344	6.0676	0.19871	0.1918:0.1613:0.6468:0.0	.	907;916	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	K	873;873;907;873;916;873	ENSP00000223341:N873K;ENSP00000336872:N873K;ENSP00000384955:N907K;ENSP00000392136:N873K;ENSP00000396918:N916K;ENSP00000402803:N873K	ENSP00000223341:N873K	N	-	3	2	URGCP	43882839	0.990000	0.36364	0.998000	0.56505	0.929000	0.56500	0.647000	0.24812	1.316000	0.45131	-0.136000	0.14681	AAC	URGCP	-	NULL	ENSG00000106608		0.527	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	74	0.00	0	G	NM_001077664		43916314	43916314	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	182	21.21	49	SNP	0.987	C
URGCP	55665	genome.wustl.edu	37	7	43916314	43916314	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43916314G>C	ENST00000453200.1	-	6	3241	c.2748C>G	c.(2746-2748)aaC>aaG	p.N916K	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.N873K|URGCP_ENST00000223341.7_Missense_Mutation_p.N873K|URGCP_ENST00000402306.3_Missense_Mutation_p.N907K|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.N873K|URGCP_ENST00000447717.3_Missense_Mutation_p.N873K			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	916	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTTTGTTTTGGTTCGACAAGC	0.527																																						dbGAP											0													138.0	135.0	136.0					7																	43916314		1992	4179	6171	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2748C>G	7.37:g.43916314G>C	ENSP00000396918:p.Asn916Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.N916K	ENST00000453200.1	37	c.2748	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	9.563	1.119106	0.20877	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.08984	3.04;3.04;3.03;3.04;3.03;3.04	5.42	3.28	0.37604	.	0.507721	0.22595	N	0.058026	T	0.05868	0.0153	L	0.45581	1.43	0.33130	D	0.542905	B;B	0.24963	0.115;0.115	B;B	0.20767	0.031;0.031	T	0.18999	-1.0319	10	0.05525	T	0.97	-42.0344	6.0676	0.19871	0.1918:0.1613:0.6468:0.0	.	907;916	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	K	873;873;907;873;916;873	ENSP00000223341:N873K;ENSP00000336872:N873K;ENSP00000384955:N907K;ENSP00000392136:N873K;ENSP00000396918:N916K;ENSP00000402803:N873K	ENSP00000223341:N873K	N	-	3	2	URGCP	43882839	0.990000	0.36364	0.998000	0.56505	0.929000	0.56500	0.647000	0.24812	1.316000	0.45131	-0.136000	0.14681	AAC	URGCP	-	NULL	ENSG00000106608		0.527	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	51	0.00	0	G	NM_001077664		43916314	43916314	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	182	21.21	49	SNP	0.987	C
URGCP	55665	genome.wustl.edu	37	7	43916437	43916437	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43916437G>C	ENST00000453200.1	-	6	3118	c.2625C>G	c.(2623-2625)atC>atG	p.I875M	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.I832M|URGCP_ENST00000223341.7_Missense_Mutation_p.I832M|URGCP_ENST00000402306.3_Missense_Mutation_p.I866M|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.I832M|URGCP_ENST00000447717.3_Missense_Mutation_p.I832M			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	875	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGATGTGCCAGATGTGCTGCT	0.602																																						dbGAP											0													58.0	58.0	58.0					7																	43916437		2033	4195	6228	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2625C>G	7.37:g.43916437G>C	ENSP00000396918:p.Ile875Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.I875M	ENST00000453200.1	37	c.2625	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050606	0.36181	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10382	2.89;2.89;2.88;2.89;2.88;2.89	5.42	-9.18	0.00688	.	1.092200	0.06966	N	0.817191	T	0.06325	0.0163	L	0.36672	1.1	0.09310	N	1	P;P	0.34826	0.471;0.471	B;B	0.31812	0.136;0.136	T	0.20140	-1.0284	10	0.52906	T	0.07	-15.0253	5.2489	0.15512	0.1323:0.3382:0.4436:0.0859	.	866;875	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	M	832;832;866;832;875;832	ENSP00000223341:I832M;ENSP00000336872:I832M;ENSP00000384955:I866M;ENSP00000392136:I832M;ENSP00000396918:I875M;ENSP00000402803:I832M	ENSP00000223341:I832M	I	-	3	3	URGCP	43882962	0.018000	0.18449	0.188000	0.23233	0.992000	0.81027	-0.450000	0.06803	-1.826000	0.01205	-0.182000	0.12963	ATC	URGCP	-	NULL	ENSG00000106608		0.602	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	52	0.00	0	G	NM_001077664		43916437	43916437	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	133	24.86	44	SNP	0.017	C
URGCP	55665	genome.wustl.edu	37	7	43916437	43916437	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43916437G>C	ENST00000453200.1	-	6	3118	c.2625C>G	c.(2623-2625)atC>atG	p.I875M	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.I832M|URGCP_ENST00000223341.7_Missense_Mutation_p.I832M|URGCP_ENST00000402306.3_Missense_Mutation_p.I866M|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.I832M|URGCP_ENST00000447717.3_Missense_Mutation_p.I832M			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	875	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGATGTGCCAGATGTGCTGCT	0.602																																						dbGAP											0													58.0	58.0	58.0					7																	43916437		2033	4195	6228	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2625C>G	7.37:g.43916437G>C	ENSP00000396918:p.Ile875Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.I875M	ENST00000453200.1	37	c.2625	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050606	0.36181	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10382	2.89;2.89;2.88;2.89;2.88;2.89	5.42	-9.18	0.00688	.	1.092200	0.06966	N	0.817191	T	0.06325	0.0163	L	0.36672	1.1	0.09310	N	1	P;P	0.34826	0.471;0.471	B;B	0.31812	0.136;0.136	T	0.20140	-1.0284	10	0.52906	T	0.07	-15.0253	5.2489	0.15512	0.1323:0.3382:0.4436:0.0859	.	866;875	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	M	832;832;866;832;875;832	ENSP00000223341:I832M;ENSP00000336872:I832M;ENSP00000384955:I866M;ENSP00000392136:I832M;ENSP00000396918:I875M;ENSP00000402803:I832M	ENSP00000223341:I832M	I	-	3	3	URGCP	43882962	0.018000	0.18449	0.188000	0.23233	0.992000	0.81027	-0.450000	0.06803	-1.826000	0.01205	-0.182000	0.12963	ATC	URGCP	-	NULL	ENSG00000106608		0.602	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	49	0.00	0	G	NM_001077664		43916437	43916437	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	133	24.86	44	SNP	0.017	C
URGCP	55665	genome.wustl.edu	37	7	43916484	43916484	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43916484G>A	ENST00000453200.1	-	6	3071	c.2578C>T	c.(2578-2580)Cgg>Tgg	p.R860W	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.R817W|URGCP_ENST00000223341.7_Missense_Mutation_p.R817W|URGCP_ENST00000402306.3_Missense_Mutation_p.R851W|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.R817W|URGCP_ENST00000447717.3_Missense_Mutation_p.R817W			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	860	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCAGTGCCCGGAAGCCGTCG	0.647																																						dbGAP											0													28.0	30.0	30.0					7																	43916484		1983	4174	6157	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2578C>T	7.37:g.43916484G>A	ENSP00000396918:p.Arg860Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.R860W	ENST00000453200.1	37	c.2578	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716359	0.68844	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10860	2.84;2.84;2.84;2.84;2.83;2.84	5.13	4.22	0.49857	.	0.761496	0.12374	N	0.474475	T	0.19604	0.0471	L	0.51422	1.61	0.32768	N	0.504179	D;D	0.69078	0.997;0.997	P;P	0.53401	0.616;0.725	T	0.17379	-1.0371	10	0.72032	D	0.01	-31.0669	10.8218	0.46610	0.0:0.0:0.811:0.189	.	851;860	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	W	817;817;851;817;860;817	ENSP00000223341:R817W;ENSP00000336872:R817W;ENSP00000384955:R851W;ENSP00000392136:R817W;ENSP00000396918:R860W;ENSP00000402803:R817W	ENSP00000223341:R817W	R	-	1	2	URGCP	43883009	1.000000	0.71417	0.802000	0.32245	0.875000	0.50365	2.161000	0.42358	1.126000	0.42016	0.591000	0.81541	CGG	URGCP	-	NULL	ENSG00000106608		0.647	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	42	0.00	0	G	NM_001077664		43916484	43916484	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	100	25.37	34	SNP	0.865	A
URGCP	55665	genome.wustl.edu	37	7	43916484	43916484	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43916484G>A	ENST00000453200.1	-	6	3071	c.2578C>T	c.(2578-2580)Cgg>Tgg	p.R860W	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.R817W|URGCP_ENST00000223341.7_Missense_Mutation_p.R817W|URGCP_ENST00000402306.3_Missense_Mutation_p.R851W|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.R817W|URGCP_ENST00000447717.3_Missense_Mutation_p.R817W			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	860	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCAGTGCCCGGAAGCCGTCG	0.647																																						dbGAP											0													28.0	30.0	30.0					7																	43916484		1983	4174	6157	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2578C>T	7.37:g.43916484G>A	ENSP00000396918:p.Arg860Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.R860W	ENST00000453200.1	37	c.2578	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716359	0.68844	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10860	2.84;2.84;2.84;2.84;2.83;2.84	5.13	4.22	0.49857	.	0.761496	0.12374	N	0.474475	T	0.19604	0.0471	L	0.51422	1.61	0.32768	N	0.504179	D;D	0.69078	0.997;0.997	P;P	0.53401	0.616;0.725	T	0.17379	-1.0371	10	0.72032	D	0.01	-31.0669	10.8218	0.46610	0.0:0.0:0.811:0.189	.	851;860	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	W	817;817;851;817;860;817	ENSP00000223341:R817W;ENSP00000336872:R817W;ENSP00000384955:R851W;ENSP00000392136:R817W;ENSP00000396918:R860W;ENSP00000402803:R817W	ENSP00000223341:R817W	R	-	1	2	URGCP	43883009	1.000000	0.71417	0.802000	0.32245	0.875000	0.50365	2.161000	0.42358	1.126000	0.42016	0.591000	0.81541	CGG	URGCP	-	NULL	ENSG00000106608		0.647	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	40	0.00	0	G	NM_001077664		43916484	43916484	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	100	25.37	34	SNP	0.865	A
URGCP	55665	genome.wustl.edu	37	7	43917613	43917613	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43917613G>C	ENST00000453200.1	-	6	1942	c.1449C>G	c.(1447-1449)atC>atG	p.I483M	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.I440M|URGCP_ENST00000223341.7_Missense_Mutation_p.I440M|URGCP_ENST00000402306.3_Missense_Mutation_p.I474M|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.I440M|URGCP_ENST00000447717.3_Missense_Mutation_p.I440M			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	483					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCGAGTCTTTGATTTTCCTGG	0.582																																						dbGAP											0													145.0	150.0	149.0					7																	43917613		2008	4159	6167	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1449C>G	7.37:g.43917613G>C	ENSP00000396918:p.Ile483Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.I483M	ENST00000453200.1	37	c.1449	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657089	0.47467	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10960	2.83;2.83;2.83;2.83;2.82;2.83	5.79	5.79	0.91817	.	0.660669	0.15089	N	0.281183	T	0.32615	0.0835	M	0.76838	2.35	0.27811	N	0.942136	D;D	0.71674	0.998;0.998	D;D	0.65443	0.935;0.935	T	0.15752	-1.0426	10	0.72032	D	0.01	-35.1341	12.4653	0.55755	0.0:0.0:0.8328:0.1672	.	474;483	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	M	440;440;474;440;483;440	ENSP00000223341:I440M;ENSP00000336872:I440M;ENSP00000384955:I474M;ENSP00000392136:I440M;ENSP00000396918:I483M;ENSP00000402803:I440M	ENSP00000223341:I440M	I	-	3	3	URGCP	43884138	0.994000	0.37717	0.300000	0.25030	0.969000	0.65631	1.455000	0.35190	2.735000	0.93741	0.655000	0.94253	ATC	URGCP	-	NULL	ENSG00000106608		0.582	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	76	0.00	0	G	NM_001077664		43917613	43917613	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	181	12.14	25	SNP	0.820	C
URGCP	55665	genome.wustl.edu	37	7	43917613	43917613	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43917613G>C	ENST00000453200.1	-	6	1942	c.1449C>G	c.(1447-1449)atC>atG	p.I483M	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.I440M|URGCP_ENST00000223341.7_Missense_Mutation_p.I440M|URGCP_ENST00000402306.3_Missense_Mutation_p.I474M|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.I440M|URGCP_ENST00000447717.3_Missense_Mutation_p.I440M			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	483					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCGAGTCTTTGATTTTCCTGG	0.582																																						dbGAP											0													145.0	150.0	149.0					7																	43917613		2008	4159	6167	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1449C>G	7.37:g.43917613G>C	ENSP00000396918:p.Ile483Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.I483M	ENST00000453200.1	37	c.1449	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657089	0.47467	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10960	2.83;2.83;2.83;2.83;2.82;2.83	5.79	5.79	0.91817	.	0.660669	0.15089	N	0.281183	T	0.32615	0.0835	M	0.76838	2.35	0.27811	N	0.942136	D;D	0.71674	0.998;0.998	D;D	0.65443	0.935;0.935	T	0.15752	-1.0426	10	0.72032	D	0.01	-35.1341	12.4653	0.55755	0.0:0.0:0.8328:0.1672	.	474;483	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	M	440;440;474;440;483;440	ENSP00000223341:I440M;ENSP00000336872:I440M;ENSP00000384955:I474M;ENSP00000392136:I440M;ENSP00000396918:I483M;ENSP00000402803:I440M	ENSP00000223341:I440M	I	-	3	3	URGCP	43884138	0.994000	0.37717	0.300000	0.25030	0.969000	0.65631	1.455000	0.35190	2.735000	0.93741	0.655000	0.94253	ATC	URGCP	-	NULL	ENSG00000106608		0.582	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	74	0.00	0	G	NM_001077664		43917613	43917613	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	181	12.14	25	SNP	0.820	C
URGCP	55665	genome.wustl.edu	37	7	43917817	43917817	+	Silent	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43917817G>T	ENST00000453200.1	-	6	1738	c.1245C>A	c.(1243-1245)gtC>gtA	p.V415V	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Silent_p.V372V|URGCP_ENST00000223341.7_Silent_p.V372V|URGCP_ENST00000402306.3_Silent_p.V406V|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.V372V|URGCP_ENST00000447717.3_Silent_p.V372V			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	415					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTTTACCAGGACATGTGAGT	0.517																																						dbGAP											0													114.0	115.0	114.0					7																	43917817		2047	4179	6226	-	-	-	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1245C>A	7.37:g.43917817G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	prints_GTP_binding_domain	p.V415	ENST00000453200.1	37	c.1245	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.517	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	99	0.00	0	G	NM_001077664		43917817	43917817	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	silent	245	13.12	37	SNP	0.054	T
URGCP	55665	genome.wustl.edu	37	7	43917817	43917817	+	Silent	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43917817G>T	ENST00000453200.1	-	6	1738	c.1245C>A	c.(1243-1245)gtC>gtA	p.V415V	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Silent_p.V372V|URGCP_ENST00000223341.7_Silent_p.V372V|URGCP_ENST00000402306.3_Silent_p.V406V|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.V372V|URGCP_ENST00000447717.3_Silent_p.V372V			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	415					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTTTACCAGGACATGTGAGT	0.517																																						dbGAP											0													114.0	115.0	114.0					7																	43917817		2047	4179	6226	-	-	-	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1245C>A	7.37:g.43917817G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	prints_GTP_binding_domain	p.V415	ENST00000453200.1	37	c.1245	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.517	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	78	0.00	0	G	NM_001077664		43917817	43917817	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	silent	245	13.12	37	SNP	0.054	T
URGCP	55665	genome.wustl.edu	37	7	43917897	43917897	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43917897G>T	ENST00000453200.1	-	6	1658	c.1165C>A	c.(1165-1167)Ccc>Acc	p.P389T	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.P346T|URGCP_ENST00000223341.7_Missense_Mutation_p.P346T|URGCP_ENST00000402306.3_Missense_Mutation_p.P380T|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.P346T|URGCP_ENST00000447717.3_Missense_Mutation_p.P346T			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	389					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCACGGTAGGGACTCAGGATG	0.423																																						dbGAP											0													125.0	120.0	122.0					7																	43917897		1957	4146	6103	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1165C>A	7.37:g.43917897G>T	ENSP00000396918:p.Pro389Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.P389T	ENST00000453200.1	37	c.1165	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968421	0.53614	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.09911	2.94;2.94;2.93;2.94;2.93;2.94	5.48	5.48	0.80851	.	0.411423	0.26400	N	0.024599	T	0.18882	0.0453	M	0.63843	1.955	0.36561	D	0.872406	P;P	0.40332	0.713;0.713	B;B	0.43575	0.424;0.424	T	0.03993	-1.0986	10	0.45353	T	0.12	-31.7424	16.8265	0.85933	0.0:0.0:1.0:0.0	.	380;389	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	T	346;346;380;346;389;346	ENSP00000223341:P346T;ENSP00000336872:P346T;ENSP00000384955:P380T;ENSP00000392136:P346T;ENSP00000396918:P389T;ENSP00000402803:P346T	ENSP00000223341:P346T	P	-	1	0	URGCP	43884422	0.009000	0.17119	0.988000	0.46212	0.963000	0.63663	0.627000	0.24506	2.571000	0.86741	0.591000	0.81541	CCC	URGCP	-	NULL	ENSG00000106608		0.423	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	81	0.00	0	G	NM_001077664		43917897	43917897	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	164	13.23	25	SNP	0.987	T
URGCP	55665	genome.wustl.edu	37	7	43917897	43917897	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43917897G>T	ENST00000453200.1	-	6	1658	c.1165C>A	c.(1165-1167)Ccc>Acc	p.P389T	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.P346T|URGCP_ENST00000223341.7_Missense_Mutation_p.P346T|URGCP_ENST00000402306.3_Missense_Mutation_p.P380T|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.P346T|URGCP_ENST00000447717.3_Missense_Mutation_p.P346T			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	389					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCACGGTAGGGACTCAGGATG	0.423																																						dbGAP											0													125.0	120.0	122.0					7																	43917897		1957	4146	6103	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1165C>A	7.37:g.43917897G>T	ENSP00000396918:p.Pro389Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.P389T	ENST00000453200.1	37	c.1165	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968421	0.53614	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.09911	2.94;2.94;2.93;2.94;2.93;2.94	5.48	5.48	0.80851	.	0.411423	0.26400	N	0.024599	T	0.18882	0.0453	M	0.63843	1.955	0.36561	D	0.872406	P;P	0.40332	0.713;0.713	B;B	0.43575	0.424;0.424	T	0.03993	-1.0986	10	0.45353	T	0.12	-31.7424	16.8265	0.85933	0.0:0.0:1.0:0.0	.	380;389	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	T	346;346;380;346;389;346	ENSP00000223341:P346T;ENSP00000336872:P346T;ENSP00000384955:P380T;ENSP00000392136:P346T;ENSP00000396918:P389T;ENSP00000402803:P346T	ENSP00000223341:P346T	P	-	1	0	URGCP	43884422	0.009000	0.17119	0.988000	0.46212	0.963000	0.63663	0.627000	0.24506	2.571000	0.86741	0.591000	0.81541	CCC	URGCP	-	NULL	ENSG00000106608		0.423	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	58	0.00	0	G	NM_001077664		43917897	43917897	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	164	13.23	25	SNP	0.987	T
URGCP	55665	genome.wustl.edu	37	7	43917967	43917967	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43917967G>A	ENST00000453200.1	-	6	1588	c.1095C>T	c.(1093-1095)atC>atT	p.I365I	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Silent_p.I322I|URGCP_ENST00000223341.7_Silent_p.I322I|URGCP_ENST00000402306.3_Silent_p.I356I|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.I322I|URGCP_ENST00000447717.3_Silent_p.I322I			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	365					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTTCTTACTGATATTGTCAG	0.453																																						dbGAP											0													97.0	92.0	93.0					7																	43917967		1914	4147	6061	-	-	-	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1095C>T	7.37:g.43917967G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	prints_GTP_binding_domain	p.I365	ENST00000453200.1	37	c.1095	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.453	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	32	0.00	0	G	NM_001077664		43917967	43917967	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	silent	82	16.16	16	SNP	0.873	A
URGCP	55665	genome.wustl.edu	37	7	43917967	43917967	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43917967G>A	ENST00000453200.1	-	6	1588	c.1095C>T	c.(1093-1095)atC>atT	p.I365I	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Silent_p.I322I|URGCP_ENST00000223341.7_Silent_p.I322I|URGCP_ENST00000402306.3_Silent_p.I356I|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.I322I|URGCP_ENST00000447717.3_Silent_p.I322I			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	365					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTTCTTACTGATATTGTCAG	0.453																																						dbGAP											0													97.0	92.0	93.0					7																	43917967		1914	4147	6061	-	-	-	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1095C>T	7.37:g.43917967G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	prints_GTP_binding_domain	p.I365	ENST00000453200.1	37	c.1095	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.453	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	35	0.00	0	G	NM_001077664		43917967	43917967	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	silent	82	16.16	16	SNP	0.873	A
URGCP	55665	genome.wustl.edu	37	7	43918063	43918063	+	Silent	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43918063G>C	ENST00000453200.1	-	6	1492	c.999C>G	c.(997-999)gcC>gcG	p.A333A	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Silent_p.A290A|URGCP_ENST00000223341.7_Silent_p.A290A|URGCP_ENST00000402306.3_Silent_p.A324A|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.A290A|URGCP_ENST00000447717.3_Silent_p.A290A			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	333					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGTTCAGAAAGGCCACAGGTT	0.488																																						dbGAP											0													74.0	75.0	75.0					7																	43918063		1903	4130	6033	-	-	-	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.999C>G	7.37:g.43918063G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	prints_GTP_binding_domain	p.A333	ENST00000453200.1	37	c.999	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.488	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	34	0.00	0	G	NM_001077664		43918063	43918063	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	silent	46	11.54	6	SNP	0.982	C
URGCP	55665	genome.wustl.edu	37	7	43918380	43918380	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43918380G>A	ENST00000453200.1	-	6	1175	c.682C>T	c.(682-684)Ctg>Ttg	p.L228L	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Silent_p.L185L|URGCP_ENST00000223341.7_Silent_p.L185L|URGCP_ENST00000402306.3_Silent_p.L219L|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.L185L|URGCP_ENST00000447717.3_Silent_p.L185L			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	228					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCCACAGCAGAAATGTATGG	0.577																																						dbGAP											0													32.0	37.0	35.0					7																	43918380		2053	4219	6272	-	-	-	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.682C>T	7.37:g.43918380G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	prints_GTP_binding_domain	p.L228	ENST00000453200.1	37	c.682	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.577	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	74	0.00	0	G	NM_001077664		43918380	43918380	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	silent	224	17.34	47	SNP	0.998	A
URGCP	55665	genome.wustl.edu	37	7	43918380	43918380	+	Silent	SNP	G	G	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43918380G>A	ENST00000453200.1	-	6	1175	c.682C>T	c.(682-684)Ctg>Ttg	p.L228L	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Silent_p.L185L|URGCP_ENST00000223341.7_Silent_p.L185L|URGCP_ENST00000402306.3_Silent_p.L219L|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.L185L|URGCP_ENST00000447717.3_Silent_p.L185L			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	228					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCCACAGCAGAAATGTATGG	0.577																																						dbGAP											0													32.0	37.0	35.0					7																	43918380		2053	4219	6272	-	-	-	SO:0001819	synonymous_variant	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.682C>T	7.37:g.43918380G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	prints_GTP_binding_domain	p.L228	ENST00000453200.1	37	c.682	CCDS47578.1	7																																																																																			URGCP	-	NULL	ENSG00000106608		0.577	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	52	0.00	0	G	NM_001077664		43918380	43918380	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	silent	224	17.34	47	SNP	0.998	A
URGCP	55665	genome.wustl.edu	37	7	43918403	43918403	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43918403G>T	ENST00000453200.1	-	6	1152	c.659C>A	c.(658-660)tCg>tAg	p.S220*	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Nonsense_Mutation_p.S177*|URGCP_ENST00000223341.7_Nonsense_Mutation_p.S177*|URGCP_ENST00000402306.3_Nonsense_Mutation_p.S211*|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Nonsense_Mutation_p.S177*|URGCP_ENST00000447717.3_Nonsense_Mutation_p.S177*			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	220					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.S220L(1)|p.S177L(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTGGTTCTCCGAGTCAGGCAA	0.572																																						dbGAP											2	Substitution - Missense(2)	lung(2)											38.0	42.0	41.0					7																	43918403		2060	4218	6278	-	-	-	SO:0001587	stop_gained	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.659C>A	7.37:g.43918403G>T	ENSP00000396918:p.Ser220*	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Nonsense_Mutation	SNP	prints_GTP_binding_domain	p.S220*	ENST00000453200.1	37	c.659	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	38	6.982770	0.97979	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	.	.	.	5.66	5.66	0.87406	.	0.805990	0.11230	N	0.585767	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-9.405	12.8981	0.58111	0.0:0.1634:0.8366:0.0	.	.	.	.	X	177;177;211;177;220;177	.	ENSP00000223341:S177X	S	-	2	0	URGCP	43884928	0.727000	0.28069	0.901000	0.35422	0.849000	0.48306	2.895000	0.48648	2.673000	0.90976	0.591000	0.81541	TCG	URGCP	-	NULL	ENSG00000106608		0.572	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	76	0.00	0	G	NM_001077664		43918403	43918403	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	nonsense	234	18.75	54	SNP	0.971	T
URGCP	55665	genome.wustl.edu	37	7	43918403	43918403	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43918403G>T	ENST00000453200.1	-	6	1152	c.659C>A	c.(658-660)tCg>tAg	p.S220*	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Nonsense_Mutation_p.S177*|URGCP_ENST00000223341.7_Nonsense_Mutation_p.S177*|URGCP_ENST00000402306.3_Nonsense_Mutation_p.S211*|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Nonsense_Mutation_p.S177*|URGCP_ENST00000447717.3_Nonsense_Mutation_p.S177*			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	220					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.S220L(1)|p.S177L(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTGGTTCTCCGAGTCAGGCAA	0.572																																						dbGAP											2	Substitution - Missense(2)	lung(2)											38.0	42.0	41.0					7																	43918403		2060	4218	6278	-	-	-	SO:0001587	stop_gained	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.659C>A	7.37:g.43918403G>T	ENSP00000396918:p.Ser220*	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Nonsense_Mutation	SNP	prints_GTP_binding_domain	p.S220*	ENST00000453200.1	37	c.659	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	38	6.982770	0.97979	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	.	.	.	5.66	5.66	0.87406	.	0.805990	0.11230	N	0.585767	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-9.405	12.8981	0.58111	0.0:0.1634:0.8366:0.0	.	.	.	.	X	177;177;211;177;220;177	.	ENSP00000223341:S177X	S	-	2	0	URGCP	43884928	0.727000	0.28069	0.901000	0.35422	0.849000	0.48306	2.895000	0.48648	2.673000	0.90976	0.591000	0.81541	TCG	URGCP	-	NULL	ENSG00000106608		0.572	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	54	0.00	0	G	NM_001077664		43918403	43918403	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	nonsense	234	18.75	54	SNP	0.971	T
URGCP	55665	genome.wustl.edu	37	7	43918481	43918481	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43918481G>C	ENST00000453200.1	-	6	1074	c.581C>G	c.(580-582)tCa>tGa	p.S194*	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Nonsense_Mutation_p.S151*|URGCP_ENST00000223341.7_Nonsense_Mutation_p.S151*|URGCP_ENST00000402306.3_Nonsense_Mutation_p.S185*|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Nonsense_Mutation_p.S151*|URGCP_ENST00000447717.3_Nonsense_Mutation_p.S151*			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	194					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAACTGTCTGAGGAGAGCAG	0.517																																						dbGAP											0													58.0	62.0	60.0					7																	43918481		2029	4193	6222	-	-	-	SO:0001587	stop_gained	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.581C>G	7.37:g.43918481G>C	ENSP00000396918:p.Ser194*	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Nonsense_Mutation	SNP	prints_GTP_binding_domain	p.S194*	ENST00000453200.1	37	c.581	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.536467	0.98345	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717;ENST00000426198	.	.	.	5.66	4.77	0.60923	.	0.135571	0.51477	D	0.000100	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-10.2033	14.307	0.66391	0.0:0.1499:0.8501:0.0	.	.	.	.	X	151;151;185;151;194;151;151	.	ENSP00000223341:S151X	S	-	2	0	URGCP	43885006	1.000000	0.71417	0.104000	0.21259	0.995000	0.86356	6.323000	0.72891	1.372000	0.46190	0.591000	0.81541	TCA	URGCP	-	NULL	ENSG00000106608		0.517	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	60	0.00	0	G	NM_001077664		43918481	43918481	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	nonsense	209	18.68	48	SNP	0.997	C
URGCP	55665	genome.wustl.edu	37	7	43918481	43918481	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43918481G>C	ENST00000453200.1	-	6	1074	c.581C>G	c.(580-582)tCa>tGa	p.S194*	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Nonsense_Mutation_p.S151*|URGCP_ENST00000223341.7_Nonsense_Mutation_p.S151*|URGCP_ENST00000402306.3_Nonsense_Mutation_p.S185*|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Nonsense_Mutation_p.S151*|URGCP_ENST00000447717.3_Nonsense_Mutation_p.S151*			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	194					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAACTGTCTGAGGAGAGCAG	0.517																																						dbGAP											0													58.0	62.0	60.0					7																	43918481		2029	4193	6222	-	-	-	SO:0001587	stop_gained	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.581C>G	7.37:g.43918481G>C	ENSP00000396918:p.Ser194*	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Nonsense_Mutation	SNP	prints_GTP_binding_domain	p.S194*	ENST00000453200.1	37	c.581	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.536467	0.98345	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717;ENST00000426198	.	.	.	5.66	4.77	0.60923	.	0.135571	0.51477	D	0.000100	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-10.2033	14.307	0.66391	0.0:0.1499:0.8501:0.0	.	.	.	.	X	151;151;185;151;194;151;151	.	ENSP00000223341:S151X	S	-	2	0	URGCP	43885006	1.000000	0.71417	0.104000	0.21259	0.995000	0.86356	6.323000	0.72891	1.372000	0.46190	0.591000	0.81541	TCA	URGCP	-	NULL	ENSG00000106608		0.517	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	56	0.00	0	G	NM_001077664		43918481	43918481	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	nonsense	209	18.68	48	SNP	0.997	C
VPS41	27072	genome.wustl.edu	37	7	38798012	38798012	+	Silent	SNP	G	G	T	rs372871510		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:38798012G>T	ENST00000310301.4	-	18	1546	c.1492C>A	c.(1492-1494)Cgg>Agg	p.R498R	VPS41_ENST00000395969.2_Silent_p.R473R	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	498					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.R498W(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						AAATGATCCCGAACTGCTTGA	0.368																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											165.0	161.0	162.0					7																	38798012		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.1492C>A	7.37:g.38798012G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PF36|Q86TP8|Q99851|Q99852	Silent	SNP	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.R498	ENST00000310301.4	37	c.1492	CCDS5457.1	7																																																																																			VPS41	-	pirsf_VPS41	ENSG00000006715		0.368	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	HGNC	protein_coding	OTTHUMT00000226986.3	19	0.00	0	G			38798012	38798012	-1	no_errors	ENST00000310301	ensembl	human	known	69_37n	silent	13	18.75	3	SNP	0.994	T
VPS41	27072	genome.wustl.edu	37	7	38798012	38798012	+	Silent	SNP	G	G	T	rs372871510		TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:38798012G>T	ENST00000310301.4	-	18	1546	c.1492C>A	c.(1492-1494)Cgg>Agg	p.R498R	VPS41_ENST00000395969.2_Silent_p.R473R	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	498					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.R498W(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						AAATGATCCCGAACTGCTTGA	0.368																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											165.0	161.0	162.0					7																	38798012		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.1492C>A	7.37:g.38798012G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PF36|Q86TP8|Q99851|Q99852	Silent	SNP	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.R498	ENST00000310301.4	37	c.1492	CCDS5457.1	7																																																																																			VPS41	-	pirsf_VPS41	ENSG00000006715		0.368	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	HGNC	protein_coding	OTTHUMT00000226986.3	22	0.00	0	G			38798012	38798012	-1	no_errors	ENST00000310301	ensembl	human	known	69_37n	silent	13	18.75	3	SNP	0.994	T
URGCP	55665	genome.wustl.edu	37	7	43918553	43918553	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr7:43918553G>T	ENST00000453200.1	-	6	1002	c.509C>A	c.(508-510)tCc>tAc	p.S170Y	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.S127Y|URGCP_ENST00000223341.7_Missense_Mutation_p.S127Y|URGCP_ENST00000402306.3_Missense_Mutation_p.S161Y|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.S127Y|URGCP_ENST00000447717.3_Missense_Mutation_p.S127Y			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	170					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTCAGAAAAGGAATAAATGTC	0.552																																						dbGAP											0													80.0	88.0	85.0					7																	43918553		2062	4188	6250	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.509C>A	7.37:g.43918553G>T	ENSP00000396918:p.Ser170Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.S170Y	ENST00000453200.1	37	c.509	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079943	0.55753	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717;ENST00000426198	T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.58	5.58	0.84498	.	0.166245	0.40469	N	0.001081	T	0.60457	0.2270	L	0.48362	1.52	0.38276	D	0.94228	D;D	0.61697	0.99;0.99	D;D	0.64321	0.924;0.924	T	0.65368	-0.6185	10	0.87932	D	0	-31.9979	15.0747	0.72069	0.0:0.0:1.0:0.0	.	161;170	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	Y	127;127;161;127;170;127;127	ENSP00000223341:S127Y;ENSP00000336872:S127Y;ENSP00000384955:S161Y;ENSP00000392136:S127Y;ENSP00000396918:S170Y;ENSP00000402803:S127Y;ENSP00000389990:S127Y	ENSP00000223341:S127Y	S	-	2	0	URGCP	43885078	1.000000	0.71417	0.997000	0.53966	0.860000	0.49131	5.787000	0.69013	2.638000	0.89438	0.655000	0.94253	TCC	URGCP	-	NULL	ENSG00000106608		0.552	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	55	0.00	0	G	NM_001077664		43918553	43918553	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	155	18.32	35	SNP	0.973	T
URGCP	55665	genome.wustl.edu	37	7	43918553	43918553	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:43918553G>T	ENST00000453200.1	-	6	1002	c.509C>A	c.(508-510)tCc>tAc	p.S170Y	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.S127Y|URGCP_ENST00000223341.7_Missense_Mutation_p.S127Y|URGCP_ENST00000402306.3_Missense_Mutation_p.S161Y|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.S127Y|URGCP_ENST00000447717.3_Missense_Mutation_p.S127Y			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	170					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTCAGAAAAGGAATAAATGTC	0.552																																						dbGAP											0													80.0	88.0	85.0					7																	43918553		2062	4188	6250	-	-	-	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.509C>A	7.37:g.43918553G>T	ENSP00000396918:p.Ser170Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	prints_GTP_binding_domain	p.S170Y	ENST00000453200.1	37	c.509	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079943	0.55753	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717;ENST00000426198	T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.58	5.58	0.84498	.	0.166245	0.40469	N	0.001081	T	0.60457	0.2270	L	0.48362	1.52	0.38276	D	0.94228	D;D	0.61697	0.99;0.99	D;D	0.64321	0.924;0.924	T	0.65368	-0.6185	10	0.87932	D	0	-31.9979	15.0747	0.72069	0.0:0.0:1.0:0.0	.	161;170	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	Y	127;127;161;127;170;127;127	ENSP00000223341:S127Y;ENSP00000336872:S127Y;ENSP00000384955:S161Y;ENSP00000392136:S127Y;ENSP00000396918:S170Y;ENSP00000402803:S127Y;ENSP00000389990:S127Y	ENSP00000223341:S127Y	S	-	2	0	URGCP	43885078	1.000000	0.71417	0.997000	0.53966	0.860000	0.49131	5.787000	0.69013	2.638000	0.89438	0.655000	0.94253	TCC	URGCP	-	NULL	ENSG00000106608		0.552	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	52	0.00	0	G	NM_001077664		43918553	43918553	-1	no_errors	ENST00000453200	ensembl	human	known	69_37n	missense	155	18.32	35	SNP	0.973	T
WBSCR27	155368	genome.wustl.edu	37	7	73255528	73255528	+	Splice_Site	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr7:73255528C>T	ENST00000297873.4	-	3	173	c.124G>A	c.(124-126)Gat>Aat	p.D42N		NM_152559.2	NP_689772.2	Q8N6F8	WBS27_HUMAN	Williams Beuren syndrome chromosome region 27	42										NS(1)|central_nervous_system(1)|lung(2)|prostate(1)	5		Lung NSC(55;0.159)				GTGGCCACATCCTGGGGAAAG	0.647																																						dbGAP											0													23.0	24.0	24.0					7																	73255528		2202	4298	6500	-	-	-	SO:0001630	splice_region_variant	0			AF534110	CCDS5561.1	7q11.23	2004-07-05			ENSG00000165171	ENSG00000165171			19068	protein-coding gene	gene with protein product		612546					Standard	NM_152559		Approved		uc003tzj.2	Q8N6F8	OTTHUMG00000130033	ENST00000297873.4:c.124-1G>A	7.37:g.73255528C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase	p.D42N	ENST00000297873.4	37	c.124	CCDS5561.1	7	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366482	0.61513	.	.	ENSG00000165171	ENST00000297873	T	0.35421	1.31	4.03	4.03	0.46877	.	0.052330	0.64402	D	0.000001	T	0.54822	0.1882	M	0.79258	2.445	0.50467	D	0.999875	P;D	0.76494	0.947;0.999	P;P	0.60345	0.676;0.873	T	0.61307	-0.7089	10	0.87932	D	0	-20.8829	11.8413	0.52355	0.0:1.0:0.0:0.0	.	42;42	B4DWM3;Q8N6F8	.;WBS27_HUMAN	N	42	ENSP00000297873:D42N	ENSP00000297873:D42N	D	-	1	0	WBSCR27	72893464	1.000000	0.71417	0.999000	0.59377	0.284000	0.27059	5.170000	0.64990	2.225000	0.72522	0.561000	0.74099	GAT	WBSCR27	-	pfam_UbiE/COQ5_MeTrFase	ENSG00000165171		0.647	WBSCR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR27	HGNC	protein_coding	OTTHUMT00000252312.1	63	0.00	0	C	NM_152559	Missense_Mutation	73255528	73255528	-1	no_errors	ENST00000297873	ensembl	human	known	69_37n	missense	47	28.79	19	SNP	1.000	T
WDR78	79819	genome.wustl.edu	37	1	67293563	67293563	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr1:67293563C>A	ENST00000371026.3	-	14	2099	c.2044G>T	c.(2044-2046)Gaa>Taa	p.E682*	WDR78_ENST00000431318.1_Intron|RP11-342H21.2_ENST00000456389.1_RNA	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	682					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						ATATGACCTTCTTCAGTGCCA	0.318																																						dbGAP											0													139.0	145.0	143.0					1																	67293563		2203	4293	6496	-	-	-	SO:0001587	stop_gained	0			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.2044G>T	1.37:g.67293563C>A	ENSP00000360065:p.Glu682*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E682*	ENST00000371026.3	37	c.2044	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.697005	0.98438	.	.	ENSG00000152763	ENST00000371026	.	.	.	5.28	4.37	0.52481	.	0.101217	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-29.3548	13.8809	0.63682	0.0:0.9264:0.0:0.0736	.	.	.	.	X	682	.	ENSP00000360065:E682X	E	-	1	0	WDR78	67066151	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.954000	0.76001	1.234000	0.43709	0.563000	0.77884	GAA	WDR78	-	superfamily_WD40_repeat_dom	ENSG00000152763		0.318	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	HGNC	protein_coding	OTTHUMT00000025404.1	26	0.00	0	C	NM_024763		67293563	67293563	-1	no_errors	ENST00000371026	ensembl	human	known	69_37n	nonsense	29	17.14	6	SNP	1.000	A
WDR78	79819	genome.wustl.edu	37	1	67293563	67293563	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr1:67293563C>A	ENST00000371026.3	-	14	2099	c.2044G>T	c.(2044-2046)Gaa>Taa	p.E682*	WDR78_ENST00000431318.1_Intron|RP11-342H21.2_ENST00000456389.1_RNA	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	682					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						ATATGACCTTCTTCAGTGCCA	0.318																																						dbGAP											0													139.0	145.0	143.0					1																	67293563		2203	4293	6496	-	-	-	SO:0001587	stop_gained	0			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.2044G>T	1.37:g.67293563C>A	ENSP00000360065:p.Glu682*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E682*	ENST00000371026.3	37	c.2044	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.697005	0.98438	.	.	ENSG00000152763	ENST00000371026	.	.	.	5.28	4.37	0.52481	.	0.101217	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-29.3548	13.8809	0.63682	0.0:0.9264:0.0:0.0736	.	.	.	.	X	682	.	ENSP00000360065:E682X	E	-	1	0	WDR78	67066151	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.954000	0.76001	1.234000	0.43709	0.563000	0.77884	GAA	WDR78	-	superfamily_WD40_repeat_dom	ENSG00000152763		0.318	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	HGNC	protein_coding	OTTHUMT00000025404.1	32	0.00	0	C	NM_024763		67293563	67293563	-1	no_errors	ENST00000371026	ensembl	human	known	69_37n	nonsense	29	17.14	6	SNP	1.000	A
XPO5	57510	genome.wustl.edu	37	6	43541244	43541244	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:43541244C>G	ENST00000265351.7	-	2	410	c.200G>C	c.(199-201)gGc>gCc	p.G67A	POLH_ENST00000372236.4_5'Flank|POLH_ENST00000535400.1_5'Flank|POLH_ENST00000372226.1_5'Flank	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	67	Necessary for interaction with Ran.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GATCTGAAGGCCAAAATGTCT	0.413																																						dbGAP											0													92.0	92.0	92.0					6																	43541244		1928	4122	6050	-	-	-	SO:0001583	missense	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.200G>C	6.37:g.43541244C>G	ENSP00000265351:p.Gly67Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.G67A	ENST00000265351.7	37	c.200	CCDS47430.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.206516	0.95033	.	.	ENSG00000124571	ENST00000265351	T	0.52057	0.68	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60392	0.2265	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.53816	-0.8385	10	0.27082	T	0.32	-12.0165	19.1314	0.93408	0.0:1.0:0.0:0.0	.	67	Q9HAV4	XPO5_HUMAN	A	67	ENSP00000265351:G67A	ENSP00000265351:G67A	G	-	2	0	XPO5	43649222	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.790000	0.85794	2.536000	0.85505	0.561000	0.74099	GGC	XPO5	-	superfamily_ARM-type_fold,smart_Importin-beta_N	ENSG00000124571		0.413	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	39	0.00	0	C	NM_020750		43541244	43541244	-1	no_errors	ENST00000265351	ensembl	human	known	69_37n	missense	54	16.92	11	SNP	1.000	G
XPO5	57510	genome.wustl.edu	37	6	43541244	43541244	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr6:43541244C>G	ENST00000265351.7	-	2	410	c.200G>C	c.(199-201)gGc>gCc	p.G67A	POLH_ENST00000372236.4_5'Flank|POLH_ENST00000535400.1_5'Flank|POLH_ENST00000372226.1_5'Flank	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	67	Necessary for interaction with Ran.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GATCTGAAGGCCAAAATGTCT	0.413																																						dbGAP											0													92.0	92.0	92.0					6																	43541244		1928	4122	6050	-	-	-	SO:0001583	missense	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.200G>C	6.37:g.43541244C>G	ENSP00000265351:p.Gly67Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.G67A	ENST00000265351.7	37	c.200	CCDS47430.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.206516	0.95033	.	.	ENSG00000124571	ENST00000265351	T	0.52057	0.68	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60392	0.2265	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.53816	-0.8385	10	0.27082	T	0.32	-12.0165	19.1314	0.93408	0.0:1.0:0.0:0.0	.	67	Q9HAV4	XPO5_HUMAN	A	67	ENSP00000265351:G67A	ENSP00000265351:G67A	G	-	2	0	XPO5	43649222	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.790000	0.85794	2.536000	0.85505	0.561000	0.74099	GGC	XPO5	-	superfamily_ARM-type_fold,smart_Importin-beta_N	ENSG00000124571		0.413	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	41	0.00	0	C	NM_020750		43541244	43541244	-1	no_errors	ENST00000265351	ensembl	human	known	69_37n	missense	54	16.92	11	SNP	1.000	G
ZNF221	7638	genome.wustl.edu	37	19	44470975	44470975	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:44470975C>T	ENST00000251269.5	+	6	1649	c.1321C>T	c.(1321-1323)Cag>Tag	p.Q441*	ZNF221_ENST00000592350.1_Nonsense_Mutation_p.Q441*|ZNF221_ENST00000587682.1_Nonsense_Mutation_p.Q441*	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				ATCTTCCCATCAGAGATCCCA	0.433																																						dbGAP											0													67.0	66.0	67.0					19																	44470975		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1321C>T	19.37:g.44470975C>T	ENSP00000251269:p.Gln441*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAI6|Q2M2H2|Q9P1U8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q441*	ENST00000251269.5	37	c.1321	CCDS12633.1	19	.	.	.	.	.	.	.	.	.	.	c	38	6.822057	0.97865	.	.	ENSG00000159905	ENST00000251269	.	.	.	2.54	-0.142	0.13448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	6.8103	0.23801	0.0:0.6998:0.1781:0.122	.	.	.	.	X	441	.	ENSP00000251269:Q441X	Q	+	1	0	ZNF221	49162815	0.000000	0.05858	0.002000	0.10522	0.853000	0.48598	-0.009000	0.12765	0.371000	0.24564	0.313000	0.20887	CAG	ZNF221	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000159905		0.433	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF221	HGNC	protein_coding	OTTHUMT00000460068.1	36	0.00	0	C			44470975	44470975	+1	no_errors	ENST00000251269	ensembl	human	known	69_37n	nonsense	28	22.22	8	SNP	0.192	T
ZNF221	7638	genome.wustl.edu	37	19	44470975	44470975	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr19:44470975C>T	ENST00000251269.5	+	6	1649	c.1321C>T	c.(1321-1323)Cag>Tag	p.Q441*	ZNF221_ENST00000592350.1_Nonsense_Mutation_p.Q441*|ZNF221_ENST00000587682.1_Nonsense_Mutation_p.Q441*	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				ATCTTCCCATCAGAGATCCCA	0.433																																						dbGAP											0													67.0	66.0	67.0					19																	44470975		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1321C>T	19.37:g.44470975C>T	ENSP00000251269:p.Gln441*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAI6|Q2M2H2|Q9P1U8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q441*	ENST00000251269.5	37	c.1321	CCDS12633.1	19	.	.	.	.	.	.	.	.	.	.	c	38	6.822057	0.97865	.	.	ENSG00000159905	ENST00000251269	.	.	.	2.54	-0.142	0.13448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	6.8103	0.23801	0.0:0.6998:0.1781:0.122	.	.	.	.	X	441	.	ENSP00000251269:Q441X	Q	+	1	0	ZNF221	49162815	0.000000	0.05858	0.002000	0.10522	0.853000	0.48598	-0.009000	0.12765	0.371000	0.24564	0.313000	0.20887	CAG	ZNF221	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000159905		0.433	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF221	HGNC	protein_coding	OTTHUMT00000460068.1	35	0.00	0	C			44470975	44470975	+1	no_errors	ENST00000251269	ensembl	human	known	69_37n	nonsense	28	22.22	8	SNP	0.192	T
ZNF283	284349	genome.wustl.edu	37	19	44351580	44351580	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:44351580C>T	ENST00000324461.7	+	7	1124	c.827C>T	c.(826-828)tCa>tTa	p.S276L	ZNF283_ENST00000588797.1_Missense_Mutation_p.S137L	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				AGCTGGGGATCAAGCCTTGTT	0.413																																						dbGAP											0													58.0	66.0	63.0					19																	44351580		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.827C>T	19.37:g.44351580C>T	ENSP00000327314:p.Ser276Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S276L	ENST00000324461.7	37	c.827	CCDS46097.1	19	.	.	.	.	.	.	.	.	.	.	a	11.12	1.545149	0.27652	.	.	ENSG00000167637	ENST00000324461	T	0.01705	4.68	2.97	1.94	0.25998	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02970	0.0088	M	0.81497	2.545	0.09310	N	0.999996	P	0.39551	0.678	B	0.30572	0.117	T	0.33317	-0.9873	9	0.62326	D	0.03	.	9.4173	0.38530	0.0:0.8794:0.0:0.1206	.	276	Q8N7M2	ZN283_HUMAN	L	276	ENSP00000327314:S276L	ENSP00000327314:S276L	S	+	2	0	ZNF283	49043420	0.000000	0.05858	1.000000	0.80357	0.960000	0.62799	-0.263000	0.08670	1.678000	0.50952	0.563000	0.77884	TCA	ZNF283	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167637		0.413	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1	24	0.00	0	C	NM_181845		44351580	44351580	+1	no_errors	ENST00000324461	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.001	T
ZNF283	284349	genome.wustl.edu	37	19	44351580	44351580	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr19:44351580C>T	ENST00000324461.7	+	7	1124	c.827C>T	c.(826-828)tCa>tTa	p.S276L	ZNF283_ENST00000588797.1_Missense_Mutation_p.S137L	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				AGCTGGGGATCAAGCCTTGTT	0.413																																						dbGAP											0													58.0	66.0	63.0					19																	44351580		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.827C>T	19.37:g.44351580C>T	ENSP00000327314:p.Ser276Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S276L	ENST00000324461.7	37	c.827	CCDS46097.1	19	.	.	.	.	.	.	.	.	.	.	a	11.12	1.545149	0.27652	.	.	ENSG00000167637	ENST00000324461	T	0.01705	4.68	2.97	1.94	0.25998	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02970	0.0088	M	0.81497	2.545	0.09310	N	0.999996	P	0.39551	0.678	B	0.30572	0.117	T	0.33317	-0.9873	9	0.62326	D	0.03	.	9.4173	0.38530	0.0:0.8794:0.0:0.1206	.	276	Q8N7M2	ZN283_HUMAN	L	276	ENSP00000327314:S276L	ENSP00000327314:S276L	S	+	2	0	ZNF283	49043420	0.000000	0.05858	1.000000	0.80357	0.960000	0.62799	-0.263000	0.08670	1.678000	0.50952	0.563000	0.77884	TCA	ZNF283	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167637		0.413	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1	40	0.00	0	C	NM_181845		44351580	44351580	+1	no_errors	ENST00000324461	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.001	T
ZNF223	7766	genome.wustl.edu	37	19	44570471	44570471	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:44570471G>C	ENST00000434772.3	+	5	745	c.490G>C	c.(490-492)Gat>Cat	p.D164H	ZNF223_ENST00000591793.1_Missense_Mutation_p.D274H	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GTCCATCTTTGATCTTCCTCA	0.433																																						dbGAP											0													152.0	140.0	144.0					19																	44570471		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.490G>C	19.37:g.44570471G>C	ENSP00000401947:p.Asp164His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D274H	ENST00000434772.3	37	c.820	CCDS12635.1	19	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554057	0.27739	.	.	ENSG00000178386	ENST00000434772	T	0.28069	1.63	2.25	-0.378	0.12497	.	.	.	.	.	T	0.25044	0.0608	N	0.17564	0.495	0.09310	N	1	D	0.69078	0.997	P	0.60473	0.875	T	0.17349	-1.0372	9	0.13108	T	0.6	.	3.8575	0.08982	0.2719:0.399:0.3291:0.0	.	164	Q9UK11	ZN223_HUMAN	H	164	ENSP00000401947:D164H	ENSP00000401947:D164H	D	+	1	0	ZNF223	49262311	0.000000	0.05858	0.000000	0.03702	0.359000	0.29487	-2.605000	0.00889	-0.137000	0.11455	0.313000	0.20887	GAT	AC084219.2	-	NULL	ENSG00000267022		0.433	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	Clone_based_vega_gene	protein_coding	OTTHUMT00000460469.2	53	0.00	0	G			44570471	44570471	+1	no_errors	ENST00000591793	ensembl	human	known	69_37n	missense	54	27.63	21	SNP	0.000	C
ZNF223	7766	genome.wustl.edu	37	19	44570471	44570471	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr19:44570471G>C	ENST00000434772.3	+	5	745	c.490G>C	c.(490-492)Gat>Cat	p.D164H	ZNF223_ENST00000591793.1_Missense_Mutation_p.D274H	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GTCCATCTTTGATCTTCCTCA	0.433																																						dbGAP											0													152.0	140.0	144.0					19																	44570471		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.490G>C	19.37:g.44570471G>C	ENSP00000401947:p.Asp164His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D274H	ENST00000434772.3	37	c.820	CCDS12635.1	19	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554057	0.27739	.	.	ENSG00000178386	ENST00000434772	T	0.28069	1.63	2.25	-0.378	0.12497	.	.	.	.	.	T	0.25044	0.0608	N	0.17564	0.495	0.09310	N	1	D	0.69078	0.997	P	0.60473	0.875	T	0.17349	-1.0372	9	0.13108	T	0.6	.	3.8575	0.08982	0.2719:0.399:0.3291:0.0	.	164	Q9UK11	ZN223_HUMAN	H	164	ENSP00000401947:D164H	ENSP00000401947:D164H	D	+	1	0	ZNF223	49262311	0.000000	0.05858	0.000000	0.03702	0.359000	0.29487	-2.605000	0.00889	-0.137000	0.11455	0.313000	0.20887	GAT	AC084219.2	-	NULL	ENSG00000267022		0.433	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	Clone_based_vega_gene	protein_coding	OTTHUMT00000460469.2	72	0.00	0	G			44570471	44570471	+1	no_errors	ENST00000591793	ensembl	human	known	69_37n	missense	54	27.63	21	SNP	0.000	C
ZNF300P1	134466	genome.wustl.edu	37	5	150310560	150310560	+	RNA	SNP	C	C	T			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:150310560C>T	ENST00000520773.1	-	0	2761									zinc finger protein 300 pseudogene 1 (functional)																		GAAGGCTTTCCCACATTCAGA	0.433																																						dbGAP											0																																										-	-	-			0			AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150310560C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			ZNF300P1	-	-	ENSG00000197083		0.433	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	41	0.00	0	C	NR_026867		150310560	150310560	-1	no_errors	ENST00000520773	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.986	T
ZNF300P1	134466	genome.wustl.edu	37	5	150310899	150310899	+	RNA	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr5:150310899C>A	ENST00000520773.1	-	0	2422									zinc finger protein 300 pseudogene 1 (functional)																		AGTACACTTACATGGCTTCTC	0.433																																						dbGAP											0																																										-	-	-			0			AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150310899C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			ZNF300P1	-	-	ENSG00000197083		0.433	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	46	0.00	0	C	NR_026867		150310899	150310899	-1	no_errors	ENST00000520773	ensembl	human	known	69_37n	rna	84	12.50	12	SNP	0.256	A
ZNF300P1	134466	genome.wustl.edu	37	5	150310899	150310899	+	RNA	SNP	C	C	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr5:150310899C>A	ENST00000520773.1	-	0	2422									zinc finger protein 300 pseudogene 1 (functional)																		AGTACACTTACATGGCTTCTC	0.433																																						dbGAP											0																																										-	-	-			0			AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150310899C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			ZNF300P1	-	-	ENSG00000197083		0.433	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	59	0.00	0	C	NR_026867		150310899	150310899	-1	no_errors	ENST00000520773	ensembl	human	known	69_37n	rna	84	12.50	12	SNP	0.256	A
ZNF527	84503	genome.wustl.edu	37	19	37879510	37879510	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:37879510A>G	ENST00000436120.2	+	5	666	c.559A>G	c.(559-561)Ata>Gta	p.I187V	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTTCCTACCATACAGCAAGT	0.328																																						dbGAP											0													62.0	60.0	60.0					19																	37879510		1816	4067	5883	-	-	-	SO:0001583	missense	0			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.559A>G	19.37:g.37879510A>G	ENSP00000390179:p.Ile187Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVL5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I187V	ENST00000436120.2	37	c.559	CCDS42559.1	19	.	.	.	.	.	.	.	.	.	.	A	6.220	0.408709	0.11812	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.04	0.126	0.14722	.	.	.	.	.	T	0.24851	0.0603	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18903	-1.0322	8	0.48119	T	0.1	.	4.5194	0.11952	0.225:0.0:0.6085:0.1664	.	187;155	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	V	187;155;135	.	ENSP00000325231:I155V	I	+	1	0	ZNF527	42571350	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-0.305000	0.08188	-0.083000	0.12618	-0.376000	0.06991	ATA	ZNF527	-	NULL	ENSG00000189164		0.328	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	HGNC	protein_coding	OTTHUMT00000458434.1	23	0.00	0	A	NM_032453		37879510	37879510	+1	no_errors	ENST00000436120	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	0.000	G
ZNF527	84503	genome.wustl.edu	37	19	37879510	37879510	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr19:37879510A>G	ENST00000436120.2	+	5	666	c.559A>G	c.(559-561)Ata>Gta	p.I187V	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTTCCTACCATACAGCAAGT	0.328																																						dbGAP											0													62.0	60.0	60.0					19																	37879510		1816	4067	5883	-	-	-	SO:0001583	missense	0			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.559A>G	19.37:g.37879510A>G	ENSP00000390179:p.Ile187Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVL5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I187V	ENST00000436120.2	37	c.559	CCDS42559.1	19	.	.	.	.	.	.	.	.	.	.	A	6.220	0.408709	0.11812	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.04	0.126	0.14722	.	.	.	.	.	T	0.24851	0.0603	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18903	-1.0322	8	0.48119	T	0.1	.	4.5194	0.11952	0.225:0.0:0.6085:0.1664	.	187;155	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	V	187;155;135	.	ENSP00000325231:I155V	I	+	1	0	ZNF527	42571350	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-0.305000	0.08188	-0.083000	0.12618	-0.376000	0.06991	ATA	ZNF527	-	NULL	ENSG00000189164		0.328	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	HGNC	protein_coding	OTTHUMT00000458434.1	24	0.00	0	A	NM_032453		37879510	37879510	+1	no_errors	ENST00000436120	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	0.000	G
ZNF547	284306	genome.wustl.edu	37	19	57888790	57888790	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr19:57888790T>A	ENST00000282282.3	+	4	596	c.446T>A	c.(445-447)gTt>gAt	p.V149D	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AACCACAGAGTTCACATGGCA	0.458																																						dbGAP											0													69.0	69.0	69.0					19																	57888790		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.446T>A	19.37:g.57888790T>A	ENSP00000282282:p.Val149Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z9|Q96NC4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V149D	ENST00000282282.3	37	c.446	CCDS33131.1	19	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822732	0.32237	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.05717	3.4	2.09	-0.25	0.13007	.	.	.	.	.	T	0.05777	0.0151	L	0.32530	0.975	0.09310	N	1	D;P;P	0.53745	0.962;0.936;0.937	P;P;B	0.47827	0.504;0.558;0.403	T	0.29027	-1.0025	9	0.56958	D	0.05	.	0.3202	0.00302	0.3722:0.133:0.2162:0.2786	.	149;149;149	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	D	149	ENSP00000282282:V149D	ENSP00000282282:V149D	V	+	2	0	ZNF547	62580602	0.000000	0.05858	0.001000	0.08648	0.091000	0.18340	-3.092000	0.00608	-0.120000	0.11809	0.402000	0.26972	GTT	ZNF547	-	NULL	ENSG00000152433		0.458	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF547	HGNC	protein_coding	OTTHUMT00000465787.1	18	0.00	0	T	NM_173631		57888790	57888790	+1	no_errors	ENST00000282282	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.000	A
ZNF547	284306	genome.wustl.edu	37	19	57888790	57888790	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr19:57888790T>A	ENST00000282282.3	+	4	596	c.446T>A	c.(445-447)gTt>gAt	p.V149D	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AACCACAGAGTTCACATGGCA	0.458																																						dbGAP											0													69.0	69.0	69.0					19																	57888790		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.446T>A	19.37:g.57888790T>A	ENSP00000282282:p.Val149Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z9|Q96NC4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V149D	ENST00000282282.3	37	c.446	CCDS33131.1	19	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822732	0.32237	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.05717	3.4	2.09	-0.25	0.13007	.	.	.	.	.	T	0.05777	0.0151	L	0.32530	0.975	0.09310	N	1	D;P;P	0.53745	0.962;0.936;0.937	P;P;B	0.47827	0.504;0.558;0.403	T	0.29027	-1.0025	9	0.56958	D	0.05	.	0.3202	0.00302	0.3722:0.133:0.2162:0.2786	.	149;149;149	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	D	149	ENSP00000282282:V149D	ENSP00000282282:V149D	V	+	2	0	ZNF547	62580602	0.000000	0.05858	0.001000	0.08648	0.091000	0.18340	-3.092000	0.00608	-0.120000	0.11809	0.402000	0.26972	GTT	ZNF547	-	NULL	ENSG00000152433		0.458	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF547	HGNC	protein_coding	OTTHUMT00000465787.1	34	0.00	0	T	NM_173631		57888790	57888790	+1	no_errors	ENST00000282282	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.000	A
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30003664	30003664	+	RNA	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	74901ecc-d370-42c5-812e-8e842cd8532f	g.chr6:30003664G>C	ENST00000376797.3	-	0	327				ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CTTCATGACAGTGCAAACATC	0.378																																						dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30003664G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.378	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253083.1	64	0.00	0	G	NR_026751		30003664	30003664	-1	no_errors	ENST00000421692	ensembl	human	known	69_37n	rna	82	33.33	41	SNP	0.005	C
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30003664	30003664	+	RNA	SNP	G	G	C			TCGA-A7-A56D-01A-11D-A27P-09	TCGA-A7-A56D-11A-72D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc8ca430-e89c-4f9b-8745-bccf6373accc	dd52f0b9-0b32-4ecd-81fb-8abeb0f9cb0d	g.chr6:30003664G>C	ENST00000376797.3	-	0	327				ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CTTCATGACAGTGCAAACATC	0.378																																						dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30003664G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.378	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253083.1	84	0.00	0	G	NR_026751		30003664	30003664	-1	no_errors	ENST00000421692	ensembl	human	known	69_37n	rna	82	33.33	41	SNP	0.005	C
